>Feature sequence001 4312 350 gene locus_tag LOCUS_00010 4312 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 5006 4452 gene locus_tag LOCUS_00020 5006 4452 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_00020 5218 6225 gene locus_tag LOCUS_00030 5218 6225 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970599.1 protein_id gnl|my_center|LOCUS_00030 6958 6281 gene locus_tag LOCUS_00040 6958 6281 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_00040 8384 6984 gene locus_tag LOCUS_00050 gene gatB 8384 6984 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393504.1 protein_id gnl|my_center|LOCUS_00050 9780 8374 gene locus_tag LOCUS_00060 gene gatA 9780 8374 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_00060 10056 9784 gene locus_tag LOCUS_00070 10056 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10943 10101 gene locus_tag LOCUS_00080 10943 10101 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_00080 11115 11978 gene locus_tag LOCUS_00090 11115 11978 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930650.1 protein_id gnl|my_center|LOCUS_00090 12036 12803 gene locus_tag LOCUS_00100 12036 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13839 12835 gene locus_tag LOCUS_00110 13839 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16506 13861 gene locus_tag LOCUS_00120 16506 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 19117 16568 gene locus_tag LOCUS_00130 19117 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20018 19158 gene locus_tag LOCUS_00140 gene rlmB 20018 19158 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_00140 21297 20176 gene locus_tag LOCUS_00150 21297 20176 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 protein_id gnl|my_center|LOCUS_00150 21418 22242 gene locus_tag LOCUS_00160 21418 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 22565 22287 gene locus_tag LOCUS_00170 22565 22287 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_00170 23276 22701 gene locus_tag LOCUS_00180 23276 22701 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287436.1 protein_id gnl|my_center|LOCUS_00180 23996 23427 gene locus_tag LOCUS_00190 23996 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 25875 24085 gene locus_tag LOCUS_00200 gene dppE 25875 24085 CDS product dipeptide ABC transporter substrate-binding protein DppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886494.1 protein_id gnl|my_center|LOCUS_00200 26172 27050 gene locus_tag LOCUS_00210 26172 27050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27116 28348 gene locus_tag LOCUS_00220 27116 28348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29192 28350 gene locus_tag LOCUS_00230 29192 28350 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_00230 29282 30130 gene locus_tag LOCUS_00240 29282 30130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31412 30189 gene locus_tag LOCUS_00250 31412 30189 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876856.1 protein_id gnl|my_center|LOCUS_00250 31655 32572 gene locus_tag LOCUS_00260 31655 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 32684 33367 gene locus_tag LOCUS_00270 32684 33367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33364 33672 gene locus_tag LOCUS_00280 33364 33672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 34911 33718 gene locus_tag LOCUS_00290 34911 33718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 35762 34836 gene locus_tag LOCUS_00300 35762 34836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36592 36023 gene locus_tag LOCUS_00310 36592 36023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37345 36638 gene locus_tag LOCUS_00320 37345 36638 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_00320 37767 37468 gene locus_tag LOCUS_00330 37767 37468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38224 37760 gene locus_tag LOCUS_00340 38224 37760 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_00340 39077 38229 gene locus_tag LOCUS_00350 39077 38229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40136 39093 gene locus_tag LOCUS_00360 40136 39093 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_00360 41551 40250 gene locus_tag LOCUS_00370 41551 40250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 42122 41592 gene locus_tag LOCUS_00380 42122 41592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42534 42265 gene locus_tag LOCUS_00390 gene atpC 42534 42265 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425849.1 protein_id gnl|my_center|LOCUS_00390 <43251 42550 gene locus_tag LOCUS_00400 <43251 42550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425850.1:F0F1 ATP synthase subunit beta >Feature sequence002 3018 1207 gene locus_tag LOCUS_00410 3018 1207 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862455.1 protein_id gnl|my_center|LOCUS_00410 2977 3177 gene locus_tag LOCUS_00420 2977 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 3174 3986 gene locus_tag LOCUS_00430 3174 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 5958 4039 gene locus_tag LOCUS_00440 5958 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 6587 6066 gene locus_tag LOCUS_00450 6587 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6716 7564 gene locus_tag LOCUS_00460 6716 7564 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_00460 7658 9139 gene locus_tag LOCUS_00470 7658 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 9282 10484 gene locus_tag LOCUS_00480 9282 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 11218 10544 gene locus_tag LOCUS_00490 11218 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 11384 12214 gene locus_tag LOCUS_00500 11384 12214 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_00500 12362 13018 gene locus_tag LOCUS_00510 12362 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 13015 13782 gene locus_tag LOCUS_00520 13015 13782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 16168 13823 gene locus_tag LOCUS_00530 16168 13823 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_00530 17682 16171 gene locus_tag LOCUS_00540 gene malQ 17682 16171 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403431.1 protein_id gnl|my_center|LOCUS_00540 18555 17716 gene locus_tag LOCUS_00550 18555 17716 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360454.1 protein_id gnl|my_center|LOCUS_00550 20048 18552 gene locus_tag LOCUS_00560 20048 18552 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_00560 21294 20083 gene locus_tag LOCUS_00570 21294 20083 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_00570 22268 21432 gene locus_tag LOCUS_00580 22268 21432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 22353 24617 gene locus_tag LOCUS_00590 22353 24617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 24614 25543 gene locus_tag LOCUS_00600 24614 25543 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170821.1 protein_id gnl|my_center|LOCUS_00600 25557 27104 gene locus_tag LOCUS_00610 25557 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 27206 28960 gene locus_tag LOCUS_00620 27206 28960 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 protein_id gnl|my_center|LOCUS_00620 29041 29778 gene locus_tag LOCUS_00630 29041 29778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 29799 30521 gene locus_tag LOCUS_00640 gene fabG 29799 30521 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_00640 31260 30589 gene locus_tag LOCUS_00650 31260 30589 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_00650 31796 31368 gene locus_tag LOCUS_00660 31796 31368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 <35751 32086 gene locus_tag LOCUS_00670 <35751 32086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068298.1:phosphoribosylformylglycinamidine synthase >Feature sequence003 1417 683 gene locus_tag LOCUS_00680 1417 683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_00680 1950 1414 gene locus_tag LOCUS_00690 1950 1414 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775452.1 protein_id gnl|my_center|LOCUS_00690 2756 2103 gene locus_tag LOCUS_00700 2756 2103 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_00700 3809 2802 gene locus_tag LOCUS_00710 3809 2802 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922076.1 protein_id gnl|my_center|LOCUS_00710 4555 3818 gene locus_tag LOCUS_00720 4555 3818 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_00720 6788 4731 gene locus_tag LOCUS_00730 6788 4731 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_00730 7354 6785 gene locus_tag LOCUS_00740 7354 6785 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_00740 8136 7438 gene locus_tag LOCUS_00750 gene cmk 8136 7438 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_00750 9412 8141 gene locus_tag LOCUS_00760 9412 8141 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_00760 10292 9405 gene locus_tag LOCUS_00770 10292 9405 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_00770 11412 10426 gene locus_tag LOCUS_00780 11412 10426 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_00780 12771 11557 gene locus_tag LOCUS_00790 12771 11557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 12918 13736 gene locus_tag LOCUS_00800 12918 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 13747 14655 gene locus_tag LOCUS_00810 13747 14655 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193500740.1 protein_id gnl|my_center|LOCUS_00810 15231 14713 gene locus_tag LOCUS_00820 15231 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 15354 15581 gene locus_tag LOCUS_00830 15354 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 16966 15584 gene locus_tag LOCUS_00840 16966 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 17469 16963 gene locus_tag LOCUS_00850 17469 16963 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_00850 19040 17604 gene locus_tag LOCUS_00860 19040 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 19543 19037 gene locus_tag LOCUS_00870 19543 19037 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_00870 20778 19612 gene locus_tag LOCUS_00880 20778 19612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 22168 20957 gene locus_tag LOCUS_00890 22168 20957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 22323 22907 gene locus_tag LOCUS_00900 22323 22907 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_00900 23189 24913 gene locus_tag LOCUS_00910 23189 24913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 25030 27096 gene locus_tag LOCUS_00920 gene ligA 25030 27096 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_00920 27093 28094 gene locus_tag LOCUS_00930 27093 28094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_00930 28091 28669 gene locus_tag LOCUS_00940 28091 28669 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_00940 28751 29572 gene locus_tag LOCUS_00950 28751 29572 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_00950 29627 30178 gene locus_tag LOCUS_00960 29627 30178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 30320 30904 gene locus_tag LOCUS_00970 30320 30904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 30901 32046 gene locus_tag LOCUS_00980 30901 32046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 32116 32580 gene locus_tag LOCUS_00990 32116 32580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 32656 33774 gene locus_tag LOCUS_01000 32656 33774 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence004 738 205 gene locus_tag LOCUS_01010 738 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 1642 773 gene locus_tag LOCUS_01020 1642 773 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_01020 4386 1639 gene locus_tag LOCUS_01030 4386 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7374 4423 gene locus_tag LOCUS_01040 7374 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 7575 8828 gene locus_tag LOCUS_01050 7575 8828 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_01050 9729 8935 gene locus_tag LOCUS_01060 9729 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 10382 9726 gene locus_tag LOCUS_01070 10382 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 10993 10466 gene locus_tag LOCUS_01080 10993 10466 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_01080 12492 11053 gene locus_tag LOCUS_01090 12492 11053 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_01090 12632 14554 gene locus_tag LOCUS_01100 12632 14554 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_01100 14793 16322 gene locus_tag LOCUS_01110 14793 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16466 18007 gene locus_tag LOCUS_01120 16466 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 18292 20352 gene locus_tag LOCUS_01130 18292 20352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 20386 22404 gene locus_tag LOCUS_01140 20386 22404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 22462 24483 gene locus_tag LOCUS_01150 22462 24483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 24500 26518 gene locus_tag LOCUS_01160 24500 26518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 26534 28552 gene locus_tag LOCUS_01170 26534 28552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 28555 30894 gene locus_tag LOCUS_01180 28555 30894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 30925 32940 gene locus_tag LOCUS_01190 30925 32940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 33147 33443 gene locus_tag LOCUS_01200 33147 33443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence005 1367 2206 gene locus_tag LOCUS_01210 1367 2206 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099678.1 protein_id gnl|my_center|LOCUS_01210 2292 2957 gene locus_tag LOCUS_01220 2292 2957 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_01220 2969 3649 gene locus_tag LOCUS_01230 2969 3649 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_01230 3772 3969 gene locus_tag LOCUS_01240 3772 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4036 5517 gene locus_tag LOCUS_01250 4036 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6089 5571 gene locus_tag LOCUS_01260 6089 5571 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965952.1 protein_id gnl|my_center|LOCUS_01260 6178 6417 gene locus_tag LOCUS_01270 6178 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6414 6824 gene locus_tag LOCUS_01280 6414 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 6835 7188 gene locus_tag LOCUS_01290 6835 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 8280 7162 gene locus_tag LOCUS_01300 8280 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 9286 8339 gene locus_tag LOCUS_01310 9286 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 10300 9296 gene locus_tag LOCUS_01320 10300 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 10482 11423 gene locus_tag LOCUS_01330 gene hprK 10482 11423 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_01330 11427 12548 gene locus_tag LOCUS_01340 11427 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 12600 13505 gene locus_tag LOCUS_01350 12600 13505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 13994 14941 gene locus_tag LOCUS_01360 13994 14941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 14967 15647 gene locus_tag LOCUS_01370 14967 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 16009 15686 gene locus_tag LOCUS_01380 16009 15686 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966647.1 protein_id gnl|my_center|LOCUS_01380 16091 16921 gene locus_tag LOCUS_01390 gene kduI 16091 16921 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383224.1 protein_id gnl|my_center|LOCUS_01390 17660 16962 gene locus_tag LOCUS_01400 17660 16962 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_01400 18493 17744 gene locus_tag LOCUS_01410 18493 17744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027158.1 protein_id gnl|my_center|LOCUS_01410 19529 18480 gene locus_tag LOCUS_01420 19529 18480 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 protein_id gnl|my_center|LOCUS_01420 20421 19483 gene locus_tag LOCUS_01430 gene cdtB 20421 19483 CDS product siderophore ABC transporter substrate-binding protein CdtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971744.1 protein_id gnl|my_center|LOCUS_01430 21356 20421 gene locus_tag LOCUS_01440 21356 20421 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_01440 22590 21451 gene locus_tag LOCUS_01450 22590 21451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 22811 23275 gene locus_tag LOCUS_01460 22811 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 23335 23943 gene locus_tag LOCUS_01470 gene spoIIR 23335 23943 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_01470 24351 23953 gene locus_tag LOCUS_01480 24351 23953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 25557 24475 gene locus_tag LOCUS_01490 25557 24475 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_01490 27861 25582 gene locus_tag LOCUS_01500 27861 25582 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620752.1 protein_id gnl|my_center|LOCUS_01500 29142 27877 gene locus_tag LOCUS_01510 29142 27877 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_01510 29314 31974 gene locus_tag LOCUS_01520 29314 31974 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906004.1 protein_id gnl|my_center|LOCUS_01520 33050 32016 gene locus_tag LOCUS_01530 gene mutY 33050 32016 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_01530 >Feature sequence006 682 368 gene locus_tag LOCUS_01540 682 368 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944876.1 protein_id gnl|my_center|LOCUS_01540 803 1288 gene locus_tag LOCUS_01550 803 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2707 1325 gene locus_tag LOCUS_01560 2707 1325 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_01560 3535 2777 gene locus_tag LOCUS_01570 gene nagB 3535 2777 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_01570 4919 3624 gene locus_tag LOCUS_01580 4919 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 6160 5225 gene locus_tag LOCUS_01590 gene glcK 6160 5225 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_01590 6299 7174 gene locus_tag LOCUS_01600 6299 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7171 7620 gene locus_tag LOCUS_01610 gene tadA 7171 7620 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 protein_id gnl|my_center|LOCUS_01610 7652 9289 gene locus_tag LOCUS_01620 7652 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9274 10689 gene locus_tag LOCUS_01630 9274 10689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_01630 11307 13295 gene locus_tag LOCUS_01640 11307 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 13338 15215 gene locus_tag LOCUS_01650 gene mnmG 13338 15215 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_01650 15450 16199 gene locus_tag LOCUS_01660 gene rsmG 15450 16199 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288804.1 protein_id gnl|my_center|LOCUS_01660 16350 17252 gene locus_tag LOCUS_01670 gene noc 16350 17252 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990072.1 protein_id gnl|my_center|LOCUS_01670 17459 18229 gene locus_tag LOCUS_01680 17459 18229 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_01680 18231 19133 gene locus_tag LOCUS_01690 18231 19133 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_01690 19188 19766 gene locus_tag LOCUS_01700 19188 19766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 19780 20619 gene locus_tag LOCUS_01710 19780 20619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 21159 20746 gene locus_tag LOCUS_01720 21159 20746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 21288 22022 gene locus_tag LOCUS_01730 21288 22022 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_01730 22022 22540 gene locus_tag LOCUS_01740 22022 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 22636 23709 gene locus_tag LOCUS_01750 22636 23709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 23725 24345 gene locus_tag LOCUS_01760 gene rnmV 23725 24345 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226752.1 protein_id gnl|my_center|LOCUS_01760 24342 24764 gene locus_tag LOCUS_01770 24342 24764 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_01770 25008 25556 gene locus_tag LOCUS_01780 25008 25556 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 protein_id gnl|my_center|LOCUS_01780 25553 26203 gene locus_tag LOCUS_01790 25553 26203 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_01790 26621 26427 gene locus_tag LOCUS_01800 26621 26427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 26518 28746 gene locus_tag LOCUS_01810 26518 28746 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_01810 29093 31081 gene locus_tag LOCUS_01820 29093 31081 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_01820 31210 32163 gene locus_tag LOCUS_01830 31210 32163 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence007 <1 575 gene locus_tag LOCUS_01840 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966527.1:glutamate 5-kinase 575 1834 gene locus_tag LOCUS_01850 575 1834 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_01850 1844 2329 gene locus_tag LOCUS_01860 1844 2329 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_01860 2326 2877 gene locus_tag LOCUS_01870 2326 2877 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_01870 2959 3549 gene locus_tag LOCUS_01880 2959 3549 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_01880 3563 4849 gene locus_tag LOCUS_01890 3563 4849 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053727.1 protein_id gnl|my_center|LOCUS_01890 4851 5696 gene locus_tag LOCUS_01900 4851 5696 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363043.1 protein_id gnl|my_center|LOCUS_01900 6316 5738 gene locus_tag LOCUS_01910 6316 5738 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_01910 7230 6325 gene locus_tag LOCUS_01920 gene truB 7230 6325 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_01920 8263 7223 gene locus_tag LOCUS_01930 8263 7223 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_01930 8633 8250 gene locus_tag LOCUS_01940 gene rbfA 8633 8250 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_01940 10177 8849 gene locus_tag LOCUS_01950 10177 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10625 11137 gene locus_tag LOCUS_01960 10625 11137 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_01960 11131 12249 gene locus_tag LOCUS_01970 11131 12249 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389026.1 protein_id gnl|my_center|LOCUS_01970 12270 14600 gene locus_tag LOCUS_01980 12270 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 14597 15652 gene locus_tag LOCUS_01990 14597 15652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 15696 17249 gene locus_tag LOCUS_02000 15696 17249 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288482.1 protein_id gnl|my_center|LOCUS_02000 18597 17302 gene locus_tag LOCUS_02010 18597 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 20735 18792 gene locus_tag LOCUS_02020 gene tet 20735 18792 CDS product tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_02020 22732 20735 gene locus_tag LOCUS_02030 22732 20735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 22950 23192 gene locus_tag LOCUS_02040 22950 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 23216 23443 gene locus_tag LOCUS_02050 23216 23443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 24336 23536 gene locus_tag LOCUS_02060 24336 23536 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_02060 26597 24357 gene locus_tag LOCUS_02070 26597 24357 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966138.1 protein_id gnl|my_center|LOCUS_02070 26807 26655 gene locus_tag LOCUS_02080 26807 26655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 27501 26884 gene locus_tag LOCUS_02090 27501 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 28049 27678 gene locus_tag LOCUS_02100 28049 27678 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_02100 29239 28064 gene locus_tag LOCUS_02110 gene metK 29239 28064 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_02110 29985 29512 gene locus_tag LOCUS_02120 29985 29512 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_02120 30656 30051 gene locus_tag LOCUS_02130 30656 30051 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence008 1897 134 gene locus_tag LOCUS_02140 1897 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3238 2048 gene locus_tag LOCUS_02150 3238 2048 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_02150 3710 3441 gene locus_tag LOCUS_02160 gene yidD 3710 3441 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_02160 4126 3707 gene locus_tag LOCUS_02170 gene rnpA 4126 3707 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_02170 4376 4242 gene locus_tag LOCUS_02180 gene rpmH 4376 4242 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_02180 5494 5171 gene locus_tag LOCUS_02190 5494 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6184 5561 gene locus_tag LOCUS_02200 6184 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 9027 6505 gene locus_tag LOCUS_02210 gene gyrA 9027 6505 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_02210 10221 9241 gene locus_tag LOCUS_02220 gene pfkB 10221 9241 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226343.1 protein_id gnl|my_center|LOCUS_02220 10978 10304 gene locus_tag LOCUS_02230 10978 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 13249 11258 gene locus_tag LOCUS_02240 gene gyrB 13249 11258 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_02240 13881 13696 gene locus_tag LOCUS_02250 13881 13696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 14208 13900 gene locus_tag LOCUS_02260 14208 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 15397 14210 gene locus_tag LOCUS_02270 gene dnaN 15397 14210 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_02270 17384 15912 gene locus_tag LOCUS_02280 gene dnaA 17384 15912 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_02280 18514 17600 gene locus_tag LOCUS_02290 18514 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 18729 21053 gene locus_tag LOCUS_02300 18729 21053 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_02300 21081 22769 gene locus_tag LOCUS_02310 21081 22769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 22766 22984 gene locus_tag LOCUS_02320 22766 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 24587 23016 gene locus_tag LOCUS_02330 24587 23016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 25230 24655 gene locus_tag LOCUS_02340 gene eutD 25230 24655 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_02340 26045 25341 gene locus_tag LOCUS_02350 26045 25341 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392015.1 protein_id gnl|my_center|LOCUS_02350 26212 27465 gene locus_tag LOCUS_02360 26212 27465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 27523 28101 gene locus_tag LOCUS_02370 27523 28101 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733192.1 protein_id gnl|my_center|LOCUS_02370 30248 28302 gene locus_tag LOCUS_02380 gene thrS 30248 28302 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence009 370 2706 gene locus_tag LOCUS_02390 370 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 2732 4093 gene locus_tag LOCUS_02400 2732 4093 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_02400 5709 4186 gene locus_tag LOCUS_02410 5709 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6022 7569 gene locus_tag LOCUS_02420 gene rny 6022 7569 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_02420 7642 8352 gene locus_tag LOCUS_02430 7642 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 8349 8813 gene locus_tag LOCUS_02440 8349 8813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 8831 9601 gene locus_tag LOCUS_02450 8831 9601 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938251.1 protein_id gnl|my_center|LOCUS_02450 9601 9765 gene locus_tag LOCUS_02460 9601 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 9955 11235 gene locus_tag LOCUS_02470 gene galK 9955 11235 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_02470 11237 11611 gene locus_tag LOCUS_02480 11237 11611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 11613 12377 gene locus_tag LOCUS_02490 11613 12377 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_02490 12405 12884 gene locus_tag LOCUS_02500 gene rlmH 12405 12884 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_02500 12920 14506 gene locus_tag LOCUS_02510 12920 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 14648 15469 gene locus_tag LOCUS_02520 14648 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 18112 15542 gene locus_tag LOCUS_02530 18112 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 19289 18138 gene locus_tag LOCUS_02540 19289 18138 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031081.1 protein_id gnl|my_center|LOCUS_02540 20794 19364 gene locus_tag LOCUS_02550 20794 19364 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_02550 22384 20942 gene locus_tag LOCUS_02560 22384 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 23795 22509 gene locus_tag LOCUS_02570 23795 22509 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_02570 24772 23939 gene locus_tag LOCUS_02580 24772 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 25709 24888 gene locus_tag LOCUS_02590 25709 24888 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_02590 25813 27450 gene locus_tag LOCUS_02600 25813 27450 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_02600 27487 29211 gene locus_tag LOCUS_02610 gene iorA 27487 29211 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_02610 29286 29849 gene locus_tag LOCUS_02620 29286 29849 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence010 <1 989 gene locus_tag LOCUS_02630 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391743.1:cysteine desulfurase family protein 993 1661 gene locus_tag LOCUS_02640 993 1661 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987086.1 protein_id gnl|my_center|LOCUS_02640 1680 2357 gene locus_tag LOCUS_02650 1680 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2387 3772 gene locus_tag LOCUS_02660 2387 3772 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_02660 3874 4926 gene locus_tag LOCUS_02670 3874 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6544 5042 gene locus_tag LOCUS_02680 6544 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8363 6585 gene locus_tag LOCUS_02690 8363 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 10046 8376 gene locus_tag LOCUS_02700 10046 8376 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_02700 12005 10071 gene locus_tag LOCUS_02710 12005 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 13972 12029 gene locus_tag LOCUS_02720 13972 12029 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484340.1 protein_id gnl|my_center|LOCUS_02720 14214 14306 gene locus_tag LOCUS_t00010 14214 14306 