>Feature sequence01 140 66 gene locus_tag LOCUS_t00010 140 66 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1448 216 gene locus_tag LOCUS_00010 1448 216 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_00010 1517 4339 gene locus_tag LOCUS_00020 gene uvrA 1517 4339 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_00020 4332 5177 gene locus_tag LOCUS_00030 4332 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5179 6150 gene locus_tag LOCUS_00040 5179 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6383 7636 gene locus_tag LOCUS_00050 6383 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8706 7921 gene locus_tag LOCUS_00060 8706 7921 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_00060 9509 8706 gene locus_tag LOCUS_00070 9509 8706 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455037.1 protein_id gnl|my_center|LOCUS_00070 9588 10415 gene locus_tag LOCUS_00080 9588 10415 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_00080 10428 11537 gene locus_tag LOCUS_00090 10428 11537 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858082.1 protein_id gnl|my_center|LOCUS_00090 11545 12258 gene locus_tag LOCUS_00100 11545 12258 CDS product phosphocholine cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202609.1 protein_id gnl|my_center|LOCUS_00100 13237 12248 gene locus_tag LOCUS_00110 13237 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14230 13253 gene locus_tag LOCUS_00120 14230 13253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15755 14475 gene locus_tag LOCUS_00130 gene nqrF 15755 14475 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_00130 16352 15765 gene locus_tag LOCUS_00140 gene nqrE 16352 15765 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_00140 16995 16375 gene locus_tag LOCUS_00150 16995 16375 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_00150 17733 16999 gene locus_tag LOCUS_00160 17733 16999 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_00160 18891 17746 gene locus_tag LOCUS_00170 18891 17746 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_00170 20254 18896 gene locus_tag LOCUS_00180 20254 18896 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_00180 20390 22810 gene locus_tag LOCUS_00190 20390 22810 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_00190 22887 23357 gene locus_tag LOCUS_00200 22887 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26254 23354 gene locus_tag LOCUS_00210 26254 23354 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_00210 26342 26415 gene locus_tag LOCUS_t00020 26342 26415 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26442 26903 gene locus_tag LOCUS_00220 26442 26903 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_00220 26900 27166 gene locus_tag LOCUS_00230 26900 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 27188 28810 gene locus_tag LOCUS_00240 27188 28810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_00240 29919 28834 gene locus_tag LOCUS_00250 gene pdxA 29919 28834 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_00250 30429 29932 gene locus_tag LOCUS_00260 gene rnhA 30429 29932 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_00260 30502 31395 gene locus_tag LOCUS_00270 gene rfbD 30502 31395 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_00270 31399 31947 gene locus_tag LOCUS_00280 gene rfbC 31399 31947 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_00280 31954 33489 gene locus_tag LOCUS_00290 31954 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039965.1 protein_id gnl|my_center|LOCUS_00290 33596 36874 gene locus_tag LOCUS_00300 gene secA 33596 36874 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_00300 36899 37318 gene locus_tag LOCUS_00310 36899 37318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37370 38359 gene locus_tag LOCUS_00320 37370 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39532 38360 gene locus_tag LOCUS_00330 39532 38360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 41750 39543 gene locus_tag LOCUS_00340 41750 39543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 44781 41752 gene locus_tag LOCUS_00350 44781 41752 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_00350 45218 44805 gene locus_tag LOCUS_00360 45218 44805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45860 45219 gene locus_tag LOCUS_00370 45860 45219 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_00370 47700 45865 gene locus_tag LOCUS_00380 47700 45865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_00380 48650 47700 gene locus_tag LOCUS_00390 48650 47700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48844 50793 gene locus_tag LOCUS_00400 48844 50793 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_00400 50786 51688 gene locus_tag LOCUS_00410 50786 51688 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_00410 52148 51752 gene locus_tag LOCUS_tm00010 52148 51752 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 52222 52980 gene locus_tag LOCUS_00420 52222 52980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52985 54094 gene locus_tag LOCUS_00430 52985 54094 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 protein_id gnl|my_center|LOCUS_00430 54095 55528 gene locus_tag LOCUS_00440 54095 55528 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_00440 55568 56497 gene locus_tag LOCUS_00450 gene ftsY 55568 56497 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_00450 56516 58960 gene locus_tag LOCUS_00460 gene pheT 56516 58960 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_00460 58960 59613 gene locus_tag LOCUS_00470 58960 59613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59613 60791 gene locus_tag LOCUS_00480 59613 60791 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_00480 60796 61551 gene locus_tag LOCUS_00490 60796 61551 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_00490 61576 62460 gene locus_tag LOCUS_00500 gene deoC 61576 62460 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_00500 62690 64291 gene locus_tag LOCUS_00510 62690 64291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 64296 64853 gene locus_tag LOCUS_00520 64296 64853 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790242.1 protein_id gnl|my_center|LOCUS_00520 64952 65656 gene locus_tag LOCUS_00530 64952 65656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 65657 65742 gene locus_tag LOCUS_t00030 65657 65742 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 65792 66784 gene locus_tag LOCUS_00540 gene obgE 65792 66784 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_00540 68651 66786 gene locus_tag LOCUS_00550 68651 66786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 70663 68663 gene locus_tag LOCUS_00560 70663 68663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 71266 70688 gene locus_tag LOCUS_00570 71266 70688 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_00570 71836 71288 gene locus_tag LOCUS_00580 gene hpt 71836 71288 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_00580 72015 73598 gene locus_tag LOCUS_00590 72015 73598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 75215 73611 gene locus_tag LOCUS_00600 75215 73611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 76179 75241 gene locus_tag LOCUS_00610 76179 75241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 77123 76191 gene locus_tag LOCUS_00620 77123 76191 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_00620 77919 77116 gene locus_tag LOCUS_00630 77919 77116 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_00630 80089 77996 gene locus_tag LOCUS_00640 80089 77996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 80163 81299 gene locus_tag LOCUS_00650 80163 81299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 81343 83031 gene locus_tag LOCUS_00660 81343 83031 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_00660 83031 83540 gene locus_tag LOCUS_00670 83031 83540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 84608 83571 gene locus_tag LOCUS_00680 84608 83571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 84674 85324 gene locus_tag LOCUS_00690 84674 85324 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667095.1 protein_id gnl|my_center|LOCUS_00690 86683 85424 gene locus_tag LOCUS_00700 86683 85424 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_00700 87978 86680 gene locus_tag LOCUS_00710 87978 86680 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_00710 88408 87986 gene locus_tag LOCUS_00720 88408 87986 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_00720 90240 88438 gene locus_tag LOCUS_00730 90240 88438 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_00730 90854 90237 gene locus_tag LOCUS_00740 90854 90237 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_00740 92173 90854 gene locus_tag LOCUS_00750 92173 90854 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_00750 93920 92163 gene locus_tag LOCUS_00760 93920 92163 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_00760 94537 93938 gene locus_tag LOCUS_00770 94537 93938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 95149 94544 gene locus_tag LOCUS_00780 95149 94544 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_00780 95866 95315 gene locus_tag LOCUS_00790 95866 95315 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_00790 98341 95933 gene locus_tag LOCUS_00800 98341 95933 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109093.1 protein_id gnl|my_center|LOCUS_00800 101054 98346 gene locus_tag LOCUS_00810 101054 98346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 102326 101076 gene locus_tag LOCUS_00820 102326 101076 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_00820 103165 102323 gene locus_tag LOCUS_00830 103165 102323 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_00830 104092 103286 gene locus_tag LOCUS_00840 104092 103286 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_00840 105305 104097 gene locus_tag LOCUS_00850 105305 104097 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_00850 106162 105302 gene locus_tag LOCUS_00860 106162 105302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 106643 106164 gene locus_tag LOCUS_00870 106643 106164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 107334 106633 gene locus_tag LOCUS_00880 107334 106633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 107429 108607 gene locus_tag LOCUS_00890 107429 108607 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_00890 108611 111418 gene locus_tag LOCUS_00900 108611 111418 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_00900 111547 111954 gene locus_tag LOCUS_00910 111547 111954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 113446 112007 gene locus_tag LOCUS_00920 113446 112007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 113719 115041 gene locus_tag LOCUS_00930 113719 115041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 115056 115826 gene locus_tag LOCUS_00940 115056 115826 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_00940 115823 116857 gene locus_tag LOCUS_00950 gene lplA2 115823 116857 CDS product lipoate protein ligase LplA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721881.1 protein_id gnl|my_center|LOCUS_00950 116870 117973 gene locus_tag LOCUS_00960 gene gcvT 116870 117973 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_00960 117999 118376 gene locus_tag LOCUS_00970 gene gcvH 117999 118376 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418363.1 protein_id gnl|my_center|LOCUS_00970 118378 119706 gene locus_tag LOCUS_00980 gene gcvPA 118378 119706 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_00980 119709 121118 gene locus_tag LOCUS_00990 gene gcvPB 119709 121118 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_00990 121122 122483 gene locus_tag LOCUS_01000 gene lpdA 121122 122483 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809814.1 protein_id gnl|my_center|LOCUS_01000 123964 122480 gene locus_tag LOCUS_01010 123964 122480 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787423.1 protein_id gnl|my_center|LOCUS_01010 124941 123976 gene locus_tag LOCUS_01020 124941 123976 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_01020 125640 125047 gene locus_tag LOCUS_01030 125640 125047 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_01030 127340 125664 gene locus_tag LOCUS_01040 gene ettA 127340 125664 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_01040 129014 127344 gene locus_tag LOCUS_01050 129014 127344 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_01050 129173 130585 gene locus_tag LOCUS_01060 gene aspA 129173 130585 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_01060 130569 131000 gene locus_tag LOCUS_01070 130569 131000 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_01070 131070 131549 gene locus_tag LOCUS_01080 131070 131549 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760619.1 protein_id gnl|my_center|LOCUS_01080 131543 131962 gene locus_tag LOCUS_01090 131543 131962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 131972 132421 gene locus_tag LOCUS_01100 131972 132421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 132436 133308 gene locus_tag LOCUS_01110 132436 133308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 133630 133340 gene locus_tag LOCUS_01120 133630 133340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 134543 133620 gene locus_tag LOCUS_01130 gene xerC 134543 133620 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_01130 136027 134540 gene locus_tag LOCUS_01140 136027 134540 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_01140 137597 136011 gene locus_tag LOCUS_01150 137597 136011 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_01150 137938 137687 gene locus_tag LOCUS_01160 137938 137687 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_01160 138843 138037 gene locus_tag LOCUS_01170 138843 138037 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_01170 139109 139372 gene locus_tag LOCUS_01180 139109 139372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence02 309 1196 gene locus_tag LOCUS_01190 309 1196 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974466.1 protein_id gnl|my_center|LOCUS_01190 1563 1207 gene locus_tag LOCUS_01200 1563 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 2287 1982 gene locus_tag LOCUS_01210 2287 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 6463 2933 gene locus_tag LOCUS_01220 gene nifJ 6463 2933 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_01220 7393 6500 gene locus_tag LOCUS_01230 gene fabD 7393 6500 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765648.1 protein_id gnl|my_center|LOCUS_01230 7483 8829 gene locus_tag LOCUS_01240 7483 8829 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_01240 8887 8959 gene locus_tag LOCUS_t00040 8887 8959 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9383 9015 gene locus_tag LOCUS_01250 9383 9015 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_01250 9488 10552 gene locus_tag LOCUS_01260 9488 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10555 11136 gene locus_tag LOCUS_01270 10555 11136 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180154.1 protein_id gnl|my_center|LOCUS_01270 11136 11969 gene locus_tag LOCUS_01280 11136 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 12007 14133 gene locus_tag LOCUS_01290 12007 14133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 14140 14442 gene locus_tag LOCUS_01300 14140 14442 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404111.1 protein_id gnl|my_center|LOCUS_01300 14566 14479 gene locus_tag LOCUS_t00050 14566 14479 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15002 14634 gene locus_tag LOCUS_01310 15002 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 15104 15673 gene locus_tag LOCUS_01320 15104 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 16480 16061 gene locus_tag LOCUS_01330 16480 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 16614 17654 gene locus_tag LOCUS_01340 16614 17654 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_01340 18846 17656 gene locus_tag LOCUS_01350 18846 17656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 18995 20320 gene locus_tag LOCUS_01360 18995 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 20813 20325 gene locus_tag LOCUS_01370 20813 20325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 23475 20827 gene locus_tag LOCUS_01380 23475 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 23915 23487 gene locus_tag LOCUS_01390 23915 23487 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005641953.1 protein_id gnl|my_center|LOCUS_01390 23991 24485 gene locus_tag LOCUS_01400 23991 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 24487 25464 gene locus_tag LOCUS_01410 24487 25464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 25500 25931 gene locus_tag LOCUS_01420 gene mscL 25500 25931 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_01420 27163 25934 gene locus_tag LOCUS_01430 gene hutI 27163 25934 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_01430 28647 27160 gene locus_tag LOCUS_01440 gene hutH 28647 27160 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_01440 30651 28660 gene locus_tag LOCUS_01450 30651 28660 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_01450 32375 30654 gene locus_tag LOCUS_01460 32375 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 32924 32463 gene locus_tag LOCUS_01470 32924 32463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 34200 32935 gene locus_tag LOCUS_01480 34200 32935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 35837 34401 gene locus_tag LOCUS_01490 35837 34401 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_01490 37690 35933 gene locus_tag LOCUS_01500 37690 35933 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201999.1 protein_id gnl|my_center|LOCUS_01500 39757 37712 gene locus_tag LOCUS_01510 39757 37712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01510 41093 39795 gene locus_tag LOCUS_01520 41093 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01520 41422 44628 gene locus_tag LOCUS_01530 41422 44628 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_01530 44667 46538 gene locus_tag LOCUS_01540 44667 46538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 46752 49919 gene locus_tag LOCUS_01550 46752 49919 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_01550 49931 51853 gene locus_tag LOCUS_01560 49931 51853 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_01560 51873 52718 gene locus_tag LOCUS_01570 51873 52718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 52765 53238 gene locus_tag LOCUS_01580 52765 53238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 53259 53465 gene locus_tag LOCUS_01590 53259 53465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 55096 53462 gene locus_tag LOCUS_01600 55096 53462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_01600 56418 55099 gene locus_tag LOCUS_01610 56418 55099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 59060 56418 gene locus_tag LOCUS_01620 59060 56418 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_01620 59797 59057 gene locus_tag LOCUS_01630 59797 59057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 61174 59801 gene locus_tag LOCUS_01640 61174 59801 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_01640 62357 61209 gene locus_tag LOCUS_01650 62357 61209 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_01650 62566 64353 gene locus_tag LOCUS_01660 gene rpsA 62566 64353 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_01660 64370 65263 gene locus_tag LOCUS_01670 64370 65263 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_01670 67386 65260 gene locus_tag LOCUS_01680 67386 65260 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_01680 68457 67405 gene locus_tag LOCUS_01690 gene mltG 68457 67405 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_01690 69390 68461 gene locus_tag LOCUS_01700 69390 68461 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_01700 69725 70114 gene locus_tag LOCUS_01710 69725 70114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 70285 71103 gene locus_tag LOCUS_01720 70285 71103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 71143 71628 gene locus_tag LOCUS_01730 71143 71628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 73789 71657 gene locus_tag LOCUS_01740 gene uvrB 73789 71657 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_01740 74370 73789 gene locus_tag LOCUS_01750 74370 73789 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_01750 74509 75468 gene locus_tag LOCUS_01760 74509 75468 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798453.1 protein_id gnl|my_center|LOCUS_01760 75493 78795 gene locus_tag LOCUS_01770 75493 78795 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766779.1 protein_id gnl|my_center|LOCUS_01770 78809 80401 gene locus_tag LOCUS_01780 78809 80401 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766778.1 protein_id gnl|my_center|LOCUS_01780 80406 81668 gene locus_tag LOCUS_01790 80406 81668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 81688 83553 gene locus_tag LOCUS_01800 81688 83553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 83560 84702 gene locus_tag LOCUS_01810 83560 84702 CDS product DUF1735 and LamG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109392.1 protein_id gnl|my_center|LOCUS_01810 84723 85421 gene locus_tag LOCUS_01820 84723 85421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 85584 86735 gene locus_tag LOCUS_01830 85584 86735 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791792.1 protein_id gnl|my_center|LOCUS_01830 87605 86793 gene locus_tag LOCUS_01840 87605 86793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 87835 89769 gene locus_tag LOCUS_01850 gene htpG 87835 89769 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_01850 89851 90927 gene locus_tag LOCUS_01860 89851 90927 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764441.1 protein_id gnl|my_center|LOCUS_01860 90938 92311 gene locus_tag LOCUS_01870 90938 92311 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_01870 92301 95258 gene locus_tag LOCUS_01880 92301 95258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 96879 95266 gene locus_tag LOCUS_01890 96879 95266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 98799 96886 gene locus_tag LOCUS_01900 98799 96886 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_01900 98987 99592 gene locus_tag LOCUS_01910 98987 99592 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_01910 99600 100175 gene locus_tag LOCUS_01920 gene pnuC 99600 100175 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_01920 100172 101251 gene locus_tag LOCUS_01930 100172 101251 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_01930 101379 102236 gene locus_tag LOCUS_01940 101379 102236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_01940 102251 103066 gene locus_tag LOCUS_01950 gene murQ 102251 103066 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962884.1 protein_id gnl|my_center|LOCUS_01950 103066 103794 gene locus_tag LOCUS_01960 103066 103794 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405267.