>Feature sequence001 237 1055 gene locus_tag LOCUS_00010 237 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1079 1441 gene locus_tag LOCUS_00020 1079 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1434 1751 gene locus_tag LOCUS_00030 1434 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1741 2070 gene locus_tag LOCUS_00040 1741 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2067 2426 gene locus_tag LOCUS_00050 2067 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2419 3015 gene locus_tag LOCUS_00060 2419 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3017 3286 gene locus_tag LOCUS_00070 3017 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3286 3474 gene locus_tag LOCUS_00080 3286 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 3477 5225 gene locus_tag LOCUS_00090 3477 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5237 6082 gene locus_tag LOCUS_00100 5237 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6075 7337 gene locus_tag LOCUS_00110 6075 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7321 7731 gene locus_tag LOCUS_00120 7321 7731 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357842.1 protein_id gnl|my_center|LOCUS_00120 7715 8461 gene locus_tag LOCUS_00130 7715 8461 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861048.1 protein_id gnl|my_center|LOCUS_00130 8827 8510 gene locus_tag LOCUS_00140 gene trxA 8827 8510 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_00140 9482 8847 gene locus_tag LOCUS_00150 9482 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 10126 9479 gene locus_tag LOCUS_00160 10126 9479 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895825.1 protein_id gnl|my_center|LOCUS_00160 11385 10126 gene locus_tag LOCUS_00170 gene hflX 11385 10126 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_00170 11674 13116 gene locus_tag LOCUS_00180 11674 13116 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948601.1 protein_id gnl|my_center|LOCUS_00180 13113 13619 gene locus_tag LOCUS_00190 gene cobO 13113 13619 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_00190 13616 14242 gene locus_tag LOCUS_00200 13616 14242 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_00200 >Feature sequence002 1467 70 gene locus_tag LOCUS_00210 1467 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 1628 3187 gene locus_tag LOCUS_00220 gene lysS 1628 3187 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_00220 3425 3249 gene locus_tag LOCUS_00230 3425 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 3553 3744 gene locus_tag LOCUS_00240 3553 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 3829 4488 gene locus_tag LOCUS_00250 3829 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4507 5238 gene locus_tag LOCUS_00260 4507 5238 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_00260 5252 5917 gene locus_tag LOCUS_00270 gene pyrE 5252 5917 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_00270 5930 6970 gene locus_tag LOCUS_00280 5930 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 10087 7106 gene locus_tag LOCUS_00290 10087 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 10346 12271 gene locus_tag LOCUS_00300 gene ftsH 10346 12271 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_00300 12261 12614 gene locus_tag LOCUS_00310 12261 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 12627 12803 gene locus_tag LOCUS_00320 12627 12803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 12875 13795 gene locus_tag LOCUS_00330 12875 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 1051 1329 gene locus_tag LOCUS_00340 1051 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 1332 2453 gene locus_tag LOCUS_00350 gene nagZ 1332 2453 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_00350 2608 4182 gene locus_tag LOCUS_00360 2608 4182 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294567.1 protein_id gnl|my_center|LOCUS_00360 4239 5894 gene locus_tag LOCUS_00370 4239 5894 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048829.1 protein_id gnl|my_center|LOCUS_00370 5951 6026 gene locus_tag LOCUS_t00010 5951 6026 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6479 7123 gene locus_tag LOCUS_00380 6479 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 7756 9087 gene locus_tag LOCUS_00390 7756 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 9238 10074 gene locus_tag LOCUS_00400 9238 10074 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_00400 10076 10786 gene locus_tag LOCUS_00410 10076 10786 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_00410 10939 11739 gene locus_tag LOCUS_00420 10939 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 11946 13190 gene locus_tag LOCUS_00430 11946 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence004 273 1607 gene locus_tag LOCUS_00440 273 1607 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_00440 1621 2166 gene locus_tag LOCUS_00450 1621 2166 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_00450 2444 2208 gene locus_tag LOCUS_00460 2444 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 3445 2828 gene locus_tag LOCUS_00470 3445 2828 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_00470 3686 3994 gene locus_tag LOCUS_00480 gene rpsF 3686 3994 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_00480 4020 4511 gene locus_tag LOCUS_00490 gene ssb 4020 4511 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981966.1 protein_id gnl|my_center|LOCUS_00490 4546 4791 gene locus_tag LOCUS_00500 gene rpsR 4546 4791 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_00500 4905 5396 gene locus_tag LOCUS_00510 4905 5396 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_00510 5389 6360 gene locus_tag LOCUS_00520 5389 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 6377 8605 gene locus_tag LOCUS_00530 6377 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 9721 8654 gene locus_tag LOCUS_00540 9721 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 10889 9801 gene locus_tag LOCUS_00550 10889 9801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 12057 10891 gene locus_tag LOCUS_00560 12057 10891 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence005 17 3823 gene locus_tag LOCUS_00570 17 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5974 3881 gene locus_tag LOCUS_00580 5974 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 6347 6135 gene locus_tag LOCUS_00590 6347 6135 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922422.1 protein_id gnl|my_center|LOCUS_00590 6457 6687 gene locus_tag LOCUS_00600 6457 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8556 6709 gene locus_tag LOCUS_00610 gene htpG 8556 6709 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_00610 9993 9055 gene locus_tag LOCUS_00620 9993 9055 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_00620 10188 11474 gene locus_tag LOCUS_00630 gene rho 10188 11474 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966173.1 protein_id gnl|my_center|LOCUS_00630 >Feature sequence006 <1 885 gene locus_tag LOCUS_00640 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924808.1:NAD(P)H-hydrate dehydratase 955 2112 gene locus_tag LOCUS_00650 gene alr 955 2112 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_00650 2145 2315 gene locus_tag LOCUS_00660 2145 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 2318 2668 gene locus_tag LOCUS_00670 2318 2668 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_00670 2799 4448 gene locus_tag LOCUS_00680 gene ade 2799 4448 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_00680 7071 4489 gene locus_tag LOCUS_00690 gene adhE 7071 4489 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035380749.1 protein_id gnl|my_center|LOCUS_00690 7299 8000 gene locus_tag LOCUS_00700 7299 8000 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_00700 7997 8296 gene locus_tag LOCUS_00710 7997 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 >Feature sequence007 1895 1074 gene locus_tag LOCUS_00720 gene pdaA 1895 1074 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 protein_id gnl|my_center|LOCUS_00720 2003 3133 gene locus_tag LOCUS_00730 2003 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3686 3183 gene locus_tag LOCUS_00740 gene nrdG 3686 3183 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_00740 5874 3748 gene locus_tag LOCUS_00750 gene nrdD 5874 3748 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_00750 6903 6283 gene locus_tag LOCUS_00760 6903 6283 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_00760 8126 6948 gene locus_tag LOCUS_00770 gene xseA 8126 6948 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_00770 <8932 8164 gene locus_tag LOCUS_00780 <8932 8164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272419.1:O-sialoglycoprotein endopeptidase >Feature sequence008 824 309 gene locus_tag LOCUS_00790 824 309 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_00790 1130 879 gene locus_tag LOCUS_00800 1130 879 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_00800 2207 1242 gene locus_tag LOCUS_00810 2207 1242 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404855.1 protein_id gnl|my_center|LOCUS_00810 2980 2210 gene locus_tag LOCUS_00820 2980 2210 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_00820 3362 2994 gene locus_tag LOCUS_00830 3362 2994 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861394.1 protein_id gnl|my_center|LOCUS_00830 3856 3380 gene locus_tag LOCUS_00840 3856 3380 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_00840 4629 3868 gene locus_tag LOCUS_00850 4629 3868 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_00850 5891 4629 gene locus_tag LOCUS_00860 5891 4629 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_00860 6685 5888 gene locus_tag LOCUS_00870 6685 5888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_00870 7507 6701 gene locus_tag LOCUS_00880 7507 6701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_00880 8561 7521 gene locus_tag LOCUS_00890 8561 7521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_00890 >Feature sequence009 605 18 gene locus_tag LOCUS_00900 605 18 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_00900 864 1304 gene locus_tag LOCUS_00910 gene rplM 864 1304 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_00910 1318 1713 gene locus_tag LOCUS_00920 gene rpsI 1318 1713 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_00920 2135 3514 gene locus_tag LOCUS_00930 2135 3514 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_00930 5800 3557 gene locus_tag LOCUS_00940 5800 3557 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_00940 7140 5797 gene locus_tag LOCUS_00950 7140 5797 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075273.1 protein_id gnl|my_center|LOCUS_00950 7267 7839 gene locus_tag LOCUS_00960 7267 7839 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_00960 8032 7865 gene locus_tag LOCUS_00970 8032 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 8276 8049 gene locus_tag LOCUS_00980 8276 8049 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence010 445 1305 gene locus_tag LOCUS_00990 gene rapZ 445 1305 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_00990 1317 2294 gene locus_tag LOCUS_01000 1317 2294 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891913.1 protein_id gnl|my_center|LOCUS_01000 2317 3018 gene locus_tag LOCUS_01010 gene whiA 2317 3018 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01010 3032 3172 gene locus_tag LOCUS_01020 3032 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 3567 3223 gene locus_tag LOCUS_01030 gene rplQ 3567 3223 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_01030 4533 3583 gene locus_tag LOCUS_01040 4533 3583 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966385.1 protein_id gnl|my_center|LOCUS_01040 5232 4639 gene locus_tag LOCUS_01050 gene rpsD 5232 4639 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_01050 5665 5267 gene locus_tag LOCUS_01060 gene rpsK 5665 5267 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_01060 6053 5685 gene locus_tag LOCUS_01070 gene rpsM 6053 5685 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_01070 6570 6352 gene locus_tag LOCUS_01080 gene infA 6570 6352 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_01080 6865 6596 gene locus_tag LOCUS_01090 6865 6596 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966390.1 protein_id gnl|my_center|LOCUS_01090 7670 6924 gene locus_tag LOCUS_01100 gene map 7670 6924 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_01100 <8254 7689 gene locus_tag LOCUS_01110 <8254 7689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878179.1:adenylate kinase >Feature sequence011 1804 611 gene locus_tag LOCUS_01120 gene coaBC 1804 611 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_01120 1945 4788 gene locus_tag LOCUS_01130 1945 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4793 5707 gene locus_tag LOCUS_01140 4793 5707 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_01140 5707 6390 gene locus_tag LOCUS_01150 gene cobI 5707 6390 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870276.1 protein_id gnl|my_center|LOCUS_01150 6455 6814 gene locus_tag LOCUS_01160 6455 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6836 7897 gene locus_tag LOCUS_01170 6836 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence012 <1 603 gene locus_tag LOCUS_01180 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966383.1:energy-coupling factor transporter ATPase 596 1459 gene locus_tag LOCUS_01190 596 1459 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_01190 1452 2270 gene locus_tag LOCUS_01200 1452 2270 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_01200 2287 3471 gene locus_tag LOCUS_01210 2287 3471 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_01210 3525 5375 gene locus_tag LOCUS_01220 gene asnB 3525 5375 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233080.1 protein_id gnl|my_center|LOCUS_01220 5444 5881 gene locus_tag LOCUS_01230 gene ohrR 5444 5881 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_01230 7773 6046 gene locus_tag LOCUS_01240 7773 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 8103 7882 gene locus_tag LOCUS_01250 8103 7882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence013 464 712 gene locus_tag LOCUS_01260 464 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 703 1389 gene locus_tag LOCUS_01270 703 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 1439 2107 gene locus_tag LOCUS_01280 gene sleB 1439 2107 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_01280 2141 2293 gene locus_tag LOCUS_01290 2141 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 3080 2325 gene locus_tag LOCUS_01300 3080 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 4247 3111 gene locus_tag LOCUS_01310 4247 3111 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_01310 4989 4420 gene locus_tag LOCUS_01320 4989 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 5318 6130 gene locus_tag LOCUS_01330 gene proB 5318 6130 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287451.1 protein_id gnl|my_center|LOCUS_01330 6135 7382 gene locus_tag LOCUS_01340 6135 7382 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence014 2650 1310 gene locus_tag LOCUS_01350 gene tilS 2650 1310 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_01350 4008 2647 gene locus_tag LOCUS_01360 4008 2647 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_01360 4476 4030 gene locus_tag LOCUS_01370 gene rplI 4476 4030 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_01370 6510 4495 gene locus_tag LOCUS_01380 6510 4495 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_01380 6852 6550 gene locus_tag LOCUS_01390 6852 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 <7841 6998 gene locus_tag