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15361 14432 gene locus_tag LOCUS_02730 15361 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 16278 15358 gene locus_tag LOCUS_02740 16278 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 16405 16629 gene locus_tag LOCUS_02750 16405 16629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 16752 17165 gene locus_tag LOCUS_02760 16752 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 17289 17540 gene locus_tag LOCUS_02770 17289 17540 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003013836.1 protein_id gnl|my_center|LOCUS_02770 17537 17914 gene locus_tag LOCUS_02780 17537 17914 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_02780 18178 18378 gene locus_tag LOCUS_02790 18178 18378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 19159 18437 gene locus_tag LOCUS_02800 19159 18437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 19304 20272 gene locus_tag LOCUS_02810 19304 20272 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_02810 21459 20320 gene locus_tag LOCUS_02820 21459 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 23070 21487 gene locus_tag LOCUS_02830 23070 21487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 24584 23100 gene locus_tag LOCUS_02840 24584 23100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 24820 25686 gene locus_tag LOCUS_02850 24820 25686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 25750 26184 gene locus_tag LOCUS_02860 25750 26184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 26323 27471 gene locus_tag LOCUS_02870 26323 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 28384 27542 gene locus_tag LOCUS_02880 28384 27542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 28524 30026 gene locus_tag LOCUS_02890 28524 30026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence011 1514 396 gene locus_tag LOCUS_02900 1514 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1709 2590 gene locus_tag LOCUS_02910 1709 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4871 2634 gene locus_tag LOCUS_02920 4871 2634 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_02920 6629 5106 gene locus_tag LOCUS_02930 6629 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7619 6633 gene locus_tag LOCUS_02940 7619 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 8532 7648 gene locus_tag LOCUS_02950 8532 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 9809 8532 gene locus_tag LOCUS_02960 9809 8532 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_02960 10669 9971 gene locus_tag LOCUS_02970 10669 9971 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_02970 12106 10805 gene locus_tag LOCUS_02980 12106 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13351 12131 gene locus_tag LOCUS_02990 gene ywaD 13351 12131 CDS product aminopeptidase YwaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242515.1 protein_id gnl|my_center|LOCUS_02990 13638 14186 gene locus_tag LOCUS_03000 gene spoVT 13638 14186 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_03000 14393 15391 gene locus_tag LOCUS_03010 14393 15391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15409 16161 gene locus_tag LOCUS_03020 15409 16161 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_03020 16333 16920 gene locus_tag LOCUS_03030 16333 16920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 16830 19847 gene locus_tag LOCUS_03040 16830 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 19822 22518 gene locus_tag LOCUS_03050 19822 22518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 23816 22668 gene locus_tag LOCUS_03060 gene fucO 23816 22668 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_03060 24049 23927 gene locus_tag LOCUS_03070 24049 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 24424 24696 gene locus_tag LOCUS_03080 24424 24696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 26127 24760 gene locus_tag LOCUS_03090 26127 24760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 27657 26140 gene locus_tag LOCUS_03100 27657 26140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 29058 27667 gene locus_tag LOCUS_03110 29058 27667 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence012 6129 4756 gene locus_tag LOCUS_03120 6129 4756 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017276.1 protein_id gnl|my_center|LOCUS_03120 6762 6178 gene locus_tag LOCUS_03130 gene pyrR 6762 6178 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_03130 7233 7631 gene locus_tag LOCUS_03140 7233 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 7631 8194 gene locus_tag LOCUS_03150 7631 8194 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 protein_id gnl|my_center|LOCUS_03150 8960 8271 gene locus_tag LOCUS_03160 8960 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9859 9206 gene locus_tag LOCUS_03170 9859 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10874 10140 gene locus_tag LOCUS_03180 10874 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 11862 11095 gene locus_tag LOCUS_03190 11862 11095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048142.1 protein_id gnl|my_center|LOCUS_03190 12172 11864 gene locus_tag LOCUS_03200 12172 11864 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_03200 13188 12184 gene locus_tag LOCUS_03210 13188 12184 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861285.1 protein_id gnl|my_center|LOCUS_03210 14462 13191 gene locus_tag LOCUS_03220 14462 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582731.1 protein_id gnl|my_center|LOCUS_03220 14721 16406 gene locus_tag LOCUS_03230 14721 16406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 16478 18562 gene locus_tag LOCUS_03240 16478 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 18584 19117 gene locus_tag LOCUS_03250 18584 19117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 19248 20051 gene locus_tag LOCUS_03260 19248 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 20991 20089 gene locus_tag LOCUS_03270 20991 20089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 22541 21078 gene locus_tag LOCUS_03280 22541 21078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 22793 23755 gene locus_tag LOCUS_03290 22793 23755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 24632 23832 gene locus_tag LOCUS_03300 24632 23832 CDS product aminoglycoside 3'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547977.1 protein_id gnl|my_center|LOCUS_03300 27329 24714 gene locus_tag LOCUS_03310 27329 24714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 27622 29172 gene locus_tag LOCUS_03320 27622 29172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence013 947 96 gene locus_tag LOCUS_03330 gene argB 947 96 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_03330 2310 1087 gene locus_tag LOCUS_03340 gene argJ 2310 1087 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03340 3289 2351 gene locus_tag LOCUS_03350 gene argC 3289 2351 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_03350 4109 3498 gene locus_tag LOCUS_03360 4109 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4286 4837 gene locus_tag LOCUS_03370 4286 4837 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063446135.1 protein_id gnl|my_center|LOCUS_03370 4939 5023 gene locus_tag LOCUS_t00020 4939 5023 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5326 5886 gene locus_tag LOCUS_03380 5326 5886 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435286.1 protein_id gnl|my_center|LOCUS_03380 5892 6620 gene locus_tag LOCUS_03390 5892 6620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_03390 6617 7348 gene locus_tag LOCUS_03400 6617 7348 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_03400 8777 7395 gene locus_tag LOCUS_03410 8777 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9975 8755 gene locus_tag LOCUS_03420 9975 8755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 10198 11064 gene locus_tag LOCUS_03430 10198 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 11074 11841 gene locus_tag LOCUS_03440 11074 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 11973 12770 gene locus_tag LOCUS_03450 11973 12770 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493653.1 protein_id gnl|my_center|LOCUS_03450 13147 12809 gene locus_tag LOCUS_03460 13147 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 14127 13267 gene locus_tag LOCUS_03470 14127 13267 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943654.1 protein_id gnl|my_center|LOCUS_03470 14579 14127 gene locus_tag LOCUS_03480 gene rpiB 14579 14127 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716792.1 protein_id gnl|my_center|LOCUS_03480 15058 14603 gene locus_tag LOCUS_03490 15058 14603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 15606 15058 gene locus_tag LOCUS_03500 15606 15058 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495432.1 protein_id gnl|my_center|LOCUS_03500 16323 15610 gene locus_tag LOCUS_03510 gene tsaB 16323 15610 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_03510 16781 16317 gene locus_tag LOCUS_03520 16781 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 16980 17056 gene locus_tag LOCUS_t00030 16980 17056 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 17373 17149 gene locus_tag LOCUS_03530 17373 17149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 18203 17412 gene locus_tag LOCUS_03540 18203 17412 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_03540 18797 18216 gene locus_tag LOCUS_03550 gene rsxA 18797 18216 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_03550 19483 18794 gene locus_tag LOCUS_03560 19483 18794 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_03560 20953 19538 gene locus_tag LOCUS_03570 20953 19538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 22040 20937 gene locus_tag LOCUS_03580 22040 20937 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_03580 23240 22062 gene locus_tag LOCUS_03590 gene rsxC 23240 22062 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_03590 24647 23553 gene locus_tag LOCUS_03600 24647 23553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 24816 24661 gene locus_tag LOCUS_03610 24816 24661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 25671 24922 gene locus_tag LOCUS_03620 25671 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 26072 25698 gene locus_tag LOCUS_03630 26072 25698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 26888 26109 gene locus_tag LOCUS_03640 26888 26109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 27197 26958 gene locus_tag LOCUS_03650 27197 26958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03650 28414 27194 gene locus_tag LOCUS_03660 28414 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 28600 28676 gene locus_tag LOCUS_t00040 28600 28676 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 28710 28784 gene locus_tag LOCUS_t00050 28710 28784 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence014 1258 1806 gene locus_tag LOCUS_03670 1258 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1870 2388 gene locus_tag LOCUS_03680 1870 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2418 3581 gene locus_tag LOCUS_03690 gene alr 2418 3581 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_03690 3603 4625 gene locus_tag LOCUS_03700 3603 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4661 5893 gene locus_tag LOCUS_03710 4661 5893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5923 6681 gene locus_tag LOCUS_03720 5923 6681 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_03720 6720 7247 gene locus_tag LOCUS_03730 6720 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7441 7707 gene locus_tag LOCUS_03740 7441 7707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 7809 8609 gene locus_tag LOCUS_03750 7809 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 8652 10052 gene locus_tag LOCUS_03760 8652 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10057 10563 gene locus_tag LOCUS_03770 gene lspA 10057 10563 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_03770 10553 11539 gene locus_tag LOCUS_03780 10553 11539 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_03780 11703 12827 gene locus_tag LOCUS_03790 11703 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 12842 14101 gene locus_tag LOCUS_03800 12842 14101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 14092 15030 gene locus_tag LOCUS_03810 14092 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 15256 16719 gene locus_tag LOCUS_03820 15256 16719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 17811 16912 gene locus_tag LOCUS_03830 17811 16912 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791099.1 protein_id gnl|my_center|LOCUS_03830 18468 17824 gene locus_tag LOCUS_03840 18468 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 19038 18541 gene locus_tag LOCUS_03850 19038 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19987 19046 gene locus_tag LOCUS_03860 19987 19046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 21084 20068 gene locus_tag LOCUS_03870 21084 20068 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_03870 21233 22162 gene locus_tag LOCUS_03880 21233 22162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 22312 23172 gene locus_tag LOCUS_03890 22312 23172 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_03890 23324 24025 gene locus_tag LOCUS_03900 23324 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 24039 25187 gene locus_tag LOCUS_03910 24039 25187 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861703.1 protein_id gnl|my_center|LOCUS_03910 25175 27151 gene locus_tag LOCUS_03920 25175 27151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 27755 27204 gene locus_tag LOCUS_03930 27755 27204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence015 784 2283 gene locus_tag LOCUS_03940 784 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2973 2344 gene locus_tag LOCUS_03950 2973 2344 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_03950 4001 2979 gene locus_tag LOCUS_03960 4001 2979 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582687.1 protein_id gnl|my_center|LOCUS_03960 5948 4026 gene locus_tag LOCUS_03970 5948 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6593 6117 gene locus_tag LOCUS_03980 6593 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 6947 6696 gene locus_tag LOCUS_03990 6947 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 protein_id gnl|my_center|LOCUS_03990 8185 6983 gene locus_tag LOCUS_04000 gene rlmD 8185 6983 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_04000 9053 8217 gene locus_tag LOCUS_04010 9053 8217 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_04010 10297 9056 gene locus_tag LOCUS_04020 10297 9056 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_04020 10581 10294 gene locus_tag LOCUS_04030 10581 10294 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_04030 11548 10667 gene locus_tag LOCUS_04040 11548 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 13235 11562 gene locus_tag LOCUS_04050 13235 11562 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861169.1 protein_id gnl|my_center|LOCUS_04050 13852 13568 gene locus_tag LOCUS_04060 13852 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 14147 14431 gene locus_tag LOCUS_04070 14147 14431 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_04070 16009 14480 gene locus_tag LOCUS_04080 16009 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 16946 16107 gene locus_tag LOCUS_04090 16946 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 17118 18197 gene locus_tag LOCUS_04100 17118 18197 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_04100 18197 18547 gene locus_tag LOCUS_04110 18197 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 18544 20286 gene locus_tag LOCUS_04120 18544 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 20273 21169 gene locus_tag LOCUS_04130 20273 21169 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_04130 21172 22116 gene locus_tag LOCUS_04140 21172 22116 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774223.1 protein_id gnl|my_center|LOCUS_04140 22255 22554 gene locus_tag LOCUS_04150 22255 22554 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_04150 22565 25057 gene locus_tag LOCUS_04160 22565 25057 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04160 25606 25103 gene locus_tag LOCUS_04170 25606 25103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 26713 25613 gene locus_tag LOCUS_04180 26713 25613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence016 287 1174 gene locus_tag LOCUS_04190 287 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1178 1693 gene locus_tag LOCUS_04200 gene yfcE 1178 1693 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_04200 1697 3097 gene locus_tag LOCUS_04210 1697 3097 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_04210 3094 4149 gene locus_tag LOCUS_04220 gene mnmA 3094 4149 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_04220 4151 4861 gene locus_tag LOCUS_04230 4151 4861 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_04230 4988 4830 gene locus_tag LOCUS_04240 4988 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5499 5729 gene locus_tag LOCUS_04250 5499 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5899 6906 gene locus_tag LOCUS_04260 gene dusB 5899 6906 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_04260 7118 7696 gene locus_tag LOCUS_04270 7118 7696 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_04270 7743 8678 gene locus_tag LOCUS_04280 7743 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 8945 9841 gene locus_tag LOCUS_04290 8945 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 11404 9884 gene locus_tag LOCUS_04300 11404 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13078 11573 gene locus_tag LOCUS_04310 13078 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 16433 13605 gene locus_tag LOCUS_04320 gene uvrA 16433 13605 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_04320 17394 16465 gene locus_tag LOCUS_04330 17394 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 17800 17441 gene locus_tag LOCUS_04340 17800 17441 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775211.1 protein_id gnl|my_center|LOCUS_04340 18616 17804 gene locus_tag LOCUS_04350 18616 17804 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_04350 20840 18846 gene locus_tag LOCUS_04360 gene uvrB 20840 18846 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722621.1 protein_id gnl|my_center|LOCUS_04360 23728 21293 gene locus_tag LOCUS_04370 23728 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence017 1120 80 gene locus_tag LOCUS_04380 1120 80 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_04380 2938 1511 gene locus_tag LOCUS_04390 gene pyk 2938 1511 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_04390 4338 3052 gene locus_tag LOCUS_04400 4338 3052 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_04400 4741 5079 gene locus_tag LOCUS_04410 4741 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5072 6352 gene locus_tag LOCUS_04420 5072 6352 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861026.1 protein_id gnl|my_center|LOCUS_04420 6421 7671 gene locus_tag LOCUS_04430 6421 7671 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674652.1 protein_id gnl|my_center|LOCUS_04430 7668 8099 gene locus_tag LOCUS_04440 7668 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8272 9309 gene locus_tag LOCUS_04450 8272 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 9330 9653 gene locus_tag LOCUS_04460 9330 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9647 9958 gene locus_tag LOCUS_04470 9647 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 9975 10337 gene locus_tag LOCUS_04480 9975 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 10356 10871 gene locus_tag LOCUS_04490 10356 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 10868 11674 gene locus_tag LOCUS_04500 10868 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11685 12683 gene locus_tag LOCUS_04510 11685 12683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 12702 13949 gene locus_tag LOCUS_04520 12702 13949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 14022 14525 gene locus_tag LOCUS_04530 14022 14525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 14546 14764 gene locus_tag LOCUS_04540 14546 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 16273 14810 gene locus_tag LOCUS_04550 16273 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 17892 16426 gene locus_tag LOCUS_04560 17892 16426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 19597 17948 gene locus_tag LOCUS_04570 19597 17948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 21818 19815 gene locus_tag LOCUS_04580 gene gyrB 21818 19815 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_04580 23677 22451 gene locus_tag LOCUS_04590 23677 22451 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_04590 <24553 23693 gene locus_tag LOCUS_04600 <24553 23693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461245.1:MBOAT family protein >Feature sequence018 <1 651 gene locus_tag LOCUS_04610 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356002.1:sodium ion-translocating decarboxylase subunit beta 666 956 gene locus_tag LOCUS_04620 666 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1151 1864 gene locus_tag LOCUS_04630 1151 1864 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_04630 1940 3664 gene locus_tag LOCUS_04640 1940 3664 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815455.1 protein_id gnl|my_center|LOCUS_04640 4724 3714 gene locus_tag LOCUS_04650 4724 3714 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_04650 5031 5378 gene locus_tag LOCUS_04660 5031 5378 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_04660 5403 7124 gene locus_tag LOCUS_04670 5403 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 7136 7666 gene locus_tag LOCUS_04680 7136 7666 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_04680 10324 7724 gene locus_tag LOCUS_04690 10324 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 11398 10340 gene locus_tag LOCUS_04700 11398 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13759 11414 gene locus_tag LOCUS_04710 13759 11414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 14744 13803 gene locus_tag LOCUS_04720 14744 13803 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814246.1 protein_id gnl|my_center|LOCUS_04720 15728 14757 gene locus_tag LOCUS_04730 15728 14757 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814244.1 protein_id gnl|my_center|LOCUS_04730 17580 15979 gene locus_tag LOCUS_04740 17580 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 18146 17592 gene locus_tag LOCUS_04750 18146 17592 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_04750 18054 18284 gene locus_tag LOCUS_04760 18054 18284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 18644 18174 gene locus_tag LOCUS_04770 gene ybaK 18644 18174 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_04770 20127 18754 gene locus_tag LOCUS_04780 20127 18754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 21134 20151 gene locus_tag LOCUS_04790 21134 20151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 21544 21131 gene locus_tag LOCUS_04800 21544 21131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21738 22931 gene locus_tag LOCUS_04810 21738 22931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence019 991 410 gene locus_tag LOCUS_04820 991 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2259 1036 gene locus_tag LOCUS_04830 2259 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3050 2346 gene locus_tag LOCUS_04840 3050 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5545 3173 gene locus_tag LOCUS_04850 5545 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7100 5616 gene locus_tag LOCUS_04860 7100 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7343 8224 gene locus_tag LOCUS_04870 gene rhaS 7343 8224 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217135.1 protein_id gnl|my_center|LOCUS_04870 8952 9311 gene locus_tag LOCUS_04880 8952 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 9313 10653 gene locus_tag LOCUS_04890 9313 10653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 10653 11390 gene locus_tag LOCUS_04900 10653 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 11441 12049 gene locus_tag LOCUS_04910 11441 12049 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005627.1 protein_id gnl|my_center|LOCUS_04910 13136 12276 gene locus_tag LOCUS_04920 13136 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 15083 13224 gene locus_tag LOCUS_04930 15083 13224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 15237 16082 gene locus_tag LOCUS_04940 15237 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 18305 16263 gene locus_tag LOCUS_04950 18305 16263 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_04950 18882 18457 gene locus_tag LOCUS_04960 18882 18457 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412237.1 protein_id gnl|my_center|LOCUS_04960 19417 18875 gene locus_tag LOCUS_04970 19417 18875 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_04970 20232 19414 gene locus_tag LOCUS_04980 20232 19414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 20612 20229 gene locus_tag LOCUS_04990 20612 20229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 20872 20615 gene locus_tag LOCUS_05000 20872 20615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 21349 20954 gene locus_tag LOCUS_05010 gene nudG 21349 20954 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781866.1 protein_id gnl|my_center|LOCUS_05010 21631 22287 gene locus_tag LOCUS_05020 21631 22287 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065188.1 protein_id gnl|my_center|LOCUS_05020 22405 22478 gene locus_tag LOCUS_t00060 22405 22478 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 512 1186 gene locus_tag LOCUS_05030 512 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1199 2794 gene locus_tag LOCUS_05040 1199 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2831 3148 gene locus_tag LOCUS_05050 2831 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_05050 3273 4343 gene locus_tag LOCUS_05060 3273 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4340 5392 gene locus_tag LOCUS_05070 4340 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8070 5428 gene locus_tag LOCUS_05080 8070 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 8225 9604 gene locus_tag LOCUS_05090 8225 9604 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_05090 9632 11254 gene locus_tag LOCUS_05100 9632 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 11267 11668 gene locus_tag LOCUS_05110 11267 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13004 11715 gene locus_tag LOCUS_05120 13004 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 14089 13151 gene locus_tag LOCUS_05130 14089 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 14239 14156 gene locus_tag LOCUS_t00070 14239 14156 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14784 14305 gene locus_tag LOCUS_05140 14784 14305 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_05140 15832 14786 gene locus_tag LOCUS_05150 15832 14786 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386658.1 protein_id gnl|my_center|LOCUS_05150 17583 15895 gene locus_tag LOCUS_05160 17583 15895 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_05160 19240 17840 gene locus_tag LOCUS_05170 gene scfB 19240 17840 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_05170 19451 19305 gene locus_tag LOCUS_05180 gene scfA 19451 19305 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_05180 20953 19538 gene locus_tag LOCUS_05190 20953 19538 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_05190 21542 20946 gene locus_tag LOCUS_05200 21542 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence021 746 1453 gene locus_tag LOCUS_05210 gene sfsA 746 1453 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_05210 1527 4529 gene locus_tag LOCUS_05220 1527 4529 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389909.1 protein_id gnl|my_center|LOCUS_05220 4584 5492 gene locus_tag LOCUS_05230 4584 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 6283 5510 gene locus_tag LOCUS_05240 6283 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 6421 8250 gene locus_tag LOCUS_05250 6421 8250 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_05250 8387 9535 gene locus_tag LOCUS_05260 8387 9535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_05260 9539 10198 gene locus_tag LOCUS_05270 9539 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10229 11302 gene locus_tag LOCUS_05280 10229 11302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11315 11947 gene locus_tag LOCUS_05290 11315 11947 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_05290 11944 12234 gene locus_tag LOCUS_05300 11944 12234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 12241 12510 gene locus_tag LOCUS_05310 12241 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 12553 13731 gene locus_tag LOCUS_05320 12553 13731 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804458.1 protein_id gnl|my_center|LOCUS_05320 13735 14043 gene locus_tag LOCUS_05330 13735 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 15217 14075 gene locus_tag LOCUS_05340 15217 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 15383 16210 gene locus_tag LOCUS_05350 15383 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 16294 17064 gene locus_tag LOCUS_05360 16294 17064 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_05360 17079 18128 gene locus_tag LOCUS_05370 17079 18128 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_05370 19659 18178 gene locus_tag LOCUS_05380 19659 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 21089 19680 gene locus_tag LOCUS_05390 21089 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence022 <1 915 gene locus_tag LOCUS_05400 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948155.1:DUF5050 domain-containing protein 1214 2401 gene locus_tag LOCUS_05410 1214 2401 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_05410 2421 2900 gene locus_tag LOCUS_05420 2421 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2913 4073 gene locus_tag LOCUS_05430 2913 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5118 4213 gene locus_tag LOCUS_05440 5118 4213 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_05440 5924 5115 gene locus_tag LOCUS_05450 5924 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6625 5930 gene locus_tag LOCUS_05460 gene tsaA 6625 5930 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_05460 7114 7269 gene locus_tag LOCUS_05470 7114 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7454 8911 gene locus_tag LOCUS_05480 7454 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 