>Feature sequence001 1409 1257 gene locus_tag LOCUS_00010 gene scfA 1409 1257 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_00010 1673 2188 gene locus_tag LOCUS_00020 1673 2188 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_00020 2237 3070 gene locus_tag LOCUS_00030 2237 3070 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_00030 5018 3432 gene locus_tag LOCUS_00040 5018 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5313 5173 gene locus_tag LOCUS_00050 5313 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5463 5338 gene locus_tag LOCUS_00060 5463 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5829 5512 gene locus_tag LOCUS_00070 5829 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7156 5840 gene locus_tag LOCUS_00080 7156 5840 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964243.1 protein_id gnl|my_center|LOCUS_00080 7745 7176 gene locus_tag LOCUS_00090 7745 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9308 7758 gene locus_tag LOCUS_00100 9308 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9815 9411 gene locus_tag LOCUS_00110 9815 9411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10135 9827 gene locus_tag LOCUS_00120 10135 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15007 10436 gene locus_tag LOCUS_00130 gene essC 15007 10436 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963368.1 protein_id gnl|my_center|LOCUS_00130 15278 14991 gene locus_tag LOCUS_00140 15278 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16359 15289 gene locus_tag LOCUS_00150 16359 15289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17117 16356 gene locus_tag LOCUS_00160 17117 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 20205 17212 gene locus_tag LOCUS_00170 20205 17212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21104 20202 gene locus_tag LOCUS_00180 21104 20202 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_00180 21815 21114 gene locus_tag LOCUS_00190 21815 21114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22785 21847 gene locus_tag LOCUS_00200 22785 21847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 26390 22899 gene locus_tag LOCUS_00210 26390 22899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence002 319 537 gene locus_tag LOCUS_00220 319 537 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_00220 824 1672 gene locus_tag LOCUS_00230 gene licT 824 1672 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_00230 1745 3889 gene locus_tag LOCUS_00240 gene ptsG 1745 3889 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_00240 4081 4749 gene locus_tag LOCUS_00250 4081 4749 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_00250 4773 5444 gene locus_tag LOCUS_00260 4773 5444 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_00260 5441 7438 gene locus_tag LOCUS_00270 5441 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 8927 7488 gene locus_tag LOCUS_00280 gene proS 8927 7488 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_00280 9099 10376 gene locus_tag LOCUS_00290 9099 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 10373 11803 gene locus_tag LOCUS_00300 10373 11803 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082865.1 protein_id gnl|my_center|LOCUS_00300 18528 11887 gene locus_tag LOCUS_00310 18528 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 18903 20318 gene locus_tag LOCUS_00320 gene miaB 18903 20318 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence003 1536 244 gene locus_tag LOCUS_00330 1536 244 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_00330 1815 2111 gene locus_tag LOCUS_00340 1815 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 2123 3586 gene locus_tag LOCUS_00350 2123 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 3954 3691 gene locus_tag LOCUS_00360 3954 3691 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_00360 4195 3947 gene locus_tag LOCUS_00370 4195 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4954 4259 gene locus_tag LOCUS_00380 gene rsmG 4954 4259 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_00380 6266 4956 gene locus_tag LOCUS_00390 gene serS 6266 4956 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_00390 6870 6310 gene locus_tag LOCUS_00400 6870 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 7792 6860 gene locus_tag LOCUS_00410 7792 6860 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_00410 8559 7789 gene locus_tag LOCUS_00420 gene soj 8559 7789 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_00420 8731 8901 gene locus_tag LOCUS_00430 8731 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8902 9288 gene locus_tag LOCUS_00440 8902 9288 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_00440 11408 9540 gene locus_tag LOCUS_00450 11408 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 13765 11498 gene locus_tag LOCUS_00460 13765 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 14356 13826 gene locus_tag LOCUS_00470 14356 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 15215 14373 gene locus_tag LOCUS_00480 15215 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence004 1335 319 gene locus_tag LOCUS_00490 1335 319 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771886.1 protein_id gnl|my_center|LOCUS_00490 1636 3018 gene locus_tag LOCUS_00500 1636 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3171 5435 gene locus_tag LOCUS_00510 3171 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 5822 5478 gene locus_tag LOCUS_00520 5822 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 6593 6733 gene locus_tag LOCUS_00530 gene rpmH 6593 6733 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640225.1 protein_id gnl|my_center|LOCUS_00530 6857 7207 gene locus_tag LOCUS_00540 6857 7207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7213 7422 gene locus_tag LOCUS_00550 gene yidD 7213 7422 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_00550 7447 8601 gene locus_tag LOCUS_00560 7447 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8613 9590 gene locus_tag LOCUS_00570 8613 9590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 10173 9736 gene locus_tag LOCUS_00580 gene spoVAC 10173 9736 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_00580 10546 10911 gene locus_tag LOCUS_00590 10546 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10916 12313 gene locus_tag LOCUS_00600 gene ffh 10916 12313 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_00600 12505 12747 gene locus_tag LOCUS_00610 gene rpsP 12505 12747 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_00610 12763 12993 gene locus_tag LOCUS_00620 12763 12993 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_00620 13067 13831 gene locus_tag LOCUS_00630 13067 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence005 1914 526 gene locus_tag LOCUS_00640 1914 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 4224 1927 gene locus_tag LOCUS_00650 4224 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 7129 4256 gene locus_tag LOCUS_00660 7129 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8296 7280 gene locus_tag LOCUS_00670 8296 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 9239 8583 gene locus_tag LOCUS_00680 9239 8583 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_00680 9665 9303 gene locus_tag LOCUS_00690 9665 9303 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048328.1 protein_id gnl|my_center|LOCUS_00690 10917 9889 gene locus_tag LOCUS_00700 10917 9889 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379286.1 protein_id gnl|my_center|LOCUS_00700 11485 10937 gene locus_tag LOCUS_00710 11485 10937 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262907.1 protein_id gnl|my_center|LOCUS_00710 11947 11516 gene locus_tag LOCUS_00720 11947 11516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 13877 11964 gene locus_tag LOCUS_00730 13877 11964 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860951.1 protein_id gnl|my_center|LOCUS_00730 <14531 13934 gene locus_tag LOCUS_00740 <14531 13934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003702976.1:SDR family oxidoreductase >Feature sequence006 3150 721 gene locus_tag LOCUS_00750 3150 721 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_00750 3914 3147 gene locus_tag LOCUS_00760 gene recO 3914 3147 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_00760 4197 4370 gene locus_tag LOCUS_00770 4197 4370 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_00770 5376 4468 gene locus_tag LOCUS_00780 5376 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 6418 6170 gene locus_tag LOCUS_00790 gene spoIIID 6418 6170 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_00790 6676 8079 gene locus_tag LOCUS_00800 6676 8079 CDS product CitMHS family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851832.1 protein_id gnl|my_center|LOCUS_00800 8190 8489 gene locus_tag LOCUS_00810 gene citD 8190 8489 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566181.1 protein_id gnl|my_center|LOCUS_00810 8486 9388 gene locus_tag LOCUS_00820 gene citE 8486 9388 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898727.1 protein_id gnl|my_center|LOCUS_00820 9404 10966 gene locus_tag LOCUS_00830 gene citF 9404 10966 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922330.