LOCUS_01400 <7841 6998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966448.1:3-isopropylmalate dehydrogenase >Feature sequence015 371 72 gene locus_tag LOCUS_01410 371 72 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158343.1 protein_id gnl|my_center|LOCUS_01410 630 2294 gene locus_tag LOCUS_01420 gene ptsP 630 2294 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_01420 2501 3787 gene locus_tag LOCUS_01430 2501 3787 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_01430 3883 4908 gene locus_tag LOCUS_01440 gene galE 3883 4908 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_01440 5101 5994 gene locus_tag LOCUS_01450 5101 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6003 6458 gene locus_tag LOCUS_01460 6003 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 >Feature sequence016 1147 158 gene locus_tag LOCUS_01470 1147 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 1340 1415 gene locus_tag LOCUS_t00020 1340 1415 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1605 1681 gene locus_tag LOCUS_t00030 1605 1681 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1708 1783 gene locus_tag LOCUS_t00040 1708 1783 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1842 1916 gene locus_tag LOCUS_t00050 1842 1916 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1965 2039 gene locus_tag LOCUS_t00060 1965 2039 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2237 3436 gene locus_tag LOCUS_01480 2237 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3433 4398 gene locus_tag LOCUS_01490 gene dusB 3433 4398 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_01490 4651 4439 gene locus_tag LOCUS_01500 4651 4439 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_01500 4783 5187 gene locus_tag LOCUS_01510 4783 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6794 5337 gene locus_tag LOCUS_01520 gene guaB 6794 5337 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264088.1 protein_id gnl|my_center|LOCUS_01520 <7694 6992 gene locus_tag LOCUS_01530 <7694 6992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680734.1:2-hydroxycarboxylate transporter family protein >Feature sequence017 44 427 gene locus_tag LOCUS_01540 44 427 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_01540 506 2134 gene locus_tag LOCUS_01550 506 2134 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107726402.1 protein_id gnl|my_center|LOCUS_01550 2131 2307 gene locus_tag LOCUS_01560 2131 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2304 2852 gene locus_tag LOCUS_01570 2304 2852 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456102.1 protein_id gnl|my_center|LOCUS_01570 2865 3209 gene locus_tag LOCUS_01580 2865 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 3187 3900 gene locus_tag LOCUS_01590 3187 3900 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 protein_id gnl|my_center|LOCUS_01590 6587 3945 gene locus_tag LOCUS_01600 6587 3945 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_01600 6803 6618 gene locus_tag LOCUS_01610 6803 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6980 7252 gene locus_tag LOCUS_01620 gene spoIIID 6980 7252 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence018 <1 687 gene locus_tag LOCUS_01630 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947977.1:CTP synthase 715 2463 gene locus_tag LOCUS_01640 715 2463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798723.1 protein_id gnl|my_center|LOCUS_01640 2464 4137 gene locus_tag LOCUS_01650 2464 4137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802963.1 protein_id gnl|my_center|LOCUS_01650 4339 6345 gene locus_tag LOCUS_01660 4339 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6336 6482 gene locus_tag LOCUS_01670 6336 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 6512 7315 gene locus_tag LOCUS_01680 6512 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence019 <1 903 gene locus_tag LOCUS_01690 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943700.1:cell wall-binding repeat-containing protein 1033 2343 gene locus_tag LOCUS_01700 1033 2343 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962350.1 protein_id gnl|my_center|LOCUS_01700 3133 3364 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tagaaataccaaacagcgtcacaag 4840 6819 gene locus_tag LOCUS_01710 4840 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 7320 6964 gene locus_tag LOCUS_01720 7320 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence020 449 1294 gene locus_tag LOCUS_01730 449 1294 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_01730 1779 1306 gene locus_tag LOCUS_01740 1779 1306 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_01740 2744 1800 gene locus_tag LOCUS_01750 2744 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5263 2744 gene locus_tag LOCUS_01760 gene gyrA 5263 2744 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_01760 6118 5381 gene locus_tag LOCUS_01770 6118 5381 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_01770 6404 6111 gene locus_tag LOCUS_01780 6404 6111 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_01780 6593 7273 gene locus_tag LOCUS_01790 6593 7273 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence021 1723 1962 gene locus_tag LOCUS_01800 1723 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3289 2018 gene locus_tag LOCUS_01810 3289 2018 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068784.1 protein_id gnl|my_center|LOCUS_01810 5109 3760 gene locus_tag LOCUS_01820 5109 3760 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_01820 5246 5407 gene locus_tag LOCUS_01830 5246 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5647 6006 gene locus_tag LOCUS_01840 5647 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6032 6715 gene locus_tag LOCUS_01850 6032 6715 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence022 <1 1873 gene locus_tag LOCUS_01860 <1 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791356.1:heavy metal translocating P-type ATPase 2598 4124 gene locus_tag LOCUS_01870 2598 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence023 1029 2345 gene locus_tag LOCUS_01880 gene secD 1029 2345 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291172.1 protein_id gnl|my_center|LOCUS_01880 2338 3414 gene locus_tag LOCUS_01890 gene secF 2338 3414 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_01890 4587 3472 gene locus_tag LOCUS_01900 4587 3472 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_01900 4931 4590 gene locus_tag LOCUS_01910 4931 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01910 5771 4935 gene locus_tag LOCUS_01920 5771 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01920 <6864 5768 gene locus_tag LOCUS_01930 <6864 5768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964048.1:AI-2E family transporter >Feature sequence024 867 31 gene locus_tag LOCUS_01940 gene xerD 867 31 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806640.1 protein_id gnl|my_center|LOCUS_01940 2943 1279 gene locus_tag LOCUS_01950 2943 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4097 2964 gene locus_tag LOCUS_01960 4097 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4986 4111 gene locus_tag LOCUS_01970 4986 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 5247 6500 gene locus_tag LOCUS_01980 5247 6500 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_01980 >Feature sequence025 1785 1078 gene locus_tag LOCUS_01990 1785 1078 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_01990 3230 1893 gene locus_tag LOCUS_02000 3230 1893 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_02000 3393 4538 gene locus_tag LOCUS_02010 3393 4538 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_02010 5395 4469 gene locus_tag LOCUS_02020 5395 4469 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_02020 5484 6410 gene locus_tag LOCUS_02030 5484 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence026 2401 614 gene locus_tag LOCUS_02040 2401 614 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814582.1 protein_id gnl|my_center|LOCUS_02040 4155 2398 gene locus_tag LOCUS_02050 4155 2398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_02050 4560 4886 gene locus_tag LOCUS_02060 4560 4886 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_02060 6371 4953 gene locus_tag LOCUS_02070 6371 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence027 78 2453 gene locus_tag LOCUS_02080 gene pheT 78 2453 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_02080 2600 5095 gene locus_tag LOCUS_02090 2600 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 5132 5782 gene locus_tag LOCUS_02100 5132 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6639 5824 gene locus_tag LOCUS_02110 6639 5824 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence028 <1 1279 gene locus_tag LOCUS_02120 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000665473.1:Na+/H+ antiporter NhaC family protein 2291 1335 gene locus_tag LOCUS_02130 2291 1335 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_02130 3606 2281 gene locus_tag LOCUS_02140 3606 2281 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602473.1 protein_id gnl|my_center|LOCUS_02140 5492 3609 gene locus_tag LOCUS_02150 5492 3609 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963745.1 protein_id gnl|my_center|LOCUS_02150 6617 5631 gene locus_tag LOCUS_02160 6617 5631 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896952.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence029 408 1988 gene locus_tag LOCUS_02170 gene rny 408 1988 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_02170 2296 3081 gene locus_tag LOCUS_02180 gene ymdB 2296 3081 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_02180 3667 3113 gene locus_tag LOCUS_02190 3667 3113 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_02190 4227 3664 gene locus_tag LOCUS_02200 4227 3664 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_02200 4367 5761 gene locus_tag LOCUS_02210 4367 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6459 5863 gene locus_tag LOCUS_02220 6459 5863 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890784.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence030 3098 1338 gene locus_tag LOCUS_02230 3098 1338 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_02230 3724 3119 gene locus_tag LOCUS_02240 3724 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4044 3736 gene locus_tag LOCUS_02250 4044 3736 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_02250 4486 4058 gene locus_tag LOCUS_02260 4486 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 <6468 4612 gene locus_tag LOCUS_02270 <6468 4612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869273.1:V-type ATPase 116kDa subunit family protein >Feature sequence031 5595 3055 gene locus_tag LOCUS_02280 5595 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 <6311 5768 gene locus_tag LOCUS_02290 <6311 5768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392053.1:GerMN domain-containing protein >Feature sequence032 75 1571 gene locus_tag LOCUS_02300 75 1571 CDS product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209898.1 protein_id gnl|my_center|LOCUS_02300 2191 1628 gene locus_tag LOCUS_02310 2191 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2432 3373 gene locus_tag LOCUS_02320 2432 3373 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_02320 3370 4248 gene locus_tag LOCUS_02330 3370 4248 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_02330 4282 5871 gene locus_tag LOCUS_02340 4282 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence033 2366 279 gene locus_tag LOCUS_02350 2366 279 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_02350 3455 2445 gene locus_tag LOCUS_02360 gene asnA 3455 2445 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284917.1 protein_id gnl|my_center|LOCUS_02360 4381 3641 gene locus_tag LOCUS_02370 4381 3641 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867289.1 protein_id gnl|my_center|LOCUS_02370 5940 4393 gene locus_tag LOCUS_02380 gene cls 5940 4393 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence034 2186 1233 gene locus_tag LOCUS_02390 2186 1233 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_02390 3293 2199 gene locus_tag LOCUS_02400 gene ychF 3293 2199 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_02400 3438 4124 gene locus_tag LOCUS_02410 3438 4124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_02410 4138 5556 gene locus_tag LOCUS_02420 4138 5556 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence035 <1 1638 gene locus_tag LOCUS_02430 <1 1638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965091.1:type I DNA topoisomerase 1628 2938 gene locus_tag LOCUS_02440 gene trmFO 1628 2938 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_02440 2940 3377 gene locus_tag LOCUS_02450 2940 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3476 4342 gene locus_tag LOCUS_02460 gene gpr 3476 4342 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460511.1 protein_id gnl|my_center|LOCUS_02460 4464 4742 gene locus_tag LOCUS_02470 4464 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5517 4735 gene locus_tag LOCUS_02480 5517 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence036 1146 2780 gene locus_tag LOCUS_02490 1146 2780 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361446.1 protein_id gnl|my_center|LOCUS_02490 4411 2834 gene locus_tag LOCUS_02500 4411 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4547 5119 gene locus_tag LOCUS_02510 4547 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence037 289 765 gene locus_tag LOCUS_02520 gene coaD 289 765 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_02520 843 1304 gene locus_tag LOCUS_02530 843 1304 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460509.1 protein_id gnl|my_center|LOCUS_02530 1387 3057 gene locus_tag LOCUS_02540 1387 3057 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048375.1 protein_id gnl|my_center|LOCUS_02540 3059 3484 gene locus_tag LOCUS_02550 gene tsaE 3059 3484 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_02550 3484 4200 gene locus_tag LOCUS_02560 gene tsaB 3484 4200 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_02560 4181 4621 gene locus_tag LOCUS_02570 gene rpiB 4181 4621 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_02570 4728 5726 gene locus_tag LOCUS_02580 gene pta 4728 5726 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence038 1259 636 gene locus_tag LOCUS_02590 gene thiE 1259 636 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_02590 2025 1261 gene locus_tag LOCUS_02600 gene thiM 2025 1261 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986722.1 protein_id gnl|my_center|LOCUS_02600 2562 2026 gene locus_tag LOCUS_02610 gene thiW 2562 2026 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870435.1 protein_id gnl|my_center|LOCUS_02610 3803 2790 gene locus_tag LOCUS_02620 gene cytX 3803 2790 CDS product putative hydroxymethylpyrimidine transporter CytX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225706.