8944 9642 gene locus_tag LOCUS_05490 8944 9642 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_05490 9748 11853 gene locus_tag LOCUS_05500 9748 11853 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_05500 12849 11911 gene locus_tag LOCUS_05510 12849 11911 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_05510 13107 13886 gene locus_tag LOCUS_05520 13107 13886 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_05520 13889 14566 gene locus_tag LOCUS_05530 13889 14566 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145123293.1 protein_id gnl|my_center|LOCUS_05530 15414 14569 gene locus_tag LOCUS_05540 15414 14569 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_05540 15523 16494 gene locus_tag LOCUS_05550 15523 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 16646 17368 gene locus_tag LOCUS_05560 16646 17368 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906060.1 protein_id gnl|my_center|LOCUS_05560 17358 17669 gene locus_tag LOCUS_05570 17358 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 17683 18153 gene locus_tag LOCUS_05580 17683 18153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 19704 18193 gene locus_tag LOCUS_05590 19704 18193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 19915 20694 gene locus_tag LOCUS_05600 19915 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence023 <1 1142 gene locus_tag LOCUS_05610 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054550.1:sodium/proline symporter 1628 1212 gene locus_tag LOCUS_05620 1628 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3174 1699 gene locus_tag LOCUS_05630 3174 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3467 3243 gene locus_tag LOCUS_05640 3467 3243 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_05640 4689 3628 gene locus_tag LOCUS_05650 4689 3628 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_05650 6094 4787 gene locus_tag LOCUS_05660 6094 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6818 6893 gene locus_tag LOCUS_t00080 6818 6893 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7435 10452 gene locus_tag LOCUS_05670 7435 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 12185 10593 gene locus_tag LOCUS_05680 12185 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 13500 12253 gene locus_tag LOCUS_05690 13500 12253 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921834.1 protein_id gnl|my_center|LOCUS_05690 14597 13515 gene locus_tag LOCUS_05700 gene bfrA 14597 13515 CDS product beta-fructosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081649.1 protein_id gnl|my_center|LOCUS_05700 14940 14704 gene locus_tag LOCUS_05710 14940 14704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 17130 14968 gene locus_tag LOCUS_05720 17130 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108901.1 protein_id gnl|my_center|LOCUS_05720 17346 17272 gene locus_tag LOCUS_t00090 17346 17272 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18007 17423 gene locus_tag LOCUS_05730 18007 17423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 18134 19729 gene locus_tag LOCUS_05740 18134 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 20515 19835 gene locus_tag LOCUS_05750 20515 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 20993 20918 gene locus_tag LOCUS_t00100 20993 20918 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 679 194 gene locus_tag LOCUS_05760 679 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1741 707 gene locus_tag LOCUS_05770 gene kdgK1 1741 707 CDS product bifunctional 2-dehydro-3-deoxygluconokinase/2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902071.1 protein_id gnl|my_center|LOCUS_05770 2585 1842 gene locus_tag LOCUS_05780 2585 1842 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244751.1 protein_id gnl|my_center|LOCUS_05780 2992 2600 gene locus_tag LOCUS_05790 2992 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3222 4769 gene locus_tag LOCUS_05800 gene murJ 3222 4769 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391760.1 protein_id gnl|my_center|LOCUS_05800 4771 5901 gene locus_tag LOCUS_05810 4771 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 5936 8932 gene locus_tag LOCUS_05820 5936 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 8929 9201 gene locus_tag LOCUS_05830 8929 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 9391 10878 gene locus_tag LOCUS_05840 9391 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 11521 11162 gene locus_tag LOCUS_05850 11521 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 12625 11561 gene locus_tag LOCUS_05860 12625 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 13374 12646 gene locus_tag LOCUS_05870 13374 12646 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100889.1 protein_id gnl|my_center|LOCUS_05870 14174 13377 gene locus_tag LOCUS_05880 14174 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 14367 15167 gene locus_tag LOCUS_05890 14367 15167 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462069.1 protein_id gnl|my_center|LOCUS_05890 15238 15792 gene locus_tag LOCUS_05900 15238 15792 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_05900 15922 16434 gene locus_tag LOCUS_05910 15922 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 17484 16564 gene locus_tag LOCUS_05920 17484 16564 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_05920 17698 18024 gene locus_tag LOCUS_05930 17698 18024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 18928 18083 gene locus_tag LOCUS_05940 18928 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <20936 18928 gene locus_tag LOCUS_05950 <20936 18928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201960.1:glycoside hydrolase family 78 protein >Feature sequence025 1458 637 gene locus_tag LOCUS_05960 gene atpG 1458 637 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_05960 2988 1471 gene locus_tag LOCUS_05970 gene atpA 2988 1471 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_05970 3546 3007 gene locus_tag LOCUS_05980 gene atpH 3546 3007 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_05980 4053 3559 gene locus_tag LOCUS_05990 gene atpF 4053 3559 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892033.1 protein_id gnl|my_center|LOCUS_05990 4375 4109 gene locus_tag LOCUS_06000 gene atpE 4375 4109 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_06000 5163 4420 gene locus_tag LOCUS_06010 gene atpB 5163 4420 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_06010 5726 5166 gene locus_tag LOCUS_06020 5726 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 5983 5723 gene locus_tag LOCUS_06030 5983 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6431 6093 gene locus_tag LOCUS_06040 6431 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6945 6415 gene locus_tag LOCUS_06050 6945 6415 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_06050 7076 8029 gene locus_tag LOCUS_06060 7076 8029 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_06060 8092 8319 gene locus_tag LOCUS_06070 8092 8319 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723866.1 protein_id gnl|my_center|LOCUS_06070 8316 9266 gene locus_tag LOCUS_06080 gene fabK 8316 9266 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_06080 9254 10168 gene locus_tag LOCUS_06090 gene fabD 9254 10168 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_06090 10165 10902 gene locus_tag LOCUS_06100 gene fabG 10165 10902 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_06100 10996 12225 gene locus_tag LOCUS_06110 gene fabF 10996 12225 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_06110 12233 12673 gene locus_tag LOCUS_06120 gene fabZ 12233 12673 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_06120 13052 12633 gene locus_tag LOCUS_06130 13052 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13258 13437 gene locus_tag LOCUS_06140 13258 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06140 13434 14219 gene locus_tag LOCUS_06150 13434 14219 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931204.1 protein_id gnl|my_center|LOCUS_06150 14338 15261 gene locus_tag LOCUS_06160 14338 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16870 15290 gene locus_tag LOCUS_06170 16870 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 18417 16906 gene locus_tag LOCUS_06180 18417 16906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19312 18716 gene locus_tag LOCUS_06190 19312 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence026 <1 968 gene locus_tag LOCUS_06200 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812354.1:glutamine synthetase III 1227 2726 gene locus_tag LOCUS_06210 1227 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2955 4712 gene locus_tag LOCUS_06220 2955 4712 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_06220 4869 6620 gene locus_tag LOCUS_06230 4869 6620 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_06230 6672 7541 gene locus_tag LOCUS_06240 6672 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 9256 7874 gene locus_tag LOCUS_06250 9256 7874 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_06250 9635 10639 gene locus_tag LOCUS_06260 9635 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12261 11671 gene locus_tag LOCUS_06270 gene pgsA 12261 11671 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_06270 13632 12274 gene locus_tag LOCUS_06280 gene rimO 13632 12274 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_06280 14307 13660 gene locus_tag LOCUS_06290 14307 13660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15514 14354 gene locus_tag LOCUS_06300 gene recF 15514 14354 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662310.1 protein_id gnl|my_center|LOCUS_06300 16411 15518 gene locus_tag LOCUS_06310 16411 15518 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_06310 17567 16416 gene locus_tag LOCUS_06320 gene recA 17567 16416 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence027 527 2179 gene locus_tag LOCUS_06330 gene gpmI 527 2179 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_06330 2260 3078 gene locus_tag LOCUS_06340 gene pgeF 2260 3078 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_06340 3799 3095 gene locus_tag LOCUS_06350 3799 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3895 5280 gene locus_tag LOCUS_06360 3895 5280 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668604.1 protein_id gnl|my_center|LOCUS_06360 5298 6596 gene locus_tag LOCUS_06370 5298 6596 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678796.1 protein_id gnl|my_center|LOCUS_06370 6618 7652 gene locus_tag LOCUS_06380 6618 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8984 7701 gene locus_tag LOCUS_06390 8984 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9463 8981 gene locus_tag LOCUS_06400 9463 8981 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_06400 10496 9585 gene locus_tag LOCUS_06410 10496 9585 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949031.1 protein_id gnl|my_center|LOCUS_06410 11049 10501 gene locus_tag LOCUS_06420 11049 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 13008 11062 gene locus_tag LOCUS_06430 13008 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 15344 13122 gene locus_tag LOCUS_06440 15344 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 16432 15344 gene locus_tag LOCUS_06450 16432 15344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 17546 16473 gene locus_tag LOCUS_06460 17546 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938446.1 protein_id gnl|my_center|LOCUS_06460 18933 17557 gene locus_tag LOCUS_06470 18933 17557 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence028 1405 194 gene locus_tag LOCUS_06480 1405 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_06480 2360 1512 gene locus_tag LOCUS_06490 2360 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 2806 2396 gene locus_tag LOCUS_06500 2806 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 4250 2844 gene locus_tag LOCUS_06510 4250 2844 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965170.1 protein_id gnl|my_center|LOCUS_06510 5294 4311 gene locus_tag LOCUS_06520 5294 4311 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388811.1 protein_id gnl|my_center|LOCUS_06520 6295 5291 gene locus_tag LOCUS_06530 6295 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7307 6297 gene locus_tag LOCUS_06540 7307 6297 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978217.1 protein_id gnl|my_center|LOCUS_06540 7425 8201 gene locus_tag LOCUS_06550 7425 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8666 9295 gene locus_tag LOCUS_06560 8666 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9412 9627 gene locus_tag LOCUS_06570 9412 9627 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_06570 11738 9693 gene locus_tag LOCUS_06580 11738 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 12252 11722 gene locus_tag LOCUS_06590 12252 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 14633 12399 gene locus_tag LOCUS_06600 gene gyrA 14633 12399 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583623.1 protein_id gnl|my_center|LOCUS_06600 15684 14641 gene locus_tag LOCUS_06610 15684 14641 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_06610 16760 15681 gene locus_tag LOCUS_06620 gene prfA 16760 15681 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_06620 17812 16850 gene locus_tag LOCUS_06630 17812 16850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 <18920 17846 gene locus_tag LOCUS_06640 <18920 17846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861085.1:aminopeptidase >Feature sequence029 188 115 gene locus_tag LOCUS_t00110 188 115 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 929 276 gene locus_tag LOCUS_06650 929 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2336 1002 gene locus_tag LOCUS_06660 gene melA 2336 1002 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_06660 2532 3494 gene locus_tag LOCUS_06670 2532 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3508 4134 gene locus_tag LOCUS_06680 3508 4134 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_06680 4145 4687 gene locus_tag LOCUS_06690 4145 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4787 4632 gene locus_tag LOCUS_06700 4787 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4887 5780 gene locus_tag LOCUS_06710 4887 5780 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_06710 5784 6056 gene locus_tag LOCUS_06720 5784 6056 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_06720 6053 6679 gene locus_tag LOCUS_06730 gene gmk 6053 6679 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_06730 6751 7077 gene locus_tag LOCUS_06740 6751 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7173 9698 gene locus_tag LOCUS_06750 gene priA 7173 9698 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_06750 9727 10209 gene locus_tag LOCUS_06760 gene def 9727 10209 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_06760 10215 11168 gene locus_tag LOCUS_06770 gene fmt 10215 11168 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_06770 11173 12480 gene locus_tag LOCUS_06780 gene rsmB 11173 12480 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206580826.1 protein_id gnl|my_center|LOCUS_06780 12477 13526 gene locus_tag LOCUS_06790 gene rlmN 12477 13526 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_06790 13626 14390 gene locus_tag LOCUS_06800 13626 14390 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 protein_id gnl|my_center|LOCUS_06800 14426 16351 gene locus_tag LOCUS_06810 gene pknB 14426 16351 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_06810 16356 17357 gene locus_tag LOCUS_06820 gene rsgA 16356 17357 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287379.1 protein_id gnl|my_center|LOCUS_06820 17350 17982 gene locus_tag LOCUS_06830 17350 17982 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002026234.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence030 455 1591 gene locus_tag LOCUS_06840 gene murG 455 1591 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286637.1 protein_id gnl|my_center|LOCUS_06840 1628 2815 gene locus_tag LOCUS_06850 1628 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3091 4254 gene locus_tag LOCUS_06860 gene ftsZ 3091 4254 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_06860 5159 4302 gene locus_tag LOCUS_06870 5159 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5320 6756 gene locus_tag LOCUS_06880 5320 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6780 8498 gene locus_tag LOCUS_06890 6780 8498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_06890 8513 9463 gene locus_tag LOCUS_06900 8513 9463 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_06900 10169 9510 gene locus_tag LOCUS_06910 10169 9510 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_06910 10598 10230 gene locus_tag LOCUS_06920 10598 10230 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081696.1 protein_id gnl|my_center|LOCUS_06920 11881 10595 gene locus_tag LOCUS_06930 11881 10595 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_06930 13340 11874 gene locus_tag LOCUS_06940 13340 11874 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957284.1 protein_id gnl|my_center|LOCUS_06940 13616 14605 gene locus_tag LOCUS_06950 13616 14605 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135810.1 protein_id gnl|my_center|LOCUS_06950 14618 16315 gene locus_tag LOCUS_06960 14618 16315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence031 584 420 gene locus_tag LOCUS_06970 584 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 792 2087 gene locus_tag LOCUS_06980 792 2087 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_06980 2212 2436 gene locus_tag LOCUS_06990 2212 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2574 3446 gene locus_tag LOCUS_07000 2574 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 4097 3489 gene locus_tag LOCUS_07010 4097 3489 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086982.1 protein_id gnl|my_center|LOCUS_07010 5145 4084 gene locus_tag LOCUS_07020 5145 4084 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_07020 6163 5147 gene locus_tag LOCUS_07030 6163 5147 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121661.1 protein_id gnl|my_center|LOCUS_07030 6888 6292 gene locus_tag LOCUS_07040 gene purN 6888 6292 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_07040 7354 6902 gene locus_tag LOCUS_07050 7354 6902 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 protein_id gnl|my_center|LOCUS_07050 8969 7380 gene locus_tag LOCUS_07060 8969 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9179 10969 gene locus_tag LOCUS_07070 9179 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 11798 11004 gene locus_tag LOCUS_07080 11798 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 12523 11795 gene locus_tag LOCUS_07090 12523 11795 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258153.1 protein_id gnl|my_center|LOCUS_07090 12702 13748 gene locus_tag LOCUS_07100 12702 13748 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_07100 13768 14571 gene locus_tag LOCUS_07110 13768 14571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 16003 14609 gene locus_tag LOCUS_07120 16003 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 17397 16000 gene locus_tag LOCUS_07130 17397 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence032 531 1607 gene locus_tag LOCUS_07140 531 1607 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095328.1 protein_id gnl|my_center|LOCUS_07140 2180 1674 gene locus_tag LOCUS_07150 2180 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2298 3437 gene locus_tag LOCUS_07160 2298 3437 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209281.1 protein_id gnl|my_center|LOCUS_07160 3465 4289 gene locus_tag LOCUS_07170 gene queG 3465 4289 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_07170 4282 7632 gene locus_tag LOCUS_07180 gene addB 4282 7632 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392018.1 protein_id gnl|my_center|LOCUS_07180 7632 11285 gene locus_tag LOCUS_07190 gene addA 7632 11285 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018662405.1 protein_id gnl|my_center|LOCUS_07190 11272 12120 gene locus_tag LOCUS_07200 11272 12120 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_07200 12113 12892 gene locus_tag LOCUS_07210 12113 12892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 14195 12984 gene locus_tag LOCUS_07220 14195 12984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 14646 14170 gene locus_tag LOCUS_07230 14646 14170 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_07230 15733 14870 gene locus_tag LOCUS_07240 gene fba 15733 14870 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_07240 17350 15869 gene locus_tag LOCUS_07250 17350 15869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence033 2703 748 gene locus_tag LOCUS_07260 2703 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2848 3315 gene locus_tag LOCUS_07270 2848 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3315 4934 gene locus_tag LOCUS_07280 3315 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4965 5627 gene locus_tag LOCUS_07290 4965 5627 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764375.1 protein_id gnl|my_center|LOCUS_07290 5636 6055 gene locus_tag LOCUS_07300 5636 6055 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_07300 6055 7845 gene locus_tag LOCUS_07310 6055 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 10129 7901 gene locus_tag LOCUS_07320 10129 7901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_07320 10689 10147 gene locus_tag LOCUS_07330 10689 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 13030 10709 gene locus_tag LOCUS_07340 13030 10709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_07340 13349 15784 gene locus_tag LOCUS_07350 13349 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 15910 16323 gene locus_tag LOCUS_07360 15910 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 16335 16754 gene locus_tag LOCUS_07370 16335 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence034 93 803 gene locus_tag LOCUS_07380 93 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 796 1296 gene locus_tag LOCUS_07390 796 1296 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027905.1 protein_id gnl|my_center|LOCUS_07390 2229 1342 gene locus_tag LOCUS_07400 2229 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3562 2234 gene locus_tag LOCUS_07410 3562 2234 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_07410 4360 3710 gene locus_tag LOCUS_07420 gene hisIE 4360 3710 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_07420 5189 4428 gene locus_tag LOCUS_07430 gene hisF 5189 4428 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_07430 5916 5194 gene locus_tag LOCUS_07440 gene hisA 5916 5194 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_07440 6553 5936 gene locus_tag LOCUS_07450 gene hisH 6553 5936 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_07450 7140 6550 gene locus_tag LOCUS_07460 gene hisB 7140 6550 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_07460 8218 7160 gene locus_tag LOCUS_07470 gene hisC 8218 7160 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_07470 9501 8215 gene locus_tag LOCUS_07480 gene hisD 9501 8215 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_07480 10100 9498 gene locus_tag LOCUS_07490 gene hisG 10100 9498 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_07490 11259 10132 gene locus_tag LOCUS_07500 11259 10132 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_07500 12711 11488 gene locus_tag LOCUS_07510 12711 11488 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_07510 13739 12804 gene locus_tag LOCUS_07520 13739 12804 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356704.1 protein_id gnl|my_center|LOCUS_07520 13666 13848 gene locus_tag LOCUS_07530 13666 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 13845 14450 gene locus_tag LOCUS_07540 13845 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14469 15650 gene locus_tag LOCUS_07550 gene thiI 14469 15650 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07550 16892 15690 gene locus_tag LOCUS_07560 16892 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence035 5089 4703 gene locus_tag LOCUS_07570 5089 4703 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461150.1 protein_id gnl|my_center|LOCUS_07570 5284 6192 gene locus_tag LOCUS_07580 5284 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7653 6238 gene locus_tag LOCUS_07590 7653 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8213 7650 gene locus_tag LOCUS_07600 8213 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 8564 9811 gene locus_tag LOCUS_07610 8564 9811 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_07610 11393 9867 gene locus_tag LOCUS_07620 11393 9867 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_07620 11557 12477 gene locus_tag LOCUS_07630 11557 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12474 14951 gene locus_tag LOCUS_07640 12474 14951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 15628 14957 gene locus_tag LOCUS_07650 15628 14957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 15722 16732 gene locus_tag LOCUS_07660 15722 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence036 1945 950 gene locus_tag LOCUS_07670 gene mraY 1945 950 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_07670 3404 1965 gene locus_tag LOCUS_07680 3404 1965 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_07680 4947 3442 gene locus_tag LOCUS_07690 4947 3442 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272490.1 protein_id gnl|my_center|LOCUS_07690 7495 5012 gene locus_tag LOCUS_07700 7495 5012 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_07700 8567 7677 gene locus_tag LOCUS_07710 8567 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9586 8648 gene locus_tag LOCUS_07720 gene rsmH 9586 8648 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_07720 10021 9602 gene locus_tag LOCUS_07730 gene mraZ 10021 9602 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_07730 10899 10387 gene locus_tag LOCUS_07740 gene coaD 10899 10387 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887287.1 protein_id gnl|my_center|LOCUS_07740 11546 10899 gene locus_tag LOCUS_07750 11546 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13548 11641 gene locus_tag LOCUS_07760 gene uvrC 13548 11641 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_07760 13984 13721 gene locus_tag LOCUS_07770 13984 13721 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_07770 14254 16068 gene locus_tag LOCUS_07780 14254 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence037 2180 27 gene locus_tag LOCUS_07790 gene rnr 2180 27 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989996.1 protein_id gnl|my_center|LOCUS_07790 2682 2293 gene locus_tag LOCUS_07800 2682 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3963 2848 gene locus_tag LOCUS_07810 3963 2848 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618882.1 protein_id gnl|my_center|LOCUS_07810 5815 4250 gene locus_tag LOCUS_07820 5815 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 6474 5848 gene locus_tag LOCUS_07830 gene gmhA 6474 5848 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_07830 7727 6783 gene locus_tag LOCUS_07840 7727 6783 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_07840 8012 7821 gene locus_tag LOCUS_07850 8012 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9451 8057 gene locus_tag LOCUS_07860 gene mnmE 9451 8057 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_07860 12850 9926 gene locus_tag LOCUS_07870 12850 9926 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_07870 13117 14364 gene locus_tag LOCUS_07880 13117 14364 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_07880 14374 15090 gene locus_tag LOCUS_07890 14374 15090 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992233.1 protein_id gnl|my_center|LOCUS_07890 15132 15989 gene locus_tag LOCUS_07900 15132 15989 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence038 1684 260 gene locus_tag LOCUS_07910 1684 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2646 1801 gene locus_tag LOCUS_07920 2646 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 5186 2673 gene locus_tag LOCUS_07930 gene polA 5186 2673 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836329.1 protein_id gnl|my_center|LOCUS_07930 5354 5779 gene locus_tag LOCUS_07940 5354 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 6266 8536 gene locus_tag LOCUS_07950 6266 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 8580 9335 gene locus_tag LOCUS_07960 8580 9335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023853.1 protein_id gnl|my_center|LOCUS_07960 9442 10380 gene locus_tag LOCUS_07970 9442 10380 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886481.1 protein_id gnl|my_center|LOCUS_07970 10374 11498 gene locus_tag LOCUS_07980 10374 11498 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_07980 11513 12703 gene locus_tag LOCUS_07990 11513 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 12707 13423 gene locus_tag LOCUS_08000 gene yycF 12707 13423 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 protein_id gnl|my_center|LOCUS_08000 13430 15241 gene locus_tag LOCUS_08010 gene walK 13430 15241 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968432.1 protein_id gnl|my_center|LOCUS_08010 15270 16658 gene locus_tag LOCUS_08020 15270 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence039 1478 3619 gene locus_tag LOCUS_08030 1478 3619 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_08030 4323 6734 gene locus_tag LOCUS_08040 4323 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 6746 9205 gene locus_tag LOCUS_08050 6746 9205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 9366 11819 gene locus_tag LOCUS_08060 9366 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 11857 14295 gene locus_tag LOCUS_08070 11857 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence040 910 113 gene locus_tag LOCUS_08080 910 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3035 1494 gene locus_tag LOCUS_08090 3035 1494 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_08090 4407 3052 gene locus_tag LOCUS_08100 gene trkA 4407 3052 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016254.1 protein_id gnl|my_center|LOCUS_08100 4643 7609 gene locus_tag LOCUS_08110 4643 7609 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_08110 7889 9244 gene locus_tag LOCUS_08120 7889 9244 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_08120 9751 9380 gene locus_tag LOCUS_08130 9751 9380 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_08130 9793 10098 gene locus_tag LOCUS_08140 9793 10098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 10274 10014 gene locus_tag LOCUS_08150 10274 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 10370 11293 gene locus_tag LOCUS_08160 10370 11293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 11422 12921 gene locus_tag LOCUS_08170 11422 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 13644 12973 gene locus_tag LOCUS_08180 13644 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 14931 13687 gene locus_tag LOCUS_08190 14931 13687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 16591 14972 gene locus_tag LOCUS_08200 16591 14972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence041 1290 571 gene locus_tag LOCUS_08210 1290 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2006 1314 gene locus_tag LOCUS_08220 2006 1314 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948640.1 protein_id gnl|my_center|LOCUS_08220 3316 2225 gene locus_tag LOCUS_08230 3316 2225 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_08230 4790 3411 gene locus_tag LOCUS_08240 4790 3411 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_08240 6234 4849 gene locus_tag LOCUS_08250 6234 4849 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_08250 7913 6432 gene locus_tag LOCUS_08260 7913 6432 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_08260 9315 7939 gene locus_tag LOCUS_08270 9315 7939 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_08270 11653 9542 gene locus_tag LOCUS_08280 11653 9542 CDS product alginate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972694.1 protein_id gnl|my_center|LOCUS_08280 12213 11665 gene locus_tag LOCUS_08290 12213 11665 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588841.1 protein_id gnl|my_center|LOCUS_08290 12410 12616 gene locus_tag LOCUS_08300 12410 12616 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815097.1 protein_id gnl|my_center|LOCUS_08300 12613 13065 gene locus_tag LOCUS_08310 12613 13065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 13152 14159 gene locus_tag LOCUS_08320 13152 14159 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_08320 <16122 14435 gene locus_tag LOCUS_08330 <16122 14435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259409.1:family 78 glycoside hydrolase catalytic domain >Feature sequence042 3868 1907 gene locus_tag LOCUS_08340 3868 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4323 3919 gene locus_tag LOCUS_08350 4323 3919 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897458.1 protein_id gnl|my_center|LOCUS_08350 4450 4818 gene locus_tag LOCUS_08360 4450 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 5656 4835 gene locus_tag LOCUS_08370 5656 4835 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114171.1 protein_id gnl|my_center|LOCUS_08370 5807 6307 gene locus_tag LOCUS_08380 5807 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 6304 7080 gene locus_tag LOCUS_08390 6304 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 7811 7119 gene locus_tag LOCUS_08400 7811 7119 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 protein_id gnl|my_center|LOCUS_08400 8314 7808 gene locus_tag LOCUS_08410 8314 7808 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631751.1 protein_id gnl|my_center|LOCUS_08410 8742 8311 gene locus_tag LOCUS_08420 gene aroQ 8742 8311 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_08420 9992 8754 gene locus_tag LOCUS_08430 9992 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 11139 9994 gene locus_tag LOCUS_08440 gene pheA 11139 9994 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_08440 12264 11185 gene locus_tag LOCUS_08450 gene aroC 12264 11185 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_08450 13541 12261 gene locus_tag LOCUS_08460 gene aroA 13541 12261 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_08460 14593 13538 gene locus_tag LOCUS_08470 gene aroB 14593 13538 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_08470 15393 14590 gene locus_tag LOCUS_08480 15393 14590 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_08480 <16088 15466 gene locus_tag LOCUS_08490 <16088 15466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439427.