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence03 1448 1020 gene locus_tag LOCUS_01970 1448 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1545 3359 gene locus_tag LOCUS_01980 1545 3359 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_01980 4750 3362 gene locus_tag LOCUS_01990 4750 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7012 4850 gene locus_tag LOCUS_02000 gene clpB 7012 4850 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_02000 7527 7162 gene locus_tag LOCUS_02010 7527 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8158 7547 gene locus_tag LOCUS_02020 8158 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 8674 8162 gene locus_tag LOCUS_02030 8674 8162 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_02030 9873 8671 gene locus_tag LOCUS_02040 9873 8671 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_02040 9983 11626 gene locus_tag LOCUS_02050 9983 11626 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_02050 13336 11774 gene locus_tag LOCUS_02060 13336 11774 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_02060 16668 13357 gene locus_tag LOCUS_02070 16668 13357 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_02070 17391 16936 gene locus_tag LOCUS_02080 17391 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 17450 18460 gene locus_tag LOCUS_02090 gene miaA 17450 18460 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_02090 20372 19104 gene locus_tag LOCUS_02100 20372 19104 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_02100 20502 21392 gene locus_tag LOCUS_02110 20502 21392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 22945 21689 gene locus_tag LOCUS_02120 gene metK 22945 21689 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_02120 23158 26454 gene locus_tag LOCUS_02130 23158 26454 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_02130 26717 30019 gene locus_tag LOCUS_02140 26717 30019 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_02140 30032 31777 gene locus_tag LOCUS_02150 30032 31777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 31790 34330 gene locus_tag LOCUS_02160 31790 34330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 34349 35605 gene locus_tag LOCUS_02170 34349 35605 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767133.1 protein_id gnl|my_center|LOCUS_02170 35624 36700 gene locus_tag LOCUS_02180 35624 36700 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_02180 36703 39591 gene locus_tag LOCUS_02190 36703 39591 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_02190 39596 40720 gene locus_tag LOCUS_02200 39596 40720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 40765 42789 gene locus_tag LOCUS_02210 40765 42789 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_02210 44411 42792 gene locus_tag LOCUS_02220 44411 42792 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_02220 44451 45101 gene locus_tag LOCUS_02230 44451 45101 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_02230 45102 45755 gene locus_tag LOCUS_02240 45102 45755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 45797 46939 gene locus_tag LOCUS_02250 45797 46939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_02250 46967 49021 gene locus_tag LOCUS_02260 gene rnr 46967 49021 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_02260 48997 49692 gene locus_tag LOCUS_02270 48997 49692 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763963.1 protein_id gnl|my_center|LOCUS_02270 51318 49687 gene locus_tag LOCUS_02280 51318 49687 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761694.1 protein_id gnl|my_center|LOCUS_02280 51558 54800 gene locus_tag LOCUS_02290 51558 54800 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_02290 54800 56599 gene locus_tag LOCUS_02300 54800 56599 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_02300 56613 58340 gene locus_tag LOCUS_02310 56613 58340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 58352 60628 gene locus_tag LOCUS_02320 58352 60628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 60633 61661 gene locus_tag LOCUS_02330 60633 61661 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141814429.1 protein_id gnl|my_center|LOCUS_02330 61673 64825 gene locus_tag LOCUS_02340 61673 64825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 64851 65018 gene locus_tag LOCUS_02350 64851 65018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 65036 68275 gene locus_tag LOCUS_02360 65036 68275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 68454 71525 gene locus_tag LOCUS_02370 68454 71525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 71585 71755 gene locus_tag LOCUS_02380 71585 71755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 71755 74079 gene locus_tag LOCUS_02390 71755 74079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 74096 76261 gene locus_tag LOCUS_02400 74096 76261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 76264 77643 gene locus_tag LOCUS_02410 76264 77643 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_02410 77733 79256 gene locus_tag LOCUS_02420 gene gpmI 77733 79256 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108817.1 protein_id gnl|my_center|LOCUS_02420 79299 80648 gene locus_tag LOCUS_02430 79299 80648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 80659 81735 gene locus_tag LOCUS_02440 80659 81735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 81746 83794 gene locus_tag LOCUS_02450 81746 83794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 83882 84880 gene locus_tag LOCUS_02460 83882 84880 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_02460 86438 84951 gene locus_tag LOCUS_02470 86438 84951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 86718 88895 gene locus_tag LOCUS_02480 86718 88895 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800561.1 protein_id gnl|my_center|LOCUS_02480 88900 91098 gene locus_tag LOCUS_02490 88900 91098 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_02490 91136 92173 gene locus_tag LOCUS_02500 91136 92173 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence04 <1 2838 gene locus_tag LOCUS_02510 <1 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202237.1:insulinase family protein 3062 2889 gene locus_tag LOCUS_02520 3062 2889 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_02520 3190 4275 gene locus_tag LOCUS_02530 3190 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 4411 6333 gene locus_tag LOCUS_02540 4411 6333 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_02540 6339 6899 gene locus_tag LOCUS_02550 6339 6899 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_02550 6900 8549 gene locus_tag LOCUS_02560 6900 8549 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_02560 9047 8601 gene locus_tag LOCUS_02570 gene rplI 9047 8601 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_02570 9334 9062 gene locus_tag LOCUS_02580 gene rpsR 9334 9062 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_02580 9702 9352 gene locus_tag LOCUS_02590 gene rpsF 9702 9352 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_02590 10198 9818 gene locus_tag LOCUS_02600 10198 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 10259 11161 gene locus_tag LOCUS_02610 10259 11161 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_02610 11163 12170 gene locus_tag LOCUS_02620 11163 12170 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764542.1 protein_id gnl|my_center|LOCUS_02620 12293 13750 gene locus_tag LOCUS_02630 12293 13750 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_02630 13794 15491 gene locus_tag LOCUS_02640 13794 15491 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_02640 15491 17023 gene locus_tag LOCUS_02650 15491 17023 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_02650 17330 17569 gene locus_tag LOCUS_02660 17330 17569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 18337 17465 gene locus_tag LOCUS_02670 18337 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 18454 19155 gene locus_tag LOCUS_02680 18454 19155 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_02680 19160 19756 gene locus_tag LOCUS_02690 19160 19756 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_02690 19743 21197 gene locus_tag LOCUS_02700 19743 21197 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_02700 21201 22538 gene locus_tag LOCUS_02710 21201 22538 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_02710 22549 23151 gene locus_tag LOCUS_02720 22549 23151 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_02720 23236 24351 gene locus_tag LOCUS_02730 23236 24351 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_02730 24394 25758 gene locus_tag LOCUS_02740 gene trkA 24394 25758 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_02740 25758 27533 gene locus_tag LOCUS_02750 25758 27533 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_02750 29342 27537 gene locus_tag LOCUS_02760 gene sppA 29342 27537 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_02760 29397 30776 gene locus_tag LOCUS_02770 gene hisS 29397 30776 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_02770 30887 30814 gene locus_tag LOCUS_t00060 30887 30814 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 31717 30938 gene locus_tag LOCUS_02780 31717 30938 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_02780 33051 31717 gene locus_tag LOCUS_02790 33051 31717 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759774.1 protein_id gnl|my_center|LOCUS_02790 35138 33150 gene locus_tag LOCUS_02800 35138 33150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 38363 35157 gene locus_tag LOCUS_02810 38363 35157 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_02810 39680 38652 gene locus_tag LOCUS_02820 39680 38652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 41047 39680 gene locus_tag LOCUS_02830 41047 39680 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_02830 41610 41056 gene locus_tag LOCUS_02840 gene def 41610 41056 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_02840 42105 41617 gene locus_tag LOCUS_02850 gene ruvX 42105 41617 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_02850 42134 42979 gene locus_tag LOCUS_02860 42134 42979 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_02860 42987 44159 gene locus_tag LOCUS_02870 42987 44159 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_02870 44170 45444 gene locus_tag LOCUS_02880 gene rseP 44170 45444 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_02880 45459 46484 gene locus_tag LOCUS_02890 45459 46484 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_02890 46570 46642 gene locus_tag LOCUS_t00070 46570 46642 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 46664 46918 gene locus_tag LOCUS_02900 gene rpsT 46664 46918 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_02900 46969 47044 gene locus_tag LOCUS_t00080 46969 47044 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 48380 47097 gene locus_tag LOCUS_02910 48380 47097 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108770.1 protein_id gnl|my_center|LOCUS_02910 51370 48383 gene locus_tag LOCUS_02920 51370 48383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 52899 51556 gene locus_tag LOCUS_02930 gene gdhA 52899 51556 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_02930 53607 53041 gene locus_tag LOCUS_02940 53607 53041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 56265 53668 gene locus_tag LOCUS_02950 56265 53668 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_02950 57027 56299 gene locus_tag LOCUS_02960 57027 56299 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_02960 57860 57039 gene locus_tag LOCUS_02970 57860 57039 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_02970 57977 58717 gene locus_tag LOCUS_02980 57977 58717 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_02980 58822 59442 gene locus_tag LOCUS_02990 58822 59442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 59461 60870 gene locus_tag LOCUS_03000 59461 60870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 62497 60830 gene locus_tag LOCUS_03010 gene recN 62497 60830 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_03010 62832 62509 gene locus_tag LOCUS_03020 62832 62509 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_03020 63774 62908 gene locus_tag LOCUS_03030 63774 62908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 64712 63783 gene locus_tag LOCUS_03040 gene trxB 64712 63783 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_03040 64802 65248 gene locus_tag LOCUS_03050 64802 65248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 65251 65922 gene locus_tag LOCUS_03060 65251 65922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 66029 65955 gene locus_tag LOCUS_t00090 66029 65955 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 67235 66078 gene locus_tag LOCUS_03070 67235 66078 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_03070 68300 67248 gene locus_tag LOCUS_03080 gene ansB 68300 67248 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479812.1 protein_id gnl|my_center|LOCUS_03080 69656 68322 gene locus_tag LOCUS_03090 69656 68322 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498700.1 protein_id gnl|my_center|LOCUS_03090 69782 71563 gene locus_tag LOCUS_03100 69782 71563 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765908.1 protein_id gnl|my_center|LOCUS_03100 71706 72434 gene locus_tag LOCUS_03110 gene radC 71706 72434 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_03110 72438 75482 gene locus_tag LOCUS_03120 72438 75482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 75551 76204 gene locus_tag LOCUS_03130 gene upp 75551 76204 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_03130 77523 76201 gene locus_tag LOCUS_03140 gene miaB 77523 76201 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_03140 77591 78043 gene locus_tag LOCUS_03150 77591 78043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 78046 78597 gene locus_tag LOCUS_03160 78046 78597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 78601 80010 gene locus_tag LOCUS_03170 gene rpoN 78601 80010 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_03170 80016 81368 gene locus_tag LOCUS_03180 gene cls 80016 81368 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_03180 81822 81415 gene locus_tag LOCUS_03190 81822 81415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 82637 81852 gene locus_tag LOCUS_03200 82637 81852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 83965 82661 gene locus_tag LOCUS_03210 83965 82661 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_03210 85472 84045 gene locus_tag LOCUS_03220 85472 84045 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_03220 85590 87479 gene locus_tag LOCUS_03230 gene dxs 85590 87479 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_03230 87528 87602 gene locus_tag LOCUS_t00100 87528 87602 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 87631 87712 gene locus_tag LOCUS_t00110 87631 87712 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 87727 87800 gene locus_tag LOCUS_t00120 87727 87800 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 87807 87879 gene locus_tag LOCUS_t00130 87807 87879 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 819 1238 gene locus_tag LOCUS_03240 819 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2305 1235 gene locus_tag LOCUS_03250 2305 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3222 2602 gene locus_tag LOCUS_03260 3222 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4298 3270 gene locus_tag LOCUS_03270 gene galE 4298 3270 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_03270 5867 4338 gene locus_tag LOCUS_03280 gene dacB 5867 4338 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217314.1 protein_id gnl|my_center|LOCUS_03280 7243 5873 gene locus_tag LOCUS_03290 gene radA 7243 5873 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_03290 8513 7254 gene locus_tag LOCUS_03300 8513 7254 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_03300 9503 8520 gene locus_tag LOCUS_03310 9503 8520 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_03310 10002 9577 gene locus_tag LOCUS_03320 10002 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10562 10002 gene locus_tag LOCUS_03330 10562 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11334 10543 gene locus_tag LOCUS_03340 11334 10543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 11949 11467 gene locus_tag LOCUS_03350 11949 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 12409 11933 gene locus_tag LOCUS_03360 12409 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 16838 12378 gene locus_tag LOCUS_03370 16838 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 19702 16835 gene locus_tag LOCUS_03380 19702 16835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 19855 20919 gene locus_tag LOCUS_03390 19855 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 24140 20916 gene locus_tag LOCUS_03400 24140 20916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 24600 24322 gene locus_tag LOCUS_03410 24600 24322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 25623 24631 gene locus_tag LOCUS_03420 25623 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 27072 25630 gene locus_tag LOCUS_03430 gene xylE 27072 25630 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_03430 28375 27062 gene locus_tag LOCUS_03440 gene xylA 28375 27062 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787643.1 protein_id gnl|my_center|LOCUS_03440 29941 28388 gene locus_tag LOCUS_03450 29941 28388 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_03450 31340 30000 gene locus_tag LOCUS_03460 31340 30000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 34368 31330 gene locus_tag LOCUS_03470 34368 31330 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_03470 36323 34377 gene locus_tag LOCUS_03480 36323 34377 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053568.1 protein_id gnl|my_center|LOCUS_03480 37271 36330 gene locus_tag LOCUS_03490 37271 36330 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969953.1 protein_id gnl|my_center|LOCUS_03490 39615 37282 gene locus_tag LOCUS_03500 39615 37282 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303180.1 protein_id gnl|my_center|LOCUS_03500 39784 40149 gene locus_tag LOCUS_03510 39784 40149 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_03510 40146 41360 gene locus_tag LOCUS_03520 40146 41360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 41368 42579 gene locus_tag LOCUS_03530 41368 42579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 42576 45464 gene locus_tag LOCUS_03540 42576 45464 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_03540 45548 47500 gene locus_tag LOCUS_03550 45548 47500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 48482 47481 gene locus_tag LOCUS_03560 48482 47481 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_03560 49812 48472 gene locus_tag LOCUS_03570 49812 48472 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000865460.1 protein_id gnl|my_center|LOCUS_03570 52896 49819 gene locus_tag LOCUS_03580 52896 49819 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141271555.1 protein_id gnl|my_center|LOCUS_03580 53916 52900 gene locus_tag LOCUS_03590 53916 52900 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_03590 54113 54991 gene locus_tag LOCUS_03600 54113 54991 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_03600 55102 56778 gene locus_tag LOCUS_03610 55102 56778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 56823 59057 gene locus_tag LOCUS_03620 56823 59057 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_03620 59125 60336 gene locus_tag LOCUS_03630 59125 60336 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_03630 61106 60333 gene locus_tag LOCUS_03640 gene argB 61106 60333 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_03640 62050 61103 gene locus_tag LOCUS_03650 62050 61103 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_03650 63171 62047 gene locus_tag LOCUS_03660 63171 62047 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_03660 64133 63174 gene locus_tag LOCUS_03670 gene argC 64133 63174 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_03670 64750 64190 gene locus_tag LOCUS_03680 64750 64190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_03680 65368 64856 gene locus_tag LOCUS_03690 65368 64856 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_03690 65931 68957 gene locus_tag LOCUS_03700 65931 68957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 69386 73114 gene locus_tag LOCUS_03710 69386 73114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 73098 73550 gene locus_tag LOCUS_03720 73098 73550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 73742 74044 gene locus_tag LOCUS_03730 73742 74044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 74034 74546 gene locus_tag LOCUS_03740 74034 74546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 75129 74554 gene locus_tag LOCUS_03750 gene citX 75129 74554 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000550422.1 protein_id gnl|my_center|LOCUS_03750 76550 75129 gene locus_tag LOCUS_03760 gene citF 76550 75129 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192238.1 protein_id gnl|my_center|LOCUS_03760 77416 76547 gene locus_tag LOCUS_03770 gene citE 77416 76547 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_03770 77730 77449 gene locus_tag LOCUS_03780 gene citD 77730 77449 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547011.1 protein_id gnl|my_center|LOCUS_03780 78689 77802 gene locus_tag LOCUS_03790 78689 77802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 78812 81217 gene locus_tag LOCUS_03800 gene feoB 78812 81217 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065727.1 protein_id gnl|my_center|LOCUS_03800 81316 82608 gene locus_tag LOCUS_03810 81316 82608 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694544.