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02620 3986 3858 gene locus_tag LOCUS_02630 3986 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 4299 4226 gene locus_tag LOCUS_t00070 4299 4226 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <5821 4370 gene locus_tag LOCUS_02640 <5821 4370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389449.1:glycoside hydrolase N-terminal domain-containing protein >Feature sequence039 1008 487 gene locus_tag LOCUS_02650 1008 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 1905 1012 gene locus_tag LOCUS_02660 1905 1012 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948636.1 protein_id gnl|my_center|LOCUS_02660 2683 1925 gene locus_tag LOCUS_02670 2683 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 3690 2680 gene locus_tag LOCUS_02680 3690 2680 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_02680 4825 3683 gene locus_tag LOCUS_02690 4825 3683 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_02690 5234 4815 gene locus_tag LOCUS_02700 5234 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence040 669 247 gene locus_tag LOCUS_02710 669 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1350 910 gene locus_tag LOCUS_02720 1350 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 2111 1365 gene locus_tag LOCUS_02730 2111 1365 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 protein_id gnl|my_center|LOCUS_02730 2624 2172 gene locus_tag LOCUS_02740 2624 2172 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_02740 3344 2649 gene locus_tag LOCUS_02750 3344 2649 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_02750 4553 3369 gene locus_tag LOCUS_02760 4553 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 5725 4697 gene locus_tag LOCUS_02770 5725 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence041 474 1571 gene locus_tag LOCUS_02780 gene recA 474 1571 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113623.1 protein_id gnl|my_center|LOCUS_02780 1748 2011 gene locus_tag LOCUS_02790 1748 2011 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_02790 2092 3972 gene locus_tag LOCUS_02800 gene uvrC 2092 3972 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02800 3953 4753 gene locus_tag LOCUS_02810 gene pgeF 3953 4753 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence042 894 2276 gene locus_tag LOCUS_02820 gene purF 894 2276 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_02820 2295 3635 gene locus_tag LOCUS_02830 2295 3635 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_02830 3785 4615 gene locus_tag LOCUS_02840 gene panB 3785 4615 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_02840 4603 5442 gene locus_tag LOCUS_02850 gene panC 4603 5442 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence043 <1 886 gene locus_tag LOCUS_02860 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392969.1:S-layer homology domain-containing protein 893 1192 gene locus_tag LOCUS_02870 893 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1309 5595 gene locus_tag LOCUS_02880 1309 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence044 5401 1892 gene locus_tag LOCUS_02890 gene addB 5401 1892 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence045 1530 445 gene locus_tag LOCUS_02900 1530 445 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_02900 1731 3344 gene locus_tag LOCUS_02910 1731 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3980 3366 gene locus_tag LOCUS_02920 gene spoIIR 3980 3366 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966181.1 protein_id gnl|my_center|LOCUS_02920 4095 5450 gene locus_tag LOCUS_02930 gene ypeB 4095 5450 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966179.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence046 283 774 gene locus_tag LOCUS_02940 283 774 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_02940 862 1827 gene locus_tag LOCUS_02950 862 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1840 2295 gene locus_tag LOCUS_02960 1840 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2363 2740 gene locus_tag LOCUS_02970 2363 2740 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898216.1 protein_id gnl|my_center|LOCUS_02970 2758 3195 gene locus_tag LOCUS_02980 2758 3195 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189433.1 protein_id gnl|my_center|LOCUS_02980 3310 4380 gene locus_tag LOCUS_02990 3310 4380 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence047 400 2772 gene locus_tag LOCUS_03000 400 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4532 2868 gene locus_tag LOCUS_03010 gene ilvD 4532 2868 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861428.1 protein_id gnl|my_center|LOCUS_03010 5200 4553 gene locus_tag LOCUS_03020 5200 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 >Feature sequence048 1359 883 gene locus_tag LOCUS_03030 gene rlmH 1359 883 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243164.1 protein_id gnl|my_center|LOCUS_03030 2145 1369 gene locus_tag LOCUS_03040 2145 1369 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_03040 3472 2192 gene locus_tag LOCUS_03050 3472 2192 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_03050 3826 3641 gene locus_tag LOCUS_03060 gene rpmB 3826 3641 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_03060 4091 5035 gene locus_tag LOCUS_03070 gene hprK 4091 5035 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_03070 5045 5233 gene locus_tag LOCUS_03080 5045 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03080 >Feature sequence049 336 1862 gene locus_tag LOCUS_03090 gene guaA 336 1862 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_03090 1957 3978 gene locus_tag LOCUS_03100 1957 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 5261 4911 gene locus_tag LOCUS_03110 5261 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence050 684 965 gene locus_tag LOCUS_03120 gene spoVG 684 965 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_03120 1084 1914 gene locus_tag LOCUS_03130 1084 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2276 3379 gene locus_tag LOCUS_03140 gene asd 2276 3379 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_03140 3392 4282 gene locus_tag LOCUS_03150 gene dapA 3392 4282 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_03150 4297 5055 gene locus_tag LOCUS_03160 gene dapB 4297 5055 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence051 2 238 gene locus_tag LOCUS_03170 2 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 273 677 gene locus_tag LOCUS_03180 gene mgsA 273 677 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_03180 789 1928 gene locus_tag LOCUS_03190 789 1928 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_03190 1941 2432 gene locus_tag LOCUS_03200 gene trmL 1941 2432 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_03200 2445 3332 gene locus_tag LOCUS_03210 2445 3332 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_03210 3350 4540 gene locus_tag LOCUS_03220 gene ytvI 3350 4540 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198961.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence052 1992 238 gene locus_tag LOCUS_03230 gene pyk 1992 238 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_03230 3033 2056 gene locus_tag LOCUS_03240 gene pfkA 3033 2056 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_03240 3255 3058 gene locus_tag LOCUS_03250 3255 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3509 3294 gene locus_tag LOCUS_03260 gene mtrB 3509 3294 CDS product trp RNA-binding attenuation protein MtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393370.1 protein_id gnl|my_center|LOCUS_03260 <5269 3646 gene locus_tag LOCUS_03270 <5269 3646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963838.1:DNA polymerase III subunit alpha >Feature sequence053 420 1484 gene locus_tag LOCUS_03280 420 1484 CDS product sulfate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942002.1 protein_id gnl|my_center|LOCUS_03280 1615 3294 gene locus_tag LOCUS_03290 1615 3294 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_03290 3278 3592 gene locus_tag LOCUS_03300 3278 3592 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_03300 3606 4505 gene locus_tag LOCUS_03310 gene cysD 3606 4505 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence054 <1 506 gene locus_tag LOCUS_03320 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052226.1:orotidine-5'-phosphate decarboxylase 632 1402 gene locus_tag LOCUS_03330 gene pyrK 632 1402 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232111.1 protein_id gnl|my_center|LOCUS_03330 1395 2306 gene locus_tag LOCUS_03340 1395 2306 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_03340 2496 4295 gene locus_tag LOCUS_03350 gene dnaG 2496 4295 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence055 <1 4551 gene locus_tag LOCUS_03360 <1 4551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109136.1:rhamnogalacturonan acetylesterase 4859 4668 gene locus_tag LOCUS_03370 4859 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence056 2 328 gene locus_tag LOCUS_03380 2 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 361 1905 gene locus_tag LOCUS_03390 361 1905 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_03390 1953 4073 gene locus_tag LOCUS_03400 1953 4073 CDS product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286368.1 protein_id gnl|my_center|LOCUS_03400 4146 4919 gene locus_tag LOCUS_03410 4146 4919 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771997.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence057 <1 602 gene locus_tag LOCUS_03420 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392054.1:N-acetylmuramoyl-L-alanine amidase 749 1141 gene locus_tag LOCUS_03430 749 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1128 1850 gene locus_tag LOCUS_03440 gene atpB 1128 1850 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_03440 1871 2125 gene locus_tag LOCUS_03450 gene atpE 1871 2125 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_03450 2150 2644 gene locus_tag LOCUS_03460 gene atpF 2150 2644 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393038.1 protein_id gnl|my_center|LOCUS_03460 2658 3185 gene locus_tag LOCUS_03470 gene atpH 2658 3185 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641440.1 protein_id gnl|my_center|LOCUS_03470 3196 4692 gene locus_tag LOCUS_03480 gene atpA 3196 4692 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence058 2622 4997 gene locus_tag LOCUS_03490 2622 4997 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202078.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence059 104 529 gene locus_tag LOCUS_03500 104 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03500 721 1323 gene locus_tag LOCUS_03510 gene thrH 721 1323 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_03510 1652 1377 gene locus_tag LOCUS_03520 1652 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2176 1658 gene locus_tag LOCUS_03530 2176 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3313 2180 gene locus_tag LOCUS_03540 3313 2180 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_03540 3671 4849 gene locus_tag LOCUS_03550 gene nifS 3671 4849 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence060 <1 890 gene locus_tag LOCUS_03560 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963539.1:M42 family metallopeptidase 890 1867 gene locus_tag LOCUS_03570 890 1867 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_03570 1882 2535 gene locus_tag LOCUS_03580 1882 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 3574 2540 gene locus_tag LOCUS_03590 3574 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3717 4574 gene locus_tag LOCUS_03600 3717 4574 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence061 4539 3835 gene locus_tag LOCUS_03610 4539 3835 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296505.1 protein_id gnl|my_center|LOCUS_03610 4905 4591 gene locus_tag LOCUS_03620 gene rhaM 4905 4591 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288247.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence062 <1 916 gene locus_tag LOCUS_03630 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393769.1:ornithine carbamoyltransferase 1070 1564 gene locus_tag LOCUS_03640 1070 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 3141 1657 gene locus_tag LOCUS_03650 gene malQ 3141 1657 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_03650 3806 3138 gene locus_tag LOCUS_03660 3806 3138 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_03660 4417 4731 gene locus_tag LOCUS_03670 gene rpsJ 4417 4731 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720954.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence063 1067 78 gene locus_tag LOCUS_03680 1067 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1989 1009 gene locus_tag LOCUS_03690 1989 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2239 1982 gene locus_tag LOCUS_03700 gene yidD 2239 1982 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_03700 2568 2236 gene locus_tag LOCUS_03710 gene rnpA 2568 2236 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_03710 2785 2651 gene locus_tag LOCUS_03720 2785 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 2991 3722 gene locus_tag LOCUS_03730 2991 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4592 3783 gene locus_tag LOCUS_03740 gene noc 4592 3783 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence064 2343 496 gene locus_tag LOCUS_03750 gene dxs 2343 496 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_03750 2937 2347 gene locus_tag LOCUS_03760 2937 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence065 <1 688 gene locus_tag LOCUS_03770 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963429.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 685 1095 gene locus_tag LOCUS_03780 685 1095 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419409.1 protein_id gnl|my_center|LOCUS_03780 1116 1913 gene locus_tag LOCUS_03790 1116 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 3218 1923 gene locus_tag LOCUS_03800 gene hemL 3218 1923 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398699.1 protein_id gnl|my_center|LOCUS_03800 3317 4306 gene locus_tag LOCUS_03810 gene hemA 3317 4306 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence066 296 1996 gene locus_tag LOCUS_03820 gene argS 296 1996 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_03820 1998 2210 gene locus_tag LOCUS_03830 1998 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 2491 2234 gene locus_tag LOCUS_03840 2491 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3353 2511 gene locus_tag LOCUS_03850 gene rsmA 3353 2511 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_03850 <4602 3367 gene locus_tag LOCUS_03860 <4602 3367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966319.1:isoleucine--tRNA ligase >Feature sequence067 972 136 gene locus_tag LOCUS_03870 972 136 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_03870 2779 977 gene locus_tag LOCUS_03880 2779 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3582 2806 gene locus_tag LOCUS_03890 3582 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3865 3701 gene locus_tag LOCUS_03900 3865 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4204 3914 gene locus_tag LOCUS_03910 4204 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence068 <1 953 gene locus_tag LOCUS_03920 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861232.1:EAL domain-containing protein 971 2182 gene locus_tag LOCUS_03930 971 2182 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_03930 2601 2230 gene locus_tag LOCUS_03940 gene ridA 2601 2230 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047539.1 protein_id gnl|my_center|LOCUS_03940 3495 2623 gene locus_tag LOCUS_03950 3495 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence069 57 1043 gene locus_tag LOCUS_03960 gene mgrA 57 1043 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 protein_id gnl|my_center|LOCUS_03960 1435 1253 gene locus_tag LOCUS_03970 1435 1253 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_03970 3564 1531 gene locus_tag LOCUS_03980 gene recG 3564 1531 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_03980 <4563 3576 gene locus_tag LOCUS_03990 <4563 3576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004440884.1:DAK2 domain-containing protein >Feature sequence070 547 4284 gene locus_tag LOCUS_04000 gene rpoB 547 4284 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence071 3230 1497 gene locus_tag LOCUS_04010 3230 1497 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence072 454 1041 gene locus_tag LOCUS_04020 gene coaE 454 1041 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_04020 1046 1684 gene locus_tag LOCUS_04030 1046 1684 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964415.1 protein_id gnl|my_center|LOCUS_04030 1720 2352 gene locus_tag LOCUS_04040 1720 2352 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_04040 2464 3195 gene locus_tag LOCUS_04050 2464 3195 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence073 912 436 gene locus_tag LOCUS_04060 912 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1355 909 gene locus_tag LOCUS_04070 1355 909 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_04070 2255 1374 gene locus_tag LOCUS_04080 2255 1374 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_04080 4192 2252 gene locus_tag LOCUS_04090 4192 2252 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence074 653 393 gene locus_tag LOCUS_04100 653 393 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810291.1 protein_id gnl|my_center|LOCUS_04100 1341 703 gene locus_tag LOCUS_04110 1341 703 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_04110 1865 1590 gene locus_tag LOCUS_04120 gene pduA 1865 1590 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_04120 2563 1955 gene locus_tag LOCUS_04130 2563 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2975 2700 gene locus_tag LOCUS_04140 gene pduA 2975 2700 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_04140 3329 2988 gene locus_tag LOCUS_04150 3329 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4449 3364 gene locus_tag LOCUS_04160 4449 3364 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015646101.