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence007 1585 863 gene locus_tag LOCUS_00840 1585 863 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_00840 2107 1706 gene locus_tag LOCUS_00850 2107 1706 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_00850 2274 2816 gene locus_tag LOCUS_00860 2274 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 2813 3520 gene locus_tag LOCUS_00870 2813 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3991 3611 gene locus_tag LOCUS_00880 3991 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4168 5094 gene locus_tag LOCUS_00890 4168 5094 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_00890 6372 5212 gene locus_tag LOCUS_00900 6372 5212 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_00900 7082 6387 gene locus_tag LOCUS_00910 gene radC 7082 6387 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_00910 7675 7274 gene locus_tag LOCUS_00920 7675 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 8882 7677 gene locus_tag LOCUS_00930 8882 7677 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_00930 10111 8927 gene locus_tag LOCUS_00940 10111 8927 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_00940 10573 10133 gene locus_tag LOCUS_00950 10573 10133 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence008 395 322 gene locus_tag LOCUS_t00010 395 322 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 679 1923 gene locus_tag LOCUS_00960 679 1923 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837362.1 protein_id gnl|my_center|LOCUS_00960 3150 2017 gene locus_tag LOCUS_00970 3150 2017 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_00970 3314 4609 gene locus_tag LOCUS_00980 3314 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 4625 5443 gene locus_tag LOCUS_00990 4625 5443 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_00990 5594 5887 gene locus_tag LOCUS_01000 5594 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5881 6150 gene locus_tag LOCUS_01010 5881 6150 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_01010 7028 6159 gene locus_tag LOCUS_01020 7028 6159 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433836.1 protein_id gnl|my_center|LOCUS_01020 8373 7084 gene locus_tag LOCUS_01030 8373 7084 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_01030 8629 10311 gene locus_tag LOCUS_01040 8629 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10335 10706 gene locus_tag LOCUS_01050 10335 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence009 2003 852 gene locus_tag LOCUS_01060 2003 852 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480232.1 protein_id gnl|my_center|LOCUS_01060 2229 2062 gene locus_tag LOCUS_01070 2229 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3311 2286 gene locus_tag LOCUS_01080 gene pfkA 3311 2286 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_01080 4008 3358 gene locus_tag LOCUS_01090 4008 3358 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_01090 4264 5313 gene locus_tag LOCUS_01100 4264 5313 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721423.1 protein_id gnl|my_center|LOCUS_01100 5310 5984 gene locus_tag LOCUS_01110 5310 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 5981 6697 gene locus_tag LOCUS_01120 5981 6697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 10196 6849 gene locus_tag LOCUS_01130 10196 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence010 3341 1137 gene locus_tag LOCUS_01140 3341 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4491 3421 gene locus_tag LOCUS_01150 4491 3421 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675020.1 protein_id gnl|my_center|LOCUS_01150 5089 4811 gene locus_tag LOCUS_01160 5089 4811 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_01160 5814 5125 gene locus_tag LOCUS_01170 gene sigH 5814 5125 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_01170 7065 6016 gene locus_tag LOCUS_01180 gene ruvB 7065 6016 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_01180 7678 7085 gene locus_tag LOCUS_01190 gene ruvA 7678 7085 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027825.1 protein_id gnl|my_center|LOCUS_01190 8277 7768 gene locus_tag LOCUS_01200 gene ruvC 8277 7768 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_01200 8791 8306 gene locus_tag LOCUS_01210 gene ilvN 8791 8306 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_01210 10403 8805 gene locus_tag LOCUS_01220 gene ilvB 10403 8805 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393739.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence011 <1 2519 gene locus_tag LOCUS_01230 <1 2519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2739 4367 gene locus_tag LOCUS_01240 2739 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5071 4427 gene locus_tag LOCUS_01250 5071 4427 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_01250 5164 5850 gene locus_tag LOCUS_01260 5164 5850 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_01260 5860 6501 gene locus_tag LOCUS_01270 5860 6501 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896158.1 protein_id gnl|my_center|LOCUS_01270 6520 7710 gene locus_tag LOCUS_01280 6520 7710 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461629.1 protein_id gnl|my_center|LOCUS_01280 8385 7816 gene locus_tag LOCUS_01290 8385 7816 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_01290 9944 8382 gene locus_tag LOCUS_01300 gene malQ 9944 8382 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173324.1 protein_id gnl|my_center|LOCUS_01300 10348 10103 gene locus_tag LOCUS_01310 10348 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence012 1390 74 gene locus_tag LOCUS_01320 1390 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 1283 1720 gene locus_tag LOCUS_01330 1283 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3214 1748 gene locus_tag LOCUS_01340 3214 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3912 3211 gene locus_tag LOCUS_01350 3912 3211 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_01350 5535 4024 gene locus_tag LOCUS_01360 5535 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7347 5578 gene locus_tag LOCUS_01370 7347 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 7503 7913 gene locus_tag LOCUS_01380 7503 7913 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_01380 7948 8472 gene locus_tag LOCUS_01390 7948 8472 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_01390 8475 9056 gene locus_tag LOCUS_01400 8475 9056 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_01400 9569 9105 gene locus_tag LOCUS_01410 gene ohrR 9569 9105 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_01410 10026 9610 gene locus_tag LOCUS_01420 10026 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 10337 10077 gene locus_tag LOCUS_01430 10337 10077 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence013 2753 3379 gene locus_tag LOCUS_01440 2753 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3440 3814 gene locus_tag LOCUS_01450 3440 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 4875 3877 gene locus_tag LOCUS_01460 4875 3877 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_01460 5301 6374 gene locus_tag LOCUS_01470 5301 6374 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_01470 6401 7240 gene locus_tag LOCUS_01480 6401 7240 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_01480 7279 8556 gene locus_tag LOCUS_01490 7279 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence014 398 1288 gene locus_tag LOCUS_01500 gene dapA 398 1288 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_01500 1608 1363 gene locus_tag LOCUS_01510 1608 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 2824 1709 gene locus_tag LOCUS_01520 2824 1709 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_01520 3184 3600 gene locus_tag LOCUS_01530 3184 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 3597 4229 gene locus_tag LOCUS_01540 3597 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 4621 8034 gene locus_tag LOCUS_01550 4621 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence015 2078 1341 gene locus_tag LOCUS_01560 2078 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 3490 2033 gene locus_tag LOCUS_01570 gene murA 3490 2033 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_01570 4767 3631 gene locus_tag LOCUS_01580 gene murG 4767 3631 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930513.1 protein_id gnl|my_center|LOCUS_01580 6092 4782 gene locus_tag LOCUS_01590 gene spoVE 6092 4782 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_01590 7109 6120 gene locus_tag LOCUS_01600 gene mraY 7109 6120 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_01600 8882 7413 gene locus_tag LOCUS_01610 8882 7413 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_01610 9930 8914 gene locus_tag LOCUS_01620 9930 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence016 2450 1668 gene locus_tag LOCUS_01630 2450 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3751 2477 gene locus_tag LOCUS_01640 3751 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4499 3744 gene locus_tag LOCUS_01650 gene truA 4499 3744 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_01650 5324 4518 gene locus_tag LOCUS_01660 5324 4518 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_01660 6184 5318 gene locus_tag LOCUS_01670 6184 5318 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_01670 7043 6189 gene locus_tag LOCUS_01680 7043 6189 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_01680 8016 7096 gene locus_tag LOCUS_01690 8016 7096 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01690 8742 8071 gene locus_tag LOCUS_01700 8742 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 9409 8720 gene locus_tag LOCUS_01710 9409 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence017 2470 44 gene locus_tag LOCUS_01720 gene leuS 2470 44 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246072.1 protein_id gnl|my_center|LOCUS_01720 3312 2494 gene locus_tag LOCUS_01730 3312 2494 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_01730 3692 3333 gene