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence06 516 352 gene locus_tag LOCUS_03820 516 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 1495 638 gene locus_tag LOCUS_03830 1495 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 1601 1849 gene locus_tag LOCUS_03840 1601 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 2123 1866 gene locus_tag LOCUS_03850 2123 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3978 2260 gene locus_tag LOCUS_03860 gene sulP 3978 2260 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797091.1 protein_id gnl|my_center|LOCUS_03860 5157 4012 gene locus_tag LOCUS_03870 5157 4012 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_03870 5604 5167 gene locus_tag LOCUS_03880 5604 5167 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_03880 6547 5615 gene locus_tag LOCUS_03890 6547 5615 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_03890 8118 6556 gene locus_tag LOCUS_03900 8118 6556 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_03900 8895 8137 gene locus_tag LOCUS_03910 8895 8137 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_03910 9588 8905 gene locus_tag LOCUS_03920 9588 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9889 10860 gene locus_tag LOCUS_03930 gene recF 9889 10860 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_03930 10850 11185 gene locus_tag LOCUS_03940 10850 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 11185 12234 gene locus_tag LOCUS_03950 gene pdxB 11185 12234 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_03950 12255 13769 gene locus_tag LOCUS_03960 12255 13769 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_03960 14199 13720 gene locus_tag LOCUS_03970 14199 13720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 14233 15420 gene locus_tag LOCUS_03980 gene lysA 14233 15420 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_03980 15442 16764 gene locus_tag LOCUS_03990 gene ffh 15442 16764 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_03990 17623 16754 gene locus_tag LOCUS_04000 17623 16754 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_04000 17696 19444 gene locus_tag LOCUS_04010 17696 19444 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_04010 21403 19472 gene locus_tag LOCUS_04020 21403 19472 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_04020 22955 21411 gene locus_tag LOCUS_04030 gene rny 22955 21411 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_04030 23474 23190 gene locus_tag LOCUS_04040 23474 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 23749 23477 gene locus_tag LOCUS_04050 23749 23477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 23823 25802 gene locus_tag LOCUS_04060 23823 25802 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_04060 26652 25819 gene locus_tag LOCUS_04070 26652 25819 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_04070 27926 26661 gene locus_tag LOCUS_04080 27926 26661 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_04080 28269 27928 gene locus_tag LOCUS_04090 28269 27928 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_04090 28362 29306 gene locus_tag LOCUS_04100 gene nusB 28362 29306 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_04100 29317 29679 gene locus_tag LOCUS_04110 gene yajC 29317 29679 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_04110 29697 30662 gene locus_tag LOCUS_04120 29697 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 30659 31231 gene locus_tag LOCUS_04130 gene coaE 30659 31231 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014305.1 protein_id gnl|my_center|LOCUS_04130 31245 31676 gene locus_tag LOCUS_04140 31245 31676 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_04140 31676 32986 gene locus_tag LOCUS_04150 gene rimO 31676 32986 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_04150 33069 33824 gene locus_tag LOCUS_04160 33069 33824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 34392 33829 gene locus_tag LOCUS_04170 34392 33829 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_04170 34724 34392 gene locus_tag LOCUS_04180 34724 34392 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_04180 35383 34742 gene locus_tag LOCUS_04190 gene queC 35383 34742 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_04190 35838 36608 gene locus_tag LOCUS_04200 35838 36608 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_04200 36829 39054 gene locus_tag LOCUS_04210 36829 39054 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_04210 39385 39062 gene locus_tag LOCUS_04220 39385 39062 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_04220 40064 39387 gene locus_tag LOCUS_04230 gene trmD 40064 39387 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_04230 40173 41933 gene locus_tag LOCUS_04240 40173 41933 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_04240 41940 43823 gene locus_tag LOCUS_04250 gene yidC 41940 43823 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_04250 43810 44460 gene locus_tag LOCUS_04260 43810 44460 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_04260 44462 46717 gene locus_tag LOCUS_04270 44462 46717 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_04270 47834 46698 gene locus_tag LOCUS_04280 gene lpxB 47834 46698 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_04280 48679 47834 gene locus_tag LOCUS_04290 gene surE 48679 47834 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_04290 48820 49818 gene locus_tag LOCUS_04300 gene gap 48820 49818 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_04300 49942 51684 gene locus_tag LOCUS_04310 49942 51684 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_04310 52453 52283 gene locus_tag LOCUS_04320 52453 52283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 52816 53772 gene locus_tag LOCUS_04330 52816 53772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 54152 53931 gene locus_tag LOCUS_04340 54152 53931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 54827 54456 gene locus_tag LOCUS_04350 54827 54456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 54919 55215 gene locus_tag LOCUS_04360 54919 55215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 55225 56151 gene locus_tag LOCUS_04370 55225 56151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 58051 56375 gene locus_tag LOCUS_04380 58051 56375 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_04380 58196 59386 gene locus_tag LOCUS_04390 58196 59386 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_04390 59468 60352 gene locus_tag LOCUS_04400 59468 60352 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_04400 60378 61199 gene locus_tag LOCUS_04410 60378 61199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 61203 62672 gene locus_tag LOCUS_04420 61203 62672 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_04420 62676 64112 gene locus_tag LOCUS_04430 62676 64112 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_04430 64141 66153 gene locus_tag LOCUS_04440 64141 66153 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence07 388 1125 gene locus_tag LOCUS_04450 388 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1118 2188 gene locus_tag LOCUS_04460 1118 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2351 3256 gene locus_tag LOCUS_04470 2351 3256 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_04470 3246 4043 gene locus_tag LOCUS_04480 3246 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4045 4458 gene locus_tag LOCUS_04490 4045 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5713 4679 gene locus_tag LOCUS_04500 5713 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5850 6554 gene locus_tag LOCUS_04510 5850 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7668 6556 gene locus_tag LOCUS_04520 gene pyrB 7668 6556 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_04520 8311 7682 gene locus_tag LOCUS_04530 gene pyrE 8311 7682 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_04530 9014 8313 gene locus_tag LOCUS_04540 gene pyrF 9014 8313 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_04540 9969 9058 gene locus_tag LOCUS_04550 9969 9058 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_04550 10688 9963 gene locus_tag LOCUS_04560 gene pyrK 10688 9963 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_04560 13876 10688 gene locus_tag LOCUS_04570 gene carB 13876 10688 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_04570 14951 13869 gene locus_tag LOCUS_04580 14951 13869 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_04580 15894 14959 gene locus_tag LOCUS_04590 15894 14959 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644720.1 protein_id gnl|my_center|LOCUS_04590 16218 16685 gene locus_tag LOCUS_04600 gene purE 16218 16685 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_04600 16738 20427 gene locus_tag LOCUS_04610 16738 20427 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775466.1 protein_id gnl|my_center|LOCUS_04610 20431 21150 gene locus_tag LOCUS_04620 20431 21150 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_04620 21150 22511 gene locus_tag LOCUS_04630 gene purF 21150 22511 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989807.1 protein_id gnl|my_center|LOCUS_04630 22516 23541 gene locus_tag LOCUS_04640 gene purM 22516 23541 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_04640 23544 24104 gene locus_tag LOCUS_04650 gene purN 23544 24104 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244322.1 protein_id gnl|my_center|LOCUS_04650 24107 25639 gene locus_tag LOCUS_04660 gene purH 24107 25639 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166538.1 protein_id gnl|my_center|LOCUS_04660 25643 26974 gene locus_tag LOCUS_04670 gene purD 25643 26974 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_04670 26980 27831 gene locus_tag LOCUS_04680 gene folD 26980 27831 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_04680 30545 27834 gene locus_tag LOCUS_04690 30545 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 31699 30548 gene locus_tag LOCUS_04700 31699 30548 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_04700 31883 33244 gene locus_tag LOCUS_04710 31883 33244 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_04710 33246 34916 gene locus_tag LOCUS_04720 33246 34916 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474328.1 protein_id gnl|my_center|LOCUS_04720 34913 36094 gene locus_tag LOCUS_04730 34913 36094 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760990.1 protein_id gnl|my_center|LOCUS_04730 36115 37959 gene locus_tag LOCUS_04740 36115 37959 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_04740 38002 41205 gene locus_tag LOCUS_04750 38002 41205 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_04750 41219 43036 gene locus_tag LOCUS_04760 41219 43036 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_04760 43040 48202 gene locus_tag LOCUS_04770 43040 48202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 48273 49688 gene locus_tag LOCUS_04780 gene uxaC 48273 49688 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_04780 49690 51165 gene locus_tag LOCUS_04790 49690 51165 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_04790 51194 52633 gene locus_tag LOCUS_04800 51194 52633 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_04800 52638 54089 gene locus_tag LOCUS_04810 52638 54089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_04810 54987 54124 gene locus_tag LOCUS_04820 54987 54124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 55829 54987 gene locus_tag LOCUS_04830 gene kduI 55829 54987 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762839.1 protein_id gnl|my_center|LOCUS_04830 56637 55834 gene locus_tag LOCUS_04840 56637 55834 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_04840 56770 57807 gene locus_tag LOCUS_04850 56770 57807 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_04850 57820 58485 gene locus_tag LOCUS_04860 57820 58485 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_04860 58949 58482 gene locus_tag LOCUS_04870 58949 58482 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence08 108 647 gene locus_tag LOCUS_04880 108 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2173 758 gene locus_tag LOCUS_04890 gene mnmE 2173 758 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_04890 3927 2188 gene locus_tag LOCUS_04900 3927 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 6873 4090 gene locus_tag LOCUS_04910 6873 4090 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_04910 6985 8127 gene locus_tag LOCUS_04920 6985 8127 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_04920 8438 9856 gene locus_tag LOCUS_04930 gene dnaA 8438 9856 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_04930 9889 11328 gene locus_tag LOCUS_04940 9889 11328 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_04940 11328 11993 gene locus_tag LOCUS_04950 gene rpe 11328 11993 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_04950 12711 11977 gene locus_tag LOCUS_04960 12711 11977 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_04960 12785 13246 gene locus_tag LOCUS_04970 12785 13246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 13247 15208 gene locus_tag LOCUS_04980 gene ftsH 13247 15208 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_04980 15201 16028 gene locus_tag LOCUS_04990 15201 16028 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_04990 16040 16693 gene locus_tag LOCUS_05000 16040 16693 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_05000 18031 16685 gene locus_tag LOCUS_05010 18031 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 18860 18021 gene locus_tag LOCUS_05020 18860 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 20647 18857 gene locus_tag LOCUS_05030 20647 18857 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_05030 22871 20640 gene locus_tag LOCUS_05040 22871 20640 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_05040 24958 22883 gene locus_tag LOCUS_05050 gene ligA 24958 22883 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_05050 25169 26398 gene locus_tag LOCUS_05060 gene pfp 25169 26398 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_05060 26402 27946 gene locus_tag LOCUS_05070 26402 27946 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_05070 28005 30140 gene locus_tag LOCUS_05080 28005 30140 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_05080 31457 30147 gene locus_tag LOCUS_05090 31457 30147 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_05090 32609 31479 gene locus_tag LOCUS_05100 32609 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_05100 32756 34159 gene locus_tag LOCUS_05110 gene rlmD 32756 34159 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_05110 34164 35126 gene locus_tag LOCUS_05120 34164 35126 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_05120 35139 36068 gene locus_tag LOCUS_05130 35139 36068 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_05130 37251 36049 gene locus_tag LOCUS_05140 37251 36049 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_05140 38524 37313 gene locus_tag LOCUS_05150 38524 37313 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_05150 38992 39417 gene locus_tag LOCUS_05160 38992 39417 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107510.1 protein_id gnl|my_center|LOCUS_05160 39495 40523 gene locus_tag LOCUS_05170 39495 40523 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_05170 40516 41778 gene locus_tag LOCUS_05180 40516 41778 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_05180 42925 41846 gene locus_tag LOCUS_05190 42925 41846 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403681.1 protein_id gnl|my_center|LOCUS_05190 43849 42929 gene locus_tag LOCUS_05200 43849 42929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 45796 43871 gene locus_tag LOCUS_05210 45796 43871 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_05210 46545 45799 gene locus_tag LOCUS_05220 gene tatC 46545 45799 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_05220 46761 46549 gene locus_tag LOCUS_05230 46761 46549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 47193 46780 gene locus_tag LOCUS_05240 47193 46780 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_05240 49850 47196 gene locus_tag LOCUS_05250 49850 47196 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_05250 49935 50261 gene locus_tag LOCUS_05260 49935 50261 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_05260 50268 50795 gene locus_tag LOCUS_05270 50268 50795 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_05270 50795 51376 gene locus_tag LOCUS_05280 50795 51376 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_05280 51896 51967 gene locus_tag LOCUS_t00140 51896 51967 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 52017 52721 gene locus_tag LOCUS_05290 52017 52721 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_05290 53886 52693 gene locus_tag LOCUS_05300 53886 52693 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_05300 54539 53883 gene locus_tag LOCUS_05310 54539 53883 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_05310 55635 54529 gene locus_tag LOCUS_05320 55635 54529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 56320 55733 gene locus_tag LOCUS_05330 56320 55733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 56424 57626 gene locus_tag LOCUS_05340 56424 57626 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_05340 57626 58357 gene locus_tag LOCUS_05350 57626 58357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 58619 58512 gene locus_tag LOCUS_r00010 58619 58512 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence09 233 159 gene locus_tag LOCUS_t00150 233 159 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 633 256 gene locus_tag LOCUS_05360 gene rplS 633 256 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_05360 1947 748 gene locus_tag LOCUS_05370 gene dnaJ 1947 748 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_05370 2498 1959 gene locus_tag LOCUS_05380 2498 1959 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_05380 3461 2586 gene locus_tag LOCUS_05390 gene mazG 3461 2586 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_05390 4731 3451 gene locus_tag LOCUS_05400 4731 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4890 5936 gene locus_tag LOCUS_05410 4890 5936 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_05410 7317 5953 gene locus_tag LOCUS_05420 7317 5953 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760379.1 protein_id gnl|my_center|LOCUS_05420 9921 7573 gene locus_tag LOCUS_05430 9921 7573 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766160.1 protein_id gnl|my_center|LOCUS_05430 10958 9924 gene locus_tag LOCUS_05440 gene rlmN 10958 9924 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_05440 11057 12076 gene locus_tag LOCUS_05450 gene recA 11057 12076 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_05450 12069 14171 gene locus_tag LOCUS_05460 gene recG 12069 14171 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172726565.1 protein_id gnl|my_center|LOCUS_05460 14174 14797 gene locus_tag LOCUS_05470 14174 14797 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460200.1 protein_id gnl|my_center|LOCUS_05470 14794 15687 gene locus_tag LOCUS_05480 14794 15687 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_05480 16029 18896 gene locus_tag LOCUS_05490 16029 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 18893 23302 gene locus_tag LOCUS_05500 18893 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 23253 23636 gene locus_tag LOCUS_05510 23253 23636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 23731 25905 gene locus_tag LOCUS_05520 23731 25905 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_05520 25908 28391 gene locus_tag LOCUS_05530 25908 28391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 28395 28847 gene locus_tag LOCUS_05540 28395 28847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 28913 32575 gene locus_tag LOCUS_05550 28913 32575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 32557 33060 gene locus_tag LOCUS_05560 32557 33060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 34400 33057 gene locus_tag LOCUS_05570 34400 33057 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_05570 35122 34418 gene locus_tag LOCUS_05580 35122 34418 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_05580 36974 35145 gene locus_tag LOCUS_05590 36974 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 37234 37001 gene locus_tag LOCUS_05600 37234 37001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 37145 37960 gene locus_tag LOCUS_05610 37145 37960 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_05610 37954 38613 gene locus_tag LOCUS_05620 37954 38613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 38784 40157 gene locus_tag LOCUS_05630 38784 40157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 40210 42519 gene locus_tag LOCUS_05640 40210 42519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 42604 45018 gene locus_tag LOCUS_05650 42604 45018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 45045 46082 gene locus_tag LOCUS_05660 45045 46082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 46086 48047 gene locus_tag LOCUS_05670 46086 48047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 48050 49606 gene locus_tag LOCUS_05680 48050 49606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 49672 52047 gene locus_tag LOCUS_05690 49672 52047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 52071 55292 gene locus_tag LOCUS_05700 52071 55292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 55636 56985 gene locus_tag LOCUS_05710 55636 56985 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094729231.