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence043 2013 805 gene locus_tag LOCUS_08500 2013 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4153 2072 gene locus_tag LOCUS_08510 4153 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5222 4248 gene locus_tag LOCUS_08520 5222 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6096 5236 gene locus_tag LOCUS_08530 6096 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 7171 6083 gene locus_tag LOCUS_08540 7171 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7595 7164 gene locus_tag LOCUS_08550 gene fucU 7595 7164 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920848.1 protein_id gnl|my_center|LOCUS_08550 7901 9385 gene locus_tag LOCUS_08560 7901 9385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9910 9425 gene locus_tag LOCUS_08570 9910 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 10031 10657 gene locus_tag LOCUS_08580 10031 10657 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054174.1 protein_id gnl|my_center|LOCUS_08580 11018 10662 gene locus_tag LOCUS_08590 gene spoVAE 11018 10662 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_08590 12034 11018 gene locus_tag LOCUS_08600 gene spoVAD 12034 11018 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_08600 12489 12040 gene locus_tag LOCUS_08610 gene spoVAC 12489 12040 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_08610 12667 13173 gene locus_tag LOCUS_08620 12667 13173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13840 13241 gene locus_tag LOCUS_08630 13840 13241 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776661.1 protein_id gnl|my_center|LOCUS_08630 15127 13844 gene locus_tag LOCUS_08640 15127 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence044 806 69 gene locus_tag LOCUS_08650 806 69 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_08650 2390 891 gene locus_tag LOCUS_08660 2390 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2634 4511 gene locus_tag LOCUS_08670 2634 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4522 5628 gene locus_tag LOCUS_08680 gene menC 4522 5628 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256750.1 protein_id gnl|my_center|LOCUS_08680 7720 5699 gene locus_tag LOCUS_08690 7720 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 8825 7836 gene locus_tag LOCUS_08700 8825 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 11693 9129 gene locus_tag LOCUS_08710 11693 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 13248 11764 gene locus_tag LOCUS_08720 13248 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 13503 14483 gene locus_tag LOCUS_08730 13503 14483 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296705.1 protein_id gnl|my_center|LOCUS_08730 14694 14600 gene locus_tag LOCUS_t00120 14694 14600 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence045 891 1364 gene locus_tag LOCUS_08740 891 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1385 3073 gene locus_tag LOCUS_08750 1385 3073 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_08750 3522 4187 gene locus_tag LOCUS_08760 3522 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 4184 5797 gene locus_tag LOCUS_08770 4184 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 6412 5846 gene locus_tag LOCUS_08780 6412 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 8709 6409 gene locus_tag LOCUS_08790 8709 6409 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897245.1 protein_id gnl|my_center|LOCUS_08790 9170 8706 gene locus_tag LOCUS_08800 9170 8706 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902988.1 protein_id gnl|my_center|LOCUS_08800 9952 9170 gene locus_tag LOCUS_08810 9952 9170 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223765.1 protein_id gnl|my_center|LOCUS_08810 10746 9949 gene locus_tag LOCUS_08820 gene fecE 10746 9949 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175449.1 protein_id gnl|my_center|LOCUS_08820 11752 10739 gene locus_tag LOCUS_08830 11752 10739 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101422.1 protein_id gnl|my_center|LOCUS_08830 12756 11749 gene locus_tag LOCUS_08840 12756 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 13585 12791 gene locus_tag LOCUS_08850 13585 12791 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107758.1 protein_id gnl|my_center|LOCUS_08850 <15009 13587 gene locus_tag LOCUS_08860 <15009 13587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109250.1:heparinase II/III family protein >Feature sequence046 1546 209 gene locus_tag LOCUS_08870 gene ffh 1546 209 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_08870 1920 1567 gene locus_tag LOCUS_08880 1920 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2140 2439 gene locus_tag LOCUS_08890 2140 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2449 3744 gene locus_tag LOCUS_08900 2449 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4293 3811 gene locus_tag LOCUS_08910 4293 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 5366 4320 gene locus_tag LOCUS_08920 5366 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 5830 5387 gene locus_tag LOCUS_08930 5830 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6162 6599 gene locus_tag LOCUS_08940 gene nusB 6162 6599 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722486.1 protein_id gnl|my_center|LOCUS_08940 6596 7567 gene locus_tag LOCUS_08950 6596 7567 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_08950 7564 8802 gene locus_tag LOCUS_08960 gene xseA 7564 8802 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_08960 8805 9056 gene locus_tag LOCUS_08970 8805 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9043 9924 gene locus_tag LOCUS_08980 9043 9924 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067329.1 protein_id gnl|my_center|LOCUS_08980 9928 10380 gene locus_tag LOCUS_08990 9928 10380 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_08990 10377 11162 gene locus_tag LOCUS_09000 10377 11162 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_09000 11168 12034 gene locus_tag LOCUS_09010 11168 12034 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_09010 12031 12501 gene locus_tag LOCUS_09020 12031 12501 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_09020 12619 14193 gene locus_tag LOCUS_09030 gene recN 12619 14193 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence047 319 1293 gene locus_tag LOCUS_09040 319 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1321 3357 gene locus_tag LOCUS_09050 gene gdpP 1321 3357 CDS product cyclic-di-AMP phosphodiesterase GdpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242517.1 protein_id gnl|my_center|LOCUS_09050 3447 3893 gene locus_tag LOCUS_09060 gene rplI 3447 3893 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_09060 3901 5229 gene locus_tag LOCUS_09070 gene dnaB 3901 5229 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_09070 5232 6155 gene locus_tag LOCUS_09080 5232 6155 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_09080 6406 8244 gene locus_tag LOCUS_09090 6406 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8357 8443 gene locus_tag LOCUS_t00130 8357 8443 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9102 8500 gene locus_tag LOCUS_09100 9102 8500 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_09100 10089 9163 gene locus_tag LOCUS_09110 10089 9163 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_09110 10896 10138 gene locus_tag LOCUS_09120 gene kduD 10896 10138 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005161658.1 protein_id gnl|my_center|LOCUS_09120 11043 12161 gene locus_tag LOCUS_09130 11043 12161 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_09130 12163 12837 gene locus_tag LOCUS_09140 12163 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 13429 12878 gene locus_tag LOCUS_09150 13429 12878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 <14562 13491 gene locus_tag LOCUS_09160 <14562 13491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888533.1:formate--tetrahydrofolate ligase >Feature sequence048 446 1600 gene locus_tag LOCUS_09170 446 1600 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_09170 1662 2558 gene locus_tag LOCUS_09180 1662 2558 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658092.1 protein_id gnl|my_center|LOCUS_09180 2659 3237 gene locus_tag LOCUS_09190 2659 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4526 3279 gene locus_tag LOCUS_09200 4526 3279 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_09200 4721 6742 gene locus_tag LOCUS_09210 4721 6742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_09210 6898 8247 gene locus_tag LOCUS_09220 6898 8247 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_09220 8778 8440 gene locus_tag LOCUS_09230 8778 8440 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_09230 9361 8804 gene locus_tag LOCUS_09240 9361 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9389 10204 gene locus_tag LOCUS_09250 9389 10204 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_09250 10201 11286 gene locus_tag LOCUS_09260 10201 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 13712 11322 gene locus_tag LOCUS_09270 13712 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence049 1470 424 gene locus_tag LOCUS_09280 1470 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 3465 1480 gene locus_tag LOCUS_09290 3465 1480 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_09290 3725 4534 gene locus_tag LOCUS_09300 3725 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6174 4657 gene locus_tag LOCUS_09310 gene spoIVA 6174 4657 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_09310 7659 6253 gene locus_tag LOCUS_09320 7659 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 8224 7733 gene locus_tag LOCUS_09330 8224 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 8257 8670 gene locus_tag LOCUS_09340 8257 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 9495 8674 gene locus_tag LOCUS_09350 gene yidA 9495 8674 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_09350 9652 11640 gene locus_tag LOCUS_09360 9652 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 11692 12609 gene locus_tag LOCUS_09370 11692 12609 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_09370 12629 13540 gene locus_tag LOCUS_09380 12629 13540 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023177.1 protein_id gnl|my_center|LOCUS_09380 14168 13587 gene locus_tag LOCUS_09390 14168 13587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence050 1297 38 gene locus_tag LOCUS_09400 1297 38 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_09400 1436 1636 gene locus_tag LOCUS_09410 1436 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1741 2043 gene locus_tag LOCUS_09420 1741 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2131 4143 gene locus_tag LOCUS_09430 2131 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 4157 5026 gene locus_tag LOCUS_09440 4157 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5990 5226 gene locus_tag LOCUS_09450 5990 5226 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_09450 6962 6021 gene locus_tag LOCUS_09460 6962 6021 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_09460 7394 7101 gene locus_tag LOCUS_09470 7394 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 7633 8244 gene locus_tag LOCUS_09480 gene nrdG 7633 8244 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_09480 8293 9231 gene locus_tag LOCUS_09490 gene rbsK 8293 9231 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038380.1 protein_id gnl|my_center|LOCUS_09490 9231 9983 gene locus_tag LOCUS_09500 9231 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 9980 10414 gene locus_tag LOCUS_09510 gene ruvX 9980 10414 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_09510 10443 11783 gene locus_tag LOCUS_09520 gene pepC 10443 11783 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983616.1 protein_id gnl|my_center|LOCUS_09520 13429 11999 gene locus_tag LOCUS_09530 13429 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <14165 13449 gene locus_tag LOCUS_09540 <14165 13449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048068.1:MBOAT family protein >Feature sequence051 2679 529 gene locus_tag LOCUS_09550 2679 529 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_09550 3420 2707 gene locus_tag LOCUS_09560 3420 2707 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_09560 3720 3793 gene locus_tag LOCUS_t00140 3720 3793 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5251 4247 gene locus_tag LOCUS_09570 5251 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5912 5268 gene locus_tag LOCUS_09580 5912 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 7561 5909 gene locus_tag LOCUS_09590 7561 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 8369 7638 gene locus_tag LOCUS_09600 8369 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 10788 8413 gene locus_tag LOCUS_09610 10788 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 12105 10903 gene locus_tag LOCUS_09620 12105 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 13410 12469 gene locus_tag LOCUS_09630 13410 12469 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_09630 <14092 13429 gene locus_tag LOCUS_09640 <14092 13429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430704.1:transketolase >Feature sequence052 194 1105 gene locus_tag LOCUS_09650 194 1105 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_09650 1847 1197 gene locus_tag LOCUS_09660 1847 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2104 1847 gene locus_tag LOCUS_09670 2104 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 4172 2121 gene locus_tag LOCUS_09680 4172 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 4421 4176 gene locus_tag LOCUS_09690 4421 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4771 4418 gene locus_tag LOCUS_09700 4771 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 5858 5085 gene locus_tag LOCUS_09710 gene nat 5858 5085 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419364.1 protein_id gnl|my_center|LOCUS_09710 7057 5933 gene locus_tag LOCUS_09720 7057 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7271 9388 gene locus_tag LOCUS_09730 7271 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 9693 9607 gene locus_tag LOCUS_t00150 9693 9607 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11183 9903 gene locus_tag LOCUS_09740 11183 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 11487 12938 gene locus_tag LOCUS_09750 11487 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence053 354 1847 gene locus_tag LOCUS_09760 354 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1872 3041 gene locus_tag LOCUS_09770 1872 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3240 3575 gene locus_tag LOCUS_09780 3240 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3553 4092 gene locus_tag LOCUS_09790 3553 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4089 5090 gene locus_tag LOCUS_09800 4089 5090 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869103.1 protein_id gnl|my_center|LOCUS_09800 5102 6556 gene locus_tag LOCUS_09810 gene miaB 5102 6556 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_09810 6579 7007 gene locus_tag LOCUS_09820 6579 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7041 9632 gene locus_tag LOCUS_09830 gene mutS 7041 9632 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_09830 9664 11745 gene locus_tag LOCUS_09840 gene mutL 9664 11745 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378991.1 protein_id gnl|my_center|LOCUS_09840 11764 12900 gene locus_tag LOCUS_09850 gene tgt 11764 12900 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence054 <1 2209 gene locus_tag LOCUS_09860 <1 2209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459276.1:M56 family metallopeptidase 2318 3868 gene locus_tag LOCUS_09870 2318 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4938 3910 gene locus_tag LOCUS_09880 4938 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5993 4977 gene locus_tag LOCUS_09890 5993 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6410 6063 gene locus_tag LOCUS_09900 6410 6063 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107654.1 protein_id gnl|my_center|LOCUS_09900 6738 6663 gene locus_tag LOCUS_t00160 6738 6663 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7131 6868 gene locus_tag LOCUS_09910 gene rpsT 7131 6868 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358111.1 protein_id gnl|my_center|LOCUS_09910 7427 8641 gene locus_tag LOCUS_09920 7427 8641 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_09920 8670 9332 gene locus_tag LOCUS_09930 gene lepB 8670 9332 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_09930 9371 10246 gene locus_tag LOCUS_09940 gene ylqF 9371 10246 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_09940 10252 10929 gene locus_tag LOCUS_09950 10252 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 10926 11330 gene locus_tag LOCUS_09960 10926 11330 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965070.1 protein_id gnl|my_center|LOCUS_09960 11333 12274 gene locus_tag LOCUS_09970 11333 12274 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence055 495 1463 gene locus_tag LOCUS_09980 gene gldA 495 1463 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_09980 1492 2199 gene locus_tag LOCUS_09990 1492 2199 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_09990 2229 3719 gene locus_tag LOCUS_10000 2229 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3716 5242 gene locus_tag LOCUS_10010 3716 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 6938 5289 gene locus_tag LOCUS_10020 6938 5289 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109250.1 protein_id gnl|my_center|LOCUS_10020 7090 7785 gene locus_tag LOCUS_10030 7090 7785 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_10030 7809 7958 gene locus_tag LOCUS_10040 7809 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 8002 10887 gene locus_tag LOCUS_10050 8002 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 10891 12288 gene locus_tag LOCUS_10060 10891 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence056 677 342 gene locus_tag LOCUS_10070 677 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1434 766 gene locus_tag LOCUS_10080 1434 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1825 2415 gene locus_tag LOCUS_10090 1825 2415 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_10090 4322 2496 gene locus_tag LOCUS_10100 4322 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4524 6023 gene locus_tag LOCUS_10110 4524 6023 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225941989.1 protein_id gnl|my_center|LOCUS_10110 6077 6607 gene locus_tag LOCUS_10120 6077 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 8670 6649 gene locus_tag LOCUS_10130 8670 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 9399 8695 gene locus_tag LOCUS_10140 9399 8695 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_10140 9719 10132 gene locus_tag LOCUS_10150 9719 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10129 10833 gene locus_tag LOCUS_10160 gene trmD 10129 10833 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_10160 11421 10867 gene locus_tag LOCUS_10170 11421 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 11487 12242 gene locus_tag LOCUS_10180 11487 12242 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_10180 12269 12820 gene locus_tag LOCUS_10190 12269 12820 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817527.1 protein_id gnl|my_center|LOCUS_10190 12909 12983 gene locus_tag LOCUS_t00170 12909 12983 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence057 2870 3568 gene locus_tag LOCUS_10200 2870 3568 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_10200 3561 3887 gene locus_tag LOCUS_10210 3561 3887 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052362.1 protein_id gnl|my_center|LOCUS_10210 3970 4641 gene locus_tag LOCUS_10220 3970 4641 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_10220 4664 5365 gene locus_tag LOCUS_10230 4664 5365 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_10230 5587 7515 gene locus_tag LOCUS_10240 5587 7515 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_10240 9166 7574 gene locus_tag LOCUS_10250 9166 7574 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_10250 9580 11958 gene locus_tag LOCUS_10260 9580 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 11955 12716 gene locus_tag LOCUS_10270 11955 12716 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence058 3051 2593 gene locus_tag LOCUS_10280 3051 2593 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905770.1 protein_id gnl|my_center|LOCUS_10280 3234 4319 gene locus_tag LOCUS_10290 3234 4319 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_10290 4381 5142 gene locus_tag LOCUS_10300 4381 5142 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_10300 5154 6326 gene locus_tag LOCUS_10310 5154 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 7093 6350 gene locus_tag LOCUS_10320 7093 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 7195 7422 gene locus_tag LOCUS_10330 7195 7422 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816044.1 protein_id gnl|my_center|LOCUS_10330 7973 7518 gene locus_tag LOCUS_10340 7973 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 8815 8198 gene locus_tag LOCUS_10350 8815 8198 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_10350 9049 8828 gene locus_tag LOCUS_10360 9049 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 9851 9090 gene locus_tag LOCUS_10370 9851 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 11310 9928 gene locus_tag LOCUS_10380 gene radA 11310 9928 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_10380 12010 11411 gene locus_tag LOCUS_10390 gene cwlD 12010 11411 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence059 824 748 gene locus_tag LOCUS_t00180 824 748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 995 2044 gene locus_tag LOCUS_10400 995 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3312 2152 gene locus_tag LOCUS_10410 3312 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4537 3473 gene locus_tag LOCUS_10420 4537 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5493 4627 gene locus_tag LOCUS_10430 5493 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 5693 7921 gene locus_tag LOCUS_10440 5693 7921 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_10440 7934 8845 gene locus_tag LOCUS_10450 7934 8845 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_10450 9397 9002 gene locus_tag LOCUS_10460 9397 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 10709 9444 gene locus_tag LOCUS_10470 10709 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 <12885 10699 gene locus_tag LOCUS_10480 <12885 10699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722316.1:ABC transporter ATP-binding protein >Feature sequence060 431 1219 gene locus_tag LOCUS_10490 431 1219 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369696.1 protein_id gnl|my_center|LOCUS_10490 1310 2413 gene locus_tag LOCUS_10500 1310 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5521 2489 gene locus_tag LOCUS_10510 5521 2489 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082402.1 protein_id gnl|my_center|LOCUS_10510 6520 5534 gene locus_tag LOCUS_10520 6520 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 7490 6513 gene locus_tag LOCUS_10530 7490 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_10530 8254 7481 gene locus_tag LOCUS_10540 8254 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 9194 8457 gene locus_tag LOCUS_10550 9194 8457 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_10550 11297 9276 gene locus_tag LOCUS_10560 11297 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 <12843 11311 gene locus_tag LOCUS_10570 <12843 11311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288607.