locus_tag LOCUS_01740 gene rsfS 3692 3333 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_01740 4961 3711 gene locus_tag LOCUS_01750 4961 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 6154 4958 gene locus_tag LOCUS_01760 6154 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6904 6167 gene locus_tag LOCUS_01770 6904 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7791 6922 gene locus_tag LOCUS_01780 7791 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8513 7791 gene locus_tag LOCUS_01790 8513 7791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 9415 8537 gene locus_tag LOCUS_01800 9415 8537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence018 1690 1376 gene locus_tag LOCUS_01810 1690 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 1746 1994 gene locus_tag LOCUS_01820 1746 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 2446 2171 gene locus_tag LOCUS_01830 2446 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2845 2606 gene locus_tag LOCUS_01840 2845 2606 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226716.1 protein_id gnl|my_center|LOCUS_01840 3131 2850 gene locus_tag LOCUS_01850 3131 2850 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_01850 3955 3128 gene locus_tag LOCUS_01860 3955 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5632 4016 gene locus_tag LOCUS_01870 5632 4016 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_01870 6229 5828 gene locus_tag LOCUS_01880 6229 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7692 6241 gene locus_tag LOCUS_01890 7692 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8309 7689 gene locus_tag LOCUS_01900 8309 7689 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_01900 8761 8306 gene locus_tag LOCUS_01910 gene dtd 8761 8306 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209009.1 protein_id gnl|my_center|LOCUS_01910 <9375 8781 gene locus_tag LOCUS_01920 <9375 8781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768340.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence019 1092 22 gene locus_tag LOCUS_01930 gene aroB 1092 22 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_01930 2114 1089 gene locus_tag LOCUS_01940 gene aroF 2114 1089 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_01940 2552 2740 gene locus_tag LOCUS_01950 2552 2740 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_01950 2770 3195 gene locus_tag LOCUS_01960 2770 3195 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813977.1 protein_id gnl|my_center|LOCUS_01960 3812 3234 gene locus_tag LOCUS_01970 3812 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 5293 3809 gene locus_tag LOCUS_01980 gene trpE 5293 3809 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_01980 7463 5841 gene locus_tag LOCUS_01990 7463 5841 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_01990 7938 8501 gene locus_tag LOCUS_02000 gene rsmD 7938 8501 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830140.1 protein_id gnl|my_center|LOCUS_02000 8498 8977 gene locus_tag LOCUS_02010 gene coaD 8498 8977 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056942.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence020 571 1131 gene locus_tag LOCUS_02020 571 1131 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_02020 1135 1557 gene locus_tag LOCUS_02030 gene ruvX 1135 1557 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_02030 1562 2401 gene locus_tag LOCUS_02040 1562 2401 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_02040 3671 2646 gene locus_tag LOCUS_02050 3671 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3997 5466 gene locus_tag LOCUS_02060 gene gltX 3997 5466 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_02060 5489 6496 gene locus_tag LOCUS_02070 gene asnA 5489 6496 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_02070 6705 8654 gene locus_tag LOCUS_02080 6705 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence021 728 1393 gene locus_tag LOCUS_02090 728 1393 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 protein_id gnl|my_center|LOCUS_02090 1503 1853 gene locus_tag LOCUS_02100 1503 1853 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206139.1 protein_id gnl|my_center|LOCUS_02100 1870 3558 gene locus_tag LOCUS_02110 1870 3558 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_02110 3982 3626 gene locus_tag LOCUS_02120 3982 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4281 3979 gene locus_tag LOCUS_02130 4281 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4420 4345 gene locus_tag LOCUS_t00020 4420 4345 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4546 5409 gene locus_tag LOCUS_02140 4546 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5410 6477 gene locus_tag LOCUS_02150 5410 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6526 7368 gene locus_tag LOCUS_02160 6526 7368 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_02160 7420 8022 gene locus_tag LOCUS_02170 7420 8022 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027885.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence022 2199 4136 gene locus_tag LOCUS_02180 2199 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4133 4813 gene locus_tag LOCUS_02190 4133 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4836 5345 gene locus_tag LOCUS_02200 4836 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5436 6665 gene locus_tag LOCUS_02210 5436 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence023 1317 274 gene locus_tag LOCUS_02220 gene rlmN 1317 274 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_02220 1519 1367 gene locus_tag LOCUS_02230 1519 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2826 1516 gene locus_tag LOCUS_02240 gene rsmB 2826 1516 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_02240 3539 2826 gene locus_tag LOCUS_02250 3539 2826 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_02250 4533 3610 gene locus_tag LOCUS_02260 gene fmt 4533 3610 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_02260 5053 4538 gene locus_tag LOCUS_02270 gene def 5053 4538 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_02270 7660 5198 gene locus_tag LOCUS_02280 gene priA 7660 5198 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 protein_id gnl|my_center|LOCUS_02280 7925 7677 gene locus_tag LOCUS_02290 7925 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 8560 7964 gene locus_tag LOCUS_02300 gene gmk 8560 7964 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence024 <1 514 gene locus_tag LOCUS_02310 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015666.1:SPFH domain-containing protein 1602 613 gene locus_tag LOCUS_02320 1602 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3374 1626 gene locus_tag LOCUS_02330 3374 1626 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_02330 3782 3375 gene locus_tag LOCUS_02340 3782 3375 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_02340 3985 3809 gene locus_tag LOCUS_02350 3985 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4713 4084 gene locus_tag LOCUS_02360 4713 4084 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_02360 5102 7087 gene locus_tag LOCUS_02370 5102 7087 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_02370 7096 8376 gene locus_tag LOCUS_02380 7096 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence025 261 506 gene locus_tag LOCUS_02390 261 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 527 1189 gene locus_tag LOCUS_02400 gene cas6e 527 1189 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_02400 1548 2348 gene locus_tag LOCUS_02410 1548 2348 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_02410 3974 2403 gene locus_tag LOCUS_02420 3974 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 5337 4048 gene locus_tag LOCUS_02430 5337 4048 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_02430 6323 5436 gene locus_tag LOCUS_02440 gene ftsX 6323 5436 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645028.1 protein_id gnl|my_center|LOCUS_02440 7008 6316 gene locus_tag LOCUS_02450 gene ftsE 7008 6316 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_02450 7345 8052 gene locus_tag LOCUS_02460 7345 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence026 2577 4112 gene locus_tag LOCUS_02470 2577 4112 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_02470 4461 4156 gene locus_tag LOCUS_02480 4461 4156 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814555.1 protein_id gnl|my_center|LOCUS_02480 4747 4448 gene locus_tag LOCUS_02490 4747 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 5941 4853 gene locus_tag LOCUS_02500 gene serC 5941 4853 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02500 7100 6153 gene locus_tag LOCUS_02510 7100 6153 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_02510 7483 7094 gene locus_tag LOCUS_02520 gene rbfA 7483 7094 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_02520 7914 7513 gene locus_tag LOCUS_02530 7914 7513 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_02530 8158 7898 gene locus_tag LOCUS_02540 8158 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence027 1223 330 gene locus_tag LOCUS_02550 1223 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2461 1220 gene locus_tag LOCUS_02560 2461 1220 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_02560 3853 2534 gene locus_tag LOCUS_02570 3853 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 4076 4915 gene locus_tag LOCUS_02580 4076 4915 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_02580 4919 6310 gene locus_tag LOCUS_02590 gene gltA 4919 6310 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_02590 6466 8127 gene locus_tag LOCUS_02600 6466 8127 