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence10 2170 875 gene locus_tag LOCUS_05720 2170 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_05720 2559 2170 gene locus_tag LOCUS_05730 2559 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2489 2707 gene locus_tag LOCUS_05740 2489 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2685 4349 gene locus_tag LOCUS_05750 2685 4349 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_05750 4356 5084 gene locus_tag LOCUS_05760 4356 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 5701 5069 gene locus_tag LOCUS_05770 gene nth 5701 5069 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_05770 6359 5679 gene locus_tag LOCUS_05780 6359 5679 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_05780 6437 9403 gene locus_tag LOCUS_05790 6437 9403 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_05790 9410 11305 gene locus_tag LOCUS_05800 9410 11305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11435 13444 gene locus_tag LOCUS_05810 gene gyrB 11435 13444 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_05810 13461 15476 gene locus_tag LOCUS_05820 13461 15476 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_05820 15498 16814 gene locus_tag LOCUS_05830 gene tig 15498 16814 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 protein_id gnl|my_center|LOCUS_05830 16820 17494 gene locus_tag LOCUS_05840 gene clpP 16820 17494 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_05840 17497 18729 gene locus_tag LOCUS_05850 gene clpX 17497 18729 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_05850 20890 18719 gene locus_tag LOCUS_05860 20890 18719 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474357.1 protein_id gnl|my_center|LOCUS_05860 23153 20892 gene locus_tag LOCUS_05870 23153 20892 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_05870 24521 23157 gene locus_tag LOCUS_05880 24521 23157 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_05880 26479 24536 gene locus_tag LOCUS_05890 26479 24536 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_05890 27624 26479 gene locus_tag LOCUS_05900 27624 26479 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_05900 27723 28334 gene locus_tag LOCUS_05910 gene lpxF 27723 28334 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_05910 28433 30316 gene locus_tag LOCUS_05920 28433 30316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 30455 31627 gene locus_tag LOCUS_05930 gene nagA 30455 31627 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108898.1 protein_id gnl|my_center|LOCUS_05930 31638 32123 gene locus_tag LOCUS_05940 31638 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 33662 32133 gene locus_tag LOCUS_05950 33662 32133 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_05950 35135 33702 gene locus_tag LOCUS_05960 gene preA 35135 33702 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956071.1 protein_id gnl|my_center|LOCUS_05960 36019 35174 gene locus_tag LOCUS_05970 36019 35174 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114604.1 protein_id gnl|my_center|LOCUS_05970 37148 36024 gene locus_tag LOCUS_05980 37148 36024 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405515.1 protein_id gnl|my_center|LOCUS_05980 37335 38429 gene locus_tag LOCUS_05990 37335 38429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 39692 38430 gene locus_tag LOCUS_06000 39692 38430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 42821 39750 gene locus_tag LOCUS_06010 42821 39750 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_06010 43511 45472 gene locus_tag LOCUS_06020 43511 45472 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_06020 47064 45559 gene locus_tag LOCUS_06030 47064 45559 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_06030 48686 47091 gene locus_tag LOCUS_06040 48686 47091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 48822 49706 gene locus_tag LOCUS_06050 48822 49706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 49742 50218 gene locus_tag LOCUS_06060 49742 50218 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943873.1 protein_id gnl|my_center|LOCUS_06060 50221 50886 gene locus_tag LOCUS_06070 50221 50886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 51021 51191 gene locus_tag LOCUS_06080 51021 51191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 51210 52250 gene locus_tag LOCUS_06090 51210 52250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 52300 53349 gene locus_tag LOCUS_06100 52300 53349 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483085.1 protein_id gnl|my_center|LOCUS_06100 53838 53371 gene locus_tag LOCUS_06110 gene greA 53838 53371 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_06110 53901 55073 gene locus_tag LOCUS_06120 53901 55073 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_06120 55077 55844 gene locus_tag LOCUS_06130 55077 55844 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence11 231 608 gene locus_tag LOCUS_06140 231 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 693 1244 gene locus_tag LOCUS_06150 693 1244 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_06150 2948 1221 gene locus_tag LOCUS_06160 2948 1221 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201995.1 protein_id gnl|my_center|LOCUS_06160 5063 3069 gene locus_tag LOCUS_06170 5063 3069 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_06170 5523 5074 gene locus_tag LOCUS_06180 5523 5074 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_06180 6728 5646 gene locus_tag LOCUS_06190 6728 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8356 6728 gene locus_tag LOCUS_06200 8356 6728 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_06200 9297 8365 gene locus_tag LOCUS_06210 9297 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 9386 10900 gene locus_tag LOCUS_06220 9386 10900 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_06220 10900 12003 gene locus_tag LOCUS_06230 gene prfB 10900 12003 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_06230 13317 12010 gene locus_tag LOCUS_06240 13317 12010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 14595 13336 gene locus_tag LOCUS_06250 14595 13336 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_06250 15810 14596 gene locus_tag LOCUS_06260 15810 14596 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_06260 17156 15813 gene locus_tag LOCUS_06270 17156 15813 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_06270 19468 17165 gene locus_tag LOCUS_06280 19468 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 20091 19498 gene locus_tag LOCUS_06290 20091 19498 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_06290 21748 20102 gene locus_tag LOCUS_06300 21748 20102 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_06300 22502 21741 gene locus_tag LOCUS_06310 22502 21741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 23656 22508 gene locus_tag LOCUS_06320 23656 22508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 23767 23841 gene locus_tag LOCUS_t00160 23767 23841 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 23937 24509 gene locus_tag LOCUS_06330 23937 24509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 25796 24585 gene locus_tag LOCUS_06340 25796 24585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 27623 25812 gene locus_tag LOCUS_06350 27623 25812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 29143 27638 gene locus_tag LOCUS_06360 29143 27638 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765315.1 protein_id gnl|my_center|LOCUS_06360 30682 29162 gene locus_tag LOCUS_06370 30682 29162 CDS product BACON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108500.1 protein_id gnl|my_center|LOCUS_06370 32319 30676 gene locus_tag LOCUS_06380 32319 30676 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_06380 35104 32369 gene locus_tag LOCUS_06390 35104 32369 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_06390 36924 35125 gene locus_tag LOCUS_06400 36924 35125 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_06400 40131 36961 gene locus_tag LOCUS_06410 40131 36961 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_06410 41390 40161 gene locus_tag LOCUS_06420 41390 40161 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705784.1 protein_id gnl|my_center|LOCUS_06420 42690 41524 gene locus_tag LOCUS_06430 42690 41524 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_06430 45192 42694 gene locus_tag LOCUS_06440 45192 42694 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_06440 46027 45200 gene locus_tag LOCUS_06450 46027 45200 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014548276.1 protein_id gnl|my_center|LOCUS_06450 46300 48186 gene locus_tag LOCUS_06460 46300 48186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 48188 49357 gene locus_tag LOCUS_06470 48188 49357 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202557.1 protein_id gnl|my_center|LOCUS_06470 49354 50610 gene locus_tag LOCUS_06480 49354 50610 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence12 <1 1623 gene locus_tag LOCUS_06490 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I 1595 2206 gene locus_tag LOCUS_06500 gene rpoE 1595 2206 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_06500 2203 2868 gene locus_tag LOCUS_06510 gene rsmG 2203 2868 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_06510 2870 5728 gene locus_tag LOCUS_06520 2870 5728 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_06520 5725 8733 gene locus_tag LOCUS_06530 5725 8733 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_06530 8796 9467 gene locus_tag LOCUS_06540 8796 9467 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_06540 9483 11948 gene locus_tag LOCUS_06550 9483 11948 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_06550 11952 12560 gene locus_tag LOCUS_06560 11952 12560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13548 12544 gene locus_tag LOCUS_06570 13548 12544 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_06570 13642 14655 gene locus_tag LOCUS_06580 13642 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14687 15277 gene locus_tag LOCUS_06590 14687 15277 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_06590 15277 15729 gene locus_tag LOCUS_06600 15277 15729 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_06600 15761 16534 gene locus_tag LOCUS_06610 15761 16534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 17321 16578 gene locus_tag LOCUS_06620 17321 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 17740 18957 gene locus_tag LOCUS_06630 17740 18957 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_06630 18972 19880 gene locus_tag LOCUS_06640 gene ptb 18972 19880 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_06640 21312 20032 gene locus_tag LOCUS_06650 21312 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 21920 21309 gene locus_tag LOCUS_06660 21920 21309 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_06660 23319 21925 gene locus_tag LOCUS_06670 23319 21925 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_06670 24330 23326 gene locus_tag LOCUS_06680 24330 23326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 24906 24352 gene locus_tag LOCUS_06690 24906 24352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 25942 24896 gene locus_tag LOCUS_06700 25942 24896 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_06700 26053 26745 gene locus_tag LOCUS_06710 26053 26745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_06710 26766 27455 gene locus_tag LOCUS_06720 26766 27455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 27452 27988 gene locus_tag LOCUS_06730 27452 27988 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_06730 29202 27985 gene locus_tag LOCUS_06740 29202 27985 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948301.1 protein_id gnl|my_center|LOCUS_06740 29294 30178 gene locus_tag LOCUS_06750 29294 30178 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_06750 30667 30182 gene locus_tag LOCUS_06760 30667 30182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 30734 32068 gene locus_tag LOCUS_06770 30734 32068 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_06770 32071 33675 gene locus_tag LOCUS_06780 32071 33675 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_06780 34140 33772 gene locus_tag LOCUS_06790 gene dtd 34140 33772 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_06790 34326 36371 gene locus_tag LOCUS_06800 34326 36371 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_06800 36400 37197 gene locus_tag LOCUS_06810 36400 37197 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_06810 37194 37961 gene locus_tag LOCUS_06820 37194 37961 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_06820 38574 37975 gene locus_tag LOCUS_06830 gene hisIE 38574 37975 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_06830 39345 38587 gene locus_tag LOCUS_06840 gene hisF 39345 38587 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_06840 40046 39315 gene locus_tag LOCUS_06850 gene hisA 40046 39315 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_06850 40633 40043 gene locus_tag LOCUS_06860 gene hisH 40633 40043 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_06860 41697 40630 gene locus_tag LOCUS_06870 gene hisB 41697 40630 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_06870 42725 41694 gene locus_tag LOCUS_06880 gene hisC 42725 41694 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_06880 43999 42722 gene locus_tag LOCUS_06890 gene hisD 43999 42722 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_06890 44847 43996 gene locus_tag LOCUS_06900 gene hisG 44847 43996 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_06900 45318 45022 gene locus_tag LOCUS_06910 45318 45022 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_06910 45897 45322 gene locus_tag LOCUS_06920 45897 45322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 46250 46657 gene locus_tag LOCUS_06930 46250 46657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 46657 47769 gene locus_tag LOCUS_06940 46657 47769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 48738 47776 gene locus_tag LOCUS_06950 48738 47776 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765031.1 protein_id gnl|my_center|LOCUS_06950 49311 48850 gene locus_tag LOCUS_06960 49311 48850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence13 356 1036 gene locus_tag LOCUS_06970 356 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1230 1859 gene locus_tag LOCUS_06980 1230 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3128 2067 gene locus_tag LOCUS_06990 3128 2067 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_06990 5200 3128 gene locus_tag LOCUS_07000 5200 3128 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_07000 5904 5272 gene locus_tag LOCUS_07010 5904 5272 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_07010 6365 5931 gene locus_tag LOCUS_07020 6365 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 6600 6851 gene locus_tag LOCUS_07030 6600 6851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 6915 9068 gene locus_tag LOCUS_07040 6915 9068 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_07040 10114 9155 gene locus_tag LOCUS_07050 10114 9155 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_07050 10171 12762 gene locus_tag LOCUS_07060 10171 12762 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_07060 12763 13290 gene locus_tag LOCUS_07070 12763 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 13292 13891 gene locus_tag LOCUS_07080 13292 13891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 13907 15343 gene locus_tag LOCUS_07090 13907 15343 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_07090 15640 16824 gene locus_tag LOCUS_07100 15640 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861265.1 protein_id gnl|my_center|LOCUS_07100 16842 17750 gene locus_tag LOCUS_07110 16842 17750 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_07110 18020 19999 gene locus_tag LOCUS_07120 18020 19999 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_07120 20058 21680 gene locus_tag LOCUS_07130 20058 21680 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108473.1 protein_id gnl|my_center|LOCUS_07130 23385 21682 gene locus_tag LOCUS_07140 23385 21682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 24964 23882 gene locus_tag LOCUS_07150 24964 23882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 26385 24961 gene locus_tag LOCUS_07160 26385 24961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 26525 26662 gene locus_tag LOCUS_07170 26525 26662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 29561 26655 gene locus_tag LOCUS_07180 29561 26655 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_07180 30801 29563 gene locus_tag LOCUS_07190 30801 29563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 31456 30821 gene locus_tag LOCUS_07200 31456 30821 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_07200 32476 31469 gene locus_tag LOCUS_07210 gene thiL 32476 31469 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_07210 32562 33371 gene locus_tag LOCUS_07220 32562 33371 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_07220 37056 33379 gene locus_tag LOCUS_07230 gene dnaE 37056 33379 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_07230 38616 37075 gene locus_tag LOCUS_07240 38616 37075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 41221 38636 gene locus_tag LOCUS_07250 41221 38636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 44410 41357 gene locus_tag LOCUS_07260 gene secDF 44410 41357 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_07260 44641 46392 gene locus_tag LOCUS_07270 44641 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 46668 46757 gene locus_tag LOCUS_t00170 46668 46757 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 1047 448 gene locus_tag LOCUS_07280 gene rsxA 1047 448 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_07280 1645 1058 gene locus_tag LOCUS_07290 1645 1058 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_07290 2252 1638 gene locus_tag LOCUS_07300 2252 1638 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813361.1 protein_id gnl|my_center|LOCUS_07300 3232 2255 gene locus_tag LOCUS_07310 3232 2255 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_07310 4615 3248 gene locus_tag LOCUS_07320 gene rsxC 4615 3248 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_07320 5542 4619 gene locus_tag LOCUS_07330 5542 4619 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_07330 5966 5550 gene locus_tag LOCUS_07340 5966 5550 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_07340 7492 5966 gene locus_tag LOCUS_07350 gene dnaB 7492 5966 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_07350 8323 7508 gene locus_tag LOCUS_07360 8323 7508 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_07360 8696 8379 gene locus_tag LOCUS_07370 8696 8379 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_07370 9661 8714 gene locus_tag LOCUS_07380 9661 8714 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_07380 10672 9665 gene locus_tag LOCUS_07390 10672 9665 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_07390 10764 13376 gene locus_tag LOCUS_07400 gene alaS 10764 13376 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_07400 13386 15845 gene locus_tag LOCUS_07410 13386 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 15845 16504 gene locus_tag LOCUS_07420 15845 16504 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_07420 16521 17972 gene locus_tag LOCUS_07430 16521 17972 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_07430 17978 19333 gene locus_tag LOCUS_07440 17978 19333 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_07440 21835 19499 gene locus_tag LOCUS_07450 21835 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 22769 21837 gene locus_tag LOCUS_07460 22769 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 22889 23338 gene locus_tag LOCUS_07470 22889 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 25433 23412 gene locus_tag LOCUS_07480 25433 23412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 26798 25446 gene locus_tag LOCUS_07490 26798 25446 CDS product DUF4302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767466.1 protein_id gnl|my_center|LOCUS_07490 27805 26810 gene locus_tag LOCUS_07500 27805 26810 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_07500 29422 27827 gene locus_tag LOCUS_07510 29422 27827 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_07510 32772 29434 gene locus_tag LOCUS_07520 32772 29434 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108709.1 protein_id gnl|my_center|LOCUS_07520 33186 33097 gene locus_tag LOCUS_t00180 33186 33097 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 34629 33397 gene locus_tag LOCUS_07530 34629 33397 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_07530 35503 34643 gene locus_tag LOCUS_07540 35503 34643 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_07540 37093 35510 gene locus_tag LOCUS_07550 gene atpA 37093 35510 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107412.1 protein_id gnl|my_center|LOCUS_07550 37670 37113 gene locus_tag LOCUS_07560 37670 37113 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241344.1 protein_id gnl|my_center|LOCUS_07560 38173 37670 gene locus_tag LOCUS_07570 gene atpF 38173 37670 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_07570 38431 38177 gene locus_tag LOCUS_07580 38431 