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence075 <1 762 gene locus_tag LOCUS_04170 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582815.1:rhamnulokinase family protein 869 2152 gene locus_tag LOCUS_04180 869 2152 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_04180 2157 2822 gene locus_tag LOCUS_04190 2157 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2822 3724 gene locus_tag LOCUS_04200 2822 3724 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence076 1222 953 gene locus_tag LOCUS_04210 1222 953 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112985.1 protein_id gnl|my_center|LOCUS_04210 1955 1224 gene locus_tag LOCUS_04220 gene rlmB 1955 1224 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_04220 3301 2093 gene locus_tag LOCUS_04230 3301 2093 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_04230 <4324 3332 gene locus_tag LOCUS_04240 <4324 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986436.1:homoserine dehydrogenase >Feature sequence077 2 202 gene locus_tag LOCUS_04250 2 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 205 1161 gene locus_tag LOCUS_04260 205 1161 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_04260 1818 1210 gene locus_tag LOCUS_04270 1818 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2670 1840 gene locus_tag LOCUS_04280 2670 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3651 2770 gene locus_tag LOCUS_04290 gene ispE 3651 2770 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_04290 <4320 3668 gene locus_tag LOCUS_04300 <4320 3668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358964.1:TlyA family rRNA (cytidine-2'-O)-methyltransferase >Feature sequence078 2495 3640 gene locus_tag LOCUS_04310 gene aroC 2495 3640 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_04310 3676 4245 gene locus_tag LOCUS_04320 3676 4245 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence079 1453 260 gene locus_tag LOCUS_04330 1453 260 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963477.1 protein_id gnl|my_center|LOCUS_04330 1929 1450 gene locus_tag LOCUS_04340 1929 1450 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_04340 2821 1916 gene locus_tag LOCUS_04350 2821 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4107 2848 gene locus_tag LOCUS_04360 gene purD 4107 2848 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence080 1470 259 gene locus_tag LOCUS_04370 1470 259 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943321.1 protein_id gnl|my_center|LOCUS_04370 2327 1485 gene locus_tag LOCUS_04380 gene dapF 2327 1485 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_04380 2862 2338 gene locus_tag LOCUS_04390 2862 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4208 2895 gene locus_tag LOCUS_04400 gene glnA 4208 2895 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence081 <1 627 gene locus_tag LOCUS_04410 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963607.1:NAD-dependent protein deacylase 624 1211 gene locus_tag LOCUS_04420 624 1211 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215722.1 protein_id gnl|my_center|LOCUS_04420 1375 1181 gene locus_tag LOCUS_04430 1375 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1506 3317 gene locus_tag LOCUS_04440 gene lepA 1506 3317 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence082 409 1596 gene locus_tag LOCUS_04450 409 1596 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_04450 1593 2087 gene locus_tag LOCUS_04460 1593 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2092 3423 gene locus_tag LOCUS_04470 gene rimO 2092 3423 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_04470 3420 3980 gene locus_tag LOCUS_04480 gene pgsA 3420 3980 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244753.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence083 1530 166 gene locus_tag LOCUS_04490 1530 166 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_04490 2965 1565 gene locus_tag LOCUS_04500 gene uxaC 2965 1565 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_04500 <4196 3145 gene locus_tag LOCUS_04510 <4196 3145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234625.1:zinc metallochaperone ZinU >Feature sequence084 168 1841 gene locus_tag LOCUS_04520 gene recN 168 1841 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_04520 1845 2321 gene locus_tag LOCUS_04530 1845 2321 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941462.1 protein_id gnl|my_center|LOCUS_04530 2388 2861 gene locus_tag LOCUS_04540 gene smpB 2388 2861 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_04540 3037 2888 gene locus_tag LOCUS_04550 3037 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3144 3332 gene locus_tag LOCUS_04560 3144 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3647 3408 gene locus_tag LOCUS_04570 3647 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3930 3664 gene locus_tag LOCUS_04580 3930 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence085 <1 2010 gene locus_tag LOCUS_04590 <1 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572298.1:helicase-exonuclease AddAB subunit AddA 2034 2411 gene locus_tag LOCUS_04600 2034 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2539 2688 gene locus_tag LOCUS_04610 gene rpmG 2539 2688 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_04610 2727 2963 gene locus_tag LOCUS_04620 2727 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 3001 3525 gene locus_tag LOCUS_04630 gene nusG 3001 3525 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_04630 3664 4089 gene locus_tag LOCUS_04640 gene rplK 3664 4089 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence086 1788 160 gene locus_tag LOCUS_04650 1788 160 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_04650 2225 1929 gene locus_tag LOCUS_04660 2225 1929 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_04660 2825 2241 gene locus_tag LOCUS_04670 2825 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3767 2862 gene locus_tag LOCUS_04680 3767 2862 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence087 517 119 gene locus_tag LOCUS_04690 517 119 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_04690 920 504 gene locus_tag LOCUS_04700 920 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1119 2444 gene locus_tag LOCUS_04710 gene rsxC 1119 2444 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_04710 2434 3387 gene locus_tag LOCUS_04720 2434 3387 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_04720 3384 3980 gene locus_tag LOCUS_04730 3384 3980 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence088 <4166 3605 gene locus_tag LOCUS_04740 <4166 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094015776.1:S-layer homology domain-containing protein >Feature sequence089 24 278 gene locus_tag LOCUS_04750 24 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 699 1019 gene locus_tag LOCUS_04760 699 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1054 1500 gene locus_tag LOCUS_04770 1054 1500 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723740.1 protein_id gnl|my_center|LOCUS_04770 1571 3649 gene locus_tag LOCUS_04780 1571 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence090 2404 1460 gene locus_tag LOCUS_04790 2404 1460 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_04790 3763 2507 gene locus_tag LOCUS_04800 3763 2507 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence091 434 1279 gene locus_tag LOCUS_04810 434 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1405 2571 gene locus_tag LOCUS_04820 1405 2571 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963926.1 protein_id gnl|my_center|LOCUS_04820 <4131 2599 gene locus_tag LOCUS_04830 <4131 2599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence092 >Feature sequence093 1052 33 gene locus_tag LOCUS_04840 gene cbiB 1052 33 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_04840 1606 1049 gene locus_tag LOCUS_04850 1606 1049 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549678.1 protein_id gnl|my_center|LOCUS_04850 1929 1603 gene locus_tag LOCUS_04860 1929 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2749 1943 gene locus_tag LOCUS_04870 gene cobS 2749 1943 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_04870 3258 2737 gene locus_tag LOCUS_04880 gene cobU 3258 2737 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_04880 <4080 3258 gene locus_tag LOCUS_04890 <4080 3258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964681.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase >Feature sequence094 1750 905 gene locus_tag LOCUS_04900 gene cdaA 1750 905 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_04900 2989 1919 gene locus_tag LOCUS_04910 gene mnmA 2989 1919 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_04910 <4051 3080 gene locus_tag LOCUS_04920 <4051 3080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081140.1:acyltransferase >Feature sequence095 >Feature sequence096 99 1634 gene locus_tag LOCUS_04930 gene putP 99 1634 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_04930 1639 2370 gene locus_tag LOCUS_04940 1639 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2639 3043 gene locus_tag LOCUS_04950 gene infC 2639 3043 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_04950 3069 3272 gene locus_tag LOCUS_04960 gene rpmI 3069 3272 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_04960 3295 3651 gene locus_tag LOCUS_04970 gene rplT 3295 3651 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence097 <1 1005 gene locus_tag LOCUS_04980 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116444.1:glycoside hydrolase family 31 protein 2016 1153 gene locus_tag LOCUS_04990 2016 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence098 1887 3098 gene locus_tag LOCUS_05000 1887 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3215 3682 gene locus_tag LOCUS_05010 3215 3682 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence099 735 2081 gene locus_tag LOCUS_05020 735 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence100 1098 2060 gene locus_tag LOCUS_05030 1098 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2073 3050 gene locus_tag LOCUS_05040 2073 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3861 3073 gene locus_tag LOCUS_05050 gene spo0A 3861 3073 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence101 >Feature sequence102 43 462 gene locus_tag LOCUS_05060 43 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 467 1129 gene locus_tag LOCUS_05070 467 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1194 1688 gene locus_tag LOCUS_05080 1194 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 1806 2714 gene locus_tag LOCUS_05090 gene nadA 1806 2714 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence103 1476 292 gene locus_tag LOCUS_05100 1476 292 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_05100 2549 1602 gene locus_tag LOCUS_05110 2549 1602 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526539.1 protein_id gnl|my_center|LOCUS_05110 2772 2605 gene locus_tag LOCUS_05120 2772 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 <3921 2844 gene locus_tag LOCUS_05130 <3921 2844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964222.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence104 13 89 gene locus_tag LOCUS_t00080 13 89 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 809 120 gene locus_tag LOCUS_05140 gene sigK 809 120 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_05140 1130 2452 gene locus_tag LOCUS_05150 1130 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3413 2496 gene locus_tag LOCUS_05160 gene metA 3413 2496 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence105 <1 919 gene locus_tag LOCUS_05170 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009891588.1:selenium-dependent xanthine dehydrogenase 1540 920 gene locus_tag LOCUS_05180 gene mocA 1540 920 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890188.1 protein_id gnl|my_center|LOCUS_05180 1678 2574 gene locus_tag LOCUS_05190 1678 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 >Feature sequence106 130 1530 gene locus_tag LOCUS_05200 gene asnS 130 1530 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_05200 1547 2356 gene locus_tag LOCUS_05210 1547 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3393 2395 gene locus_tag LOCUS_05220 3393 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence107 1664 72 gene locus_tag LOCUS_05230 1664 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1842 2885 gene locus_tag LOCUS_05240 1842 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3009 3686 gene locus_tag LOCUS_05250 3009 3686 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811062.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence108 679 1101 gene locus_tag LOCUS_05260 679 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1108 1674 gene locus_tag LOCUS_05270 1108 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1667 3724 gene locus_tag LOCUS_05280 1667 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence109 1144 278 gene locus_tag LOCUS_05290 gene ylqF 1144 278 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_05290 1873 1145 gene locus_tag LOCUS_05300 gene lepB 1873 1145 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948309.1 protein_id gnl|my_center|LOCUS_05300 2299 1949 gene locus_tag LOCUS_05310 gene rplS 2299 1949 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_05310 2489 3610 gene locus_tag LOCUS_05320 2489 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence110 667 110 gene locus_tag LOCUS_05330 667 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1444 686 gene locus_tag LOCUS_05340 1444 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence111 1878 1186 gene locus_tag LOCUS_05350 1878 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3379 1901 gene locus_tag LOCUS_05360 gene spoIVA 3379 1901 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence112 3779 672 gene locus_tag LOCUS_05370 3779 672 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272308.