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence028 213 614 gene locus_tag LOCUS_02610 213 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 680 2161 gene locus_tag LOCUS_02620 680 2161 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_02620 2293 2481 gene locus_tag LOCUS_02630 2293 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2801 4201 gene locus_tag LOCUS_02640 2801 4201 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_02640 4201 5061 gene locus_tag LOCUS_02650 gene rsmA 4201 5061 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_02650 5539 5862 gene locus_tag LOCUS_02660 5539 5862 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_02660 5879 7630 gene locus_tag LOCUS_02670 gene iorA 5879 7630 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_02670 7633 8205 gene locus_tag LOCUS_02680 7633 8205 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence029 1848 55 gene locus_tag LOCUS_02690 1848 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2058 2636 gene locus_tag LOCUS_02700 2058 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 3562 2816 gene locus_tag LOCUS_02710 gene gpmA 3562 2816 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_02710 3677 3489 gene locus_tag LOCUS_02720 3677 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3925 3710 gene locus_tag LOCUS_02730 3925 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4783 3956 gene locus_tag LOCUS_02740 4783 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 4923 5609 gene locus_tag LOCUS_02750 4923 5609 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_02750 5606 6010 gene locus_tag LOCUS_02760 5606 6010 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_02760 6145 7290 gene locus_tag LOCUS_02770 6145 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence030 2414 1707 gene locus_tag LOCUS_02780 2414 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3080 2502 gene locus_tag LOCUS_02790 3080 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3563 3117 gene locus_tag LOCUS_02800 3563 3117 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119129.1 protein_id gnl|my_center|LOCUS_02800 4270 3560 gene locus_tag LOCUS_02810 4270 3560 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_02810 5651 4383 gene locus_tag LOCUS_02820 5651 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5955 5719 gene locus_tag LOCUS_02830 gene hfq 5955 5719 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392630.1 protein_id gnl|my_center|LOCUS_02830 6978 6037 gene locus_tag LOCUS_02840 gene miaA 6978 6037 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_02840 <8256 7137 gene locus_tag LOCUS_02850 <8256 7137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257019.1:DNA mismatch repair endonuclease MutL >Feature sequence031 <1 1012 gene locus_tag LOCUS_02860 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963949.1:peptide chain release factor 3 1024 1752 gene locus_tag LOCUS_02870 1024 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2596 1775 gene locus_tag LOCUS_02880 gene pdaA 2596 1775 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_02880 2729 3409 gene locus_tag LOCUS_02890 2729 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3994 3464 gene locus_tag LOCUS_02900 3994 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4735 4130 gene locus_tag LOCUS_02910 4735 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 6036 4912 gene locus_tag LOCUS_02920 6036 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 7013 6033 gene locus_tag LOCUS_02930 7013 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence032 <1 1541 gene locus_tag LOCUS_02940 <1 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003548204.1:glycoside hydrolase family 78 protein 4145 1563 gene locus_tag LOCUS_02950 4145 1563 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256267.1 protein_id gnl|my_center|LOCUS_02950 4699 4166 gene locus_tag LOCUS_02960 4699 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 5211 4687 gene locus_tag LOCUS_02970 5211 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02970 6968 5217 gene locus_tag LOCUS_02980 6968 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 <8169 6984 gene locus_tag LOCUS_02990 <8169 6984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157437265.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence033 1 468 gene locus_tag LOCUS_03000 1 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 485 877 gene locus_tag LOCUS_03010 485 877 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_03010 1500 1222 gene locus_tag LOCUS_03020 1500 1222 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_03020 1762 2418 gene locus_tag LOCUS_03030 gene spmA 1762 2418 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_03030 2415 2927 gene locus_tag LOCUS_03040 2415 2927 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_03040 4065 3220 gene locus_tag LOCUS_03050 4065 3220 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219939.1 protein_id gnl|my_center|LOCUS_03050 4575 4153 gene locus_tag LOCUS_03060 4575 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4658 6031 gene locus_tag LOCUS_03070 4658 6031 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_03070 7463 6075 gene locus_tag LOCUS_03080 gene murC 7463 6075 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence034 1446 130 gene locus_tag LOCUS_03090 gene hsdS 1446 130 CDS product type I restriction-modification system specificity subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014003.1 protein_id gnl|my_center|LOCUS_03090 2866 1448 gene locus_tag LOCUS_03100 2866 1448 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_03100 6129 2863 gene locus_tag LOCUS_03110 gene hsdR 6129 2863 CDS product type I restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122926.1 protein_id gnl|my_center|LOCUS_03110 6402 6318 gene locus_tag LOCUS_t00030 6402 6318 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6511 6436 gene locus_tag LOCUS_t00040 6511 6436 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 <1 959 gene locus_tag LOCUS_03120 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963887.1:Ldh family oxidoreductase 1036 2313 gene locus_tag LOCUS_03130 1036 2313 CDS product 2-hydroxycarboxylate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002308483.1 protein_id gnl|my_center|LOCUS_03130 2381 3556 gene locus_tag LOCUS_03140 2381 3556 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_03140 4898 3753 gene locus_tag LOCUS_03150 4898 3753 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942513.1 protein_id gnl|my_center|LOCUS_03150 5145 4885 gene locus_tag LOCUS_03160 5145 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5498 6127 gene locus_tag LOCUS_03170 5498 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6188 7519 gene locus_tag LOCUS_03180 6188 7519 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence036 <1 695 gene locus_tag LOCUS_03190 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437476.1:stage V sporulation protein AD 1959 745 gene locus_tag LOCUS_03200 1959 745 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_03200 3361 2036 gene locus_tag LOCUS_03210 3361 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 3579 3797 gene locus_tag LOCUS_03220 3579 3797 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_03220 4440 4862 gene locus_tag LOCUS_03230 4440 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4889 5359 gene locus_tag LOCUS_03240 gene flgC 4889 5359 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_03240 5529 6047 gene locus_tag LOCUS_03250 5529 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence037 <1 565 gene locus_tag LOCUS_03260 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001107329.1:S-layer homology domain-containing protein 793 1530 gene locus_tag LOCUS_03270 793 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1520 1957 gene locus_tag LOCUS_03280 1520 1957 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_03280 1978 3531 gene locus_tag LOCUS_03290 1978 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3548 5728 gene locus_tag LOCUS_03300 3548 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence038 482 1393 gene locus_tag LOCUS_03310 gene murB 482 1393 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287058.1 protein_id gnl|my_center|LOCUS_03310 1469 2335 gene locus_tag LOCUS_03320 gene rapZ 1469 2335 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_03320 2342 3373 gene locus_tag LOCUS_03330 2342 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 3583 4503 gene locus_tag LOCUS_03340 gene whiA 3583 4503 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_03340 4507 5400 gene locus_tag LOCUS_03350 4507 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5478 5930 gene locus_tag LOCUS_03360 5478 5930 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence039 1007 105 gene locus_tag LOCUS_03370 1007 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_03370 1237 1533 gene locus_tag LOCUS_03380 1237 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1526 2734 gene locus_tag LOCUS_03390 1526 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 2803 3837 gene locus_tag LOCUS_03400 2803 3837 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_03400 3837 4340 gene locus_tag LOCUS_03410 gene ybeY 3837 4340 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259163.1 protein_id gnl|my_center|LOCUS_03410 5186 4461 gene locus_tag LOCUS_03420 5186 4461 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027219.1 protein_id gnl|my_center|LOCUS_03420 6273 5335 gene locus_tag LOCUS_03430 6273 5335 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_03430 7365 6430 gene