38177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 39472 38474 gene locus_tag LOCUS_07590 gene atpB 39472 38474 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_07590 39741 39496 gene locus_tag LOCUS_07600 gene atpC 39741 39496 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_07600 41270 39759 gene locus_tag LOCUS_07610 gene atpD 41270 39759 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_07610 40316 40407 gene locus_tag LOCUS_t00190 40316 40407 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 42583 41276 gene locus_tag LOCUS_07620 gene eno 42583 41276 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_07620 43567 42614 gene locus_tag LOCUS_07630 43567 42614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 43764 43681 gene locus_tag LOCUS_t00200 43764 43681 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43941 44495 gene locus_tag LOCUS_07640 43941 44495 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_07640 44503 45000 gene locus_tag LOCUS_07650 44503 45000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 45724 44990 gene locus_tag LOCUS_07660 45724 44990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence15 1749 175 gene locus_tag LOCUS_07670 gene guaA 1749 175 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_07670 1855 3663 gene locus_tag LOCUS_07680 gene typA 1855 3663 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_07680 3725 4195 gene locus_tag LOCUS_07690 3725 4195 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764107.1 protein_id gnl|my_center|LOCUS_07690 4235 4417 gene locus_tag LOCUS_07700 gene rpmF 4235 4417 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_07700 4450 4522 gene locus_tag LOCUS_t00210 4450 4522 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5684 4680 gene locus_tag LOCUS_07710 5684 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6950 5712 gene locus_tag LOCUS_07720 6950 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8443 7088 gene locus_tag LOCUS_07730 8443 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8598 8443 gene locus_tag LOCUS_07740 8598 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8774 8595 gene locus_tag LOCUS_07750 8774 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 10652 8868 gene locus_tag LOCUS_07760 10652 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 10753 11220 gene locus_tag LOCUS_07770 gene argR 10753 11220 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_07770 11239 13308 gene locus_tag LOCUS_07780 11239 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 13311 14963 gene locus_tag LOCUS_07790 13311 14963 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_07790 14966 15373 gene locus_tag LOCUS_07800 14966 15373 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_07800 15366 16895 gene locus_tag LOCUS_07810 15366 16895 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_07810 17637 16897 gene locus_tag LOCUS_07820 17637 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 18266 17646 gene locus_tag LOCUS_07830 gene udk 18266 17646 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_07830 19746 18346 gene locus_tag LOCUS_07840 gene asnS 19746 18346 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_07840 20321 19854 gene locus_tag LOCUS_07850 20321 19854 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_07850 20910 20335 gene locus_tag LOCUS_07860 20910 20335 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_07860 21363 20917 gene locus_tag LOCUS_07870 21363 20917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22179 21376 gene locus_tag LOCUS_07880 22179 21376 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_07880 22121 22270 gene locus_tag LOCUS_07890 22121 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 23348 22302 gene locus_tag LOCUS_07900 23348 22302 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074859600.1 protein_id gnl|my_center|LOCUS_07900 24121 23345 gene locus_tag LOCUS_07910 24121 23345 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817413.1 protein_id gnl|my_center|LOCUS_07910 25304 24156 gene locus_tag LOCUS_07920 25304 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 26483 25434 gene locus_tag LOCUS_07930 gene queA 26483 25434 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_07930 27463 26525 gene locus_tag LOCUS_07940 27463 26525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 28776 27460 gene locus_tag LOCUS_07950 28776 27460 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108106.1 protein_id gnl|my_center|LOCUS_07950 29216 28776 gene locus_tag LOCUS_07960 29216 28776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 29266 29877 gene locus_tag LOCUS_07970 29266 29877 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_07970 31885 30932 gene locus_tag LOCUS_07980 31885 30932 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_07980 32544 31885 gene locus_tag LOCUS_07990 32544 31885 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640660.1 protein_id gnl|my_center|LOCUS_07990 32653 33759 gene locus_tag LOCUS_08000 32653 33759 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_08000 34696 33746 gene locus_tag LOCUS_08010 34696 33746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 37340 34776 gene locus_tag LOCUS_08020 37340 34776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 38565 37345 gene locus_tag LOCUS_08030 38565 37345 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107416.1 protein_id gnl|my_center|LOCUS_08030 40570 38576 gene locus_tag LOCUS_08040 40570 38576 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_08040 41685 40780 gene locus_tag LOCUS_08050 41685 40780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 42367 41693 gene locus_tag LOCUS_08060 gene rsmI 42367 41693 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_08060 43044 42367 gene locus_tag LOCUS_08070 43044 42367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 43105 43677 gene locus_tag LOCUS_08080 43105 43677 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784663.1 protein_id gnl|my_center|LOCUS_08080 43683 44522 gene locus_tag LOCUS_08090 gene xerD 43683 44522 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761920.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence16 <1 1252 gene locus_tag LOCUS_08100 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760797.1:pseudouridine synthase 1264 2160 gene locus_tag LOCUS_08110 gene era 1264 2160 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_08110 2176 4962 gene locus_tag LOCUS_08120 2176 4962 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_08120 4982 5437 gene locus_tag LOCUS_08130 4982 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7277 5541 gene locus_tag LOCUS_08140 gene recJ 7277 5541 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_08140 7472 8422 gene locus_tag LOCUS_08150 7472 8422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8476 9993 gene locus_tag LOCUS_08160 gene lysS 8476 9993 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_08160 10045 10848 gene locus_tag LOCUS_08170 10045 10848 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_08170 10845 11738 gene locus_tag LOCUS_08180 10845 11738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 11810 12286 gene locus_tag LOCUS_08190 11810 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 12295 13581 gene locus_tag LOCUS_08200 12295 13581 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_08200 13578 14930 gene locus_tag LOCUS_08210 13578 14930 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202181.1 protein_id gnl|my_center|LOCUS_08210 14935 16185 gene locus_tag LOCUS_08220 14935 16185 CDS product PNGase F N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813194.1 protein_id gnl|my_center|LOCUS_08220 16451 16912 gene locus_tag LOCUS_08230 gene mraZ 16451 16912 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_08230 16924 17841 gene locus_tag LOCUS_08240 gene rsmH 16924 17841 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_08240 17853 18185 gene locus_tag LOCUS_08250 17853 18185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 18260 20332 gene locus_tag LOCUS_08260 18260 20332 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_08260 20335 21768 gene locus_tag LOCUS_08270 20335 21768 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_08270 21765 23066 gene locus_tag LOCUS_08280 gene mraY 21765 23066 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_08280 23079 24425 gene locus_tag LOCUS_08290 gene murD 23079 24425 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_08290 24441 25865 gene locus_tag LOCUS_08300 24441 25865 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_08300 25870 27015 gene locus_tag LOCUS_08310 gene murG 25870 27015 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_08310 27015 28367 gene locus_tag LOCUS_08320 gene murC 27015 28367 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_08320 28368 29147 gene locus_tag LOCUS_08330 28368 29147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 29160 30599 gene locus_tag LOCUS_08340 gene ftsA 29160 30599 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_08340 30604 31866 gene locus_tag LOCUS_08350 30604 31866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 31927 33429 gene locus_tag LOCUS_08360 gene gltX 31927 33429 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_08360 33443 33871 gene locus_tag LOCUS_08370 gene rpiB 33443 33871 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_08370 33874 34854 gene locus_tag LOCUS_08380 33874 34854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 34927 35955 gene locus_tag LOCUS_08390 34927 35955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 36186 36509 gene locus_tag LOCUS_08400 36186 36509 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760436.1 protein_id gnl|my_center|LOCUS_08400 36587 37498 gene locus_tag LOCUS_08410 36587 37498 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_08410 37501 38358 gene locus_tag LOCUS_08420 37501 38358 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_08420 38364 39245 gene locus_tag LOCUS_08430 38364 39245 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233875.1 protein_id gnl|my_center|LOCUS_08430 39817 39242 gene locus_tag LOCUS_08440 39817 39242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 40353 39817 gene locus_tag LOCUS_08450 40353 39817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 40659 40366 gene locus_tag LOCUS_08460 40659 40366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 40752 41861 gene locus_tag LOCUS_08470 40752 41861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 41931 42452 gene locus_tag LOCUS_08480 41931 42452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence17 1198 557 gene locus_tag LOCUS_08490 1198 557 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932831.1 protein_id gnl|my_center|LOCUS_08490 1712 2044 gene locus_tag LOCUS_08500 1712 2044 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_08500 3485 2091 gene locus_tag LOCUS_08510 3485 2091 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_08510 3582 5099 gene locus_tag LOCUS_08520 3582 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5117 6040 gene locus_tag LOCUS_08530 5117 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 6741 6037 gene locus_tag LOCUS_08540 6741 6037 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_08540 7164 6787 gene locus_tag LOCUS_08550 7164 6787 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788735.1 protein_id gnl|my_center|LOCUS_08550 8280 7180 gene locus_tag LOCUS_08560 8280 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8371 9408 gene locus_tag LOCUS_08570 8371 9408 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 protein_id gnl|my_center|LOCUS_08570 9416 10099 gene locus_tag LOCUS_08580 9416 10099 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_08580 10593 11939 gene locus_tag LOCUS_08590 10593 11939 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_08590 11936 13177 gene locus_tag LOCUS_08600 11936 13177 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_08600 13174 14196 gene locus_tag LOCUS_08610 13174 14196 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_08610 14193 15524 gene locus_tag LOCUS_08620 gene argH 14193 15524 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_08620 16165 15716 gene locus_tag LOCUS_08630 16165 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17401 16166 gene locus_tag LOCUS_08640 gene serB 17401 16166 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_08640 18587 17388 gene locus_tag LOCUS_08650 18587 17388 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_08650 21115 18587 gene locus_tag LOCUS_08660 21115 18587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 21279 21127 gene locus_tag LOCUS_08670 21279 21127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 21502 22005 gene locus_tag LOCUS_08680 21502 22005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 22002 22478 gene locus_tag LOCUS_08690 22002 22478 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798225.1 protein_id gnl|my_center|LOCUS_08690 22475 22882 gene locus_tag LOCUS_08700 22475 22882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 22879 23364 gene locus_tag LOCUS_08710 22879 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 26102 23442 gene locus_tag LOCUS_08720 26102 23442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 27579 26167 gene locus_tag LOCUS_08730 27579 26167 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201944.1 protein_id gnl|my_center|LOCUS_08730 27746 28987 gene locus_tag LOCUS_08740 27746 28987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 28984 29838 gene locus_tag LOCUS_08750 28984 29838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 30035 33370 gene locus_tag LOCUS_08760 30035 33370 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106605886.1 protein_id gnl|my_center|LOCUS_08760 33402 35030 gene locus_tag LOCUS_08770 33402 35030 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108353.1 protein_id gnl|my_center|LOCUS_08770 35973 35389 gene locus_tag LOCUS_08780 35973 35389 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_08780 36364 35960 gene locus_tag LOCUS_08790 36364 35960 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_08790 39809 36393 gene locus_tag LOCUS_08800 gene ileS 39809 36393 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_08800 39908 40396 gene locus_tag LOCUS_08810 39908 40396 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256853.1 protein_id gnl|my_center|LOCUS_08810 41108 40425 gene locus_tag LOCUS_08820 41108 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence18 855 2153 gene locus_tag LOCUS_08830 855 2153 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_08830 3178 2219 gene locus_tag LOCUS_08840 3178 2219 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_08840 4696 3194 gene locus_tag LOCUS_08850 4696 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 5242 4787 gene locus_tag LOCUS_08860 5242 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7250 5262 gene locus_tag LOCUS_08870 7250 5262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202070.1 protein_id gnl|my_center|LOCUS_08870 7237 7512 gene locus_tag LOCUS_08880 7237 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8322 7552 gene locus_tag LOCUS_08890 8322 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 8544 9950 gene locus_tag LOCUS_08900 8544 9950 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_08900 9963 10958 gene locus_tag LOCUS_08910 9963 10958 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_08910 10958 12127 gene locus_tag LOCUS_08920 10958 12127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_08920 12134 13333 gene locus_tag LOCUS_08930 12134 13333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_08930 15414 13330 gene locus_tag LOCUS_08940 15414 13330 CDS product glycoside hydrolase family 92 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048697949.1 protein_id gnl|my_center|LOCUS_08940 16309 15911 gene locus_tag LOCUS_08950 16309 15911 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_08950 16391 16702 gene locus_tag LOCUS_08960 16391 16702 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_08960 16769 17296 gene locus_tag LOCUS_08970 16769 17296 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208152.1 protein_id gnl|my_center|LOCUS_08970 17899 17306 gene locus_tag LOCUS_08980 17899 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 18059 19003 gene locus_tag LOCUS_08990 18059 19003 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_08990 20398 19016 gene locus_tag LOCUS_09000 gene purF 20398 19016 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_09000 22584 20398 gene locus_tag LOCUS_09010 22584 20398 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_09010 24211 22598 gene locus_tag LOCUS_09020 24211 22598 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_09020 28526 24240 gene locus_tag LOCUS_09030 28526 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 28825 29208 gene locus_tag LOCUS_09040 gene mutT 28825 29208 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_09040 30292 29603 gene locus_tag LOCUS_09050 30292 29603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 31254 30634 gene locus_tag LOCUS_09060 31254 30634 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09060 31914 31276 gene locus_tag LOCUS_09070 31914 31276 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_09070 33802 32099 gene locus_tag LOCUS_09080 33802 32099 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_09080 36597 33805 gene locus_tag LOCUS_09090 gene uvrA 36597 33805 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_09090 37295 36594 gene locus_tag LOCUS_09100 37295 36594 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_09100 39570 37297 gene locus_tag LOCUS_09110 39570 37297 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence19 591 208 gene locus_tag LOCUS_09120 gene rpsL 591 208 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_09120 1732 719 gene locus_tag LOCUS_09130 1732 719 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_09130 2686 1805 gene locus_tag LOCUS_09140 2686 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6239 2688 gene locus_tag LOCUS_09150 6239 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7187 6261 gene locus_tag LOCUS_09160 7187 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 7357 7184 gene locus_tag LOCUS_09170 7357 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 10075 7646 gene locus_tag LOCUS_09180 gene galB 10075 7646 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_09180 10641 10084 gene locus_tag LOCUS_09190 10641 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 13058 10647 gene locus_tag LOCUS_09200 13058 10647 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_09200 13760 13068 gene locus_tag LOCUS_09210 13760 13068 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_09210 13840 14292 gene locus_tag LOCUS_09220 gene smpB 13840 14292 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_09220 15236 14301 gene locus_tag LOCUS_09230 gene trmB 15236 14301 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_09230 15648 15223 gene locus_tag LOCUS_09240 15648 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 16796 15645 gene locus_tag LOCUS_09250 16796 15645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 17845 16775 gene locus_tag LOCUS_09260 17845 16775 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_09260 18824 17856 gene locus_tag LOCUS_09270 18824 17856 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_09270 19459 18824 gene locus_tag LOCUS_09280 19459 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 19787 19473 gene locus_tag LOCUS_09290 gene trxA 19787 19473 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_09290 20102 19809 gene locus_tag LOCUS_09300 20102 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_09300 23254 20120 gene locus_tag LOCUS_09310 23254 20120 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_09310 24307 23270 gene locus_tag LOCUS_09320 24307 23270 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_09320 25778 24315 gene locus_tag LOCUS_09330 25778 24315 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_09330 26645 25782 gene locus_tag LOCUS_09340 gene lgt 26645 25782 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783541.1 protein_id gnl|my_center|LOCUS_09340 27964 26711 gene locus_tag LOCUS_09350 27964 26711 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_09350 28914 27991 gene locus_tag LOCUS_09360 28914 27991 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_09360 32047 28892 gene locus_tag LOCUS_09370 32047 28892 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_09370 32159 32506 gene locus_tag LOCUS_09380 32159 32506 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_09380 32509 33261 gene locus_tag LOCUS_09390 32509 33261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 33268 34008 gene locus_tag LOCUS_09400 33268 34008 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_09400 34008 34370 gene locus_tag LOCUS_09410 34008 34370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 34345 34587 gene locus_tag LOCUS_09420 gene yidD 34345 34587 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_09420 34638 35825 gene locus_tag LOCUS_09430 34638 35825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 35881 35955 gene locus_tag LOCUS_t00220 35881 35955 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence20 258 1967 gene locus_tag LOCUS_09440 gene uvrC 258 1967 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_09440 1964 2725 gene locus_tag LOCUS_09450 gene pnuC 1964 2725 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_09450 2899 3147 gene locus_tag LOCUS_09460 2899 3147 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_09460 4816 3221 gene locus_tag LOCUS_09470 4816 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5636 4818 gene locus_tag LOCUS_09480 5636 4818 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_09480 5736 6590 gene locus_tag