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence113 <1 2121 gene locus_tag LOCUS_05380 <1 2121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814361.1:TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein 3052 2198 gene locus_tag LOCUS_05390 3052 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence114 604 449 gene locus_tag LOCUS_05400 604 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 653 1495 gene locus_tag LOCUS_05410 653 1495 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_05410 1496 1975 gene locus_tag LOCUS_05420 gene queF 1496 1975 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689837.1 protein_id gnl|my_center|LOCUS_05420 1977 2642 gene locus_tag LOCUS_05430 gene queC 1977 2642 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966890.1 protein_id gnl|my_center|LOCUS_05430 2630 2965 gene locus_tag LOCUS_05440 gene queD 2630 2965 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_05440 2969 3637 gene locus_tag LOCUS_05450 gene queE 2969 3637 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence115 157 678 gene locus_tag LOCUS_05460 157 678 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262901.1 protein_id gnl|my_center|LOCUS_05460 1371 811 gene locus_tag LOCUS_05470 1371 811 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_05470 1521 1697 gene locus_tag LOCUS_05480 1521 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence116 912 190 gene locus_tag LOCUS_05490 912 190 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_05490 2237 912 gene locus_tag LOCUS_05500 2237 912 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_05500 2366 3001 gene locus_tag LOCUS_05510 2366 3001 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_05510 <3759 3032 gene locus_tag LOCUS_05520 <3759 3032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978652.1:glycerophosphodiester phosphodiesterase family protein >Feature sequence117 231 485 gene locus_tag LOCUS_05530 gene rpmA 231 485 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916187.1 protein_id gnl|my_center|LOCUS_05530 557 1900 gene locus_tag LOCUS_05540 557 1900 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_05540 1912 2556 gene locus_tag LOCUS_05550 1912 2556 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence118 1799 2302 gene locus_tag LOCUS_05560 1799 2302 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_05560 2317 2901 gene locus_tag LOCUS_05570 2317 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 <3716 2939 gene locus_tag LOCUS_05580 <3716 2939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003547075.1:site-specific tyrosine recombinase XerD >Feature sequence119 <1 975 gene locus_tag LOCUS_05590 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965056.1:radical SAM protein >Feature sequence120 <1 817 gene locus_tag LOCUS_05600 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545351.1:TatD family hydrolase 892 1917 gene locus_tag LOCUS_05610 892 1917 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_05610 2019 2477 gene locus_tag LOCUS_05620 gene fabZ 2019 2477 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462206.1 protein_id gnl|my_center|LOCUS_05620 2470 3201 gene locus_tag LOCUS_05630 2470 3201 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence121 412 1659 gene locus_tag LOCUS_05640 412 1659 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_05640 1872 2123 gene locus_tag LOCUS_05650 1872 2123 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_05650 2173 2835 gene locus_tag LOCUS_05660 gene trmB 2173 2835 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 protein_id gnl|my_center|LOCUS_05660 3493 2849 gene locus_tag LOCUS_05670 3493 2849 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence122 1303 875 gene locus_tag LOCUS_05680 1303 875 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461399.1 protein_id gnl|my_center|LOCUS_05680 1463 2296 gene locus_tag LOCUS_05690 1463 2296 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_05690 2308 3111 gene locus_tag LOCUS_05700 2308 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence123 467 2209 gene locus_tag LOCUS_05710 467 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence124 2328 262 gene locus_tag LOCUS_05720 2328 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence125 1503 688 gene locus_tag LOCUS_05730 gene larE 1503 688 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_05730 1924 1541 gene locus_tag LOCUS_05740 1924 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2090 2956 gene locus_tag LOCUS_05750 gene metF 2090 2956 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence126 798 403 gene locus_tag LOCUS_05760 gene mscL 798 403 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254148.1 protein_id gnl|my_center|LOCUS_05760 2200 830 gene locus_tag LOCUS_05770 2200 830 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence127 <1 666 gene locus_tag LOCUS_05780 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545170.1:segregation/condensation protein A 663 1283 gene locus_tag LOCUS_05790 gene scpB 663 1283 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_05790 1299 1937 gene locus_tag LOCUS_05800 1299 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1930 2382 gene locus_tag LOCUS_05810 gene ytfJ 1930 2382 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence128 334 35 gene locus_tag LOCUS_05820 334 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 988 590 gene locus_tag LOCUS_05830 988 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1274 978 gene locus_tag LOCUS_05840 1274 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1419 2573 gene locus_tag LOCUS_05850 1419 2573 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_05850 2605 2763 gene locus_tag LOCUS_05860 2605 2763 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_05860 3005 2930 gene locus_tag LOCUS_t00090 3005 2930 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3240 3482 gene locus_tag LOCUS_05870 3240 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence129 2222 3082 gene locus_tag LOCUS_05880 2222 3082 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence130 1910 540 gene locus_tag LOCUS_05890 1910 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3295 1907 gene locus_tag LOCUS_05900 3295 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence131 1739 2398 gene locus_tag LOCUS_05910 gene hypB 1739 2398 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_05910 2391 2735 gene locus_tag LOCUS_05920 gene hypA 2391 2735 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_05920 <3638 2758 gene locus_tag LOCUS_05930 <3638 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964127.1:hydrogenase expression/formation protein HypE >Feature sequence132 484 1326 gene locus_tag LOCUS_05940 484 1326 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392086.1 protein_id gnl|my_center|LOCUS_05940 2154 1318 gene locus_tag LOCUS_05950 gene folD 2154 1318 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_05950 <3617 2048 gene locus_tag LOCUS_05960 <3617 2048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437073.1:YgiQ family radical SAM protein >Feature sequence133 2656 20 gene locus_tag LOCUS_05970 gene alaS 2656 20 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence134 293 159 gene locus_tag LOCUS_05980 293 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 579 1610 gene locus_tag LOCUS_05990 579 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2043 1660 gene locus_tag LOCUS_06000 2043 1660 CDS product iron dependent repressor, metal binding and dimerization domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460462.1 protein_id gnl|my_center|LOCUS_06000 <3585 2151 gene locus_tag LOCUS_06010 <3585 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948276.1:calcium-translocating P-type ATPase, SERCA-type >Feature sequence135 <1 527 gene locus_tag LOCUS_06020 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391810.1:phosphopyruvate hydratase 685 1047 gene locus_tag LOCUS_06030 685 1047 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_06030 1752 1093 gene locus_tag LOCUS_06040 1752 1093 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113620978.1 protein_id gnl|my_center|LOCUS_06040 2718 1783 gene locus_tag LOCUS_06050 2718 1783 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_06050 3144 2743 gene locus_tag LOCUS_06060 3144 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 >Feature sequence136 3 155 gene locus_tag LOCUS_06070 3 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 178 783 gene locus_tag LOCUS_06080 gene rnmV 178 783 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657333.1 protein_id gnl|my_center|LOCUS_06080 863 1195 gene locus_tag LOCUS_06090 863 1195 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935001.1 protein_id gnl|my_center|LOCUS_06090 1287 2627 gene locus_tag LOCUS_06100 gene ffh 1287 2627 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_06100 2696 2941 gene locus_tag LOCUS_06110 gene rpsP 2696 2941 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_06110 2957 3187 gene locus_tag LOCUS_06120 2957 3187 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence137 1276 62 gene locus_tag LOCUS_06130 1276 62 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_06130 <3455 1287 gene locus_tag LOCUS_06140 <3455 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242617.1:GDSL-type esterase/lipase family protein >Feature sequence138 2742 1012 gene locus_tag LOCUS_06150 2742 1012 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_06150 3296 2805 gene locus_tag LOCUS_06160 3296 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence139 1886 987 gene locus_tag LOCUS_06170 1886 987 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_06170 2810 1899 gene locus_tag LOCUS_06180 gene ftsY 2810 1899 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_06180 <3448 2822 gene locus_tag LOCUS_06190 <3448 2822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003232028.1:chromosome segregation protein SMC >Feature sequence140 449 661 gene locus_tag LOCUS_06200 449 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 967 644 gene locus_tag LOCUS_06210 967 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1104 1973 gene locus_tag LOCUS_06220 1104 1973 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_06220 1994 3226 gene locus_tag LOCUS_06230 1994 3226 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_06230 3274 3357 gene locus_tag LOCUS_t00100 3274 3357 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 2097 2249 gene locus_tag LOCUS_06240 2097 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 <3433 2288 gene locus_tag LOCUS_06250 <3433 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963928.1:diaminopimelate decarboxylase >Feature sequence142 <1 915 gene locus_tag LOCUS_06260 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048080.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 917 1147 gene locus_tag LOCUS_06270 gene yaaA 917 1147 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420479.1 protein_id gnl|my_center|LOCUS_06270 1147 2229 gene locus_tag LOCUS_06280 gene recF 1147 2229 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_06280 2229 2474 gene locus_tag LOCUS_06290 2229 2474 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence143 2033 843 gene locus_tag LOCUS_06300 2033 843 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261147.1 protein_id gnl|my_center|LOCUS_06300 2174 3220 gene locus_tag LOCUS_06310 2174 3220 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101284.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence144 1646 1164 gene locus_tag LOCUS_06320 1646 1164 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_06320 1876 2349 gene locus_tag LOCUS_06330 1876 2349 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence145 313 801 gene locus_tag LOCUS_06340 gene ybeY 313 801 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_06340 823 1740 gene locus_tag LOCUS_06350 gene era 823 1740 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_06350 1815 1997 gene locus_tag LOCUS_06360 1815 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1964 2707 gene locus_tag LOCUS_06370 gene recO 1964 2707 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775744.1 protein_id gnl|my_center|LOCUS_06370 2860 3123 gene locus_tag LOCUS_06380 gene rpsT 2860 3123 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence146 <1 547 gene locus_tag LOCUS_06390 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398637.1:D-alanyl-D-alanine carboxypeptidase DacF 603 1331 gene locus_tag LOCUS_06400 603 1331 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_06400 1349 2608 gene locus_tag LOCUS_06410 1349 2608 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence147 <1 1157 gene locus_tag LOCUS_06420 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813684.1:ComEC/Rec2 family competence protein 1160 2209 gene locus_tag LOCUS_06430 gene holA 1160 2209 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence148 20 760 gene locus_tag LOCUS_06440 gene fabG 20 760 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911773.1 protein_id gnl|my_center|LOCUS_06440 829 1059 gene locus_tag LOCUS_06450 gene acpP 829 1059 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_06450 1161 2399 gene locus_tag LOCUS_06460 gene fabF 1161 2399 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_06460 2545 3222 gene locus_tag LOCUS_06470 gene rnc 2545 3222 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence149 <1 1797 gene locus_tag LOCUS_06480 <1 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 1823 2533 gene locus_tag LOCUS_06490 1823 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence150 564 418 gene locus_tag LOCUS_06500 gene scfA 564 418 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_06500 995 636 gene locus_tag LOCUS_06510 995 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1465 1055 gene locus_tag LOCUS_06520 1465 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2144 1542 gene locus_tag LOCUS_06530 2144 1542 CDS product genetic competence negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230533.1 protein_id gnl|my_center|LOCUS_06530 2313 3071 gene locus_tag LOCUS_06540 2313 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence151 1365 1281 gene locus_tag LOCUS_t00110 1365 1281 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1444 1369 gene locus_tag LOCUS_t00120 1444 1369 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1685 1610 gene locus_tag LOCUS_t00130 1685 1610 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1769 1693 gene locus_tag LOCUS_t00140 1769 1693 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2906 1884 gene locus_tag LOCUS_06550 2906 1884 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462321.