locus_tag LOCUS_03440 7365 6430 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence040 491 976 gene locus_tag LOCUS_03450 491 976 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_03450 1046 1765 gene locus_tag LOCUS_03460 gene ispD 1046 1765 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_03460 1762 2244 gene locus_tag LOCUS_03470 gene ispF 1762 2244 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191369.1 protein_id gnl|my_center|LOCUS_03470 2589 3935 gene locus_tag LOCUS_03480 gene dnaA 2589 3935 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_03480 4361 5470 gene locus_tag LOCUS_03490 gene dnaN 4361 5470 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_03490 5635 5856 gene locus_tag LOCUS_03500 5635 5856 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_03500 5846 6958 gene locus_tag LOCUS_03510 gene recF 5846 6958 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence041 1338 55 gene locus_tag LOCUS_03520 1338 55 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_03520 1797 1354 gene locus_tag LOCUS_03530 1797 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2099 1794 gene locus_tag LOCUS_03540 2099 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2205 3170 gene locus_tag LOCUS_03550 2205 3170 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_03550 3917 3429 gene locus_tag LOCUS_03560 3917 3429 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_03560 4261 3914 gene locus_tag LOCUS_03570 4261 3914 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_03570 4905 4258 gene locus_tag LOCUS_03580 4905 4258 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_03580 5536 4916 gene locus_tag LOCUS_03590 5536 4916 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148797.1 protein_id gnl|my_center|LOCUS_03590 5606 6505 gene locus_tag LOCUS_03600 5606 6505 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence042 513 2372 gene locus_tag LOCUS_03610 513 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807777.1 protein_id gnl|my_center|LOCUS_03610 2470 3735 gene locus_tag LOCUS_03620 2470 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3907 4638 gene locus_tag LOCUS_03630 3907 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4761 6179 gene locus_tag LOCUS_03640 4761 6179 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_03640 6339 6926 gene locus_tag LOCUS_03650 6339 6926 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence043 <1 2922 gene locus_tag LOCUS_03660 <1 2922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227589.1:alpha-L-rhamnosidase 3085 4692 gene locus_tag LOCUS_03670 3085 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 5993 4731 gene locus_tag LOCUS_03680 5993 4731 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888852.1 protein_id gnl|my_center|LOCUS_03680 6749 6051 gene locus_tag LOCUS_03690 6749 6051 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_03690 7332 6754 gene locus_tag LOCUS_03700 7332 6754 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430302.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence044 2556 1819 gene locus_tag LOCUS_03710 2556 1819 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876426.1 protein_id gnl|my_center|LOCUS_03710 3280 2627 gene locus_tag LOCUS_03720 3280 2627 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_03720 3954 3277 gene locus_tag LOCUS_03730 gene cmk 3954 3277 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_03730 5170 3986 gene locus_tag LOCUS_03740 5170 3986 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_03740 6076 5216 gene locus_tag LOCUS_03750 6076 5216 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_03750 6838 6125 gene locus_tag LOCUS_03760 6838 6125 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence045 360 151 gene locus_tag LOCUS_03770 360 151 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_03770 1730 450 gene locus_tag LOCUS_03780 1730 450 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460075.1 protein_id gnl|my_center|LOCUS_03780 3388 1730 gene locus_tag LOCUS_03790 gene ilvD 3388 1730 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_03790 3644 3408 gene locus_tag LOCUS_03800 3644 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 5071 4052 gene locus_tag LOCUS_03810 gene ilvC 5071 4052 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_03810 5451 7418 gene locus_tag LOCUS_03820 gene treP 5451 7418 CDS product PTS system trehalose-specific EIIBC component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514332.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence046 <1 662 gene locus_tag LOCUS_03830 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002986100.1:LytTR family DNA-binding domain-containing protein 659 1291 gene locus_tag LOCUS_03840 659 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1288 1536 gene locus_tag LOCUS_03850 1288 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1633 2001 gene locus_tag LOCUS_03860 1633 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2012 2308 gene locus_tag LOCUS_03870 2012 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 2319 2642 gene locus_tag LOCUS_03880 2319 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2662 2967 gene locus_tag LOCUS_03890 2662 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2957 4459 gene locus_tag LOCUS_03900 2957 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4456 5163 gene locus_tag LOCUS_03910 gene pppA 4456 5163 CDS product serine/threonine phosphatase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106965.1 protein_id gnl|my_center|LOCUS_03910 5183 5335 gene locus_tag LOCUS_03920 5183 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5465 5923 gene locus_tag LOCUS_03930 5465 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence047 <1 609 gene locus_tag LOCUS_03940 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000190444.1:type II secretion system F family protein 694 1416 gene locus_tag LOCUS_03950 694 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1436 2230 gene locus_tag LOCUS_03960 1436 2230 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_03960 2252 3340 gene locus_tag LOCUS_03970 2252 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3365 4120 gene locus_tag LOCUS_03980 3365 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4117 4743 gene locus_tag LOCUS_03990 4117 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4943 5368 gene locus_tag LOCUS_04000 4943 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 5642 6817 gene locus_tag LOCUS_04010 gene metK 5642 6817 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence048 2151 988 gene locus_tag LOCUS_04020 2151 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2437 5016 gene locus_tag LOCUS_04030 2437 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5032 5487 gene locus_tag LOCUS_04040 5032 5487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5445 6023 gene locus_tag LOCUS_04050 5445 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 6295 6897 gene locus_tag LOCUS_04060 6295 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence049 557 411 gene locus_tag LOCUS_04070 557 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1791 550 gene locus_tag LOCUS_04080 1791 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 2465 1794 gene locus_tag LOCUS_04090 2465 1794 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_04090 3224 2478 gene locus_tag LOCUS_04100 3224 2478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_04100 4700 3399 gene locus_tag LOCUS_04110 4700 3399 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_04110 5066 5995 gene locus_tag LOCUS_04120 5066 5995 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_04120 6012 7073 gene locus_tag LOCUS_04130 6012 7073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence050 1078 14 gene locus_tag LOCUS_04140 gene hisC 1078 14 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_04140 2346 1075 gene locus_tag LOCUS_04150 gene hisD 2346 1075 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_04150 3854 2343 gene locus_tag LOCUS_04160 3854 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5132 4020 gene locus_tag LOCUS_04170 gene csaB 5132 4020 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_04170 6200 5139 gene locus_tag LOCUS_04180 6200 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 6368 6850 gene locus_tag LOCUS_04190 6368 6850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence051 2122 206 gene locus_tag LOCUS_04200 gene gyrB 2122 206 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_04200 2307 5063 gene locus_tag LOCUS_04210 gene secA 2307 5063 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_04210 5225 6043 gene locus_tag LOCUS_04220 gene pgeF 5225 6043 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_04220 6057 6335 gene locus_tag LOCUS_04230 6057 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 6332 6634 gene locus_tag LOCUS_04240 6332 6634 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944457.