LOCUS_09490 5736 6590 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_09490 6594 6827 gene locus_tag LOCUS_09500 6594 6827 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_09500 6829 7647 gene locus_tag LOCUS_09510 6829 7647 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_09510 7652 8395 gene locus_tag LOCUS_09520 7652 8395 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_09520 9363 8641 gene locus_tag LOCUS_09530 9363 8641 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_09530 9726 10097 gene locus_tag LOCUS_09540 gene rplP 9726 10097 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_09540 10115 10309 gene locus_tag LOCUS_09550 gene rpmC 10115 10309 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_09550 10321 10575 gene locus_tag LOCUS_09560 gene rpsQ 10321 10575 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_09560 10578 10943 gene locus_tag LOCUS_09570 gene rplN 10578 10943 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_09570 10956 11273 gene locus_tag LOCUS_09580 gene rplX 10956 11273 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_09580 11276 11875 gene locus_tag LOCUS_09590 gene rplE 11276 11875 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_09590 11887 12156 gene locus_tag LOCUS_09600 gene rpsN 11887 12156 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_09600 12245 12640 gene locus_tag LOCUS_09610 gene rpsH 12245 12640 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_09610 12658 13218 gene locus_tag LOCUS_09620 gene rplF 12658 13218 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_09620 13235 13597 gene locus_tag LOCUS_09630 gene rplR 13235 13597 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_09630 13606 14124 gene locus_tag LOCUS_09640 gene rpsE 13606 14124 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_09640 14137 14316 gene locus_tag LOCUS_09650 gene rpmD 14137 14316 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_09650 14334 14786 gene locus_tag LOCUS_09660 gene rplO 14334 14786 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_09660 14789 16132 gene locus_tag LOCUS_09670 gene secY 14789 16132 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_09670 16152 16931 gene locus_tag LOCUS_09680 gene map 16152 16931 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_09680 16944 17162 gene locus_tag LOCUS_09690 gene infA 16944 17162 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_09690 17332 17709 gene locus_tag LOCUS_09700 gene rpsM 17332 17709 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_09700 17721 18110 gene locus_tag LOCUS_09710 gene rpsK 17721 18110 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_09710 18132 18737 gene locus_tag LOCUS_09720 gene rpsD 18132 18737 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_09720 18804 19772 gene locus_tag LOCUS_09730 18804 19772 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_09730 19775 20260 gene locus_tag LOCUS_09740 gene rplQ 19775 20260 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_09740 21121 20327 gene locus_tag LOCUS_09750 gene nagB 21121 20327 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705423.1 protein_id gnl|my_center|LOCUS_09750 23065 21128 gene locus_tag LOCUS_09760 23065 21128 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_09760 23935 23072 gene locus_tag LOCUS_09770 23935 23072 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_09770 24973 23945 gene locus_tag LOCUS_09780 24973 23945 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_09780 25085 27274 gene locus_tag LOCUS_09790 25085 27274 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_09790 27323 28054 gene locus_tag LOCUS_09800 27323 28054 CDS product non-specific acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001785756.1 protein_id gnl|my_center|LOCUS_09800 28123 28198 gene locus_tag LOCUS_t00230 28123 28198 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28292 28762 gene locus_tag LOCUS_09810 28292 28762 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765910.1 protein_id gnl|my_center|LOCUS_09810 28991 28749 gene locus_tag LOCUS_09820 28991 28749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 29303 29028 gene locus_tag LOCUS_09830 29303 29028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 29776 29303 gene locus_tag LOCUS_09840 29776 29303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence21 1524 220 gene locus_tag LOCUS_09850 gene agp 1524 220 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704989.1 protein_id gnl|my_center|LOCUS_09850 1724 3454 gene locus_tag LOCUS_09860 1724 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3936 3421 gene locus_tag LOCUS_09870 3936 3421 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_09870 5595 4183 gene locus_tag LOCUS_09880 gene rodA 5595 4183 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_09880 7430 5595 gene locus_tag LOCUS_09890 gene mrdA 7430 5595 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_09890 7926 7414 gene locus_tag LOCUS_09900 7926 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8759 7923 gene locus_tag LOCUS_09910 8759 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9782 8760 gene locus_tag LOCUS_09920 9782 8760 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_09920 9923 10588 gene locus_tag LOCUS_09930 9923 10588 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_09930 11060 10539 gene locus_tag LOCUS_09940 11060 10539 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005928359.1 protein_id gnl|my_center|LOCUS_09940 13420 11132 gene locus_tag LOCUS_09950 gene topA 13420 11132 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_09950 13559 15892 gene locus_tag LOCUS_09960 13559 15892 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_09960 15903 16916 gene locus_tag LOCUS_09970 15903 16916 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_09970 16920 17816 gene locus_tag LOCUS_09980 gene prmC 16920 17816 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_09980 17914 19092 gene locus_tag LOCUS_09990 17914 19092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 20945 19089 gene locus_tag LOCUS_10000 20945 19089 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_10000 21894 20947 gene locus_tag LOCUS_10010 21894 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 22076 24769 gene locus_tag LOCUS_10020 22076 24769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 24748 25404 gene locus_tag LOCUS_10030 24748 25404 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_10030 25631 25401 gene locus_tag LOCUS_10040 25631 25401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 26107 25634 gene locus_tag LOCUS_10050 26107 25634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 26195 27106 gene locus_tag LOCUS_10060 26195 27106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 27107 28201 gene locus_tag LOCUS_10070 gene hemW 27107 28201 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_10070 28782 28348 gene locus_tag LOCUS_10080 28782 28348 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_10080 29042 28779 gene locus_tag LOCUS_10090 29042 28779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence22 459 4097 gene locus_tag LOCUS_10100 459 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4151 4972 gene locus_tag LOCUS_10110 gene cas1 4151 4972 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_10110 5427 6057 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgatgtagaaaaggaataatgaacaac 6608 6135 gene locus_tag LOCUS_10120 6608 6135 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_10120 7164 6610 gene locus_tag LOCUS_10130 gene nadD 7164 6610 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_10130 7753 7166 gene locus_tag LOCUS_10140 gene gmk 7753 7166 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_10140 7882 8883 gene locus_tag LOCUS_10150 7882 8883 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_10150 10578 8962 gene locus_tag LOCUS_10160 gene pckA 10578 8962 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_10160 10726 12609 gene locus_tag LOCUS_10170 10726 12609 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_10170 14225 12606 gene locus_tag LOCUS_10180 14225 12606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_10180 15384 14233 gene locus_tag LOCUS_10190 15384 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 18032 15387 gene locus_tag LOCUS_10200 18032 15387 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_10200 18669 18025 gene locus_tag LOCUS_10210 18669 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 19625 18672 gene locus_tag LOCUS_10220 19625 18672 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_10220 20863 19622 gene locus_tag LOCUS_10230 gene mtaB 20863 19622 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_10230 21584 20865 gene locus_tag LOCUS_10240 21584 20865 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_10240 26139 21571 gene locus_tag LOCUS_10250 26139 21571 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_10250 26221 27243 gene locus_tag LOCUS_10260 gene tsaD 26221 27243 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_10260 27247 28923 gene locus_tag LOCUS_10270 27247 28923 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence23 2 2509 gene locus_tag LOCUS_10280 2 2509 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201991.1 protein_id gnl|my_center|LOCUS_10280 2514 3707 gene locus_tag LOCUS_10290 2514 3707 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_10290 3718 4584 gene locus_tag LOCUS_10300 3718 4584 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811883.1 protein_id gnl|my_center|LOCUS_10300 4572 5177 gene locus_tag LOCUS_10310 4572 5177 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_10310 5249 6487 gene locus_tag LOCUS_10320 5249 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 6844 6455 gene locus_tag LOCUS_10330 6844 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 7009 7878 gene locus_tag LOCUS_10340 7009 7878 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_10340 7879 10233 gene locus_tag LOCUS_10350 7879 10233 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_10350 10338 10195 gene locus_tag LOCUS_10360 10338 10195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 10699 13230 gene locus_tag LOCUS_10370 gene gyrA 10699 13230 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765727.1 protein_id gnl|my_center|LOCUS_10370 13235 14533 gene locus_tag LOCUS_10380 13235 14533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 15521 14565 gene locus_tag LOCUS_10390 15521 14565 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_10390 16564 15539 gene locus_tag LOCUS_10400 16564 15539 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203192.1 protein_id gnl|my_center|LOCUS_10400 16728 17255 gene locus_tag LOCUS_10410 16728 17255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 17258 18610 gene locus_tag LOCUS_10420 17258 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 18617 21385 gene locus_tag LOCUS_10430 gene leuS 18617 21385 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_10430 21414 22340 gene locus_tag LOCUS_10440 21414 22340 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_10440 22340 23293 gene locus_tag LOCUS_10450 22340 23293 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_10450 23850 23578 gene locus_tag LOCUS_10460 23850 23578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 25031 24276 gene locus_tag LOCUS_10470 25031 24276 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_10470 25165 27042 gene locus_tag LOCUS_10480 gene dnaK 25165 27042 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_10480 27128 28240 gene locus_tag LOCUS_10490 gene trpS 27128 28240 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_10490 28573 28253 gene locus_tag LOCUS_10500 28573 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 28857 28579 gene locus_tag LOCUS_10510 28857 28579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence24 <1 1950 gene locus_tag LOCUS_10520 <1 1950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033492290.1:GIY-YIG nuclease family protein 3406 2030 gene locus_tag LOCUS_10530 3406 2030 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167439.1 protein_id gnl|my_center|LOCUS_10530 4167 3415 gene locus_tag LOCUS_10540 4167 3415 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_10540 4776 4198 gene locus_tag LOCUS_10550 4776 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4869 5504 gene locus_tag LOCUS_10560 4869 5504 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_10560 5506 6789 gene locus_tag LOCUS_10570 5506 6789 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10570 7476 6763 gene locus_tag LOCUS_10580 7476 6763 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701830.1 protein_id gnl|my_center|LOCUS_10580 8456 7560 gene locus_tag LOCUS_10590 8456 7560 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_10590 8987 8460 gene locus_tag LOCUS_10600 8987 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 9986 8991 gene locus_tag LOCUS_10610 9986 8991 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_10610 10078 11076 gene locus_tag LOCUS_10620 10078 11076 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_10620 11197 12729 gene locus_tag LOCUS_10630 gene cysS 11197 12729 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_10630 12731 13480 gene locus_tag LOCUS_10640 12731 13480 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_10640 13509 15125 gene locus_tag LOCUS_10650 13509 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 15363 15136 gene locus_tag LOCUS_10660 15363 15136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 15313 15714 gene locus_tag LOCUS_10670 15313 15714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 20020 15773 gene locus_tag LOCUS_10680 gene rpoC 20020 15773 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_10680 23868 20047 gene locus_tag LOCUS_10690 gene rpoB 23868 20047 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_10690 24347 23973 gene locus_tag LOCUS_10700 gene rplL 24347 23973 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_10700 24912 24385 gene locus_tag LOCUS_10710 gene rplJ 24912 24385 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_10710 25627 24929 gene locus_tag LOCUS_10720 gene rplA 25627 24929 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_10720 26086 25640 gene locus_tag LOCUS_10730 gene rplK 26086 25640 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_10730 26650 26093 gene locus_tag LOCUS_10740 gene nusG 26650 26093 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_10740 26851 26663 gene locus_tag LOCUS_10750 26851 26663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 27004 26931 gene locus_tag LOCUS_t00240 27004 26931 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <27876 27061 gene locus_tag LOCUS_10760 <27876 27061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762026.1:elongation factor Tu >Feature sequence25 1101 115 gene locus_tag LOCUS_10770 1101 115 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_10770 1365 2000 gene locus_tag LOCUS_10780 1365 2000 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_10780 2226 4436 gene locus_tag LOCUS_10790 2226 4436 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_10790 4441 4956 gene locus_tag LOCUS_10800 gene nrdG 4441 4956 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108083.1 protein_id gnl|my_center|LOCUS_10800 6190 4985 gene locus_tag LOCUS_10810 6190 4985 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_10810 7838 6183 gene locus_tag LOCUS_10820 7838 6183 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_10820 7965 8507 gene locus_tag LOCUS_10830 7965 8507 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_10830 8509 9747 gene locus_tag LOCUS_10840 8509 9747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10176 9751 gene locus_tag LOCUS_10850 gene tsaE 10176 9751 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_10850 10331 11608 gene locus_tag LOCUS_10860 10331 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 11605 13164 gene locus_tag LOCUS_10870 11605 13164 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_10870 13288 14118 gene locus_tag LOCUS_10880 13288 14118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_10880 14131 14979 gene locus_tag LOCUS_10890 14131 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 14979 15317 gene locus_tag LOCUS_10900 14979 15317 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_10900 15335 17791 gene locus_tag LOCUS_10910 15335 17791 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_10910 18730 17792 gene locus_tag LOCUS_10920 gene ispE 18730 17792 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_10920 19365 18733 gene locus_tag LOCUS_10930 19365 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 20115 19369 gene locus_tag LOCUS_10940 gene sufC 20115 19369 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_10940 20701 20117 gene locus_tag LOCUS_10950 gene pnuC 20701 20117 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706944.1 protein_id gnl|my_center|LOCUS_10950 22146 20701 gene locus_tag LOCUS_10960 gene sufB 22146 20701 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_10960 23205 22159 gene locus_tag LOCUS_10970 gene aroC 23205 22159 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_10970 25223 23202 gene locus_tag LOCUS_10980 25223 23202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 26199 25198 gene locus_tag LOCUS_10990 gene aroB 26199 25198 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070659.1 protein_id gnl|my_center|LOCUS_10990 26247 26334 gene locus_tag LOCUS_t00250 26247 26334 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27433 26369 gene locus_tag LOCUS_11000 27433 26369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence26 185 622 gene locus_tag LOCUS_11010 185 622 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_11010 1743 625 gene locus_tag LOCUS_11020 1743 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1830 2492 gene locus_tag LOCUS_11030 1830 2492 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_11030 2536 2609 gene locus_tag LOCUS_t00260 2536 2609 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2645 3220 gene locus_tag LOCUS_11040 2645 3220 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836767.1 protein_id gnl|my_center|LOCUS_11040 4158 3256 gene locus_tag LOCUS_11050 4158 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4631 4161 gene locus_tag LOCUS_11060 gene coaD 4631 4161 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_11060 5311 4643 gene locus_tag LOCUS_11070 gene ung 5311 4643 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_11070 7551 5311 gene locus_tag LOCUS_11080 gene lon 7551 5311 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_11080 7954 8229 gene locus_tag LOCUS_11090 7954 8229 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_11090 8426 9985 gene locus_tag LOCUS_11100 8426 9985 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_11100 11069 9999 gene locus_tag LOCUS_11110 11069 9999 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_11110 11884 11069 gene locus_tag LOCUS_11120 11884 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12523 11900 gene locus_tag LOCUS_11130 12523 11900 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_11130 12581 14218 gene locus_tag LOCUS_11140 gene lnt 12581 14218 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_11140 14222 14971 gene locus_tag LOCUS_11150 14222 14971 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_11150 17949 14968 gene locus_tag LOCUS_11160 17949 14968 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_11160 18579 18025 gene locus_tag LOCUS_11170 gene ruvC 18579 18025 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_11170 19843 18572 gene locus_tag LOCUS_11180 gene serS 19843 18572 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_11180 20185 19925 gene locus_tag LOCUS_11190 gene rpmA 20185 19925 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_11190 20518 20207 gene locus_tag LOCUS_11200 gene rplU 20518 20207 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_11200 20811 20617 gene locus_tag LOCUS_11210 gene rpsU 20811 20617 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_11210 21588 20878 gene locus_tag LOCUS_11220 21588 20878 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_11220 22748 21591 gene locus_tag LOCUS_11230 22748 21591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 23893 22751 gene locus_tag LOCUS_11240 23893 22751 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_11240 24683 23922 gene locus_tag LOCUS_11250 24683 23922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 24901 25056 gene locus_tag LOCUS_11260 24901 25056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 25058 25600 gene locus_tag LOCUS_11270 25058 25600 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_11270 25597 26037 gene locus_tag LOCUS_11280 25597 26037 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133920.1 protein_id gnl|my_center|LOCUS_11280 26078 26227 gene locus_tag LOCUS_11290 26078 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence27 1954 524 gene locus_tag LOCUS_11300 1954 524 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_11300 4179 1957 gene locus_tag LOCUS_11310 4179 1957 CDS product alpha-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107267.1 protein_id gnl|my_center|LOCUS_11310 4256 4927 gene locus_tag LOCUS_11320 gene tsaA 4256 4927 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_11320 4924 5610 gene locus_tag LOCUS_11330 4924 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6990 5617 gene locus_tag LOCUS_11340 6990 5617 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_11340 9528 7000 gene locus_tag LOCUS_11350 9528 7000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 10774 9533 gene locus_tag LOCUS_11360 10774 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 10931 12061 gene locus_tag LOCUS_11370 10931 12061 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_11370 13001 12015 gene locus_tag