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence061 450 2102 gene locus_tag LOCUS_10580 450 2102 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129256806.1 protein_id gnl|my_center|LOCUS_10580 2806 2144 gene locus_tag LOCUS_10590 2806 2144 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896673.1 protein_id gnl|my_center|LOCUS_10590 2973 3695 gene locus_tag LOCUS_10600 2973 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4851 3754 gene locus_tag LOCUS_10610 4851 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5716 4868 gene locus_tag LOCUS_10620 5716 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6737 5718 gene locus_tag LOCUS_10630 6737 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8937 6841 gene locus_tag LOCUS_10640 8937 6841 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_10640 10473 8950 gene locus_tag LOCUS_10650 gene xylB 10473 8950 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_10650 10693 11562 gene locus_tag LOCUS_10660 10693 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 11564 12415 gene locus_tag LOCUS_10670 11564 12415 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence062 3 1373 gene locus_tag LOCUS_10680 3 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2353 1433 gene locus_tag LOCUS_10690 2353 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2463 3167 gene locus_tag LOCUS_10700 2463 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 3447 3638 gene locus_tag LOCUS_10710 3447 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3823 4692 gene locus_tag LOCUS_10720 3823 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 5372 4767 gene locus_tag LOCUS_10730 5372 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 5946 5350 gene locus_tag LOCUS_10740 5946 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 6190 7029 gene locus_tag LOCUS_10750 6190 7029 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922568.1 protein_id gnl|my_center|LOCUS_10750 7111 7788 gene locus_tag LOCUS_10760 7111 7788 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_10760 7782 9017 gene locus_tag LOCUS_10770 7782 9017 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_10770 9146 9874 gene locus_tag LOCUS_10780 9146 9874 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_10780 9867 10538 gene locus_tag LOCUS_10790 9867 10538 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_10790 10778 10584 gene locus_tag LOCUS_10800 10778 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 12152 10800 gene locus_tag LOCUS_10810 12152 10800 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_10810 <12783 12156 gene locus_tag LOCUS_10820 <12783 12156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000878896.1:ketose-bisphosphate aldolase >Feature sequence063 1095 2177 gene locus_tag LOCUS_10830 1095 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2208 2756 gene locus_tag LOCUS_10840 2208 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3101 3844 gene locus_tag LOCUS_10850 3101 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 3861 4598 gene locus_tag LOCUS_10860 3861 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4659 5672 gene locus_tag LOCUS_10870 gene pheS 4659 5672 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_10870 5892 8306 gene locus_tag LOCUS_10880 gene pheT 5892 8306 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_10880 8318 8893 gene locus_tag LOCUS_10890 8318 8893 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_10890 8957 9511 gene locus_tag LOCUS_10900 8957 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 10336 9557 gene locus_tag LOCUS_10910 10336 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10916 10338 gene locus_tag LOCUS_10920 10916 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 11100 11645 gene locus_tag LOCUS_10930 11100 11645 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_10930 11707 11889 gene locus_tag LOCUS_10940 gene rpmF 11707 11889 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence064 <1 212 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq caccaccatcaccacgacga 214 483 gene locus_tag LOCUS_10950 214 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 501 1445 gene locus_tag LOCUS_10960 501 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1445 2425 gene locus_tag LOCUS_10970 1445 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2415 2951 gene locus_tag LOCUS_10980 2415 2951 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689851.1 protein_id gnl|my_center|LOCUS_10980 2972 3616 gene locus_tag LOCUS_10990 2972 3616 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_10990 4169 3678 gene locus_tag LOCUS_11000 4169 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5226 4300 gene locus_tag LOCUS_11010 5226 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5430 6548 gene locus_tag LOCUS_11020 5430 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11020 6554 7276 gene locus_tag LOCUS_11030 6554 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11030 7273 8385 gene locus_tag LOCUS_11040 7273 8385 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259713.1 protein_id gnl|my_center|LOCUS_11040 8948 9433 gene locus_tag LOCUS_11050 8948 9433 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_11050 9894 10616 gene locus_tag LOCUS_11060 9894 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence065 92 1879 gene locus_tag LOCUS_11070 92 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1893 3332 gene locus_tag LOCUS_11080 1893 3332 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016943.1 protein_id gnl|my_center|LOCUS_11080 4459 3599 gene locus_tag LOCUS_11090 4459 3599 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_11090 4662 4985 gene locus_tag LOCUS_11100 4662 4985 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827865.1 protein_id gnl|my_center|LOCUS_11100 4982 5524 gene locus_tag LOCUS_11110 4982 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6749 5589 gene locus_tag LOCUS_11120 6749 5589 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169508.1 protein_id gnl|my_center|LOCUS_11120 7642 6782 gene locus_tag LOCUS_11130 7642 6782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 7853 8740 gene locus_tag LOCUS_11140 7853 8740 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_11140 8767 10467 gene locus_tag LOCUS_11150 8767 10467 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723060.1 protein_id gnl|my_center|LOCUS_11150 11984 10542 gene locus_tag LOCUS_11160 11984 10542 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence066 1094 1468 gene locus_tag LOCUS_11170 1094 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1599 3071 gene locus_tag LOCUS_11180 1599 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 3886 3170 gene locus_tag LOCUS_11190 3886 3170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895525.1 protein_id gnl|my_center|LOCUS_11190 5524 3911 gene locus_tag LOCUS_11200 5524 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6742 5963 gene locus_tag LOCUS_11210 6742 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7871 6807 gene locus_tag LOCUS_11220 7871 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 8529 7879 gene locus_tag LOCUS_11230 8529 7879 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518847.1 protein_id gnl|my_center|LOCUS_11230 9011 8532 gene locus_tag LOCUS_11240 9011 8532 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_11240 10357 9008 gene locus_tag LOCUS_11250 10357 9008 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_11250 10951 10385 gene locus_tag LOCUS_11260 10951 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11452 10961 gene locus_tag LOCUS_11270 11452 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 11661 11834 gene locus_tag LOCUS_11280 11661 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence067 396 1238 gene locus_tag LOCUS_11290 gene mreC 396 1238 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135485.1 protein_id gnl|my_center|LOCUS_11290 1216 1875 gene locus_tag LOCUS_11300 1216 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1898 3991 gene locus_tag LOCUS_11310 1898 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4004 6103 gene locus_tag LOCUS_11320 4004 6103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7230 6238 gene locus_tag LOCUS_11330 7230 6238 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_11330 8767 7316 gene locus_tag LOCUS_11340 8767 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8901 9728 gene locus_tag LOCUS_11350 8901 9728 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_11350 9865 11541 gene locus_tag LOCUS_11360 9865 11541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence068 3186 898 gene locus_tag LOCUS_11370 3186 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3356 4336 gene locus_tag LOCUS_11380 3356 4336 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_11380 6683 4383 gene locus_tag LOCUS_11390 6683 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 7886 6702 gene locus_tag LOCUS_11400 7886 6702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104266.1 protein_id gnl|my_center|LOCUS_11400 9576 7894 gene locus_tag LOCUS_11410 9576 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 9751 11727 gene locus_tag LOCUS_11420 9751 11727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence069 1350 520 gene locus_tag LOCUS_11430 1350 520 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_11430 2371 1337 gene locus_tag LOCUS_11440 2371 1337 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_11440 3335 2364 gene locus_tag LOCUS_11450 3335 2364 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_11450 3757 3323 gene locus_tag LOCUS_11460 3757 3323 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_11460 5742 3748 gene locus_tag LOCUS_11470 5742 3748 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_11470 6145 5759 gene locus_tag LOCUS_11480 6145 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6936 6157 gene locus_tag LOCUS_11490 6936 6157 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_11490 8332 6956 gene locus_tag LOCUS_11500 gene fumC 8332 6956 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_11500 9309 8365 gene locus_tag LOCUS_11510 9309 8365 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_11510 10556 9624 gene locus_tag LOCUS_11520 gene cysK 10556 9624 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_11520 11407 10595 gene locus_tag LOCUS_11530 11407 10595 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721653.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence070 2514 73 gene locus_tag LOCUS_11540 2514 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5016 2632 gene locus_tag LOCUS_11550 5016 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 6121 5144 gene locus_tag LOCUS_11560 gene pfkA 6121 5144 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_11560 7720 6137 gene locus_tag LOCUS_11570 7720 6137 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_11570 8162 7794 gene locus_tag LOCUS_11580 8162 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 8330 9436 gene locus_tag LOCUS_11590 8330 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10757 9480 gene locus_tag LOCUS_11600 10757 9480 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_11600 10895 11113 gene locus_tag LOCUS_11610 10895 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence071 941 183 gene locus_tag LOCUS_11620 941 183 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529695.1 protein_id gnl|my_center|LOCUS_11620 2554 1232 gene locus_tag LOCUS_11630 2554 1232 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_11630 2704 3501 gene locus_tag LOCUS_11640 2704 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4396 3551 gene locus_tag LOCUS_11650 4396 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5824 4520 gene locus_tag LOCUS_11660 5824 4520 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_11660 7416 5806 gene locus_tag LOCUS_11670 7416 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 8128 7409 gene locus_tag LOCUS_11680 gene deoD 8128 7409 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_11680 8318 9283 gene locus_tag LOCUS_11690 8318 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 9301 10098 gene locus_tag LOCUS_11700 9301 10098 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_11700 10098 10889 gene locus_tag LOCUS_11710 10098 10889 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence072 <1 875 gene locus_tag LOCUS_11720 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860945.1:extracellular solute-binding protein 875 2209 gene locus_tag LOCUS_11730 875 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2265 3440 gene locus_tag LOCUS_11740 2265 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 5384 3675 gene locus_tag LOCUS_11750 5384 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 6256 5426 gene locus_tag LOCUS_11760 6256 5426 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_11760 6980 6456 gene locus_tag LOCUS_11770 6980 6456 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365476.1 protein_id gnl|my_center|LOCUS_11770 8616 7060 gene locus_tag LOCUS_11780 8616 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 9516 8788 gene locus_tag LOCUS_11790 gene ugpQ 9516 8788 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815363.1 protein_id gnl|my_center|LOCUS_11790 10352 9609 gene locus_tag LOCUS_11800 10352 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence073 1470 835 gene locus_tag LOCUS_11810 1470 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2521 1457 gene locus_tag LOCUS_11820 2521 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2897 2523 gene locus_tag LOCUS_11830 gene mgsA 2897 2523 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684761.1 protein_id gnl|my_center|LOCUS_11830 3128 4486 gene locus_tag LOCUS_11840 3128 4486 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_11840 4549 5304 gene locus_tag LOCUS_11850 4549 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 5349 5831 gene locus_tag LOCUS_11860 5349 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5828 6379 gene locus_tag LOCUS_11870 5828 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 6609 6394 gene locus_tag LOCUS_11880 6609 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 6771 8654 gene locus_tag LOCUS_11890 6771 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 9008 9481 gene locus_tag LOCUS_11900 gene purE 9008 9481 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_11900 9522 10949 gene locus_tag LOCUS_11910 9522 10949 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence074 1435 689 gene locus_tag LOCUS_11920 gene rnc 1435 689 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_11920 2456 1416 gene locus_tag LOCUS_11930 gene plsX 2456 1416 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_11930 3822 2509 gene locus_tag LOCUS_11940 gene trmFO 3822 2509 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_11940 6104 3828 gene locus_tag LOCUS_11950 gene topA 6104 3828 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_11950 7556 6174 gene locus_tag LOCUS_11960 7556 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 8420 7578 gene locus_tag LOCUS_11970 8420 7578 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_11970 8851 8498 gene locus_tag LOCUS_11980 gene rplT 8851 8498 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_11980 9095 8901 gene locus_tag LOCUS_11990 gene rpmI 9095 8901 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112988.1 protein_id gnl|my_center|LOCUS_11990 9663 9157 gene locus_tag LOCUS_12000 gene infC 9663 9157 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_12000 10006 10668 gene locus_tag LOCUS_12010 10006 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence075 399 611 gene locus_tag LOCUS_12020 399 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1836 763 gene locus_tag LOCUS_12030 1836 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2844 1840 gene locus_tag LOCUS_12040 2844 1840 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083301.1 protein_id gnl|my_center|LOCUS_12040 3920 2862 gene locus_tag LOCUS_12050 3920 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4906 4010 gene locus_tag LOCUS_12060 4906 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 5071 5925 gene locus_tag LOCUS_12070 5071 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 6007 7107 gene locus_tag LOCUS_12080 6007 7107 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_12080 8348 7149 gene locus_tag LOCUS_12090 8348 7149 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_12090 8970 8410 gene locus_tag LOCUS_12100 8970 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence076 399 1367 gene locus_tag LOCUS_12110 399 1367 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989909.1 protein_id gnl|my_center|LOCUS_12110 2101 1433 gene locus_tag LOCUS_12120 2101 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3416 2250 gene locus_tag LOCUS_12130 3416 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3560 5410 gene locus_tag LOCUS_12140 3560 5410 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_12140 5465 6859 gene locus_tag LOCUS_12150 5465 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6856 7536 gene locus_tag LOCUS_12160 6856 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 9015 7618 gene locus_tag LOCUS_12170 9015 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9421 9002 gene locus_tag LOCUS_12180 9421 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 9583 10071 gene locus_tag LOCUS_12190 9583 10071 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_12190 10249 10324 gene locus_tag LOCUS_t00190 10249 10324 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 298 1848 gene locus_tag LOCUS_12200 298 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3309 1894 gene locus_tag LOCUS_12210 3309 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3431 4213 gene locus_tag LOCUS_12220 3431 4213 CDS product AraC family ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000959952.1 protein_id gnl|my_center|LOCUS_12220 5572 4232 gene locus_tag LOCUS_12230 5572 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5806 7203 gene locus_tag LOCUS_12240 5806 7203 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_12240 7284 8369 gene locus_tag LOCUS_12250 7284 8369 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_12250 8383 9201 gene locus_tag LOCUS_12260 8383 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 9268 10020 gene locus_tag LOCUS_12270 9268 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence078 270 2738 gene locus_tag LOCUS_12280 270 2738 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_12280 2888 3958 gene locus_tag LOCUS_12290 2888 3958 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029843.1 protein_id gnl|my_center|LOCUS_12290 3955 5487 gene locus_tag LOCUS_12300 3955 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5546 6502 gene locus_tag LOCUS_12310 5546 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6612 6959 gene locus_tag LOCUS_12320 6612 6959 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_12320 6922 7539 gene locus_tag LOCUS_12330 6922 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 7536 8369 gene locus_tag LOCUS_12340 7536 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 9795 8410 gene locus_tag LOCUS_12350 9795 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10150 9809 gene locus_tag LOCUS_12360 10150 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence079 111 992 gene locus_tag LOCUS_12370 111 992 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_12370 1001 1456 gene locus_tag LOCUS_12380 1001 1456 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_12380 1695 2702 gene locus_tag LOCUS_12390 1695 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4463 2796 gene locus_tag LOCUS_12400 4463 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4398 4613 gene locus_tag LOCUS_12410 4398 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5835 4600 gene locus_tag LOCUS_12420 5835 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6387 5929 gene locus_tag LOCUS_12430 6387 5929 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837587.1 protein_id gnl|my_center|LOCUS_12430 8068 6389 gene locus_tag LOCUS_12440 8068 6389 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_12440 9558 8065 gene locus_tag LOCUS_12450 9558 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 10256 9555 gene locus_tag LOCUS_12460 10256 9555 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_12460 10482 10276 gene locus_tag LOCUS_12470 10482 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence080 475 1971 gene locus_tag LOCUS_12480 475 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2102 3484 gene locus_tag LOCUS_12490 2102 3484 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_12490 3596 4786 gene locus_tag LOCUS_12500 3596 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4866 6410 gene locus_tag LOCUS_12510 4866 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 6421 7737 gene locus_tag LOCUS_12520 6421 7737 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_12520 <10325 7926 gene locus_tag LOCUS_12530 <10325 7926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582581.1:glycosyl hydrolase >Feature sequence081 423 2804 gene locus_tag LOCUS_12540 gene galB 423 2804 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_12540 3200 2865 gene locus_tag LOCUS_12550 3200 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3416 3204 gene locus_tag LOCUS_12560 3416 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4536 3430 gene locus_tag LOCUS_12570 4536 3430 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095405.1 protein_id gnl|my_center|LOCUS_12570 4703 6592 gene locus_tag LOCUS_12580 4703 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 7428 6640 gene locus_tag LOCUS_12590 7428 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7558 8943 gene locus_tag LOCUS_12600 7558 8943 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989199.1 protein_id gnl|my_center|LOCUS_12600 9752 9033 gene locus_tag LOCUS_12610 9752 9033 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence082 704 246 gene locus_tag LOCUS_12620 704 246 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064908.1 protein_id gnl|my_center|LOCUS_12620 850 2073 gene locus_tag LOCUS_12630 850 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2151 2227 gene locus_tag LOCUS_t00200 2151 2227 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2289 3710 gene locus_tag LOCUS_12640 2289 3710 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_12640 4396 3758 gene locus_tag LOCUS_12650 4396 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 5069 4410 gene locus_tag LOCUS_12660 5069 4410 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_12660 6061 5117 gene locus_tag LOCUS_12670 6061 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 7211 6063 gene locus_tag LOCUS_12680 7211 6063 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083303.1 protein_id gnl|my_center|LOCUS_12680 7404 8291 gene locus_tag LOCUS_12690 7404 8291 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_12690 8490 9371 gene locus_tag LOCUS_12700 8490 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9915 9484 gene locus_tag LOCUS_12710 9915 9484 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence083 912 64 gene locus_tag LOCUS_12720 912 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3360 1021 gene locus_tag LOCUS_12730 3360 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3570 4367 gene locus_tag LOCUS_12740 3570 4367 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_12740 4464 5111 gene locus_tag LOCUS_12750 4464 5111 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_12750 5125 5979 gene locus_tag LOCUS_12760 5125 5979 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_12760 6112 6996 gene locus_tag LOCUS_12770 6112 6996 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_12770 6993 7652 gene locus_tag LOCUS_12780 6993 7652 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_12780 7736 8764 gene locus_tag LOCUS_12790 7736 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 8820 9239 gene locus_tag LOCUS_12800 8820 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 9236 10078 gene locus_tag LOCUS_12810 9236 10078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12810 >Feature sequence084 1938 829 gene locus_tag LOCUS_12820 1938 829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_12820 2479 3357 gene locus_tag LOCUS_12830 2479 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 4256 3387 gene locus_tag LOCUS_12840 4256 3387 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_12840 4456 5637 gene locus_tag LOCUS_12850 4456 5637 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808433.1 protein_id gnl|my_center|LOCUS_12850 5747 6637 gene locus_tag LOCUS_12860 gene ispE 5747 6637 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140106.1 protein_id gnl|my_center|LOCUS_12860 8737 7310 gene locus_tag LOCUS_12870 8737 7310 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811050.1 protein_id gnl|my_center|LOCUS_12870 9962 8847 gene locus_tag LOCUS_12880 9962 8847 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence085 138 986 gene locus_tag LOCUS_12890 gene prmC 138 986 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337836.1 protein_id gnl|my_center|LOCUS_12890 998 2080 gene locus_tag LOCUS_12900 998 2080 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_12900 2201 2425 gene locus_tag LOCUS_12910 2201 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3212 2625 gene locus_tag LOCUS_12920 3212 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3935 3246 gene locus_tag LOCUS_12930 3935 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12930 4892 3957 gene locus_tag LOCUS_12940 gene ribF 4892 3957 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_12940 5191 4934 gene locus_tag LOCUS_12950 5191 4934 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_12950 5413 6543 gene locus_tag LOCUS_12960 5413 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 8077 6596 gene locus_tag LOCUS_12970 8077 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 8273 9082 gene locus_tag LOCUS_12980 8273 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence086 490 1578 gene locus_tag LOCUS_12990 490 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 2914 1631 gene locus_tag LOCUS_13000 2914 1631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_13000 5663 2994 gene locus_tag LOCUS_13010 5663 2994 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183697638.1 protein_id gnl|my_center|LOCUS_13010 5844 6950 gene locus_tag LOCUS_13020 5844 6950 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392810.1 protein_id gnl|my_center|LOCUS_13020 7824 7150 gene locus_tag LOCUS_13030 7824 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 9286 8051 gene locus_tag LOCUS_13040 9286 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 9453 9803 gene locus_tag LOCUS_13050 9453 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence087 2775 349 gene locus_tag LOCUS_13060 2775 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3125 5653 gene locus_tag LOCUS_13070 3125 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5679 7520 gene locus_tag LOCUS_13080 gene dxs 5679 7520 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460263.1 protein_id gnl|my_center|LOCUS_13080 8862 7957 gene locus_tag LOCUS_13090 8862 7957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 9229 8900 gene locus_tag LOCUS_13100 9229 8900 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_13100 9367 9825 gene locus_tag LOCUS_13110 9367 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence088 833 1288 gene locus_tag LOCUS_13120 833 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1299 2204 gene locus_tag LOCUS_13130 1299 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3026 2253 gene locus_tag LOCUS_13140 gene spo0A 3026 2253 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_13140 3207 4697 gene locus_tag LOCUS_13150 3207 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 4684 6231 gene locus_tag LOCUS_13160 4684 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7947 6280 gene locus_tag LOCUS_13170 7947 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 9053 8013 gene locus_tag LOCUS_13180 9053 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 9802 9170 gene locus_tag LOCUS_13190 9802 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence089 1674 541 gene locus_tag LOCUS_13200 1674 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1961 2302 gene locus_tag LOCUS_13210 gene rplS 1961 2302 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_13210 2369 3508 gene locus_tag LOCUS_13220 2369 3508 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_13220 3842 5191 gene locus_tag LOCUS_13230 3842 5191 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_13230 5188 6378 gene locus_tag LOCUS_13240 5188 6378 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_13240 6480 6890 gene locus_tag LOCUS_13250 6480 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 7834 6968 gene locus_tag LOCUS_13260 7834 6968 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017864718.1 protein_id gnl|my_center|LOCUS_13260 8032 8229 gene locus_tag LOCUS_13270 8032 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8395 9462 gene locus_tag LOCUS_13280 8395 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence090 1038 2270 gene locus_tag LOCUS_13290 1038 2270 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_13290 2310 2513 gene locus_tag LOCUS_13300 2310 2513 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_13300 2573 3295 gene locus_tag LOCUS_13310 2573 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3292 4065 gene locus_tag LOCUS_13320 3292 4065 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_13320 4659 4111 gene locus_tag LOCUS_13330 4659 4111 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081283.1 protein_id gnl|my_center|LOCUS_13330 5285 4665 gene locus_tag LOCUS_13340 5285 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_13340 6379 5300 gene locus_tag LOCUS_13350 6379 5300 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_13350 6568 7311 gene locus_tag LOCUS_13360 6568 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 7483 9501 gene locus_tag LOCUS_13370 7483 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence091 323 3679 gene locus_tag LOCUS_13380 gene smc 323 3679 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_13380 3701 3919 gene locus_tag LOCUS_13390 3701 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13390 3944 4885 gene locus_tag LOCUS_13400 gene ftsY 3944 4885 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_13400 4882 5556 gene locus_tag LOCUS_13410 4882 5556 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_13410 5563 5850 gene locus_tag LOCUS_13420 gene yhbY 5563 5850 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_13420 5853 6488 gene locus_tag LOCUS_13430 gene nadD 5853 6488 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296447.1 protein_id gnl|my_center|LOCUS_13430 6502 7140 gene locus_tag LOCUS_13440 gene yqeK 6502 7140 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_13440 7222 8394 gene locus_tag LOCUS_13450 7222 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 8396 8812 gene locus_tag LOCUS_13460 gene rsfS 8396 8812 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898109.