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence052 728 6895 gene locus_tag LOCUS_04250 728 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence053 1172 543 gene locus_tag LOCUS_04260 1172 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 1498 1178 gene locus_tag LOCUS_04270 1498 1178 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088117.1 protein_id gnl|my_center|LOCUS_04270 3030 1615 gene locus_tag LOCUS_04280 3030 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5533 3257 gene locus_tag LOCUS_04290 5533 3257 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence054 1609 614 gene locus_tag LOCUS_04300 1609 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2214 1630 gene locus_tag LOCUS_04310 2214 1630 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_04310 2624 2229 gene locus_tag LOCUS_04320 2624 2229 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_04320 3851 2637 gene locus_tag LOCUS_04330 gene ilvA 3851 2637 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_04330 4549 5649 gene locus_tag LOCUS_04340 4549 5649 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_04340 5957 5721 gene locus_tag LOCUS_04350 5957 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6116 6340 gene locus_tag LOCUS_04360 6116 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6333 6566 gene locus_tag LOCUS_04370 6333 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence055 <1 730 gene locus_tag LOCUS_04380 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein 895 1647 gene locus_tag LOCUS_04390 gene larB 895 1647 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_04390 1652 2458 gene locus_tag LOCUS_04400 gene larE 1652 2458 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_04400 2894 2541 gene locus_tag LOCUS_04410 2894 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3087 2869 gene locus_tag LOCUS_04420 3087 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 <7014 3334 gene locus_tag LOCUS_04430 <7014 3334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007058870.1:DEAD/DEAH box helicase >Feature sequence056 330 1058 gene locus_tag LOCUS_04440 gene cas6 330 1058 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272867.1 protein_id gnl|my_center|LOCUS_04440 5635 1133 gene locus_tag LOCUS_04450 5635 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 <6995 5681 gene locus_tag LOCUS_04460 <6995 5681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000608887.1:glycoside hydrolase family 32 protein >Feature sequence057 <1 2585 gene locus_tag LOCUS_04470 <1 2585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390101.1:phosphoribosylformylglycinamidine synthase 2600 4105 gene locus_tag LOCUS_04480 2600 4105 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_04480 4175 4447 gene locus_tag LOCUS_04490 4175 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4440 4700 gene locus_tag LOCUS_04500 4440 4700 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924721.1 protein_id gnl|my_center|LOCUS_04500 5075 5692 gene locus_tag LOCUS_04510 5075 5692 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_04510 5696 5875 gene locus_tag LOCUS_04520 5696 5875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6441 5800 gene locus_tag LOCUS_04530 6441 5800 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211250.1 protein_id gnl|my_center|LOCUS_04530 6608 6420 gene locus_tag LOCUS_04540 6608 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6802 6964 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttaatccctcatagggaaggtatgac >Feature sequence058 607 188 gene locus_tag LOCUS_04550 607 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1309 662 gene locus_tag LOCUS_04560 gene trmB 1309 662 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939002.1 protein_id gnl|my_center|LOCUS_04560 1451 1717 gene locus_tag LOCUS_04570 1451 1717 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301196.1 protein_id gnl|my_center|LOCUS_04570 1730 2029 gene locus_tag LOCUS_04580 1730 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2046 5126 gene locus_tag LOCUS_04590 2046 5126 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_04590 5144 6439 gene locus_tag LOCUS_04600 gene hflX 5144 6439 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence059 545 2560 gene locus_tag LOCUS_04610 gene recG 545 2560 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_04610 4929 2704 gene locus_tag LOCUS_04620 4929 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5255 5800 gene locus_tag LOCUS_04630 5255 5800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 6091 6639 gene locus_tag LOCUS_04640 6091 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence060 3581 4180 gene locus_tag LOCUS_04650 3581 4180 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016701.1 protein_id gnl|my_center|LOCUS_04650 <6829 4230 gene locus_tag LOCUS_04660 <6829 4230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461050.1:efflux RND transporter permease subunit >Feature sequence061 761 453 gene locus_tag LOCUS_04670 761 453 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358018.1 protein_id gnl|my_center|LOCUS_04670 2346 838 gene locus_tag LOCUS_04680 2346 838 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576736.1 protein_id gnl|my_center|LOCUS_04680 2864 2370 gene locus_tag LOCUS_04690 2864 2370 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358021.1 protein_id gnl|my_center|LOCUS_04690 4033 2930 gene locus_tag LOCUS_04700 gene ulaG 4033 2930 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368618.1 protein_id gnl|my_center|LOCUS_04700 4434 5276 gene locus_tag LOCUS_04710 gene ulaE 4434 5276 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949498.1 protein_id gnl|my_center|LOCUS_04710 5293 6351 gene locus_tag LOCUS_04720 5293 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837545.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence062 5313 5951 gene locus_tag LOCUS_04730 5313 5951 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence063 170 1471 gene locus_tag LOCUS_04740 170 1471 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_04740 1487 1918 gene locus_tag LOCUS_04750 1487 1918 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_04750 2219 1980 gene locus_tag LOCUS_04760 2219 1980 CDS product type II toxin-antitoxin system MqsA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065704.1 protein_id gnl|my_center|LOCUS_04760 3862 2234 gene locus_tag LOCUS_04770 3862 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 4040 5599 gene locus_tag LOCUS_04780 4040 5599 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_04780 5596 6435 gene locus_tag LOCUS_04790 5596 6435 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence064 305 1864 gene locus_tag LOCUS_04800 305 1864 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266940.1 protein_id gnl|my_center|LOCUS_04800 2403 1897 gene locus_tag LOCUS_04810 2403 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2561 3391 gene locus_tag LOCUS_04820 2561 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence065 <1 1299 gene locus_tag LOCUS_04830 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392762.1:uroporphyrinogen-III C-methyltransferase 1304 1780 gene locus_tag LOCUS_04840 1304 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1777 2790 gene locus_tag LOCUS_04850 gene nirJ2 1777 2790 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_04850 2784 3968 gene locus_tag LOCUS_04860 gene nirJ1 2784 3968 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_04860 4088 4558 gene locus_tag LOCUS_04870 4088 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4555 5031 gene locus_tag LOCUS_04880 4555 5031 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966078.1 protein_id gnl|my_center|LOCUS_04880 6189 5041 gene locus_tag LOCUS_04890 6189 5041 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859695.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence066 1214 273 gene locus_tag LOCUS_04900 1214 273 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_04900 1425 2495 gene locus_tag LOCUS_04910 1425 2495 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_04910 2656 3939 gene locus_tag LOCUS_04920 2656 3939 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_04920 4027 5031 gene locus_tag LOCUS_04930 4027 5031 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732427.1 protein_id gnl|my_center|LOCUS_04930 <6449 5052 gene locus_tag LOCUS_04940 <6449 5052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107164.1:NAD(+) synthase >Feature sequence067 439 2022 gene locus_tag LOCUS_04950 439 2022 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_04950 2019 2990 gene locus_tag LOCUS_04960 2019 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 4194 3160 gene locus_tag LOCUS_04970 gene mnmA 4194 3160 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_04970 4377 5912 gene locus_tag LOCUS_04980 4377 5912 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence068 1089 388 gene locus_tag LOCUS_04990 1089 388 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437036.1 protein_id gnl|my_center|LOCUS_04990 1763 1242 gene locus_tag LOCUS_05000 gene pgsA 1763 1242 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_05000 3093 1747 gene locus_tag LOCUS_05010 gene rimO 3093 1747 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_05010 3710 3093 gene locus_tag LOCUS_05020 3710 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4876 3749 gene locus_tag LOCUS_05030 gene recA 4876 3749 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_05030 5882 5016 gene locus_tag LOCUS_05040 5882 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 <6403 5884 gene locus_tag LOCUS_05050 <6403 5884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943726.1:DUF1385 domain-containing protein >Feature sequence069 1980 529 gene locus_tag LOCUS_05060 1980 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2098 2817 gene locus_tag LOCUS_05070 2098 2817 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048228.1 protein_id gnl|my_center|LOCUS_05070 3016 4107 gene locus_tag LOCUS_05080 3016 4107 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393831.1 protein_id gnl|my_center|LOCUS_05080 4835 4143 gene locus_tag LOCUS_05090 gene tsaA 4835 4143 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_05090 5265 4978 gene locus_tag LOCUS_05100 5265 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 5568 5831 gene locus_tag LOCUS_05110 5568 5831 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence070 2062 425 gene locus_tag LOCUS_05120 2062 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 2768 2163 gene locus_tag LOCUS_05130 2768 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6140 3033 gene locus_tag LOCUS_05140 6140 3033 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870273.