LOCUS_11380 13001 12015 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_11380 13779 12985 gene locus_tag LOCUS_11390 13779 12985 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_11390 14615 13782 gene locus_tag LOCUS_11400 14615 13782 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_11400 15476 14628 gene locus_tag LOCUS_11410 15476 14628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 16822 15488 gene locus_tag LOCUS_11420 16822 15488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_11420 17729 16827 gene locus_tag LOCUS_11430 17729 16827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_11430 18772 17726 gene locus_tag LOCUS_11440 gene holA 18772 17726 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_11440 19225 18794 gene locus_tag LOCUS_11450 19225 18794 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_11450 20523 19258 gene locus_tag LOCUS_11460 gene fabF 20523 19258 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_11460 21525 20578 gene locus_tag LOCUS_11470 21525 20578 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_11470 21700 22554 gene locus_tag LOCUS_11480 21700 22554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 23242 22535 gene locus_tag LOCUS_11490 23242 22535 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_11490 23829 23365 gene locus_tag LOCUS_11500 gene queF 23829 23365 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_11500 24928 23831 gene locus_tag LOCUS_11510 gene prfA 24928 23831 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759884.1 protein_id gnl|my_center|LOCUS_11510 25497 25063 gene locus_tag LOCUS_11520 25497 25063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence28 <1 654 gene locus_tag LOCUS_11530 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761151.1:O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase 651 1664 gene locus_tag LOCUS_11540 gene metX 651 1664 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_11540 1652 4009 gene locus_tag LOCUS_11550 gene thrA 1652 4009 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_11550 4011 4991 gene locus_tag LOCUS_11560 4011 4991 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962688.1 protein_id gnl|my_center|LOCUS_11560 5059 6672 gene locus_tag LOCUS_11570 5059 6672 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_11570 6687 7373 gene locus_tag LOCUS_11580 6687 7373 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_11580 7394 9457 gene locus_tag LOCUS_11590 7394 9457 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_11590 10444 9461 gene locus_tag LOCUS_11600 10444 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 11680 10445 gene locus_tag LOCUS_11610 gene gltS 11680 10445 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_11610 15183 11680 gene locus_tag LOCUS_11620 15183 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 16085 15180 gene locus_tag LOCUS_11630 16085 15180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 17131 16085 gene locus_tag LOCUS_11640 17131 16085 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203190.1 protein_id gnl|my_center|LOCUS_11640 17274 18902 gene locus_tag LOCUS_11650 17274 18902 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_11650 18914 20101 gene locus_tag LOCUS_11660 18914 20101 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_11660 21475 20111 gene locus_tag LOCUS_11670 21475 20111 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_11670 22584 21493 gene locus_tag LOCUS_11680 22584 21493 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_11680 23418 22588 gene locus_tag LOCUS_11690 23418 22588 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765359.1 protein_id gnl|my_center|LOCUS_11690 23553 25016 gene locus_tag LOCUS_11700 23553 25016 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence29 2845 1460 gene locus_tag LOCUS_11710 2845 1460 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_11710 3677 2856 gene locus_tag LOCUS_11720 3677 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5153 3678 gene locus_tag LOCUS_11730 gene guaB 5153 3678 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_11730 6561 5233 gene locus_tag LOCUS_11740 6561 5233 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766461.1 protein_id gnl|my_center|LOCUS_11740 6610 7557 gene locus_tag LOCUS_11750 gene rsgA 6610 7557 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_11750 8057 7851 gene locus_tag LOCUS_11760 8057 7851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 8677 8186 gene locus_tag LOCUS_11770 8677 8186 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_11770 9923 8757 gene locus_tag LOCUS_11780 9923 8757 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_11780 10650 9925 gene locus_tag LOCUS_11790 10650 9925 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_11790 11282 10653 gene locus_tag LOCUS_11800 11282 10653 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_11800 12366 11287 gene locus_tag LOCUS_11810 12366 11287 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_11810 12980 12357 gene locus_tag LOCUS_11820 12980 12357 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_11820 14776 12986 gene locus_tag LOCUS_11830 gene mutL 14776 12986 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_11830 15077 14778 gene locus_tag LOCUS_11840 15077 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 15152 15631 gene locus_tag LOCUS_11850 gene ispF 15152 15631 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_11850 15717 15790 gene locus_tag LOCUS_t00270 15717 15790 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15805 15879 gene locus_tag LOCUS_t00280 15805 15879 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16085 16729 gene locus_tag LOCUS_11860 16085 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 17308 16736 gene locus_tag LOCUS_11870 17308 16736 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966761.1 protein_id gnl|my_center|LOCUS_11870 18037 17588 gene locus_tag LOCUS_11880 18037 17588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 19398 18475 gene locus_tag LOCUS_11890 19398 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 19687 19974 gene locus_tag LOCUS_11900 19687 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 19971 20678 gene locus_tag LOCUS_11910 19971 20678 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_11910 21245 22447 gene locus_tag LOCUS_11920 21245 22447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 23692 22451 gene locus_tag LOCUS_11930 23692 22451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 24061 23873 gene locus_tag LOCUS_11940 24061 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 24243 24377 gene locus_tag LOCUS_11950 24243 24377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence30 <1 897 gene locus_tag LOCUS_11960 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460214.1:NAD(P)/FAD-dependent oxidoreductase 1238 894 gene locus_tag LOCUS_11970 1238 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1268 2338 gene locus_tag LOCUS_11980 1268 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2866 2312 gene locus_tag LOCUS_11990 2866 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3771 2866 gene locus_tag LOCUS_12000 3771 2866 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_12000 4905 3784 gene locus_tag LOCUS_12010 gene dnaN 4905 3784 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_12010 5033 6487 gene locus_tag LOCUS_12020 5033 6487 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_12020 6498 7358 gene locus_tag LOCUS_12030 6498 7358 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_12030 7383 9173 gene locus_tag LOCUS_12040 gene argS 7383 9173 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_12040 9178 10335 gene locus_tag LOCUS_12050 9178 10335 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202122.1 protein_id gnl|my_center|LOCUS_12050 11220 10336 gene locus_tag LOCUS_12060 11220 10336 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_12060 11299 13038 gene locus_tag LOCUS_12070 11299 13038 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_12070 13152 13460 gene locus_tag LOCUS_12080 13152 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 13749 13489 gene locus_tag LOCUS_12090 13749 13489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 13639 15219 gene locus_tag LOCUS_12100 13639 15219 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_12100 15219 17354 gene locus_tag LOCUS_12110 15219 17354 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_12110 17483 18325 gene locus_tag LOCUS_12120 17483 18325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832962.1 protein_id gnl|my_center|LOCUS_12120 19047 18322 gene locus_tag LOCUS_12130 19047 18322 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_12130 22262 19050 gene locus_tag LOCUS_12140 22262 19050 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_12140 22382 23767 gene locus_tag LOCUS_12150 22382 23767 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence31 244 948 gene locus_tag LOCUS_12160 gene tsaB 244 948 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_12160 2091 940 gene locus_tag LOCUS_12170 2091 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2506 2102 gene locus_tag LOCUS_12180 2506 2102 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_12180 2979 2506 gene locus_tag LOCUS_12190 gene greA 2979 2506 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_12190 3971 3069 gene locus_tag LOCUS_12200 3971 3069 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108346.1 protein_id gnl|my_center|LOCUS_12200 8213 3978 gene locus_tag LOCUS_12210 8213 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 9425 8220 gene locus_tag LOCUS_12220 9425 8220 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_12220 10722 9430 gene locus_tag LOCUS_12230 10722 9430 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_12230 12663 10726 gene locus_tag LOCUS_12240 12663 10726 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_12240 14763 12766 gene locus_tag LOCUS_12250 14763 12766 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_12250 14968 14786 gene locus_tag LOCUS_12260 14968 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 16712 14973 gene locus_tag LOCUS_12270 16712 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 18565 17102 gene locus_tag LOCUS_12280 18565 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 19481 18588 gene locus_tag LOCUS_12290 19481 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 20674 19487 gene locus_tag LOCUS_12300 gene xseA 20674 19487 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_12300 21809 20676 gene locus_tag LOCUS_12310 21809 20676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 22260 21844 gene locus_tag LOCUS_12320 22260 21844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 23260 23036 gene locus_tag LOCUS_12330 23260 23036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence32 4338 3037 gene locus_tag LOCUS_12340 4338 3037 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_12340 4393 5517 gene locus_tag LOCUS_12350 4393 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5545 6873 gene locus_tag LOCUS_12360 5545 6873 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_12360 6970 9696 gene locus_tag LOCUS_12370 gene ppdK 6970 9696 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_12370 10072 9887 gene locus_tag LOCUS_12380 10072 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 11485 10085 gene locus_tag LOCUS_12390 11485 10085 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_12390 12015 11566 gene locus_tag LOCUS_12400 12015 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 15258 12097 gene locus_tag LOCUS_12410 15258 12097 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_12410 17119 15395 gene locus_tag LOCUS_12420 17119 15395 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_12420 18154 17132 gene locus_tag LOCUS_12430 18154 17132 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_12430 19027 18158 gene locus_tag LOCUS_12440 19027 18158 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_12440 20392 19046 gene locus_tag LOCUS_12450 20392 19046 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_12450 20509 21006 gene locus_tag LOCUS_12460 20509 21006 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence33 204 1802 gene locus_tag LOCUS_12470 204 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1904 2275 gene locus_tag LOCUS_12480 1904 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2330 3817 gene locus_tag LOCUS_12490 2330 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3831 4334 gene locus_tag LOCUS_12500 3831 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107174.1 protein_id gnl|my_center|LOCUS_12500 4934 4455 gene locus_tag LOCUS_12510 4934 4455 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_12510 6325 4934 gene locus_tag LOCUS_12520 6325 4934 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_12520 6918 6427 gene locus_tag LOCUS_12530 6918 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 7124 8137 gene locus_tag LOCUS_12540 7124 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 8165 8740 gene locus_tag LOCUS_12550 8165 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 10342 9596 gene locus_tag LOCUS_12560 gene fabG 10342 9596 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_12560 10469 11716 gene locus_tag LOCUS_12570 10469 11716 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_12570 11744 13132 gene locus_tag LOCUS_12580 gene nhaA 11744 13132 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_12580 13215 15551 gene locus_tag LOCUS_12590 13215 15551 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_12590 16289 15561 gene locus_tag LOCUS_12600 16289 15561 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975840.1 protein_id gnl|my_center|LOCUS_12600 18539 16311 gene locus_tag LOCUS_12610 18539 16311 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_12610 19744 18536 gene locus_tag LOCUS_12620 19744 18536 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_12620 19995 19744 gene locus_tag LOCUS_12630 19995 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 21258 20026 gene locus_tag LOCUS_12640 21258 20026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence34 985 65 gene locus_tag LOCUS_12650 985 65 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_12650 2090 1017 gene locus_tag LOCUS_12660 gene serC 2090 1017 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_12660 2765 2166 gene locus_tag LOCUS_12670 2765 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2827 3237 gene locus_tag LOCUS_12680 2827 3237 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_12680 4079 4573 gene locus_tag LOCUS_12690 4079 4573 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_12690 4672 5241 gene locus_tag LOCUS_12700 4672 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 5254 6114 gene locus_tag LOCUS_12710 gene miaA 5254 6114 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964020.1 protein_id gnl|my_center|LOCUS_12710 8380 6164 gene locus_tag LOCUS_12720 gene recQ 8380 6164 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_12720 8544 9368 gene locus_tag LOCUS_12730 gene fkpA 8544 9368 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417197.1 protein_id gnl|my_center|LOCUS_12730 9368 9739 gene locus_tag LOCUS_12740 9368 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 9779 10426 gene locus_tag LOCUS_12750 9779 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 10433 12364 gene locus_tag LOCUS_12760 gene dnaG 10433 12364 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_12760 12393 14657 gene locus_tag LOCUS_12770 12393 14657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 15566 14712 gene locus_tag LOCUS_12780 15566 14712 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_12780 15644 16093 gene locus_tag LOCUS_12790 15644 16093 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_12790 16978 16184 gene locus_tag LOCUS_12800 gene lptB 16978 16184 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_12800 18718 16991 gene locus_tag LOCUS_12810 18718 16991 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_12810 18804 19610 gene locus_tag LOCUS_12820 18804 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence35 141 68 gene locus_tag LOCUS_t00290 141 68 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 293 2305 gene locus_tag LOCUS_12830 293 2305 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_12830 2418 5096 gene locus_tag LOCUS_12840 2418 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 5102 6238 gene locus_tag LOCUS_12850 5102 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 7517 6225 gene locus_tag LOCUS_12860 7517 6225 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_12860 8833 7532 gene locus_tag LOCUS_12870 8833 7532 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_12870 9346 8843 gene locus_tag LOCUS_12880 9346 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 11508 9343 gene locus_tag LOCUS_12890 11508 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 14401 11543 gene locus_tag LOCUS_12900 14401 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 15924 14407 gene locus_tag LOCUS_12910 15924 14407 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_12910 17110 15917 gene locus_tag LOCUS_12920 17110 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 18908 17130 gene locus_tag LOCUS_12930 18908 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence36 252 1094 gene locus_tag LOCUS_12940 252 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1610 1089 gene locus_tag LOCUS_12950 1610 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2756 1977 gene locus_tag LOCUS_12960 2756 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3944 2769 gene locus_tag LOCUS_12970 3944 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 4570 3941 gene locus_tag LOCUS_12980 4570 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5889 4780 gene locus_tag LOCUS_12990 5889 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6342 5902 gene locus_tag LOCUS_13000 6342 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7404 6373 gene locus_tag LOCUS_13010 7404 6373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 7898 9193 gene locus_tag LOCUS_13020 gene tyrS 7898 9193 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_13020 9219 9575 gene locus_tag LOCUS_13030 gene rbfA 9219 9575 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_13030 9572 10822 gene locus_tag LOCUS_13040 9572 10822 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_13040 12191 10776 gene locus_tag LOCUS_13050 12191 10776 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_13050 12360 15083 gene locus_tag LOCUS_13060 12360 15083 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203196.1 protein_id gnl|my_center|LOCUS_13060 15080 15466 gene locus_tag LOCUS_13070 15080 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 15463 16980 gene locus_tag LOCUS_13080 15463 16980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 16998 18458 gene locus_tag LOCUS_13090 16998 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 18557 18709 gene locus_tag LOCUS_13100 gene rpmH 18557 18709 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence37 20 1372 gene locus_tag LOCUS_13110 20 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1404 2156 gene locus_tag LOCUS_13120 1404 2156 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_13120 2177 3352 gene locus_tag LOCUS_13130 2177 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 3359 4699 gene locus_tag LOCUS_13140 3359 4699 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_13140 4745 6112 gene locus_tag LOCUS_13150 4745 6112 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766760.1 protein_id gnl|my_center|LOCUS_13150 6129 8696 gene locus_tag LOCUS_13160 6129 8696 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_13160 8703 9248 gene locus_tag LOCUS_13170 8703 9248 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_13170 9252 11534 gene locus_tag LOCUS_13180 9252 11534 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_13180 11537 12466 gene locus_tag LOCUS_13190 11537 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 14837 12480 gene locus_tag LOCUS_13200 14837 12480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 15080 14850 gene locus_tag LOCUS_13210 15080 14850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 16273 15188 gene locus_tag LOCUS_13220 16273 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 16482 16712 gene locus_tag LOCUS_13230 16482 16712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 17518 17445 gene locus_tag LOCUS_t00300 17518 17445 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 17609 17534 gene locus_tag LOCUS_t00310 17609 17534 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence38 <1 2257 gene locus_tag LOCUS_13240 <1 2257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783920.1:translation initiation factor IF-2 2259 2945 gene locus_tag LOCUS_13250 2259 2945 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727970.1 protein_id gnl|my_center|LOCUS_13250 2949 4142 gene locus_tag LOCUS_13260 2949 4142 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_13260 4148 4969 gene locus_tag LOCUS_13270 gene folP 4148 4969 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_13270 4972 6306 gene locus_tag LOCUS_13280 gene purB 4972 6306 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_13280 6677 6336 gene locus_tag LOCUS_13290 6677 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 6759 7694 gene locus_tag LOCUS_13300 6759 7694 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_13300 7698 8633 gene locus_tag LOCUS_13310 7698 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 9345 8593 gene locus_tag LOCUS_13320 9345 8593 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_13320 10770 9349 gene locus_tag LOCUS_13330 10770 9349 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_13330 10849 12339 gene locus_tag LOCUS_13340 10849 12339 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 protein_id gnl|my_center|LOCUS_13340 12343 13623 gene locus_tag LOCUS_13350 12343 13623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 13725 14891 gene locus_tag LOCUS_13360 gene buk 13725 14891 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_13360 14909 15949 gene locus_tag LOCUS_13370 14909 15949 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_13370 15950 16219 gene locus_tag LOCUS_13380 15950 16219 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766138.