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence092 3038 1311 gene locus_tag LOCUS_13470 3038 1311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_13470 4121 3162 gene locus_tag LOCUS_13480 4121 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 5591 4131 gene locus_tag LOCUS_13490 5591 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 6467 5604 gene locus_tag LOCUS_13500 6467 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 7615 6476 gene locus_tag LOCUS_13510 7615 6476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_13510 7964 8896 gene locus_tag LOCUS_13520 7964 8896 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_13520 9547 8951 gene locus_tag LOCUS_13530 9547 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence093 288 1139 gene locus_tag LOCUS_13540 288 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2273 1200 gene locus_tag LOCUS_13550 gene uxuA 2273 1200 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_13550 3324 2515 gene locus_tag LOCUS_13560 3324 2515 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_13560 4159 3353 gene locus_tag LOCUS_13570 4159 3353 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_13570 4977 4216 gene locus_tag LOCUS_13580 4977 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5242 5057 gene locus_tag LOCUS_13590 gene rpmB 5242 5057 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_13590 6520 5348 gene locus_tag LOCUS_13600 6520 5348 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_13600 6996 6520 gene locus_tag LOCUS_13610 6996 6520 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_13610 8641 7022 gene locus_tag LOCUS_13620 8641 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9141 8671 gene locus_tag LOCUS_13630 9141 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9477 9301 gene locus_tag LOCUS_13640 9477 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence094 17 2158 gene locus_tag LOCUS_13650 17 2158 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_13650 3880 2213 gene locus_tag LOCUS_13660 3880 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 4055 4609 gene locus_tag LOCUS_13670 4055 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 4732 6744 gene locus_tag LOCUS_13680 4732 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence095 <1 1738 gene locus_tag LOCUS_13690 <1 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003566883.1:asparagine synthase (glutamine-hydrolyzing) 1767 2993 gene locus_tag LOCUS_13700 1767 2993 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906398.1 protein_id gnl|my_center|LOCUS_13700 3006 3752 gene locus_tag LOCUS_13710 3006 3752 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_13710 3779 4981 gene locus_tag LOCUS_13720 3779 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5008 6522 gene locus_tag LOCUS_13730 5008 6522 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_13730 7108 6575 gene locus_tag LOCUS_13740 7108 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 7951 7202 gene locus_tag LOCUS_13750 7951 7202 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721237.1 protein_id gnl|my_center|LOCUS_13750 9338 7938 gene locus_tag LOCUS_13760 9338 7938 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence096 2062 74 gene locus_tag LOCUS_13770 2062 74 CDS product pyruvate formate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797468.1 protein_id gnl|my_center|LOCUS_13770 2244 2657 gene locus_tag LOCUS_13780 gene fur 2244 2657 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814098.1 protein_id gnl|my_center|LOCUS_13780 2670 3605 gene locus_tag LOCUS_13790 2670 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3605 4315 gene locus_tag LOCUS_13800 3605 4315 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_13800 4308 5132 gene locus_tag LOCUS_13810 4308 5132 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_13810 5129 6142 gene locus_tag LOCUS_13820 5129 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 7310 6177 gene locus_tag LOCUS_13830 7310 6177 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_13830 7540 7307 gene locus_tag LOCUS_13840 7540 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 8577 7606 gene locus_tag LOCUS_13850 8577 7606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence097 367 978 gene locus_tag LOCUS_13860 gene thiT 367 978 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228966.1 protein_id gnl|my_center|LOCUS_13860 1367 2893 gene locus_tag LOCUS_13870 1367 2893 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_13870 3814 2987 gene locus_tag LOCUS_13880 3814 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3949 5457 gene locus_tag LOCUS_13890 3949 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 5569 6489 gene locus_tag LOCUS_13900 5569 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145860136.1 protein_id gnl|my_center|LOCUS_13900 6486 6902 gene locus_tag LOCUS_13910 6486 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6917 8599 gene locus_tag LOCUS_13920 6917 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 8696 9121 gene locus_tag LOCUS_13930 8696 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence098 1849 50 gene locus_tag LOCUS_13940 1849 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3410 1914 gene locus_tag LOCUS_13950 3410 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3578 4450 gene locus_tag LOCUS_13960 3578 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4597 6120 gene locus_tag LOCUS_13970 4597 6120 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_13970 6124 6804 gene locus_tag LOCUS_13980 6124 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6804 7529 gene locus_tag LOCUS_13990 6804 7529 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728586.1 protein_id gnl|my_center|LOCUS_13990 7526 8503 gene locus_tag LOCUS_14000 7526 8503 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence099 1634 2182 gene locus_tag LOCUS_14010 1634 2182 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_14010 2179 2742 gene locus_tag LOCUS_14020 2179 2742 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_14020 3407 2784 gene locus_tag LOCUS_14030 gene pcp 3407 2784 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_14030 6125 3591 gene locus_tag LOCUS_14040 6125 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6950 6228 gene locus_tag LOCUS_14050 6950 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 7507 6947 gene locus_tag LOCUS_14060 7507 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 8075 7542 gene locus_tag LOCUS_14070 8075 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8150 8785 gene locus_tag LOCUS_14080 8150 8785 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence100 3218 1731 gene locus_tag LOCUS_14090 3218 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4275 3265 gene locus_tag LOCUS_14100 4275 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 6539 4272 gene locus_tag LOCUS_14110 6539 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 8260 6656 gene locus_tag LOCUS_14120 8260 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence101 2162 237 gene locus_tag LOCUS_14130 2162 237 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_14130 3566 2334 gene locus_tag LOCUS_14140 3566 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4336 3602 gene locus_tag LOCUS_14150 4336 3602 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_14150 4577 4350 gene locus_tag LOCUS_14160 4577 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 5492 4590 gene locus_tag LOCUS_14170 5492 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 6719 5571 gene locus_tag LOCUS_14180 6719 5571 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_14180 7571 6762 gene locus_tag LOCUS_14190 7571 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 7919 8131 gene locus_tag LOCUS_14200 7919 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 8104 8415 gene locus_tag LOCUS_14210 gene rpsJ 8104 8415 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence102 3435 2062 gene locus_tag LOCUS_14220 gene lpdA 3435 2062 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797088.1 protein_id gnl|my_center|LOCUS_14220 4764 3448 gene locus_tag LOCUS_14230 4764 3448 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389632.1 protein_id gnl|my_center|LOCUS_14230 5625 4846 gene locus_tag LOCUS_14240 5625 4846 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208861.1 protein_id gnl|my_center|LOCUS_14240 7237 5822 gene locus_tag LOCUS_14250 gene murC 7237 5822 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_14250 7425 7733 gene locus_tag LOCUS_14260 gene spoVG 7425 7733 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_14260 <8562 7804 gene locus_tag LOCUS_14270 <8562 7804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357457.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence103 1691 12 gene locus_tag LOCUS_14280 1691 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4171 1739 gene locus_tag LOCUS_14290 4171 1739 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_14290 5061 4186 gene locus_tag LOCUS_14300 gene metF 5061 4186 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_14300 6627 5095 gene locus_tag LOCUS_14310 6627 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7043 6873 gene locus_tag LOCUS_14320 7043 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 7164 7643 gene locus_tag LOCUS_14330 7164 7643 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence104 2646 1831 gene locus_tag LOCUS_14340 2646 1831 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_14340 3513 2668 gene locus_tag LOCUS_14350 3513 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4375 3527 gene locus_tag LOCUS_14360 4375 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4580 5605 gene locus_tag LOCUS_14370 4580 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 5953 6915 gene locus_tag LOCUS_14380 5953 6915 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 protein_id gnl|my_center|LOCUS_14380 6926 7207 gene locus_tag LOCUS_14390 6926 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 7221 8168 gene locus_tag LOCUS_14400 7221 8168 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227672.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence105 837 2627 gene locus_tag LOCUS_14410 837 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 7923 2716 gene locus_tag LOCUS_14420 7923 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence106 1431 265 gene locus_tag LOCUS_14430 1431 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 1788 2648 gene locus_tag LOCUS_14440 1788 2648 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_14440 2890 2759 gene locus_tag LOCUS_14450 2890 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3652 3011 gene locus_tag LOCUS_14460 3652 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3975 3724 gene locus_tag LOCUS_14470 3975 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3868 6282 gene locus_tag LOCUS_14480 3868 6282 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396915.1 protein_id gnl|my_center|LOCUS_14480 7212 6322 gene locus_tag LOCUS_14490 7212 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence107 557 1126 gene locus_tag LOCUS_14500 557 1126 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_14500 1165 1968 gene locus_tag LOCUS_14510 1165 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2046 3527 gene locus_tag LOCUS_14520 2046 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3702 3917 gene locus_tag LOCUS_14530 3702 3917 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809912.1 protein_id gnl|my_center|LOCUS_14530 3904 4347 gene locus_tag LOCUS_14540 3904 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809910.1 protein_id gnl|my_center|LOCUS_14540 4469 5848 gene locus_tag LOCUS_14550 gene hisS 4469 5848 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_14550 5850 6215 gene locus_tag LOCUS_14560 5850 6215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 6251 7492 gene locus_tag LOCUS_14570 6251 7492 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence108 185 1144 gene locus_tag LOCUS_14580 185 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1205 3118 gene locus_tag LOCUS_14590 1205 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4400 3180 gene locus_tag LOCUS_14600 gene pepT 4400 3180 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_14600 4556 5563 gene locus_tag LOCUS_14610 4556 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5577 6659 gene locus_tag LOCUS_14620 5577 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 7218 6715 gene locus_tag LOCUS_14630 gene greA 7218 6715 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence109 48 833 gene locus_tag LOCUS_14640 48 833 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272204.1 protein_id gnl|my_center|LOCUS_14640 849 1334 gene locus_tag LOCUS_14650 849 1334 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_14650 1344 2027 gene locus_tag LOCUS_14660 1344 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2782 2111 gene locus_tag LOCUS_14670 2782 2111 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066690.1 protein_id gnl|my_center|LOCUS_14670 3021 3710 gene locus_tag LOCUS_14680 gene pnuC 3021 3710 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_14680 4993 3761 gene locus_tag LOCUS_14690 4993 3761 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_14690 5553 5071 gene locus_tag LOCUS_14700 5553 5071 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337765.1 protein_id gnl|my_center|LOCUS_14700 6926 5628 gene locus_tag LOCUS_14710 6926 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7061 7822 gene locus_tag LOCUS_14720 7061 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence110 <1 1235 gene locus_tag LOCUS_14730 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682090.1:M18 family aminopeptidase 1248 2489 gene locus_tag LOCUS_14740 1248 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4868 2667 gene locus_tag LOCUS_14750 4868 2667 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_14750 6193 4865 gene locus_tag LOCUS_14760 6193 4865 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_14760 7600 6206 gene locus_tag LOCUS_14770 7600 6206 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence111 1471 452 gene locus_tag LOCUS_14780 1471 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2061 1519 gene locus_tag LOCUS_14790 2061 1519 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_14790 2369 3547 gene locus_tag LOCUS_14800 gene nagA 2369 3547 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074509.1 protein_id gnl|my_center|LOCUS_14800 3567 5519 gene locus_tag LOCUS_14810 gene metG 3567 5519 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_14810 5519 6307 gene locus_tag LOCUS_14820 5519 6307 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_14820 6703 6347 gene locus_tag LOCUS_14830 6703 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence112 <1 1060 gene locus_tag LOCUS_14840 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203202.1:alpha-L-fucosidase 1760 1608 gene locus_tag LOCUS_14850 1760 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2681 1836 gene locus_tag LOCUS_14860 2681 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3054 4052 gene locus_tag LOCUS_14870 3054 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 4074 6320 gene locus_tag LOCUS_14880 4074 6320 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027130.1 protein_id gnl|my_center|LOCUS_14880 7775 6363 gene locus_tag LOCUS_14890 7775 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence113 1 762 gene locus_tag LOCUS_14900 1 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 762 1469 gene locus_tag LOCUS_14910 762 1469 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900216.1 protein_id gnl|my_center|LOCUS_14910 1487 2443 gene locus_tag LOCUS_14920 gene murB 1487 2443 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674346.1 protein_id gnl|my_center|LOCUS_14920 2436 3170 gene locus_tag LOCUS_14930 2436 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 3195 6773 gene locus_tag LOCUS_14940 3195 6773 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_14940 7146 6775 gene locus_tag LOCUS_14950 7146 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence114 1192 74 gene locus_tag LOCUS_14960 1192 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1905 1438 gene locus_tag LOCUS_14970 1905 1438 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405734.1 protein_id gnl|my_center|LOCUS_14970 3569 1902 gene locus_tag LOCUS_14980 3569 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4220 3672 gene locus_tag LOCUS_14990 4220 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 5327 4257 gene locus_tag LOCUS_15000 5327 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 5522 6823 gene locus_tag LOCUS_15010 5522 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 6969 7796 gene locus_tag LOCUS_15020 6969 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence115 738 226 gene locus_tag LOCUS_15030 738 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 972 1460 gene locus_tag LOCUS_15040 972 1460 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_15040 1470 2114 gene locus_tag LOCUS_15050 1470 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2111 2563 gene locus_tag LOCUS_15060 gene rimI 2111 2563 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_15060 2580 3638 gene locus_tag LOCUS_15070 gene tsaD 2580 3638 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830015.1 protein_id gnl|my_center|LOCUS_15070 3873 4838 gene locus_tag LOCUS_15080 3873 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4868 5827 gene locus_tag LOCUS_15090 4868 5827 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence116 2008 1727 gene locus_tag LOCUS_15100 2008 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2993 2046 gene locus_tag LOCUS_15110 2993 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 4498 3236 gene locus_tag LOCUS_15120 4498 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 5695 4730 gene locus_tag LOCUS_15130 5695 4730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7409 5739 gene locus_tag LOCUS_15140 7409 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence117 2273 1167 gene locus_tag LOCUS_15150 2273 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4240 2402 gene locus_tag LOCUS_15160 4240 2402 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_15160 6229 4265 gene locus_tag LOCUS_15170 6229 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence118 620 189 gene locus_tag LOCUS_15180 gene rplM 620 189 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393902.1 protein_id gnl|my_center|LOCUS_15180 1005 811 gene locus_tag LOCUS_15190 1005 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1113 2636 gene locus_tag LOCUS_15200 1113 2636 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_15200 2978 4150 gene locus_tag LOCUS_15210 2978 4150 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963926.1 protein_id gnl|my_center|LOCUS_15210 4170 5513 gene locus_tag LOCUS_15220 4170 5513 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_15220 6154 5564 gene locus_tag LOCUS_15230 6154 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 6131 6322 gene locus_tag LOCUS_15240 6131 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 6351 7397 gene locus_tag LOCUS_15250 6351 7397 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence119 18 347 gene locus_tag LOCUS_15260 18 347 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_15260 350 1315 gene locus_tag LOCUS_15270 350 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1468 2520 gene locus_tag LOCUS_15280 1468 2520 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_15280 2562 4280 gene locus_tag LOCUS_15290 2562 4280 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_15290 4434 4775 gene locus_tag LOCUS_15300 4434 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4867 5106 gene locus_tag LOCUS_15310 4867 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence120 <1 1064 gene locus_tag LOCUS_15320 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118023.1:class II aldolase/adducin family protein 1941 1252 gene locus_tag LOCUS_15330 1941 1252 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_15330 3589 1934 gene locus_tag LOCUS_15340 gene araB 3589 1934 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_15340 3759 5231 gene locus_tag LOCUS_15350 gene abfB 3759 5231 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_15350 5228 5494 gene locus_tag LOCUS_15360 5228 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6033 5593 gene locus_tag LOCUS_15370 6033 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6895 6179 gene locus_tag LOCUS_15380 6895 6179 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461349.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence121 497 1573 gene locus_tag LOCUS_15390 497 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1732 2730 gene locus_tag LOCUS_15400 1732 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2783 3772 gene locus_tag LOCUS_15410 2783 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3817 4086 gene locus_tag LOCUS_15420 3817 4086 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_15420 4113 5471 gene locus_tag LOCUS_15430 4113 5471 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_15430 5476 5946 gene locus_tag LOCUS_15440 5476 5946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 5965 6708 gene locus_tag LOCUS_15450 5965 6708 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence122 1749 31 gene locus_tag LOCUS_15460 1749 31 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_15460 1921 2727 gene locus_tag LOCUS_15470 1921 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2820 3488 gene locus_tag LOCUS_15480 2820 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 4141 3542 gene locus_tag LOCUS_15490 4141 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943220.1 protein_id gnl|my_center|LOCUS_15490 4272 5237 gene locus_tag LOCUS_15500 gene miaA 4272 5237 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_15500 5322 6017 gene locus_tag LOCUS_15510 5322 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 6967 6062 gene locus_tag LOCUS_15520 6967 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence123 411 1274 gene locus_tag LOCUS_15530 411 1274 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_15530 1435 2163 gene locus_tag LOCUS_15540 1435 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2181 3896 gene locus_tag LOCUS_15550 2181 3896 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_15550 6905 3936 gene locus_tag LOCUS_15560 6905 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence124 3315 2659 gene locus_tag LOCUS_15570 gene pth 3315 2659 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_15570 3586 4695 gene locus_tag LOCUS_15580 3586 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4713 5588 gene locus_tag LOCUS_15590 gene rlmA 4713 5588 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_15590 5613 6347 gene locus_tag LOCUS_15600 5613 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 6385 6897 gene locus_tag LOCUS_15610 6385 6897 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence125 2128 62 gene locus_tag LOCUS_15620 2128 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2302 3345 gene locus_tag LOCUS_15630 2302 3345 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_15630 3354 4289 gene locus_tag LOCUS_15640 3354 4289 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_15640 4279 5040 gene locus_tag LOCUS_15650 4279 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 5082 6047 gene locus_tag LOCUS_15660 5082 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence126 9 644 gene locus_tag LOCUS_15670 9 644 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_15670 655 1413 gene locus_tag LOCUS_15680 655 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 2553 1480 gene locus_tag LOCUS_15690 gene ytvI 2553 1480 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_15690 3192 2665 gene locus_tag LOCUS_15700 gene raiA 3192 2665 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_15700 4488 3409 gene locus_tag LOCUS_15710 gene asd 4488 3409 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_15710 5684 4686 gene locus_tag LOCUS_15720 5684 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5920 6090 gene locus_tag LOCUS_15730 5920 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence127 599 1972 gene locus_tag LOCUS_15740 599 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2747 2247 gene locus_tag LOCUS_15750 2747 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 5092 2750 gene locus_tag LOCUS_15760 5092 2750 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_15760 5272 5832 gene locus_tag LOCUS_15770 5272 5832 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461583.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence128 1897 167 gene locus_tag LOCUS_15780 1897 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 2125 2616 gene locus_tag LOCUS_15790 2125 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2613 3431 gene locus_tag LOCUS_15800 2613 3431 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071831617.1 protein_id gnl|my_center|LOCUS_15800 3715 4464 gene locus_tag LOCUS_15810 3715 4464 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021033.1 protein_id gnl|my_center|LOCUS_15810 4490 6721 gene locus_tag LOCUS_15820 4490 6721 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence129 1212 535 gene locus_tag LOCUS_15830 gene ftsE 1212 535 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_15830 2464 1379 gene locus_tag LOCUS_15840 2464 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3080 2637 gene locus_tag LOCUS_15850 3080 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3820 3299 gene locus_tag LOCUS_15860 3820 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4875 3949 gene locus_tag LOCUS_15870 gene prmA 4875 3949 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_15870 6000 4897 gene locus_tag LOCUS_15880 gene dnaJ 6000 4897 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_15880 6741 6094 gene locus_tag LOCUS_15890 6741 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence130 1045 1968 gene locus_tag LOCUS_15900 1045 1968 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222562.1 protein_id gnl|my_center|LOCUS_15900 3286 2054 gene locus_tag LOCUS_15910 3286 2054 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_15910 4189 3317 gene locus_tag LOCUS_15920 4189 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4415 4786 gene locus_tag LOCUS_15930 4415 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence131 553 128 gene locus_tag LOCUS_15940 gene rplK 553 128 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_15940 1223 675 gene locus_tag LOCUS_15950 gene nusG 1223 675 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_15950 1518 1237 gene locus_tag LOCUS_15960 1518 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1687 1538 gene locus_tag LOCUS_15970 gene rpmG 1687 1538 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_15970 2032 2970 gene locus_tag LOCUS_15980 2032 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3108 4841 gene locus_tag LOCUS_15990 3108 4841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_15990 4834 6645 gene locus_tag LOCUS_16000 4834 6645 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence132 2115 721 gene locus_tag LOCUS_16010 2115 721 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_16010 2611 2249 gene locus_tag LOCUS_16020 2611 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 4143 2710 gene locus_tag LOCUS_16030 4143 2710 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767194.1 protein_id gnl|my_center|LOCUS_16030 4298 5110 gene locus_tag LOCUS_16040 4298 5110 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974053.1 protein_id gnl|my_center|LOCUS_16040 5153 6487 gene locus_tag LOCUS_16050 5153 6487 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence133 430 8 gene locus_tag LOCUS_16060 430 8 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_16060 709 1800 gene locus_tag LOCUS_16070 709 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1812 2780 gene locus_tag LOCUS_16080 gene manA 1812 2780 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027535.1 protein_id gnl|my_center|LOCUS_16080 2783 3364 gene locus_tag LOCUS_16090 2783 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461759.1 protein_id gnl|my_center|LOCUS_16090 4114 3413 gene locus_tag LOCUS_16100 4114 3413 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_16100 5805 4123 gene locus_tag LOCUS_16110 5805 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 5963 6460 gene locus_tag LOCUS_16120 5963 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence134 <1 667 gene locus_tag LOCUS_16130 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947925.1:thymidylate kinase 749 1312 gene locus_tag LOCUS_16140 749 1312 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_16140 1375 1902 gene locus_tag LOCUS_16150 1375 1902 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_16150 1892 2791 gene locus_tag LOCUS_16160 1892 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2825 4702 gene locus_tag LOCUS_16170 2825 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 6411 4756 gene locus_tag LOCUS_16180 6411 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence135 5458 2708 gene locus_tag LOCUS_16190 5458 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 <6470 5468 gene locus_tag LOCUS_16200 <6470 5468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001160248.1:RsmF rRNA methyltransferase first C-terminal domain-containing protein >Feature sequence136 234 1373 gene locus_tag LOCUS_16210 234 1373 CDS product oligogalacturonate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098577.1 protein_id gnl|my_center|LOCUS_16210 1390 2427 gene locus_tag LOCUS_16220 1390 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 3100 2468 gene locus_tag LOCUS_16230 3100 2468 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_16230 3404 3084 gene locus_tag LOCUS_16240 3404 3084 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006512.1 protein_id gnl|my_center|LOCUS_16240 4833 3517 gene locus_tag LOCUS_16250 4833 3517 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022789.1 protein_id gnl|my_center|LOCUS_16250 5103 5387 gene locus_tag LOCUS_16260 5103 5387 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence137 <1 1184 gene locus_tag LOCUS_16270 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359327.1:ATP-dependent zinc metalloprotease FtsH 1313 2122 gene locus_tag LOCUS_16280 1313 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2252 3100 gene locus_tag LOCUS_16290 2252 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4637 3147 gene locus_tag LOCUS_16300 4637 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 4799 5218 gene locus_tag LOCUS_16310 4799 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence138 4831 797 gene locus_tag LOCUS_16320 gene carB 4831 797 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862003.1 protein_id gnl|my_center|LOCUS_16320 5892 4831 gene locus_tag LOCUS_16330 gene carA 5892 4831 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104362.