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence071 <1 1051 gene locus_tag LOCUS_05150 <1 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861528.1:mannitol-1-phosphate 5-dehydrogenase 1409 1101 gene locus_tag LOCUS_05160 1409 1101 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_05160 1680 1402 gene locus_tag LOCUS_05170 1680 1402 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_05170 3656 1776 gene locus_tag LOCUS_05180 gene htpG 3656 1776 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_05180 3838 4230 gene locus_tag LOCUS_05190 3838 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 <6271 4342 gene locus_tag LOCUS_05200 <6271 4342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128975638.1:LTA synthase family protein >Feature sequence072 2250 163 gene locus_tag LOCUS_05210 gene metG 2250 163 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence073 1524 142 gene locus_tag LOCUS_05220 1524 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5364 1579 gene locus_tag LOCUS_05230 5364 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence074 3641 3354 gene locus_tag LOCUS_05240 3641 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3721 4326 gene locus_tag LOCUS_05250 3721 4326 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_05250 4437 5171 gene locus_tag LOCUS_05260 4437 5171 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_05260 5164 5829 gene locus_tag LOCUS_05270 5164 5829 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence075 <1 687 gene locus_tag LOCUS_05280 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966588.1:cardiolipin synthase 873 2108 gene locus_tag LOCUS_05290 gene hemA 873 2108 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_05290 2128 3108 gene locus_tag LOCUS_05300 gene hemB 2128 3108 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_05300 3105 4382 gene locus_tag LOCUS_05310 gene hemL 3105 4382 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_05310 4379 5278 gene locus_tag LOCUS_05320 gene hemC 4379 5278 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence076 1 381 gene locus_tag LOCUS_05330 1 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 459 824 gene locus_tag LOCUS_05340 459 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 879 1301 gene locus_tag LOCUS_05350 879 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1576 2043 gene locus_tag LOCUS_05360 1576 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2067 2672 gene locus_tag LOCUS_05370 2067 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3500 2823 gene locus_tag LOCUS_05380 gene sigK 3500 2823 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_05380 4200 3613 gene locus_tag LOCUS_05390 4200 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4343 4609 gene locus_tag LOCUS_05400 4343 4609 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812819.1 protein_id gnl|my_center|LOCUS_05400 4602 4940 gene locus_tag LOCUS_05410 4602 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5097 5471 gene locus_tag LOCUS_05420 5097 5471 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810919.1 protein_id gnl|my_center|LOCUS_05420 5468 5917 gene locus_tag LOCUS_05430 gene nusB 5468 5917 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276210.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence077 1378 167 gene locus_tag LOCUS_05440 1378 167 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_05440 1801 1400 gene locus_tag LOCUS_05450 1801 1400 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_05450 3826 1922 gene locus_tag LOCUS_05460 3826 1922 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_05460 4400 3999 gene locus_tag LOCUS_05470 gene vapC 4400 3999 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_05470 4627 4397 gene locus_tag LOCUS_05480 4627 4397 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_05480 5327 4725 gene locus_tag LOCUS_05490 5327 4725 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_05490 5902 5324 gene locus_tag LOCUS_05500 5902 5324 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence078 1 438 gene locus_tag LOCUS_05510 1 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 585 1565 gene locus_tag LOCUS_05520 gene pta 585 1565 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243393.1 protein_id gnl|my_center|LOCUS_05520 2000 2461 gene locus_tag LOCUS_05530 2000 2461 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_05530 2544 3884 gene locus_tag LOCUS_05540 gene nusA 2544 3884 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_05540 3981 4196 gene locus_tag LOCUS_05550 3981 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 4183 5016 gene locus_tag LOCUS_05560 4183 5016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence079 444 1748 gene locus_tag LOCUS_05570 444 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 1809 2510 gene locus_tag LOCUS_05580 1809 2510 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_05580 2510 3079 gene locus_tag LOCUS_05590 2510 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 3163 3723 gene locus_tag LOCUS_05600 3163 3723 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357273.1 protein_id gnl|my_center|LOCUS_05600 <5906 3656 gene locus_tag LOCUS_05610 <5906 3656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963838.1:DNA polymerase III subunit alpha >Feature sequence080 1096 245 gene locus_tag LOCUS_05620 1096 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3456 1093 gene locus_tag LOCUS_05630 3456 1093 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_05630 4198 3542 gene locus_tag LOCUS_05640 4198 3542 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_05640 <5883 4370 gene locus_tag LOCUS_05650 <5883 4370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009994355.1:glycoside hydrolase family 25 protein >Feature sequence081 463 1002 gene locus_tag LOCUS_05660 gene cobU 463 1002 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_05660 989 1720 gene locus_tag LOCUS_05670 989 1720 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404265.1 protein_id gnl|my_center|LOCUS_05670 1730 2068 gene locus_tag LOCUS_05680 1730 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2062 3003 gene locus_tag LOCUS_05690 gene cbiB 2062 3003 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_05690 3101 4141 gene locus_tag LOCUS_05700 gene cobD 3101 4141 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173241.1 protein_id gnl|my_center|LOCUS_05700 4195 5730 gene locus_tag LOCUS_05710 4195 5730 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168494.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence082 222 1646 gene locus_tag LOCUS_05720 222 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1773 1946 gene locus_tag LOCUS_05730 1773 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 1953 2192 gene locus_tag LOCUS_05740 1953 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2210 2662 gene locus_tag LOCUS_05750 2210 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 5533 2705 gene locus_tag LOCUS_05760 gene uvrA 5533 2705 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence083 1311 592 gene locus_tag LOCUS_05770 1311 592 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_05770 1924 1388 gene locus_tag LOCUS_05780 1924 1388 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_05780 3027 2071 gene locus_tag LOCUS_05790 gene dcyD 3027 2071 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128192.1 protein_id gnl|my_center|LOCUS_05790 3674 3024 gene locus_tag LOCUS_05800 gene rpe 3674 3024 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_05800 3975 4946 gene locus_tag LOCUS_05810 3975 4946 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968826.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence084 809 2173 gene locus_tag LOCUS_05820 809 2173 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002035938.1 protein_id gnl|my_center|LOCUS_05820 3395 2262 gene locus_tag LOCUS_05830 gene hemW 3395 2262 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_05830 3539 4099 gene locus_tag LOCUS_05840 3539 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4128 4298 gene locus_tag LOCUS_05850 4128 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4267 5091 gene locus_tag LOCUS_05860 gene tatC 4267 5091 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733010.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence085 <1 825 gene locus_tag LOCUS_05870 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223846944.1:Cof-type HAD-IIB family hydrolase 2976 889 gene locus_tag LOCUS_05880 2976 889 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_05880 3135 4409 gene locus_tag LOCUS_05890 3135 4409 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393792.1 protein_id gnl|my_center|LOCUS_05890 5449 4517 gene locus_tag LOCUS_05900 5449 4517 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482709.