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence39 515 988 gene locus_tag LOCUS_13390 515 988 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_13390 2153 969 gene locus_tag LOCUS_13400 2153 969 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_13400 3599 2157 gene locus_tag LOCUS_13410 gene mnmA 3599 2157 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_13410 4808 3753 gene locus_tag LOCUS_13420 4808 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5616 4789 gene locus_tag LOCUS_13430 5616 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6893 5628 gene locus_tag LOCUS_13440 6893 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 8765 6906 gene locus_tag LOCUS_13450 8765 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 9128 8778 gene locus_tag LOCUS_13460 9128 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 9418 9828 gene locus_tag LOCUS_13470 9418 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 11117 9837 gene locus_tag LOCUS_13480 11117 9837 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_13480 11219 12361 gene locus_tag LOCUS_13490 gene tgt 11219 12361 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_13490 12375 13469 gene locus_tag LOCUS_13500 12375 13469 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_13500 13478 13912 gene locus_tag LOCUS_13510 gene dut 13478 13912 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_13510 13916 15283 gene locus_tag LOCUS_13520 13916 15283 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence40 1375 1983 gene locus_tag LOCUS_13530 1375 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2165 3697 gene locus_tag LOCUS_13540 2165 3697 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_13540 4583 3702 gene locus_tag LOCUS_13550 4583 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 5989 4580 gene locus_tag LOCUS_13560 5989 4580 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_13560 8616 5992 gene locus_tag LOCUS_13570 8616 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 9364 8621 gene locus_tag LOCUS_13580 9364 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 10365 9361 gene locus_tag LOCUS_13590 10365 9361 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_13590 11345 10362 gene locus_tag LOCUS_13600 11345 10362 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_13600 12317 11349 gene locus_tag LOCUS_13610 12317 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 13208 12321 gene locus_tag LOCUS_13620 13208 12321 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_13620 14197 13208 gene locus_tag LOCUS_13630 14197 13208 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_13630 14229 15020 gene locus_tag LOCUS_13640 gene truA 14229 15020 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence41 159 1532 gene locus_tag LOCUS_13650 159 1532 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_13650 1572 4619 gene locus_tag LOCUS_13660 1572 4619 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_13660 4632 6305 gene locus_tag LOCUS_13670 4632 6305 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_13670 6321 9293 gene locus_tag LOCUS_13680 6321 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 9479 11602 gene locus_tag LOCUS_13690 9479 11602 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108937.1 protein_id gnl|my_center|LOCUS_13690 11608 12942 gene locus_tag LOCUS_13700 11608 12942 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_13700 12949 14859 gene locus_tag LOCUS_13710 12949 14859 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence42 938 865 gene locus_tag LOCUS_t00320 938 865 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1483 1007 gene locus_tag LOCUS_13720 gene ybaK 1483 1007 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_13720 2778 1483 gene locus_tag LOCUS_13730 gene tilS 2778 1483 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_13730 3804 2782 gene locus_tag LOCUS_13740 3804 2782 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_13740 5307 3829 gene locus_tag LOCUS_13750 gene proS 5307 3829 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_13750 6490 6209 gene locus_tag LOCUS_13760 6490 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6976 8457 gene locus_tag LOCUS_13770 6976 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 9113 8454 gene locus_tag LOCUS_13780 9113 8454 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_13780 9931 9113 gene locus_tag LOCUS_13790 gene lpxA 9931 9113 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_13790 10836 9934 gene locus_tag LOCUS_13800 10836 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 11879 10893 gene locus_tag LOCUS_13810 gene lpxD 11879 10893 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_13810 12017 12484 gene locus_tag LOCUS_13820 gene rimP 12017 12484 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_13820 12506 13765 gene locus_tag LOCUS_13830 gene nusA 12506 13765 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence43 1885 1118 gene locus_tag LOCUS_13840 gene rpsC 1885 1118 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_13840 2286 1888 gene locus_tag LOCUS_13850 gene rplV 2286 1888 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_13850 2600 2328 gene locus_tag LOCUS_13860 gene rpsS 2600 2328 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_13860 3447 2623 gene locus_tag LOCUS_13870 gene rplB 3447 2623 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_13870 3750 3460 gene locus_tag LOCUS_13880 gene rplW 3750 3460 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_13880 4392 3763 gene locus_tag LOCUS_13890 gene rplD 4392 3763 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_13890 4990 4397 gene locus_tag LOCUS_13900 gene rplC 4990 4397 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_13900 5344 13407 gene locus_tag LOCUS_13910 5344 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence44 278 1306 gene locus_tag LOCUS_13920 278 1306 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_13920 1303 2454 gene locus_tag LOCUS_13930 1303 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 3296 2451 gene locus_tag LOCUS_13940 3296 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3819 3328 gene locus_tag LOCUS_13950 3819 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 4231 3824 gene locus_tag LOCUS_13960 4231 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4444 5403 gene locus_tag LOCUS_13970 4444 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 6895 5684 gene locus_tag LOCUS_13980 6895 5684 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_13980 7231 9198 gene locus_tag LOCUS_13990 7231 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9623 9549 gene locus_tag LOCUS_t00330 9623 9549 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10009 9704 gene locus_tag LOCUS_14000 gene rpsJ 10009 9704 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_14000 12153 10042 gene locus_tag LOCUS_14010 gene fusA 12153 10042 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762033.1 protein_id gnl|my_center|LOCUS_14010 12511 12176 gene locus_tag LOCUS_14020 12511 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence45 2484 430 gene locus_tag LOCUS_14030 2484 430 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963110.1 protein_id gnl|my_center|LOCUS_14030 4221 2599 gene locus_tag LOCUS_14040 gene groL 4221 2599 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_14040 4500 4234 gene locus_tag LOCUS_14050 4500 4234 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_14050 4851 4513 gene locus_tag LOCUS_14060 4851 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4841 10219 gene locus_tag LOCUS_14070 4841 10219 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence46 3039 1027 gene locus_tag LOCUS_14080 3039 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4337 3036 gene locus_tag LOCUS_14090 4337 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4955 4341 gene locus_tag LOCUS_14100 4955 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5200 5042 gene locus_tag LOCUS_14110 5200 5042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5409 5221 gene locus_tag LOCUS_14120 gene rpmG 5409 5221 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_14120 5666 5421 gene locus_tag LOCUS_14130 gene rpmB 5666 5421 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_14130 7086 5746 gene locus_tag LOCUS_14140 7086 5746 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_14140 7458 7114 gene locus_tag LOCUS_14150 gene rplT 7458 7114 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_14150 7743 7549 gene locus_tag LOCUS_14160 gene rpmI 7743 7549 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_14160 8191 7796 gene locus_tag LOCUS_14170 8191 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 10382 8451 gene locus_tag LOCUS_14180 gene thrS 10382 8451 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_14180 10470 11069 gene locus_tag LOCUS_14190 10470 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 11075 12037 gene locus_tag LOCUS_14200 11075 12037 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence47 954 259 gene locus_tag LOCUS_14210 954 259 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_14210 1064 1768 gene locus_tag LOCUS_14220 gene pyrH 1064 1768 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_14220 1799 2368 gene locus_tag LOCUS_14230 gene frr 1799 2368 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829472.1 protein_id gnl|my_center|LOCUS_14230 2376 3443 gene locus_tag LOCUS_14240 2376 3443 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760854.1 protein_id gnl|my_center|LOCUS_14240 4579 3419 gene locus_tag LOCUS_14250 gene lpxK 4579 3419 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_14250 4686 5669 gene locus_tag LOCUS_14260 gene dusB 4686 5669 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_14260 5727 6149 gene locus_tag LOCUS_14270 5727 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6264 6716 gene locus_tag LOCUS_14280 gene rplM 6264 6716 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_14280 6726 7118 gene locus_tag LOCUS_14290 gene rpsI 6726 7118 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109004.1 protein_id gnl|my_center|LOCUS_14290 7342 8178 gene locus_tag LOCUS_14300 gene rpsB 7342 8178 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_14300 8204 9193 gene locus_tag LOCUS_14310 gene tsf 8204 9193 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 protein_id gnl|my_center|LOCUS_14310 9998 9291 gene locus_tag LOCUS_14320 9998 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 10079 11755 gene locus_tag LOCUS_14330 10079 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence48 2354 1263 gene locus_tag LOCUS_14340 2354 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 3872 2385 gene locus_tag LOCUS_14350 3872 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4618 3881 gene locus_tag LOCUS_14360 4618 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5535 4633 gene locus_tag LOCUS_14370 5535 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 6863 5535 gene locus_tag LOCUS_14380 6863 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 7495 6875 gene locus_tag LOCUS_14390 7495 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 7494 9359 gene locus_tag LOCUS_14400 gene lepA 7494 9359 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_14400 9361 10188 gene locus_tag LOCUS_14410 9361 10188 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_14410 10185 11096 gene locus_tag LOCUS_14420 10185 11096 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208944.1 protein_id gnl|my_center|LOCUS_14420 11106 11816 gene locus_tag LOCUS_14430 gene ubiE 11106 11816 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence49 2755 314 gene locus_tag LOCUS_14440 2755 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2922 2752 gene locus_tag LOCUS_14450 2922 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 3075 3254 gene locus_tag LOCUS_14460 3075 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3405 3770 gene locus_tag LOCUS_14470 3405 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 3852 4520 gene locus_tag LOCUS_14480 3852 4520 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_14480 4540 5079 gene locus_tag LOCUS_14490 4540 5079 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_14490 5357 5488 gene locus_tag LOCUS_14500 5357 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6403 7587 gene locus_tag LOCUS_14510 gene purT 6403 7587 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406408.1 protein_id gnl|my_center|LOCUS_14510 7622 8557 gene locus_tag LOCUS_14520 7622 8557 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235632064.1 protein_id gnl|my_center|LOCUS_14520 8575 9780 gene locus_tag LOCUS_14530 8575 9780 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_14530 9785 10963 gene locus_tag LOCUS_14540 9785 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence50 1484 2512 gene locus_tag LOCUS_14550 1484 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2526 3923 gene locus_tag LOCUS_14560 gene potA 2526 3923 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_14560 3907 4674 gene locus_tag LOCUS_14570 3907 4674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_14570 4678 5502 gene locus_tag LOCUS_14580 4678 5502 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_14580 5513 6799 gene locus_tag LOCUS_14590 5513 6799 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_14590 6854 8131 gene locus_tag LOCUS_14600 6854 8131 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence51 817 320 gene locus_tag LOCUS_14610 gene dfrA 817 320 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_14610 3389 819 gene locus_tag LOCUS_14620 gene mutS 3389 819 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_14620 3432 4748 gene locus_tag LOCUS_14630 3432 4748 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_14630 4748 7366 gene locus_tag LOCUS_14640 4748 7366 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_14640 7377 7991 gene locus_tag LOCUS_14650 7377 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence52 999 2144 gene locus_tag LOCUS_14660 999 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2647 2159 gene locus_tag LOCUS_14670 2647 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_14670 3032 2649 gene locus_tag LOCUS_14680 3032 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3618 3085 gene locus_tag LOCUS_14690 3618 3085 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_14690 4572 3619 gene locus_tag LOCUS_14700 4572 3619 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_14700 5414 4575 gene locus_tag LOCUS_14710 5414 4575 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_14710 5511 6116 gene locus_tag LOCUS_14720 5511 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 6848 6129 gene locus_tag LOCUS_14730 6848 6129 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_14730 7501 6848 gene locus_tag LOCUS_14740 7501 6848 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence53 327 623 gene locus_tag LOCUS_14750 327 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 641 1156 gene locus_tag LOCUS_14760 641 1156 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_14760 2058 1303 gene locus_tag LOCUS_14770 gene tpiA 2058 1303 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_14770 2162 3025 gene locus_tag LOCUS_14780 2162 3025 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_14780 3249 3076 gene locus_tag LOCUS_14790 3249 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4067 3396 gene locus_tag LOCUS_14800 gene pth 4067 3396 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_14800 4645 4070 gene locus_tag LOCUS_14810 4645 4070 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_14810 5300 4758 gene locus_tag LOCUS_14820 5300 4758 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_14820 6080 5316 gene locus_tag LOCUS_14830 6080 5316 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_14830 7175 6093 gene locus_tag LOCUS_14840 7175 6093 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence54 265 184 gene locus_tag LOCUS_t00340 265 184 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4026 253 gene locus_tag LOCUS_14850 4026 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 5105 4038 gene locus_tag LOCUS_14860 5105 4038 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_14860 6523 5105 gene locus_tag LOCUS_14870 gene glmM 6523 5105 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_14870 6626 6700 gene locus_tag LOCUS_t00350 6626 6700 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6737 6810 gene locus_tag LOCUS_t00360 6737 6810 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence55 8 3064 gene locus_tag LOCUS_14880 8 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4372 3065 gene locus_tag LOCUS_14890 gene der 4372 3065 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_14890 4638 4369 gene locus_tag LOCUS_14900 4638 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 5627 4650 gene locus_tag LOCUS_14910 5627 4650 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_14910 6232 5633 gene locus_tag LOCUS_14920 gene yihA 6232 5633 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_14920 6335 6409 gene locus_tag LOCUS_t00370 6335 6409 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence56 1261 287 gene locus_tag LOCUS_14930 1261 287 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762406.1 protein_id gnl|my_center|LOCUS_14930 1358 2548 gene locus_tag LOCUS_14940 gene kbl 1358 2548 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_14940 2549 3991 gene locus_tag LOCUS_14950 2549 3991 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_14950 3988 5958 gene locus_tag LOCUS_14960 3988 5958 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202545.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence57 1524 2144 gene locus_tag LOCUS_14970 1524 2144 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723672.1 protein_id gnl|my_center|LOCUS_14970 3235 2156 gene locus_tag LOCUS_14980 3235 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4698 3232 gene locus_tag LOCUS_14990 4698 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 <5294 4695 gene locus_tag LOCUS_15000 <5294 4695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202931.1:phosphonoacetaldehyde reductase >Feature sequence58 53 1987 gene locus_tag LOCUS_15010 53 1987 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_15010 1990 3210 gene locus_tag LOCUS_15020 gene pepT 1990 3210 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence59 504 1220 gene locus_tag LOCUS_15030 gene cmk 504 1220 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_15030 1221 2114 gene locus_tag LOCUS_15040 1221 2114 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108114.1 protein_id gnl|my_center|LOCUS_15040 2141 2707 gene locus_tag LOCUS_15050 gene efp 2141 2707 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_15050 3163 2744 gene locus_tag LOCUS_15060 3163 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 3250 3723 gene locus_tag LOCUS_15070 gene rlmH 3250 3723 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence60 1247 144 gene locus_tag LOCUS_15080 gene ychF 1247 144 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_15080 1417 2304 gene locus_tag LOCUS_15090 1417 2304 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_15090 2317 3522 gene locus_tag LOCUS_15100 gene galK 2317 3522 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence61 1347 466 gene locus_tag LOCUS_15110 1347 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 2238 1372 gene locus_tag LOCUS_15120 2238 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2885 2235 gene locus_tag LOCUS_15130 2885 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence62 <1 835 gene locus_tag LOCUS_15140 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962250.1:Abi family protein 1132 1380 gene locus_tag LOCUS_15150 1132 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2611 1730 gene locus_tag LOCUS_15160 2611 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3385 2618 gene locus_tag LOCUS_15170 3385 2618 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence63 803 21 gene locus_tag LOCUS_15180 803 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1218 805 gene locus_tag LOCUS_15190 1218 805 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791127.1 protein_id gnl|my_center|LOCUS_15190 1962 1222 gene locus_tag LOCUS_15200 1962 1222 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_15200 2673 2035 gene locus_tag LOCUS_15210 2673 2035 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_15210 <3312 2693 gene locus_tag LOCUS_15220 <3312 2693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785168.1:tRNA pseudouridine(38-40) synthase TruA >Feature sequence64 <1 776 gene locus_tag LOCUS_15230 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005782189.1:50S ribosomal protein L3 780 1409 gene locus_tag LOCUS_15240 gene rplD 780 1409 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_15240 1423 1713 gene locus_tag LOCUS_15250 gene rplW 1423 1713 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_15250 1716 2540 gene locus_tag LOCUS_15260 gene rplB 1716 2540 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence65 400 182 gene locus_tag LOCUS_15270 400 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 996 661 gene locus_tag LOCUS_15280 996 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15280 1701 1129 gene locus_tag LOCUS_15290 1701 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290