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence139 1284 2828 gene locus_tag LOCUS_16340 1284 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 4653 3463 gene locus_tag LOCUS_16350 gene patB 4653 3463 CDS product cystathionine beta-lyase PatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228854.1 protein_id gnl|my_center|LOCUS_16350 5770 4676 gene locus_tag LOCUS_16360 5770 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6174 5989 gene locus_tag LOCUS_16370 6174 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence140 2223 1375 gene locus_tag LOCUS_16380 2223 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 3292 2234 gene locus_tag LOCUS_16390 3292 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4515 3685 gene locus_tag LOCUS_16400 4515 3685 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_16400 4686 5540 gene locus_tag LOCUS_16410 4686 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence141 1294 194 gene locus_tag LOCUS_16420 1294 194 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582687.1 protein_id gnl|my_center|LOCUS_16420 1423 1560 gene locus_tag LOCUS_16430 1423 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1636 1902 gene locus_tag LOCUS_16440 1636 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2048 1899 gene locus_tag LOCUS_16450 2048 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2035 2262 gene locus_tag LOCUS_16460 2035 2262 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887863.1 protein_id gnl|my_center|LOCUS_16460 2267 4081 gene locus_tag LOCUS_16470 2267 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence142 1299 457 gene locus_tag LOCUS_16480 1299 457 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_16480 2644 1328 gene locus_tag LOCUS_16490 2644 1328 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_16490 3304 2723 gene locus_tag LOCUS_16500 3304 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 3535 5640 gene locus_tag LOCUS_16510 3535 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 <6237 5690 gene locus_tag LOCUS_16520 <6237 5690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482634.1:tryptophan synthase subunit beta >Feature sequence143 336 914 gene locus_tag LOCUS_16530 336 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321468.1 protein_id gnl|my_center|LOCUS_16530 939 1913 gene locus_tag LOCUS_16540 939 1913 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_16540 1928 2593 gene locus_tag LOCUS_16550 1928 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2610 3470 gene locus_tag LOCUS_16560 2610 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 4314 3538 gene locus_tag LOCUS_16570 4314 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 5106 4345 gene locus_tag LOCUS_16580 5106 4345 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564059.1 protein_id gnl|my_center|LOCUS_16580 5231 6034 gene locus_tag LOCUS_16590 5231 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence144 215 54 gene locus_tag LOCUS_16600 215 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 480 1079 gene locus_tag LOCUS_16610 480 1079 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287055.1 protein_id gnl|my_center|LOCUS_16610 2556 1231 gene locus_tag LOCUS_16620 gene mtaB 2556 1231 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_16620 3405 2569 gene locus_tag LOCUS_16630 3405 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4482 3418 gene locus_tag LOCUS_16640 4482 3418 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_16640 <6206 4605 gene locus_tag LOCUS_16650 <6206 4605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459352.1:heavy metal translocating P-type ATPase >Feature sequence145 1252 365 gene locus_tag LOCUS_16660 1252 365 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_16660 2250 1258 gene locus_tag LOCUS_16670 2250 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2534 3349 gene locus_tag LOCUS_16680 2534 3349 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_16680 3356 4318 gene locus_tag LOCUS_16690 3356 4318 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_16690 4315 5250 gene locus_tag LOCUS_16700 4315 5250 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140222.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence146 <1 2109 gene locus_tag LOCUS_16710 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246110.1:single-stranded-DNA-specific exonuclease RecJ 2140 4374 gene locus_tag LOCUS_16720 2140 4374 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_16720 4388 4855 gene locus_tag LOCUS_16730 gene dtd 4388 4855 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence147 478 23 gene locus_tag LOCUS_16740 478 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1982 507 gene locus_tag LOCUS_16750 1982 507 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_16750 3385 2096 gene locus_tag LOCUS_16760 3385 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4271 3372 gene locus_tag LOCUS_16770 gene cdaA 4271 3372 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_16770 4834 5718 gene locus_tag LOCUS_16780 gene spoIVB 4834 5718 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence148 1800 1441 gene locus_tag LOCUS_16790 1800 1441 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_16790 3032 1911 gene locus_tag LOCUS_16800 3032 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 4219 3185 gene locus_tag LOCUS_16810 4219 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 <6019 4221 gene locus_tag LOCUS_16820 <6019 4221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111154492.1:alpha-galactosidase >Feature sequence149 668 1687 gene locus_tag LOCUS_16830 668 1687 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_16830 1687 1911 gene locus_tag LOCUS_16840 1687 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1933 2247 gene locus_tag LOCUS_16850 1933 2247 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_16850 2249 2443 gene locus_tag LOCUS_16860 2249 2443 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_16860 3012 2488 gene locus_tag LOCUS_16870 3012 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3871 3026 gene locus_tag LOCUS_16880 3871 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 5085 3868 gene locus_tag LOCUS_16890 5085 3868 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_16890 5609 5118 gene locus_tag LOCUS_16900 5609 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 5976 5602 gene locus_tag LOCUS_16910 5976 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence150 173 943 gene locus_tag LOCUS_16920 173 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 980 2338 gene locus_tag LOCUS_16930 980 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2342 3100 gene locus_tag LOCUS_16940 2342 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3542 3165 gene locus_tag LOCUS_16950 3542 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4021 3626 gene locus_tag LOCUS_16960 4021 3626 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_16960 <5934 4049 gene locus_tag LOCUS_16970 <5934 4049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242683.1:DUF4129 domain-containing transglutaminase family protein >Feature sequence151 1309 17 gene locus_tag LOCUS_16980 1309 17 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_16980 1924 1475 gene locus_tag LOCUS_16990 1924 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2031 2270 gene locus_tag LOCUS_17000 2031 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2398 2473 gene locus_tag LOCUS_t00210 2398 2473 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2498 2582 gene locus_tag LOCUS_t00220 2498 2582 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3800 2736 gene locus_tag LOCUS_17010 3800 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 5794 3890 gene locus_tag LOCUS_17020 5794 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence152 2109 1225 gene locus_tag LOCUS_17030 2109 1225 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393753.1 protein_id gnl|my_center|LOCUS_17030 2891 2088 gene locus_tag LOCUS_17040 2891 2088 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285030.1 protein_id gnl|my_center|LOCUS_17040 3859 3005 gene locus_tag LOCUS_17050 3859 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4020 5156 gene locus_tag LOCUS_17060 4020 5156 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870412.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence153 642 2216 gene locus_tag LOCUS_17070 642 2216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_17070 2200 3300 gene locus_tag LOCUS_17080 2200 3300 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_17080 3297 4253 gene locus_tag LOCUS_17090 3297 4253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_17090 5344 4307 gene locus_tag LOCUS_17100 5344 4307 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_17100 5661 5341 gene locus_tag LOCUS_17110 5661 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence154 1551 2561 gene locus_tag LOCUS_17120 1551 2561 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083301.1 protein_id gnl|my_center|LOCUS_17120 2636 3958 gene locus_tag LOCUS_17130 2636 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 3987 5186 gene locus_tag LOCUS_17140 3987 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence155 <1 765 gene locus_tag LOCUS_17150 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627021.1:elongation factor G 905 2014 gene locus_tag LOCUS_17160 905 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2126 3616 gene locus_tag LOCUS_17170 gene glpK 2126 3616 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139398.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence156 1352 120 gene locus_tag LOCUS_17180 1352 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2029 1349 gene locus_tag LOCUS_17190 2029 1349 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_17190 2115 3149 gene locus_tag LOCUS_17200 2115 3149 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_17200 3213 3374 gene locus_tag LOCUS_17210 3213 3374 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_17210 3413 3718 gene locus_tag LOCUS_17220 gene trxA 3413 3718 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018943.1 protein_id gnl|my_center|LOCUS_17220 3810 4322 gene locus_tag LOCUS_17230 3810 4322 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_17230 4335 4544 gene locus_tag LOCUS_17240 4335 4544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 <5641 4599 gene locus_tag LOCUS_17250 <5641 4599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681491.1:metallophosphoesterase >Feature sequence157 22 792 gene locus_tag LOCUS_17260 22 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1960 824 gene locus_tag LOCUS_17270 gene rodA 1960 824 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_17270 3413 1974 gene locus_tag LOCUS_17280 gene proS 3413 1974 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_17280 <5638 3502 gene locus_tag LOCUS_17290 <5638 3502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817187.1:DNA helicase PcrA >Feature sequence158 304 981 gene locus_tag LOCUS_17300 gene ftsE 304 981 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_17300 978 1859 gene locus_tag LOCUS_17310 gene ftsX 978 1859 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_17310 1876 3129 gene locus_tag LOCUS_17320 1876 3129 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_17320 3204 4427 gene locus_tag LOCUS_17330 3204 4427 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494947.1 protein_id gnl|my_center|LOCUS_17330 4505 4993 gene locus_tag LOCUS_17340 gene greA 4505 4993 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence159 1019 99 gene locus_tag LOCUS_17350 1019 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1229 3427 gene locus_tag LOCUS_17360 1229 3427 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467386.1 protein_id gnl|my_center|LOCUS_17360 4332 3460 gene locus_tag LOCUS_17370 4332 3460 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_17370 4798 4343 gene locus_tag LOCUS_17380 gene bcp 4798 4343 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_17380 <5476 4819 gene locus_tag LOCUS_17390 <5476 4819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678782.1:DNA alkylation repair protein >Feature sequence160 449 225 gene locus_tag LOCUS_17400 449 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17400 834 484 gene locus_tag LOCUS_17410 834 484 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_17410 1050 1526 gene locus_tag LOCUS_17420 1050 1526 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_17420 1541 2155 gene locus_tag LOCUS_17430 1541 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 2180 2740 gene locus_tag LOCUS_17440 2180 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 2823 4226 gene locus_tag LOCUS_17450 2823 4226 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_17450 4243 5346 gene locus_tag LOCUS_17460 4243 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence161 296 832 gene locus_tag LOCUS_17470 296 832 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_17470 951 1925 gene locus_tag LOCUS_17480 951 1925 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_17480 2330 3736 gene locus_tag LOCUS_17490 2330 3736 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence162 758 15 gene locus_tag LOCUS_17500 758 15 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_17500 1527 760 gene locus_tag LOCUS_17510 gene dapB 1527 760 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_17510 2483 1587 gene locus_tag LOCUS_17520 gene dapA 2483 1587 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_17520 2730 2452 gene locus_tag LOCUS_17530 2730 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2879 3994 gene locus_tag LOCUS_17540 gene queA 2879 3994 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_17540 4190 4765 gene locus_tag LOCUS_17550 4190 4765 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454633.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence163 <1 605 gene locus_tag LOCUS_17560 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287898.1:Cof-type HAD-IIB family hydrolase 592 1374 gene locus_tag LOCUS_17570 gene yigL 592 1374 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211488.1 protein_id gnl|my_center|LOCUS_17570 1371 1910 gene locus_tag LOCUS_17580 1371 1910 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_17580 1913 2392 gene locus_tag LOCUS_17590 1913 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2389 2598 gene locus_tag LOCUS_17600 2389 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2616 3932 gene locus_tag LOCUS_17610 2616 3932 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_17610 4075 4890 gene locus_tag LOCUS_17620 4075 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5181 4906 gene locus_tag LOCUS_17630 5181 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence164 <1 562 gene locus_tag LOCUS_17640 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583097.1:corrinoid protein 590 1600 gene locus_tag LOCUS_17650 590 1600 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_17650 1590 2162 gene locus_tag LOCUS_17660 1590 2162 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462052.1 protein_id gnl|my_center|LOCUS_17660 2176 3690 gene locus_tag LOCUS_17670 2176 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3744 4565 gene locus_tag LOCUS_17680 3744 4565 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245153.1 protein_id gnl|my_center|LOCUS_17680 <5361 4572 gene locus_tag LOCUS_17690 <5361 4572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861405.1:class I SAM-dependent methyltransferase >Feature sequence165 472 1242 gene locus_tag LOCUS_17700 472 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 1226 3289 gene locus_tag LOCUS_17710 1226 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3315 3767 gene locus_tag LOCUS_17720 gene dut 3315 3767 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_17720 3778 4035 gene locus_tag LOCUS_17730 3778 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4050 4655 gene locus_tag LOCUS_17740 4050 4655 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence166 480 1169 gene locus_tag LOCUS_17750 480 1169 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_17750 1785 1138 gene locus_tag LOCUS_17760 1785 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1899 2681 gene locus_tag LOCUS_17770 1899 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 2808 3572 gene locus_tag LOCUS_17780 2808 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 3629 4744 gene locus_tag LOCUS_17790 3629 4744 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_17790 <5338 4787 gene locus_tag LOCUS_17800 <5338 4787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013913595.1:ABC transporter ATP-binding protein >Feature sequence167 <1 796 gene locus_tag LOCUS_17810 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015777129.1:sugar phosphate isomerase/epimerase 859 1464 gene locus_tag LOCUS_17820 859 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1501 1794 gene locus_tag LOCUS_17830 1501 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2997 1816 gene locus_tag LOCUS_17840 2997 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3419 3015 gene locus_tag LOCUS_17850 3419 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4312 3416 gene locus_tag LOCUS_17860 4312 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence168 <1 1460 gene locus_tag LOCUS_17870 <1 1460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583888.1:beta-glucuronidase 2649 1501 gene locus_tag LOCUS_17880 gene nagA 2649 1501 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788940.1 protein_id gnl|my_center|LOCUS_17880 3407 2649 gene locus_tag LOCUS_17890 3407 2649 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_17890 4501 3422 gene locus_tag LOCUS_17900 4501 3422 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719757.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence169 606 241 gene locus_tag LOCUS_17910 606 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 3436 830 gene locus_tag LOCUS_17920 3436 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3616 4386 gene locus_tag LOCUS_17930 3616 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 4442 4960 gene locus_tag LOCUS_17940 4442 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 5037 5121 gene locus_tag LOCUS_t00230 5037 5121 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence170 578 1303 gene locus_tag LOCUS_17950 578 1303 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_17950 1332 2171 gene locus_tag LOCUS_17960 1332 2171 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359680.1 protein_id gnl|my_center|LOCUS_17960 2186 3409 gene locus_tag LOCUS_17970 2186 3409 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_17970 3427 4449 gene locus_tag LOCUS_17980 gene rseP 3427 4449 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583162.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence171 926 216 gene locus_tag LOCUS_17990 926 216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062202.1 protein_id gnl|my_center|LOCUS_17990 1703 933 gene locus_tag LOCUS_18000 1703 933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 protein_id gnl|my_center|LOCUS_18000 2836 1703 gene locus_tag LOCUS_18010 2836 1703 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_18010 3708 2836 gene locus_tag LOCUS_18020 3708 2836 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_18020 4982 3828 gene locus_tag LOCUS_18030 4982 3828 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence172 221 2080 gene locus_tag LOCUS_18040 221 2080 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256471.1 protein_id gnl|my_center|LOCUS_18040 3646 2171 gene locus_tag LOCUS_18050 3646 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4521 3658 gene locus_tag LOCUS_18060 4521 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 4628 4807 gene locus_tag LOCUS_18070 4628 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence173 424 296 gene locus_tag LOCUS_18080 424 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 932 856 gene locus_tag LOCUS_t00240 932 856 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2516 1017 gene locus_tag LOCUS_18090 2516 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4068 2647 gene locus_tag LOCUS_18100 4068 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence174 <1 965 gene locus_tag LOCUS_18110 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107686.1:L-fucose isomerase 1027 2295 gene locus_tag LOCUS_18120 1027 2295 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727913.1 protein_id gnl|my_center|LOCUS_18120 4418 2412 gene locus_tag LOCUS_18130 4418 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5142 4423 gene locus_tag LOCUS_18140 5142 4423 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence175 2 340 gene locus_tag LOCUS_18150 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 356 1090 gene locus_tag LOCUS_18160 gene plsY 356 1090 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225265.1 protein_id gnl|my_center|LOCUS_18160 1087 2298 gene locus_tag LOCUS_18170 1087 2298 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681116.1 protein_id gnl|my_center|LOCUS_18170 2338 3627 gene locus_tag LOCUS_18180 2338 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence176 176 27 gene locus_tag LOCUS_18190 176 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1138 197 gene locus_tag LOCUS_18200 1138 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1791 1135 gene locus_tag LOCUS_18210 1791 1135 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029031.1 protein_id gnl|my_center|LOCUS_18210 2580 1807 gene locus_tag LOCUS_18220 2580 1807 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_18220 3747 2596 gene locus_tag LOCUS_18230 gene dgoD 3747 2596 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171654832.1 protein_id gnl|my_center|LOCUS_18230 4044 4640 gene locus_tag LOCUS_18240 4044 4640 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816420.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence177 1404 1096 gene locus_tag LOCUS_18250 1404 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3154 1409 gene locus_tag LOCUS_18260 3154 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3464 4027 gene locus_tag LOCUS_18270 3464 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence178 1860 1129 gene locus_tag LOCUS_18280 gene sigE 1860 1129 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_18280 2696 1878 gene locus_tag LOCUS_18290 2696 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2924 3724 gene locus_tag LOCUS_18300 2924 3724 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071302.1 protein_id gnl|my_center|LOCUS_18300 3813 4547 gene locus_tag LOCUS_18310 3813 4547 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence179 <1 659 gene locus_tag LOCUS_18320 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790318.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 681 1598 gene locus_tag LOCUS_18330 gene metA 681 1598 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_18330 4085 1641 gene locus_tag LOCUS_18340 4085 1641 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810223.1 protein_id gnl|my_center|LOCUS_18340 4719 4165 gene locus_tag LOCUS_18350 4719 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4961 4716 gene locus_tag LOCUS_18360 4961 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence180 1451 243 gene locus_tag LOCUS_18370 1451 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 2617 1469 gene locus_tag LOCUS_18380 2617 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2607 2852 gene locus_tag LOCUS_18390 2607 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 3552 2911 gene locus_tag LOCUS_18400 3552 2911 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_18400 3689 3564 gene locus_tag LOCUS_18410 3689 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 <4908 3676 gene locus_tag LOCUS_18420 <4908 3676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861672.1:LCP family protein >Feature sequence181 171 440 gene locus_tag LOCUS_18430 171 440 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_18430 560 1618 gene locus_tag LOCUS_18440 560 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1630 2454 gene locus_tag LOCUS_18450 1630 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 3696 2503 gene locus_tag LOCUS_18460 3696 2503 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674457.1 protein_id gnl|my_center|LOCUS_18460 4297 3710 gene locus_tag LOCUS_18470 4297 3710 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582845.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence182 <1 3175 gene locus_tag LOCUS_18480 <1 3175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986794.1:PolC-type DNA polymerase III 4221 3235 gene locus_tag LOCUS_18490 4221 3235 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803848.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence183 2399 1125 gene locus_tag LOCUS_18500 gene purD 2399 1125 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_18500 3864 2629 gene locus_tag LOCUS_18510 3864 2629 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_18510 <4805 3985 gene locus_tag LOCUS_18520 <4805 3985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765038.1:phosphoribosylaminoimidazolecarboxamide formyltransferase >Feature sequence184 367 945 gene locus_tag LOCUS_18530 367 945 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459865.1 protein_id gnl|my_center|LOCUS_18530 983 1576 gene locus_tag LOCUS_18540 983 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1573 2190 gene locus_tag LOCUS_18550 1573 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2212 2829 gene locus_tag LOCUS_18560 2212 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 2840 4108 gene locus_tag LOCUS_18570 2840 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 4119 4709 gene locus_tag LOCUS_18580 4119 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence185 1060 2196 gene locus_tag LOCUS_18590 1060 2196 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_18590 2294 3286 gene locus_tag LOCUS_18600 gene mgrA 2294 3286 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224864.1 protein_id gnl|my_center|LOCUS_18600 3614 3495 gene locus_tag LOCUS_18610 3614 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 <4684 3819 gene locus_tag LOCUS_18620 <4684 3819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815867.1:uroporphyrinogen decarboxylase family protein >Feature sequence186 <1 562 gene locus_tag LOCUS_18630 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_060993369.1:orotate phosphoribosyltransferase 559 1476 gene locus_tag LOCUS_18640 gene pyrB 559 1476 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_18640 1473 1913 gene locus_tag LOCUS_18650 1473 1913 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965941.1 protein_id gnl|my_center|LOCUS_18650 3070 1979 gene locus_tag LOCUS_18660 3070 1979 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_18660 3455 3279 gene locus_tag LOCUS_18670 3455 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 <4683 3562 gene locus_tag LOCUS_18680 <4683 3562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246072.1:leucine--tRNA ligase >Feature sequence187 2682 352 gene locus_tag LOCUS_18690 2682 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 <4559 2708 gene locus_tag LOCUS_18700 <4559 2708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582764.1:sugar ABC transporter substrate-binding protein >Feature sequence188 2627 480 gene locus_tag LOCUS_18710 gene recG 2627 480 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_18710 2753 3496 gene locus_tag LOCUS_18720 2753 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence189 1323 739 gene locus_tag LOCUS_18730 gene clpP 1323 739 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_18730 2737 1439 gene locus_tag LOCUS_18740 gene tig 2737 1439 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460919.1 protein_id gnl|my_center|LOCUS_18740 3588 2860 gene locus_tag LOCUS_18750 3588 2860 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_18750 3684 3851 gene locus_tag LOCUS_18760 3684 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 <4417 3899 gene locus_tag LOCUS_18770 <4417 3899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434031.1:threonine synthase >Feature sequence190 209 1444 gene locus_tag LOCUS_18780 209 1444 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_18780 1437 2378 gene locus_tag LOCUS_18790 1437 2378 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183386.1 protein_id gnl|my_center|LOCUS_18790 2375 3361 gene locus_tag LOCUS_18800 2375 3361 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287135.1 protein_id gnl|my_center|LOCUS_18800 3352 4125 gene locus_tag LOCUS_18810 3352 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence191 1 1137 gene locus_tag LOCUS_18820 1 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1227 1469 gene locus_tag LOCUS_18830 1227 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1496 2896 gene locus_tag LOCUS_18840 gene tilS 1496 2896 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_18840 2946 3509 gene locus_tag LOCUS_18850 gene hpt 2946 3509 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence192 <1 2230 gene locus_tag LOCUS_18860 <1 2230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229052.1:DNA internalization-related competence protein ComEC/Rec2 2518 2204 gene locus_tag LOCUS_18870 2518 2204 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_18870 2952 2515 gene locus_tag LOCUS_18880 gene rnhA 2952 2515 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_18880 3185 3544 gene locus_tag LOCUS_18890 3185 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3532 3798 gene locus_tag LOCUS_18900 3532 3798 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence193 293 715 gene locus_tag LOCUS_18910 293 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1441 794 gene locus_tag LOCUS_18920 1441 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2073 1438 gene locus_tag LOCUS_18930 2073 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257318.1 protein_id gnl|my_center|LOCUS_18930 2907 2095 gene locus_tag LOCUS_18940 2907 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 3775 2909 gene locus_tag LOCUS_18950 3775 2909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence194 465 1754 gene locus_tag LOCUS_18960 gene obgE 465 1754 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_18960 1953 1783 gene locus_tag LOCUS_18970 1953 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 2052 2348 gene locus_tag LOCUS_18980 2052 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 2503 3342 gene locus_tag LOCUS_18990 2503 3342 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_18990 3359 3748 gene locus_tag LOCUS_19000 3359 3748 CDS product DUF5412 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022545.1 protein_id gnl|my_center|LOCUS_19000 4048 3803 gene locus_tag LOCUS_19010 4048 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence195 691 158 gene locus_tag LOCUS_19020 691 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1023 775 gene locus_tag LOCUS_19030 1023 775 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_19030 1953 1048 gene locus_tag LOCUS_19040 1953 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2774 1950 gene locus_tag LOCUS_19050 2774 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2944 3687 gene locus_tag LOCUS_19060 gene trmB 2944 3687 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893561.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence196 381 2342 gene locus_tag LOCUS_19070 381 2342 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_19070 2377 3234 gene locus_tag LOCUS_19080 2377 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 3262 3921 gene locus_tag LOCUS_19090 3262 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3925 4158 gene locus_tag LOCUS_19100 3925 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence197 2014 2919 gene locus_tag LOCUS_19110 2014 2919 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974053.1 protein_id gnl|my_center|LOCUS_19110 3404 3009 gene locus_tag LOCUS_19120 3404 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3569 3493 gene locus_tag LOCUS_t00250 3569 3493 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4002 3691 gene locus_tag LOCUS_19130 4002 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence198 349 1599 gene locus_tag LOCUS_19140 349 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 1673 3604 gene locus_tag LOCUS_19150 1673 3604 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966001.