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence152 >Feature sequence153 1958 804 gene locus_tag LOCUS_06560 gene rseP 1958 804 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_06560 3105 1960 gene locus_tag LOCUS_06570 3105 1960 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence154 <1 1302 gene locus_tag LOCUS_06580 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435635.1:glucose-6-phosphate isomerase 1328 1738 gene locus_tag LOCUS_06590 1328 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence155 765 88 gene locus_tag LOCUS_06600 765 88 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence156 1354 89 gene locus_tag LOCUS_06610 gene aroA 1354 89 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_06610 1503 2696 gene locus_tag LOCUS_06620 1503 2696 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence157 369 809 gene locus_tag LOCUS_06630 369 809 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06630 1617 841 gene locus_tag LOCUS_06640 1617 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1751 2287 gene locus_tag LOCUS_06650 gene hpt 1751 2287 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_06650 2287 3240 gene locus_tag LOCUS_06660 2287 3240 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence158 <1 2018 gene locus_tag LOCUS_06670 <1 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256471.1:carbohydrate-binding domain-containing protein 2284 2964 gene locus_tag LOCUS_06680 2284 2964 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence159 415 903 gene locus_tag LOCUS_06690 415 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_06690 948 2045 gene locus_tag LOCUS_06700 gene hemW 948 2045 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence160 716 991 gene locus_tag LOCUS_06710 gene yqfC 716 991 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_06710 1000 2256 gene locus_tag LOCUS_06720 gene yqfD 1000 2256 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_06720 2219 3214 gene locus_tag LOCUS_06730 2219 3214 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence161 <1 765 gene locus_tag LOCUS_06740 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392969.1:S-layer homology domain-containing protein >Feature sequence162 2183 621 gene locus_tag LOCUS_06750 2183 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 3133 2315 gene locus_tag LOCUS_06760 3133 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence163 <1 1170 gene locus_tag LOCUS_06770 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814523.1:carbohydrate-binding domain-containing protein 1323 1958 gene locus_tag LOCUS_06780 1323 1958 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_06780 2054 2890 gene locus_tag LOCUS_06790 gene xerD 2054 2890 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence164 <1 530 gene locus_tag LOCUS_06800 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583757.1:Maf family protein 544 1545 gene locus_tag LOCUS_06810 544 1545 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_06810 1571 2398 gene locus_tag LOCUS_06820 gene mreC 1571 2398 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964556.1 protein_id gnl|my_center|LOCUS_06820 2508 2918 gene locus_tag LOCUS_06830 2508 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence165 <1 750 gene locus_tag LOCUS_06840 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002217854.1:hydroxymethylbilane synthase 753 2159 gene locus_tag LOCUS_06850 gene cobA 753 2159 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898657.1 protein_id gnl|my_center|LOCUS_06850 2156 3121 gene locus_tag LOCUS_06860 gene hemB 2156 3121 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392760.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence166 475 1485 gene locus_tag LOCUS_06870 gene spoVAD 475 1485 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437476.1 protein_id gnl|my_center|LOCUS_06870 1488 1844 gene locus_tag LOCUS_06880 gene spoVAE 1488 1844 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418423.1 protein_id gnl|my_center|LOCUS_06880 2094 2951 gene locus_tag LOCUS_06890 2094 2951 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence167 87 974 gene locus_tag LOCUS_06900 gene hslO 87 974 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_06900 984 2939 gene locus_tag LOCUS_06910 984 2939 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence168 1415 189 gene locus_tag LOCUS_06920 1415 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 2943 1399 gene locus_tag LOCUS_06930 2943 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence169 209 334 gene locus_tag LOCUS_06940 209 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 378 638 gene locus_tag LOCUS_06950 378 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 650 1273 gene locus_tag LOCUS_06960 650 1273 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_06960 1270 1704 gene locus_tag LOCUS_06970 1270 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1717 2433 gene locus_tag LOCUS_06980 1717 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence170 45 857 gene locus_tag LOCUS_06990 45 857 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_06990 1055 1918 gene locus_tag LOCUS_07000 1055 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1970 2806 gene locus_tag LOCUS_07010 1970 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence171 109 897 gene locus_tag LOCUS_07020 109 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1405 974 gene locus_tag LOCUS_07030 1405 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1563 2063 gene locus_tag LOCUS_07040 1563 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2950 2009 gene locus_tag LOCUS_07050 2950 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence172 66 446 gene locus_tag LOCUS_07060 66 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 477 3074 gene locus_tag LOCUS_07070 gene mutS 477 3074 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence173 <1 659 gene locus_tag LOCUS_07080 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389962.1:1,3-beta-galactosyl-N-acetylhexosamine phosphorylase 844 1974 gene locus_tag LOCUS_07090 gene rodA 844 1974 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_07090 2124 2909 gene locus_tag LOCUS_07100 2124 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence174 >Feature sequence175 1734 1438 gene locus_tag LOCUS_07110 1734 1438 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_07110 1905 2735 gene locus_tag LOCUS_07120 1905 2735 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence176 >Feature sequence177 873 229 gene locus_tag LOCUS_07130 873 229 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963678.1 protein_id gnl|my_center|LOCUS_07130 1687 980 gene locus_tag LOCUS_07140 1687 980 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_07140 2420 1680 gene locus_tag LOCUS_07150 2420 1680 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_07150 2818 2420 gene locus_tag LOCUS_07160 2818 2420 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence178 137 1006 gene locus_tag LOCUS_07170 gene truB 137 1006 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_07170 1022 1927 gene locus_tag LOCUS_07180 1022 1927 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986788.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence179 >Feature sequence180 <3078 807 gene locus_tag LOCUS_07190 <3078 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288633.1:glycosyl hydrolase 53 family protein >Feature sequence181 2860 1958 gene locus_tag LOCUS_07200 2860 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07200 >Feature sequence182 <1 1501 gene locus_tag LOCUS_07210 <1 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966466.1:ATP-dependent Clp protease ATP-binding subunit 2879 1551 gene locus_tag LOCUS_07220 2879 1551 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence183 <1 1630 gene locus_tag LOCUS_07230 <1 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965622.1:Ig-like domain-containing protein 1694 1951 gene locus_tag LOCUS_07240 1694 1951 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_07240 2020 2475 gene locus_tag LOCUS_07250 gene nrdR 2020 2475 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence184 82 1071 gene locus_tag LOCUS_07260 82 1071 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_07260 1068 2420 gene locus_tag LOCUS_07270 gene trkA 1068 2420 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence185 980 462 gene locus_tag LOCUS_07280 980 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2319 1213 gene locus_tag LOCUS_07290 2319 1213 CDS product resuscitation-promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733142.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence186 135 222 gene locus_tag LOCUS_t00150 135 222 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 311 401 gene locus_tag LOCUS_t00160 311 401 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 871 1614 gene locus_tag LOCUS_07300 871 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2425 1661 gene locus_tag LOCUS_07310 2425 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 <3025 2418 gene locus_tag LOCUS_07320 <3025 2418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399785.1:bifunctional glutamate--cysteine ligase/glutathione synthetase >Feature sequence187 <3023 1295 gene locus_tag LOCUS_07330 <3023 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949155.1:homocysteine S-methyltransferase family protein >Feature sequence188 2 196 gene locus_tag LOCUS_07340 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 298 1350 gene locus_tag LOCUS_07350 298 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence189 1303 740 gene locus_tag LOCUS_07360 1303 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1893 1306 gene locus_tag LOCUS_07370 1893 1306 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174736.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence190 1371 2624 gene locus_tag LOCUS_07380 1371 2624 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence191 <1 1000 gene locus_tag LOCUS_07390 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009903281.1:DUF512 domain-containing protein 997 2322 gene locus_tag LOCUS_07400 gene der 997 2322 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence192 440 1390 gene locus_tag LOCUS_07410 440 1390 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888286.1 protein_id gnl|my_center|LOCUS_07410 1387 2574 gene locus_tag LOCUS_07420 gene gltS 1387 2574 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_07420 2593 2763 gene locus_tag LOCUS_07430 2593 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence193 <1 871 gene locus_tag LOCUS_07440 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084053047.1:S-layer homology domain-containing protein 954 2177 gene locus_tag LOCUS_07450 954 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence194 969 475 gene locus_tag LOCUS_07460 gene nuoE 969 475 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_07460 1986 1141 gene locus_tag LOCUS_07470 1986 1141 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_07470 2586 1999 gene locus_tag LOCUS_07480 gene rsxA 2586 1999 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence195 <1 879 gene locus_tag LOCUS_07490 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460203.1:lysophospholipid acyltransferase family protein >Feature sequence196 30 434 gene locus_tag LOCUS_07500 30 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2708 1338 gene locus_tag LOCUS_07510 gene glmU 2708 1338 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence197 278 1474 gene locus_tag LOCUS_07520 278 1474 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438096.1 protein_id gnl|my_center|LOCUS_07520 1599 2939 gene locus_tag LOCUS_07530 1599 2939 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence198 19 1620 gene locus_tag LOCUS_07540 19 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence199 >Feature sequence200 <1 531 gene locus_tag LOCUS_07550 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437835.1:ATP synthase F1 subunit gamma 548 1951 gene locus_tag LOCUS_07560 gene atpD 548 1951 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_07560 1951 2217 gene locus_tag LOCUS_07570 gene atpC 1951 2217 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425849.1 protein_id gnl|my_center|LOCUS_07570 <2949 2227 gene locus_tag LOCUS_07580 <2949 2227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811435.1:AraC family transcriptional regulator >Feature sequence201 1825 1211 gene locus_tag LOCUS_07590 1825 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2573 1947 gene locus_tag LOCUS_07600 gene upp 2573 1947 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254935.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence202 122 955 gene locus_tag LOCUS_07610 122 955 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_07610 942 1556 gene locus_tag LOCUS_07620 942 1556 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_07620 1585 2571 gene locus_tag LOCUS_07630 1585 2571 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence203 560 1690 gene locus_tag LOCUS_07640 gene dnaJ 560 1690 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence204 <1 925 gene locus_tag LOCUS_07650 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392356.1:stage V sporulation protein D 947 2383 gene locus_tag LOCUS_07660 947 2383 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence205 >Feature sequence206 542 1930 gene locus_tag LOCUS_07670 542 1930 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_07670 1981 2721 gene locus_tag LOCUS_07680 gene truA 1981 2721 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence207 849 1319 gene locus_tag LOCUS_07690 849 1319 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence208 2163 1822 gene locus_tag LOCUS_07700 2163 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2297 2815 gene locus_tag LOCUS_07710 2297 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence209 877 2154 gene locus_tag LOCUS_07720 877 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence210 <1 1492 gene locus_tag LOCUS_07730 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767250.1:glycoside hydrolase family 88 protein 1765 2760 gene locus_tag LOCUS_07740 1765 2760 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244086.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence211 326 877 gene locus_tag LOCUS_07750 326 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2679 934 gene locus_tag LOCUS_07760 2679 934 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence212 474 1571 gene locus_tag LOCUS_07770 gene rmgQ 474 1571 CDS product unsaturated rhamnogalacturonyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906487.1 protein_id gnl|my_center|LOCUS_07770 1652 2371 gene locus_tag LOCUS_07780 gene pyrH 1652 2371 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence213 186 1388 gene locus_tag LOCUS_07790 gene hydF 186 1388 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964958.1 protein_id gnl|my_center|LOCUS_07790 1493 2680 gene locus_tag LOCUS_07800 1493 2680 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence214 <1 927 gene locus_tag LOCUS_07810 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880347.1:anthranilate synthase component I 928 1509 gene locus_tag LOCUS_07820 928 1509 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_07820 1502 2518 gene locus_tag LOCUS_07830 gene trpD 1502 2518 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence215 1915 83 gene locus_tag LOCUS_07840 1915 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 <2674 1916 gene locus_tag LOCUS_07850 <2674 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545033.1:adenylosuccinate synthase >Feature sequence216 <1 1264 gene locus_tag LOCUS_07860 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948715.1:HAMP domain-containing sensor histidine kinase 1441 2586 gene locus_tag LOCUS_07870 1441 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence217 >Feature sequence218 >Feature sequence219 2478 508 gene locus_tag LOCUS_07880 gene mutL 2478 508 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence220 <1 792 gene locus_tag LOCUS_07890 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048388.1:UDP-N-acetylmuramate--L-alanine ligase <2641 841 gene locus_tag LOCUS_07900 <2641 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966706.