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence199 942 1433 gene locus_tag LOCUS_19160 942 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2957 1476 gene locus_tag LOCUS_19170 2957 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence200 42 1541 gene locus_tag LOCUS_19180 42 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 1577 2848 gene locus_tag LOCUS_19190 1577 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 3765 2905 gene locus_tag LOCUS_19200 3765 2905 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713634.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence201 <1 1179 gene locus_tag LOCUS_19210 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048157.1:valine--tRNA ligase 1431 2312 gene locus_tag LOCUS_19220 1431 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2309 3178 gene locus_tag LOCUS_19230 2309 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence202 860 486 gene locus_tag LOCUS_19240 860 486 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_19240 1239 928 gene locus_tag LOCUS_19250 1239 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 1958 1248 gene locus_tag LOCUS_19260 1958 1248 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942064.1 protein_id gnl|my_center|LOCUS_19260 2480 2067 gene locus_tag LOCUS_19270 2480 2067 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_19270 3265 2552 gene locus_tag LOCUS_19280 3265 2552 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582696.1 protein_id gnl|my_center|LOCUS_19280 3895 3269 gene locus_tag LOCUS_19290 3895 3269 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897160.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19290 4072 3920 gene locus_tag LOCUS_19300 4072 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence203 917 1639 gene locus_tag LOCUS_19310 917 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1691 4033 gene locus_tag LOCUS_19320 1691 4033 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence204 1090 194 gene locus_tag LOCUS_19330 gene rsmI 1090 194 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435873.1 protein_id gnl|my_center|LOCUS_19330 1886 1095 gene locus_tag LOCUS_19340 1886 1095 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_19340 2144 1971 gene locus_tag LOCUS_19350 2144 1971 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_19350 3137 2220 gene locus_tag LOCUS_19360 3137 2220 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_19360 <4027 3200 gene locus_tag LOCUS_19370 <4027 3200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435878.1:DNA polymerase III subunit delta' C-terminal domain-containing protein >Feature sequence205 518 1753 gene locus_tag LOCUS_19380 518 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3755 1809 gene locus_tag LOCUS_19390 3755 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 3918 3993 gene locus_tag LOCUS_t00260 3918 3993 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 1 366 gene locus_tag LOCUS_19400 1 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 507 683 gene locus_tag LOCUS_19410 507 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 1276 635 gene locus_tag LOCUS_19420 1276 635 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_19420 3262 1298 gene locus_tag LOCUS_19430 3262 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence207 324 1157 gene locus_tag LOCUS_19440 324 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 1217 2332 gene locus_tag LOCUS_19450 1217 2332 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_19450 2325 2960 gene locus_tag LOCUS_19460 gene coaE 2325 2960 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_19460 2957 3526 gene locus_tag LOCUS_19470 2957 3526 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence208 1717 683 gene locus_tag LOCUS_19480 1717 683 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836873.1 protein_id gnl|my_center|LOCUS_19480 1866 2363 gene locus_tag LOCUS_19490 1866 2363 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_19490 2360 3091 gene locus_tag LOCUS_19500 2360 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence209 179 409 gene locus_tag LOCUS_19510 179 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 406 759 gene locus_tag LOCUS_19520 406 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 779 1003 gene locus_tag LOCUS_19530 779 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2526 1597 gene locus_tag LOCUS_19540 2526 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence210 1432 128 gene locus_tag LOCUS_19550 1432 128 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_19550 2735 1422 gene locus_tag LOCUS_19560 2735 1422 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_19560 <3838 2841 gene locus_tag LOCUS_19570 <3838 2841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949062.1:aspartate--ammonia ligase >Feature sequence211 839 282 gene locus_tag LOCUS_19580 gene efp 839 282 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_19580 2072 1002 gene locus_tag LOCUS_19590 2072 1002 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_19590 2604 2092 gene locus_tag LOCUS_19600 2604 2092 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226126.1 protein_id gnl|my_center|LOCUS_19600 <3824 2622 gene locus_tag LOCUS_19610 <3824 2622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029239.1:aspartate--tRNA ligase >Feature sequence212 2268 1249 gene locus_tag LOCUS_19620 2268 1249 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_19620 2995 2354 gene locus_tag LOCUS_19630 2995 2354 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_19630 <3809 2992 gene locus_tag LOCUS_19640 <3809 2992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894120.1:GTPase HflX >Feature sequence213 1349 399 gene locus_tag LOCUS_19650 1349 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 2290 1346 gene locus_tag LOCUS_19660 2290 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2771 3559 gene locus_tag LOCUS_19670 gene dppA 2771 3559 CDS product D-aminopeptidase DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245814.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence214 513 1316 gene locus_tag LOCUS_19680 513 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1573 2679 gene locus_tag LOCUS_19690 gene hrcA 1573 2679 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_19690 2682 3284 gene locus_tag LOCUS_19700 2682 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence215 1314 2213 gene locus_tag LOCUS_19710 1314 2213 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_19710 2326 3333 gene locus_tag LOCUS_19720 gene trpS 2326 3333 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence216 564 2201 gene locus_tag LOCUS_19730 564 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2454 3527 gene locus_tag LOCUS_19740 2454 3527 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence217 749 243 gene locus_tag LOCUS_19750 749 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1015 755 gene locus_tag LOCUS_19760 1015 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 2235 1852 gene locus_tag LOCUS_19770 gene spoIIIAD 2235 1852 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393042.1 protein_id gnl|my_center|LOCUS_19770 2426 2232 gene locus_tag LOCUS_19780 2426 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2833 2444 gene locus_tag LOCUS_19790 2833 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 <3516 2880 gene locus_tag LOCUS_19800 <3516 2880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358945.1:stage III sporulation protein AA >Feature sequence218 915 76 gene locus_tag LOCUS_19810 915 76 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_19810 <3492 1048 gene locus_tag LOCUS_19820 <3492 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002355749.1:calcium-translocating P-type ATPase, PMCA-type >Feature sequence219 <1 2863 gene locus_tag LOCUS_19830 <1 2863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966420.1:DNA-directed RNA polymerase subunit beta' >Feature sequence220 <1 660 gene locus_tag LOCUS_19840 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966383.1:energy-coupling factor transporter ATPase 690 1562 gene locus_tag LOCUS_19850 690 1562 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_19850 1559 2383 gene locus_tag LOCUS_19860 1559 2383 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966381.1 protein_id gnl|my_center|LOCUS_19860 2390 3187 gene locus_tag LOCUS_19870 gene truA 2390 3187 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence221 <1 625 gene locus_tag LOCUS_19880 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109158.1:HAD family hydrolase 755 1243 gene locus_tag LOCUS_19890 755 1243 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_19890 1281 2342 gene locus_tag LOCUS_19900 gene nusA 1281 2342 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_19900 2370 2666 gene locus_tag LOCUS_19910 2370 2666 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_19910 2635 3012 gene locus_tag LOCUS_19920 2635 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence222 45 425 gene locus_tag LOCUS_19930 45 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 446 1492 gene locus_tag LOCUS_19940 gene purM 446 1492 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_19940 1486 2121 gene locus_tag LOCUS_19950 gene purN 1486 2121 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_19950 2134 2910 gene locus_tag LOCUS_19960 2134 2910 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence223 1853 603 gene locus_tag LOCUS_19970 1853 603 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_19970 2115 2834 gene locus_tag LOCUS_19980 gene pyrH 2115 2834 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence224 1 297 gene locus_tag LOCUS_19990 1 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 313 1137 gene locus_tag LOCUS_20000 313 1137 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_20000 1152 2015 gene locus_tag LOCUS_20010 1152 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 2059 2877 gene locus_tag LOCUS_20020 2059 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence225 2483 630 gene locus_tag LOCUS_20030 2483 630 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_20030 <3341 2781 gene locus_tag LOCUS_20040 <3341 2781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704256.1:alanine dehydrogenase >Feature sequence226 <1 1096 gene locus_tag LOCUS_20050 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964665.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydG 1119 2321 gene locus_tag LOCUS_20060 gene hydF 1119 2321 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_20060 2921 2364 gene locus_tag LOCUS_20070 2921 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence227 <1 600 gene locus_tag LOCUS_20080 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813559.1:ABC transporter ATP-binding protein 623 1303 gene locus_tag LOCUS_20090 623 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence228 1791 100 gene locus_tag LOCUS_20100 1791 100 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_20100 2440 1817 gene locus_tag LOCUS_20110 2440 1817 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence229 2061 496 gene locus_tag LOCUS_20120 gene araB 2061 496 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_20120 2740 2066 gene locus_tag LOCUS_20130 gene rpe 2740 2066 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence230 2 796 gene locus_tag LOCUS_20140 2 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 >Feature sequence231 1970 1707 gene locus_tag LOCUS_20150 gene rpsO 1970 1707 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence232 183 1211 gene locus_tag LOCUS_20160 183 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 1244 2443 gene locus_tag LOCUS_20170 gene hemW 1244 2443 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_20170 2474 3256 gene locus_tag LOCUS_20180 2474 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence233 188 922 gene locus_tag LOCUS_20190 188 922 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815788.1 protein_id gnl|my_center|LOCUS_20190 915 1118 gene locus_tag LOCUS_20200 915 1118 CDS product PLD nuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562727.1 protein_id gnl|my_center|LOCUS_20200 1119 2018 gene locus_tag LOCUS_20210 1119 2018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860718.1 protein_id gnl|my_center|LOCUS_20210 2015 2785 gene locus_tag LOCUS_20220 2015 2785 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435927.1 protein_id gnl|my_center|LOCUS_20220 3255 2824 gene locus_tag LOCUS_20230 3255 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence234 368 1849 gene locus_tag LOCUS_20240 368 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 1901 2683 gene locus_tag LOCUS_20250 1901 2683 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence235 114 551 gene locus_tag LOCUS_20260 114 551 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438060.1 protein_id gnl|my_center|LOCUS_20260 692 1357 gene locus_tag LOCUS_20270 gene nth 692 1357 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_20270 1354 1542 gene locus_tag LOCUS_20280 1354 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2861 2016 gene locus_tag LOCUS_20290 2861 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence236 1274 222 gene locus_tag LOCUS_20300 1274 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 <3257 1285 gene locus_tag LOCUS_20310 <3257 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083145.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence237 1414 170 gene locus_tag LOCUS_20320 1414 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2443 1445 gene locus_tag LOCUS_20330 2443 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence238 1210 524 gene locus_tag LOCUS_20340 gene rpe 1210 524 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106173.1 protein_id gnl|my_center|LOCUS_20340 1718 1248 gene locus_tag LOCUS_20350 gene ispF 1718 1248 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167293.1 protein_id gnl|my_center|LOCUS_20350 2484 1720 gene locus_tag LOCUS_20360 gene ispD 2484 1720 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence239 1286 45 gene locus_tag LOCUS_20370 1286 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2316 1360 gene locus_tag LOCUS_20380 2316 1360 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968016.1 protein_id gnl|my_center|LOCUS_20380 2397 3128 gene locus_tag LOCUS_20390 2397 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence240 <1 1232 gene locus_tag LOCUS_20400 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966492.1:transcription-repair coupling factor 1300 2382 gene locus_tag LOCUS_20410 1300 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence241 553 1047 gene locus_tag LOCUS_20420 553 1047 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_20420 1219 1779 gene locus_tag LOCUS_20430 1219 1779 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257731.1 protein_id gnl|my_center|LOCUS_20430 1776 2783 gene locus_tag LOCUS_20440 1776 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence242 342 968 gene locus_tag LOCUS_20450 gene ruvA 342 968 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_20450 988 2067 gene locus_tag LOCUS_20460 gene ruvB 988 2067 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_20460 2064 2789 gene locus_tag LOCUS_20470 gene radC 2064 2789 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938489.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence243 1733 1281 gene locus_tag LOCUS_20480 1733 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2465 1818 gene locus_tag LOCUS_20490 2465 1818 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460066.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence244 3 845 gene locus_tag LOCUS_20500 gene lgt 3 845 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886663.1 protein_id gnl|my_center|LOCUS_20500 851 1705 gene locus_tag LOCUS_20510 gene folD 851 1705 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_20510 1852 2172 gene locus_tag LOCUS_20520 gene rplU 1852 2172 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_20520 2224 2574 gene locus_tag LOCUS_20530 2224 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2607 2885 gene locus_tag LOCUS_20540 gene rpmA 2607 2885 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence245 1419 910 gene locus_tag LOCUS_20550 1419 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1951 1421 gene locus_tag LOCUS_20560 1951 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2562 1948 gene locus_tag LOCUS_20570 2562 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 >Feature sequence246 18 476 gene locus_tag LOCUS_20580 18 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 1313 486 gene locus_tag LOCUS_20590 gene amrS 1313 486 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_20590 2698 1310 gene locus_tag LOCUS_20600 gene amrA 2698 1310 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_20600 >Feature sequence247 21 1244 gene locus_tag LOCUS_20610 21 1244 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853233.1 protein_id gnl|my_center|LOCUS_20610 1338 2186 gene locus_tag LOCUS_20620 1338 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 <2973 2383 gene locus_tag LOCUS_20630 <2973 2383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460388.1:polyribonucleotide nucleotidyltransferase >Feature sequence248 2749 1151 gene locus_tag LOCUS_20640 2749 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence249 <1 882 gene locus_tag LOCUS_20650 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002362247.1:YgeY family selenium metabolism-linked hydrolase 916 2115 gene locus_tag LOCUS_20660 gene ygeW 916 2115 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence250 749 1267 gene locus_tag LOCUS_20670 749 1267 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027149.1 protein_id gnl|my_center|LOCUS_20670 1663 1328 gene locus_tag LOCUS_20680 1663 1328 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_20680 1813 2250 gene locus_tag LOCUS_20690 1813 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2897 2475 gene locus_tag LOCUS_20700 2897 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 >Feature sequence251 <1 917 gene locus_tag LOCUS_20710 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931806.1:phenylacetate--CoA ligase 1435 1767 gene locus_tag LOCUS_20720 1435 1767 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_20720 1905 2756 gene locus_tag LOCUS_20730 1905 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence252 170 1513 gene locus_tag LOCUS_20740 170 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 <2925 1553 gene locus_tag LOCUS_20750 <2925 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965634.1:phospho-sugar mutase >Feature sequence253 1808 2758 gene locus_tag LOCUS_20760 1808 2758 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_20760 >Feature sequence254 2572 242 gene locus_tag LOCUS_20770 2572 242 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence255 <1 641 gene locus_tag LOCUS_20780 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721949.1:peptidylprolyl isomerase 1354 683 gene locus_tag LOCUS_20790 1354 683 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence256 80 223 gene locus_tag LOCUS_20800 80 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 240 1433 gene locus_tag LOCUS_20810 240 1433 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895828.1 protein_id gnl|my_center|LOCUS_20810 1459 2427 gene locus_tag LOCUS_20820 1459 2427 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966592.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence257 <1 683 gene locus_tag LOCUS_20830 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198886.1:acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta 861 1193 gene locus_tag LOCUS_20840 861 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 1186 2382 gene locus_tag LOCUS_20850 1186 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence258 21 239 gene locus_tag LOCUS_20860 21 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 226 1329 gene locus_tag LOCUS_20870 gene recF 226 1329 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_20870 1362 1784 gene locus_tag LOCUS_20880 1362 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 1786 2052 gene locus_tag LOCUS_20890 1786 2052 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence259 1587 511 gene locus_tag LOCUS_20900 1587 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1763 2392 gene locus_tag LOCUS_20910 1763 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence260 <1 759 gene locus_tag LOCUS_20920 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002456487.1:glycine--tRNA ligase 855 1778 gene locus_tag LOCUS_20930 gene rsmA 855 1778 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279637.1 protein_id gnl|my_center|LOCUS_20930 1775 2143 gene locus_tag LOCUS_20940 1775 2143 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022772.1 protein_id gnl|my_center|LOCUS_20940 >Feature sequence261 >Feature sequence262 490 65 gene locus_tag LOCUS_20950 490 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_20950 1077 523 gene locus_tag LOCUS_20960 gene efp 1077 523 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_20960 2578 1229 gene locus_tag LOCUS_20970 2578 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence263 166 1761 gene locus_tag LOCUS_20980 166 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 <2611 1801 gene locus_tag LOCUS_20990 <2611 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532944.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence264 >Feature sequence265 1238 2098 gene locus_tag LOCUS_21000 1238 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence266 1185 1541 gene locus_tag LOCUS_21010 1185 1541 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_21010 1538 1762 gene locus_tag LOCUS_21020 1538 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence267 69 1286 gene locus_tag LOCUS_21030 69 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 >Feature sequence268 709 80 gene locus_tag LOCUS_21040 709 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 905 2542 gene locus_tag LOCUS_21050 905 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence269 1790 1386 gene locus_tag LOCUS_21060 1790 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2537 1809 gene locus_tag LOCUS_21070 2537 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence270 2102 135 gene locus_tag LOCUS_21080 2102 135 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102176.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence271 1238 189 gene locus_tag LOCUS_21090 gene hydE 1238 189 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_21090 1488 1231 gene locus_tag LOCUS_21100 1488 1231 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_21100 <2546 1659 gene locus_tag LOCUS_21110 <2546 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033065833.1:aminoacyl-histidine dipeptidase >Feature sequence272 965 165 gene locus_tag LOCUS_21120 965 165 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_21120 1141 2460 gene locus_tag LOCUS_21130 gene rlmD 1141 2460 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence273 917 33 gene locus_tag LOCUS_21140 917 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1818 934 gene locus_tag LOCUS_21150 1818 934 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_21150 <2502 1929 gene locus_tag LOCUS_21160 <2502 1929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545036.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence274 1123 434 gene locus_tag LOCUS_21170 1123 434 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896360.1 protein_id gnl|my_center|LOCUS_21170 1950 1111 gene locus_tag LOCUS_21180 gene pdaA 1950 1111 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence275 56 1171 gene locus_tag LOCUS_21190 56 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 1250 2020 gene locus_tag LOCUS_21200 1250 2020 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_21200 2121 2483 gene locus_tag LOCUS_21210 2121 2483 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence276 1238 9 gene locus_tag LOCUS_21220 1238 9 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_21220 1367 2110 gene locus_tag LOCUS_21230 1367 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence277 1522 35 gene locus_tag LOCUS_21240 1522 35 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence278 >Feature sequence279 859 62 gene locus_tag LOCUS_21250 859 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 995 2209 gene locus_tag LOCUS_21260 995 2209 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence280 272 1600 gene locus_tag LOCUS_21270 gene der 272 1600 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_21270 1597 2232 gene locus_tag LOCUS_21280 gene plsY 1597 2232 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence281 1534 401 gene locus_tag LOCUS_21290 1534 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 2099 1602 gene locus_tag LOCUS_21300 2099 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence282 183 446 gene locus_tag LOCUS_21310 gene rpsO 183 446 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_21310 >Feature sequence283 1630 764 gene locus_tag LOCUS_21320 1630 764 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_21320 2264 1653 gene locus_tag LOCUS_21330 2264 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence284 2 577 gene locus_tag LOCUS_21340 2 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 588 1799 gene locus_tag LOCUS_21350 588 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence285 <1 1839 gene locus_tag LOCUS_21360 <1 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963335.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence286 2000 306 gene locus_tag LOCUS_21370 2000 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence287 >Feature sequence288 123 989 gene locus_tag LOCUS_21380 123 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1023 1619 gene locus_tag LOCUS_21390 1023 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence289 <1 801 gene locus_tag LOCUS_21400 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762692.1:AMP-binding protein 807 1475 gene locus_tag LOCUS_21410 807 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_21410 1492 1698 gene locus_tag LOCUS_21420 1492 1698 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence290 <1 550 gene locus_tag LOCUS_21430 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966244.1:UDP-glucose--hexose-1-phosphate uridylyltransferase note possible pseudo, frameshifted 514 1119 gene locus_tag LOCUS_21440 514 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21440 >Feature sequence291 254 111 gene locus_tag LOCUS_21450 254 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 580 1440 gene locus_tag LOCUS_21460 580 1440 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_21460 >Feature sequence292 1132 1500 gene locus_tag LOCUS_21470 1132 1500 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699985.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence293 1462 92 gene locus_tag LOCUS_21480 1462 92 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_21480 1925 1452 gene locus_tag LOCUS_21490 gene ybaK 1925 1452 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence294 1632 391 gene locus_tag LOCUS_21500 1632 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence295 1228 470 gene locus_tag LOCUS_21510 1228 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 <2061 1229 gene locus_tag LOCUS_21520 <2061 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964541.1:recombinase family protein note possible pseudo, internal stop codon >Feature sequence296 <1 1775 gene locus_tag LOCUS_21530 <1 1775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083312.1:FAD-binding protein >Feature sequence297 1248 280 gene locus_tag LOCUS_21540 1248 280 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024772.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence298 1872 1663 gene locus_tag LOCUS_21550 1872 1663 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence299 927 223 gene locus_tag LOCUS_21560 927 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 <2005 962 gene locus_tag LOCUS_21570 <2005 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119142.1:exo-alpha-sialidase >Feature sequence300 >Feature sequence301 1487 933 gene locus_tag LOCUS_21580 1487 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence302 <1 808 gene locus_tag LOCUS_21590 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460411.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence303 1186 197 gene locus_tag LOCUS_21600 1186 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 <1865 1200 gene locus_tag LOCUS_21610 <1865 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420839.1:redox-sensing transcriptional repressor Rex >Feature sequence304 >Feature sequence305 1800 637 gene locus_tag LOCUS_21620 1800 637 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_21620 >Feature sequence306 <1 511 gene locus_tag LOCUS_21630 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964880.1:fructose-1,6-bisphosphatase 524 1339 gene locus_tag LOCUS_21640 gene nhoA 524 1339 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence307 1311 169 gene locus_tag LOCUS_21650 1311 169 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence308 528 1382 gene locus_tag LOCUS_21660 528 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence309 <1819 386 gene locus_tag LOCUS_21670 <1819 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942746.1:glycyl radical protein >Feature sequence310 1353 448 gene locus_tag LOCUS_21680 1353 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 1765 1376 gene locus_tag LOCUS_21690 1765 1376 CDS product DUF2809 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109280.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence311 238 146 gene locus_tag LOCUS_t00270 238 146 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 422 1495 gene locus_tag LOCUS_21700 422 1495 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence312 1379 936 gene locus_tag LOCUS_21710 1379 936 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence313 1310 120 gene locus_tag LOCUS_21720 1310 120 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_21720 >Feature sequence314 <1628 559 gene locus_tag LOCUS_21730 <1628 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001108367.1:dihydroorotase >Feature sequence315 1193 417 gene locus_tag LOCUS_21740 gene ymdB 1193 417 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_21740