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein >Feature sequence221 >Feature sequence222 >Feature sequence223 122 292 gene locus_tag LOCUS_07910 122 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 429 354 gene locus_tag LOCUS_t00170 429 354 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 585 1307 gene locus_tag LOCUS_07920 585 1307 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_07920 1446 2411 gene locus_tag LOCUS_07930 1446 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence224 1538 72 gene locus_tag LOCUS_07940 1538 72 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_07940 <2615 1629 gene locus_tag LOCUS_07950 <2615 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548782.1:peptidase M13 >Feature sequence225 >Feature sequence226 1597 365 gene locus_tag LOCUS_07960 gene hisS 1597 365 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_07960 <2602 1601 gene locus_tag LOCUS_07970 <2602 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110342.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence227 1361 981 gene locus_tag LOCUS_07980 1361 981 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_07980 1774 1376 gene locus_tag LOCUS_07990 1774 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 <2586 1789 gene locus_tag LOCUS_08000 <2586 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879706.1:methylmalonyl-CoA decarboxylase subunit alpha >Feature sequence228 1999 1751 gene locus_tag LOCUS_08010 1999 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence229 <1 1042 gene locus_tag LOCUS_08020 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002387048.1:endonuclease subunit UvrC 2171 1356 gene locus_tag LOCUS_08030 2171 1356 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence230 <1 1087 gene locus_tag LOCUS_08040 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066666688.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence231 <1 544 gene locus_tag LOCUS_08050 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965686.1:N-acetyl-gamma-glutamyl-phosphate reductase 556 1437 gene locus_tag LOCUS_08060 gene argB 556 1437 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940826.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence232 <1 1609 gene locus_tag LOCUS_08070 <1 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000796600.1:heavy metal translocating P-type ATPase >Feature sequence233 1773 232 gene locus_tag LOCUS_08080 1773 232 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_08080 <2552 1933 gene locus_tag LOCUS_08090 <2552 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895264.1:CapA family protein >Feature sequence234 <1 816 gene locus_tag LOCUS_08100 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462039.1:3-phosphoserine/phosphohydroxythreonine transaminase 833 1990 gene locus_tag LOCUS_08110 833 1990 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence235 391 684 gene locus_tag LOCUS_08120 391 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08120 684 1301 gene locus_tag LOCUS_08130 gene hisB 684 1301 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437839.1 protein_id gnl|my_center|LOCUS_08130 1413 1901 gene locus_tag LOCUS_08140 1413 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence236 702 58 gene locus_tag LOCUS_08150 gene rpe 702 58 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence237 1294 602 gene locus_tag LOCUS_08160 gene cwlD 1294 602 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_08160 2468 1344 gene locus_tag LOCUS_08170 2468 1344 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392538.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence238 1309 272 gene locus_tag LOCUS_08180 1309 272 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705392.1 protein_id gnl|my_center|LOCUS_08180 1935 1309 gene locus_tag LOCUS_08190 1935 1309 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_08190 2207 1941 gene locus_tag LOCUS_08200 2207 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence239 <1 762 gene locus_tag LOCUS_08210 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671452.1:NCS2 family permease 2251 860 gene locus_tag LOCUS_08220 gene gltA 2251 860 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence240 534 815 gene locus_tag LOCUS_08230 534 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1575 2093 gene locus_tag LOCUS_08240 1575 2093 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234256.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence241 1235 2389 gene locus_tag LOCUS_08250 1235 2389 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence242 1848 670 gene locus_tag LOCUS_08260 gene dprA 1848 670 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_08260 <2500 1925 gene locus_tag LOCUS_08270 <2500 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965655.1:RNA methyltransferase >Feature sequence243 1185 70 gene locus_tag LOCUS_08280 1185 70 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582960.1 protein_id gnl|my_center|LOCUS_08280 <2497 1182 gene locus_tag LOCUS_08290 <2497 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143733.1:IctB family putative bicarbonate transporter >Feature sequence244 496 987 gene locus_tag LOCUS_08300 gene ybaK 496 987 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_08300 1000 2259 gene locus_tag LOCUS_08310 1000 2259 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence245 1587 1084 gene locus_tag LOCUS_08320 1587 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence246 <1 1089 gene locus_tag LOCUS_08330 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287377.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1093 1959 gene locus_tag LOCUS_08340 gene rsgA 1093 1959 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence247 1167 2078 gene locus_tag LOCUS_08350 1167 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence248 <1 1670 gene locus_tag LOCUS_08360 <1 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase large subunit >Feature sequence249 2366 1224 gene locus_tag LOCUS_08370 2366 1224 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence250 542 1834 gene locus_tag LOCUS_08380 542 1834 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence251 2182 1928 gene locus_tag LOCUS_08390 2182 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2391 2182 gene locus_tag LOCUS_08400 2391 2182 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence252 <1 1092 gene locus_tag LOCUS_08410 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861628.1:pitrilysin family protein 1933 1121 gene locus_tag LOCUS_08420 1933 1121 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence253 510 2402 gene locus_tag LOCUS_08430 510 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence254 1214 885 gene locus_tag LOCUS_08440 1214 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1497 1204 gene locus_tag LOCUS_08450 1497 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1652 1512 gene locus_tag LOCUS_08460 1652 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2025 1756 gene locus_tag LOCUS_08470 2025 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2293 2027 gene locus_tag LOCUS_08480 2293 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence255 >Feature sequence256 1951 32 gene locus_tag LOCUS_08490 1951 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence257 >Feature sequence258 329 1090 gene locus_tag LOCUS_08500 329 1090 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_08500 1090 2262 gene locus_tag LOCUS_08510 1090 2262 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence259 31 1221 gene locus_tag LOCUS_08520 31 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1836 1270 gene locus_tag LOCUS_08530 1836 1270 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence260 >Feature sequence261 1203 502 gene locus_tag LOCUS_08540 1203 502 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_08540 1817 1218 gene locus_tag LOCUS_08550 1817 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence262 2191 899 gene locus_tag LOCUS_08560 2191 899 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_08560 2352 2188 gene locus_tag LOCUS_08570 2352 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence263 1269 439 gene locus_tag LOCUS_08580 gene cysT 1269 439 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971172.1 protein_id gnl|my_center|LOCUS_08580 <2348 1297 gene locus_tag LOCUS_08590 <2348 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072773820.1:sulfate ABC transporter substrate-binding protein >Feature sequence264 845 477 gene locus_tag LOCUS_08600 gene aroH 845 477 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020790.1 protein_id gnl|my_center|LOCUS_08600 1454 1041 gene locus_tag LOCUS_08610 1454 1041 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392857.1 protein_id gnl|my_center|LOCUS_08610 <2338 1456 gene locus_tag LOCUS_08620 <2338 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897869.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence265 <1 595 gene locus_tag LOCUS_08630 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048155.1:polysaccharide deacetylase family sporulation protein PdaB 670 1614 gene locus_tag LOCUS_08640 670 1614 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence266 1299 772 gene locus_tag LOCUS_08650 1299 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2245 1313 gene locus_tag LOCUS_08660 2245 1313 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence267 921 1259 gene locus_tag LOCUS_08670 921 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence268 1512 250 gene locus_tag LOCUS_08680 gene clpX 1512 250 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_08680 2136 1546 gene locus_tag LOCUS_08690 gene clpP 2136 1546 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence269 3 1670 gene locus_tag LOCUS_08700 3 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1807 2025 gene locus_tag LOCUS_08710 1807 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08710 >Feature sequence270 1383 994 gene locus_tag LOCUS_08720 1383 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1754 1398 gene locus_tag LOCUS_08730 1754 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08730 <2286 1761 gene locus_tag LOCUS_08740 <2286 1761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965581.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA note possible pseudo, internal stop codon >Feature sequence271 >Feature sequence272 633 157 gene locus_tag LOCUS_08750 633 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08750 899 672 gene locus_tag LOCUS_08760 899 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1276 911 gene locus_tag LOCUS_08770 1276 911 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_08770 1916 1269 gene locus_tag LOCUS_08780 1916 1269 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence273 >Feature sequence274 1022 120 gene locus_tag LOCUS_08790 1022 120 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_08790 1462 1019 gene locus_tag LOCUS_08800 1462 1019 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_08800 1635 1799 gene locus_tag LOCUS_08810 1635 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence275 885 742 gene locus_tag LOCUS_08820 gene scfA 885 742 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_08820 1288 953 gene locus_tag LOCUS_08830 1288 953 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423377.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence276 <1 1181 gene locus_tag LOCUS_08840 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206077.1:sulfate adenylyltransferase subunit CysN 1198 1698 gene locus_tag LOCUS_08850 1198 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1709 2128 gene locus_tag LOCUS_08860 1709 2128 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence277 <1 793 gene locus_tag LOCUS_08870 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836528.1:cobalt-precorrin-5B (C(1))-methyltransferase CbiD 793 1545 gene locus_tag LOCUS_08880 793 1545 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891957.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence278 <1 1061 gene locus_tag LOCUS_08890 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965426.1:phospho-N-acetylmuramoyl-pentapeptide-transferase >Feature sequence279 26 934 gene locus_tag LOCUS_08900 26 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence280 1257 130 gene locus_tag LOCUS_08910 1257 130 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_08910 1500 1261 gene locus_tag LOCUS_08920 1500 1261 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780840.1 protein_id gnl|my_center|LOCUS_08920 1643 1804 gene locus_tag LOCUS_08930 1643 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence281 >Feature sequence282 1390 899 gene locus_tag LOCUS_08940 1390 899 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964777.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence283 932 165 gene locus_tag LOCUS_08950 932 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1723 932 gene locus_tag LOCUS_08960 gene proC 1723 932 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence284 1031 1870 gene locus_tag LOCUS_08970 1031 1870 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence285 <2216 543 gene locus_tag LOCUS_08980 <2216 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109145.1:beta-galactosidase >Feature sequence286 2172 1375 gene locus_tag LOCUS_08990 2172 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence287 173 1435 gene locus_tag LOCUS_09000 gene leuC 173 1435 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_09000 1438 1923 gene locus_tag LOCUS_09010 gene leuD 1438 1923 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence288 1975 656 gene locus_tag LOCUS_09020 1975 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence289 <1 766 gene locus_tag LOCUS_09030 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582803.1:rhamnose ABC transporter substrate-binding protein >Feature sequence290 <1 956 gene locus_tag LOCUS_09040 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817343.1:tryptophan--tRNA ligase 978 1988 gene locus_tag LOCUS_09050 978 1988 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_09050 1995 2117 gene locus_tag LOCUS_09060 1995 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence291 >Feature sequence292 <1 633 gene locus_tag LOCUS_09070 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027441.1:HAD family hydrolase 691 1407 gene locus_tag LOCUS_09080 gene radC 691 1407 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_09080 1472 1924 gene locus_tag LOCUS_09090 1472 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence293 >Feature sequence294 >Feature sequence295 >Feature sequence296 >Feature sequence297 >Feature sequence298 1049 216 gene locus_tag LOCUS_09100 1049 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence299 167 1717 gene locus_tag LOCUS_09110 167 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2150 1812 gene locus_tag LOCUS_09120 2150 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence300 <1 1705 gene locus_tag LOCUS_09130 <1 1705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000061358.1:two-component system response regulator >Feature sequence301 <2144 186 gene locus_tag LOCUS_09140 <2144 186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027862.1:alpha-L-arabinofuranosidase C-terminal domain-containing protein >Feature sequence302 1564 296 gene locus_tag LOCUS_09150 1564 296 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_09150 1799 1629 gene locus_tag LOCUS_09160 1799 1629 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence303 <1 665 gene locus_tag LOCUS_09170 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986205.1:magnesium transporter >Feature sequence304 42 377 gene locus_tag LOCUS_09180 42 377 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_09180 393 695 gene locus_tag LOCUS_09190 393 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 692 1288 gene locus_tag LOCUS_09200 gene nadD 692 1288 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416411.1 protein_id gnl|my_center|LOCUS_09200 1272 1832 gene locus_tag LOCUS_09210 gene yqeK 1272 1832 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence305 <1 679 gene locus_tag LOCUS_09220 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792714.1:pyridoxamine kinase 1000 1491 gene locus_tag LOCUS_09230 1000 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence306 314 568 gene locus_tag LOCUS_09240 314 568 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_09240 569 1171 gene locus_tag LOCUS_09250 gene gmk 569 1171 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_09250 1189 1506 gene locus_tag LOCUS_09260 1189 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence307 293 658 gene locus_tag LOCUS_09270 293 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 884 1168 gene locus_tag LOCUS_09280 884 1168 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence308 <1 567 gene locus_tag LOCUS_09290 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986778.1:adenylosuccinate lyase 581 1645 gene locus_tag LOCUS_09300 581 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence309 455 694 gene locus_tag LOCUS_09310 455 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 <2087 724 gene locus_tag LOCUS_09320 <2087 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879268.1:long-chain fatty acid--CoA ligase >Feature sequence310 355 1332 gene locus_tag LOCUS_09330 355 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1358 2014 gene locus_tag LOCUS_09340 1358 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence311 177 1034 gene locus_tag LOCUS_09350 177 1034 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391904.1 protein_id gnl|my_center|LOCUS_09350 1049 1240 gene locus_tag LOCUS_09360 1049 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence312 >Feature sequence313 <2063 1277 gene locus_tag LOCUS_09370 <2063 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393762.1:sodium:solute symporter >Feature sequence314 <2062 257 gene locus_tag LOCUS_09380 <2062 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201627021.1:elongation factor G >Feature sequence315 240 1607 gene locus_tag LOCUS_09390 240 1607 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence316 <1 1481 gene locus_tag LOCUS_09400 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000605281.1:non-ribosomal peptide synthetase >Feature sequence317 963 1532 gene locus_tag LOCUS_09410 963 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1504 1947 gene locus_tag LOCUS_09420 1504 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence318 397 2025 gene locus_tag LOCUS_09430 397 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09430 >Feature sequence319 359 988 gene locus_tag LOCUS_09440 gene sigH 359 988 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942746.1 protein_id gnl|my_center|LOCUS_09440 1019 1294 gene locus_tag LOCUS_09450 1019 1294 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence320 <1 683 gene locus_tag LOCUS_09460 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681843.1:PTS sugar transporter subunit IIC 1515 763 gene locus_tag LOCUS_09470 gene pdaB 1515 763 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence321 <1 920 gene locus_tag LOCUS_09480 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125161.1:3-dehydroquinate synthase 924 1400 gene locus_tag LOCUS_09490 gene lspA 924 1400 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364048.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence322 563 1036 gene locus_tag LOCUS_09500 563 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1123 1743 gene locus_tag LOCUS_09510 1123 1743 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973054.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence323 1432 986 gene locus_tag LOCUS_09520 1432 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 <1985 1447 gene locus_tag LOCUS_09530 <1985 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425992.1:glutamate racemase >Feature sequence324 710 216 gene locus_tag LOCUS_09540 710 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence325 1408 101 gene locus_tag LOCUS_09550 1408 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1722 1357 gene locus_tag LOCUS_09560 1722 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence326 >Feature sequence327 1073 411 gene locus_tag LOCUS_09570 1073 411 CDS product YesU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233822.1 protein_id gnl|my_center|LOCUS_09570 <1972 1169 gene locus_tag LOCUS_09580 <1972 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860980.1:MBL fold metallo-hydrolase >Feature sequence328 >Feature sequence329 1402 368 gene locus_tag LOCUS_09590 1402 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09590 >Feature sequence330 >Feature sequence331 <1 543 gene locus_tag LOCUS_09600 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966455.1:proline--tRNA ligase >Feature sequence332 <1 645 gene locus_tag LOCUS_09610 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048454.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 757 682 gene locus_tag LOCUS_t00180 757 682 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1234 788 gene locus_tag LOCUS_09620 1234 788 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_09620 1431 1258 gene locus_tag LOCUS_09630 1431 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence333 1085 42 gene locus_tag LOCUS_09640 1085 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1409 1098 gene locus_tag LOCUS_09650 1409 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <1934 1421 gene locus_tag LOCUS_09660 <1934 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989505.1:PFL family protein >Feature sequence334 <1930 236 gene locus_tag LOCUS_09670 <1930 236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000777372.1:VanW family protein >Feature sequence335 1841 465 gene locus_tag LOCUS_09680 1841 465 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence336 149 1060 gene locus_tag LOCUS_09690 gene spoIID 149 1060 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence337 <1 1478 gene locus_tag LOCUS_09700 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964413.1:DNA polymerase I >Feature sequence338 1384 146 gene locus_tag LOCUS_09710 1384 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 <1918 1384 gene locus_tag LOCUS_09720 <1918 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861108.1:DNA topoisomerase 3 >Feature sequence339 >Feature sequence340 1197 406 gene locus_tag LOCUS_09730 1197 406 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660848.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence341 1192 1578 gene locus_tag LOCUS_09740 1192 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1575 1886 gene locus_tag LOCUS_09750 1575 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence342 >Feature sequence343 1130 54 gene locus_tag LOCUS_09760 1130 54 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence344 1518 682 gene locus_tag LOCUS_09770 1518 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09770 >Feature sequence345 <1 980 gene locus_tag LOCUS_09780 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425909.1:polysaccharide biosynthesis protein >Feature sequence346 >Feature sequence347 48 1478 gene locus_tag LOCUS_09790 48 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1480 1701 gene locus_tag LOCUS_09800 1480 1701 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence348 1166 378 gene locus_tag LOCUS_09810 1166 378 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930487.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence349 38 400 gene locus_tag LOCUS_09820 38 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence350 446 1696 gene locus_tag LOCUS_09830 gene murA 446 1696 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence351 >Feature sequence352 2 880 gene locus_tag LOCUS_09840 2 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 877 1323 gene locus_tag LOCUS_09850 877 1323 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence353 <1 842 gene locus_tag LOCUS_09860 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957237.1:selenide, water dikinase SelD >Feature sequence354 646 573 gene locus_tag LOCUS_t00190 646 573 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 826 1479 gene locus_tag LOCUS_09870 826 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence355 72 830 gene locus_tag LOCUS_09880 gene hisF 72 830 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_09880 827 1267 gene locus_tag LOCUS_09890 827 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1283 1798 gene locus_tag LOCUS_09900 1283 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence356 101 769 gene locus_tag LOCUS_09910 101 769 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_09910 848 1237 gene locus_tag LOCUS_09920 848 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence357 >Feature sequence358 <1819 1041 gene locus_tag LOCUS_09930 <1819 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986316.1:1-phosphofructokinase >Feature sequence359 1426 44 gene locus_tag LOCUS_09940 1426 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence360 <1805 813 gene locus_tag LOCUS_09950 <1805 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808617.1:argininosuccinate lyase >Feature sequence361 213 422 gene locus_tag LOCUS_09960 213 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 382 1653 gene locus_tag LOCUS_09970 382 1653 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047809.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence362 <1795 772 gene locus_tag LOCUS_09980 <1795 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148265477.1:peptide chain release factor 2 >Feature sequence363 375 1004 gene locus_tag LOCUS_09990 375 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence364 >Feature sequence365 196 1485 gene locus_tag LOCUS_10000 196 1485 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence366 >Feature sequence367 1716 532 gene locus_tag LOCUS_10010 1716 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10010 >Feature sequence368 <1 1220 gene locus_tag LOCUS_10020 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811470.1:serine/threonine transporter SstT >Feature sequence369 141 362 gene locus_tag LOCUS_10030 141 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 382 801 gene locus_tag LOCUS_10040 382 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence370 1181 174 gene locus_tag LOCUS_10050 gene ruvB 1181 174 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_10050 <1762 1203 gene locus_tag LOCUS_10060 <1762 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816524.1:Holliday junction branch migration protein RuvA >Feature sequence371 1634 276 gene locus_tag LOCUS_10070 1634 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10070 >Feature sequence372 <1 712 gene locus_tag LOCUS_10080 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582581.1:glycosyl hydrolase 631 1605 gene locus_tag LOCUS_10090 631 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence373 710 438 gene locus_tag LOCUS_10100 710 438 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_10100 969 697 gene locus_tag LOCUS_10110 969 697 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_10110 1710 1078 gene locus_tag LOCUS_10120 1710 1078 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence374 >Feature sequence375 1607 1059 gene locus_tag LOCUS_10130 1607 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence376 190 921 gene locus_tag LOCUS_10140 190 921 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388610.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence377 <1 631 gene locus_tag LOCUS_10150 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144073.1:aconitate hydratase >Feature sequence378 <1 680 gene locus_tag LOCUS_10160 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242617.1:GDSL-type esterase/lipase family protein >Feature sequence379 470 1444 gene locus_tag LOCUS_10170 470 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10170 >Feature sequence380 >Feature sequence381 103 1386 gene locus_tag LOCUS_10180 103 1386 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence382 1 1458 gene locus_tag LOCUS_10190 1 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence383 <1 1169 gene locus_tag LOCUS_10200 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438167.1:U32 family peptidase >Feature sequence384 1474 1226 gene locus_tag LOCUS_10210 1474 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10210 >Feature sequence385 1551 820 gene locus_tag LOCUS_10220 1551 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence386 299 1444 gene locus_tag LOCUS_10230 299 1444 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861386.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence387 283 1227 gene locus_tag LOCUS_10240 gene mltG 283 1227 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10240 1234 1365 gene locus_tag LOCUS_10250 1234 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence388 >Feature sequence389 <1 748 gene locus_tag LOCUS_10260 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003592589.1:indole-3-glycerol phosphate synthase TrpC 745 1353 gene locus_tag LOCUS_10270 745 1353 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence390 115 1323 gene locus_tag LOCUS_10280 115 1323 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence391 >Feature sequence392 2 862 gene locus_tag LOCUS_10290 2 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence393 886 464 gene locus_tag LOCUS_10300 gene spoIIAB 886 464 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_10300 1226 879 gene locus_tag LOCUS_10310 gene spoIIAA 1226 879 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence394 1422 436 gene locus_tag LOCUS_10320 1422 436 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence395 >Feature sequence396 532 221 gene locus_tag LOCUS_10330 532 221 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080935.1 protein_id gnl|my_center|LOCUS_10330 1402 557 gene locus_tag LOCUS_10340 1402 557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence397 >Feature sequence398 1001 255 gene locus_tag LOCUS_10350 1001 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 <1543 1021 gene locus_tag LOCUS_10360 <1543 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963806.1:phosphoglucosamine mutase >Feature sequence399 307 1044 gene locus_tag LOCUS_10370 307 1044 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence400 >Feature sequence401 1104 439 gene locus_tag LOCUS_10380 1104 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence402 >Feature sequence403 96 329 gene locus_tag LOCUS_10390 96 329 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942410.1 protein_id gnl|my_center|LOCUS_10390 332 1207 gene locus_tag LOCUS_10400 332 1207 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence404 >Feature sequence405 1008 601 gene locus_tag LOCUS_10410 1008 601 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836528.1 protein_id gnl|my_center|LOCUS_10410 1342 1001 gene locus_tag LOCUS_10420 1342 1001 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870108.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence406 457 1182 gene locus_tag LOCUS_10430 gene pflA 457 1182 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357530.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence407 <1515 522 gene locus_tag LOCUS_10440 <1515 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048439.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence408 <1 1404 gene locus_tag LOCUS_10450 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460522.1:penicillin-binding transpeptidase domain-containing protein >Feature sequence409 <1 946 gene locus_tag LOCUS_10460 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010081095.1:phosphoribosylformylglycinamidine cyclo-ligase 946 1356 gene locus_tag LOCUS_10470 946 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10470