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence086 2519 432 gene locus_tag LOCUS_05910 2519 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3124 2531 gene locus_tag LOCUS_05920 3124 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 4026 3178 gene locus_tag LOCUS_05930 4026 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4363 4046 gene locus_tag LOCUS_05940 4363 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence087 <1 509 gene locus_tag LOCUS_05950 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 748 1899 gene locus_tag LOCUS_05960 gene dnaJ 748 1899 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_05960 2018 2455 gene locus_tag LOCUS_05970 gene rpiB 2018 2455 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_05970 2483 3625 gene locus_tag LOCUS_05980 2483 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3669 4529 gene locus_tag LOCUS_05990 3669 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4616 5392 gene locus_tag LOCUS_06000 4616 5392 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903444.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence088 1290 2096 gene locus_tag LOCUS_06010 1290 2096 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723815.1 protein_id gnl|my_center|LOCUS_06010 2167 2442 gene locus_tag LOCUS_06020 2167 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2805 4835 gene locus_tag LOCUS_06030 2805 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5169 4879 gene locus_tag LOCUS_06040 5169 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5525 5166 gene locus_tag LOCUS_06050 5525 5166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence089 456 172 gene locus_tag LOCUS_06060 gene gatC 456 172 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881409.1 protein_id gnl|my_center|LOCUS_06060 1962 529 gene locus_tag LOCUS_06070 gene gatB 1962 529 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_06070 3155 1959 gene locus_tag LOCUS_06080 gene gatA 3155 1959 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888491.1 protein_id gnl|my_center|LOCUS_06080 3447 3163 gene locus_tag LOCUS_06090 3447 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 5195 3465 gene locus_tag LOCUS_06100 gene aspS 5195 3465 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence090 122 976 gene locus_tag LOCUS_06110 122 976 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_06110 973 1620 gene locus_tag LOCUS_06120 973 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1888 2544 gene locus_tag LOCUS_06130 1888 2544 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_06130 2709 3281 gene locus_tag LOCUS_06140 2709 3281 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence091 2167 1049 gene locus_tag LOCUS_06150 2167 1049 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828679.1 protein_id gnl|my_center|LOCUS_06150 2472 3926 gene locus_tag LOCUS_06160 gene pyk 2472 3926 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_06160 4277 4573 gene locus_tag LOCUS_06170 4277 4573 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066199.1 protein_id gnl|my_center|LOCUS_06170 <5632 4623 gene locus_tag LOCUS_06180 <5632 4623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986205.1:magnesium transporter >Feature sequence092 145 2085 gene locus_tag LOCUS_06190 gene bglF 145 2085 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277858.1 protein_id gnl|my_center|LOCUS_06190 2153 2719 gene locus_tag LOCUS_06200 2153 2719 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642721.1 protein_id gnl|my_center|LOCUS_06200 2740 4176 gene locus_tag LOCUS_06210 gene bglA 2740 4176 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350137.1 protein_id gnl|my_center|LOCUS_06210 4650 4252 gene locus_tag LOCUS_06220 4650 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 4831 4637 gene locus_tag LOCUS_06230 4831 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence093 1282 380 gene locus_tag LOCUS_06240 gene cysD 1282 380 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532711.1 protein_id gnl|my_center|LOCUS_06240 1609 1295 gene locus_tag LOCUS_06250 1609 1295 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_06250 3246 1606 gene locus_tag LOCUS_06260 3246 1606 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_06260 4322 3249 gene locus_tag LOCUS_06270 4322 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5162 4338 gene locus_tag LOCUS_06280 gene cysW 5162 4338 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534651.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence094 3504 3803 gene locus_tag LOCUS_06290 3504 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3859 4176 gene locus_tag LOCUS_06300 3859 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4277 4849 gene locus_tag LOCUS_06310 4277 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence095 <1 1263 gene locus_tag LOCUS_06320 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939301.1:BREX system Lon protease-like protein BrxL 1263 1463 gene locus_tag LOCUS_06330 1263 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 1445 2602 gene locus_tag LOCUS_06340 gene nifS 1445 2602 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_06340 3802 2666 gene locus_tag LOCUS_06350 3802 2666 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_06350 4677 3847 gene locus_tag LOCUS_06360 4677 3847 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254320.1 protein_id gnl|my_center|LOCUS_06360 <5504 4693 gene locus_tag LOCUS_06370 <5504 4693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943758.1:isoleucine--tRNA ligase >Feature sequence096 1423 353 gene locus_tag LOCUS_06380 1423 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1778 1434 gene locus_tag LOCUS_06390 gene rplV 1778 1434 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_06390 2061 1798 gene locus_tag LOCUS_06400 gene rpsS 2061 1798 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357326.1 protein_id gnl|my_center|LOCUS_06400 2912 2076 gene locus_tag LOCUS_06410 gene rplB 2912 2076 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_06410 3230 2934 gene locus_tag LOCUS_06420 gene rplW 3230 2934 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_06420 3853 3230 gene locus_tag LOCUS_06430 gene rplD 3853 3230 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_06430 4588 3872 gene locus_tag LOCUS_06440 gene rplC 4588 3872 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_06440 4982 4671 gene locus_tag LOCUS_06450 gene rpsJ 4982 4671 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence097 <1 628 gene locus_tag LOCUS_06460 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459567.1:cytochrome c biogenesis protein CcdA 642 1199 gene locus_tag LOCUS_06470 642 1199 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_06470 1283 2452 gene locus_tag LOCUS_06480 1283 2452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_06480 2442 3296 gene locus_tag LOCUS_06490 2442 3296 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_06490 3293 5293 gene locus_tag LOCUS_06500 3293 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence098 <1 1965 gene locus_tag LOCUS_06510 <1 1965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000061358.1:two-component system response regulator 2877 2065 gene locus_tag LOCUS_06520 gene proC 2877 2065 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836906.1 protein_id gnl|my_center|LOCUS_06520 4132 2969 gene locus_tag LOCUS_06530 4132 2969 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255283.1 protein_id gnl|my_center|LOCUS_06530 4997 4224 gene locus_tag LOCUS_06540 4997 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence099 133 720 gene locus_tag LOCUS_06550 gene hisB 133 720 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_06550 775 1386 gene locus_tag LOCUS_06560 gene hisH 775 1386 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_06560 1401 2120 gene locus_tag LOCUS_06570 gene hisA 1401 2120 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461460.1 protein_id gnl|my_center|LOCUS_06570 2114 2869 gene locus_tag LOCUS_06580 gene hisF 2114 2869 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_06580 2886 3095 gene locus_tag LOCUS_06590 2886 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3079 3714 gene locus_tag LOCUS_06600 gene hisIE 3079 3714 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_06600 3711 4547 gene locus_tag LOCUS_06610 3711 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 4557 5207 gene locus_tag LOCUS_06620 4557 5207 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence100 835 1302 gene locus_tag LOCUS_06630 835 1302 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_06630 1381 2571 gene locus_tag LOCUS_06640 1381 2571 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_06640 2687 3469 gene locus_tag LOCUS_06650 gene tpiA 2687 3469 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829574.1 protein_id gnl|my_center|LOCUS_06650 3529 5034 gene locus_tag LOCUS_06660 gene gpmI 3529 5034 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_06660 5406 5107 gene locus_tag LOCUS_06670 5406 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence101 3 350 gene locus_tag LOCUS_06680 3 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 340 870 gene locus_tag LOCUS_06690 340 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 882 3377 gene locus_tag LOCUS_06700 882 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3395 3835 gene locus_tag LOCUS_06710 3395 3835 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence102 744 304 gene locus_tag LOCUS_06720 744 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1636 764 gene locus_tag LOCUS_06730 1636 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3081 1711 gene locus_tag LOCUS_06740 3081 1711 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_06740 3536 3105 gene locus_tag LOCUS_06750 3536 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4411 3548 gene locus_tag LOCUS_06760 4411 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 <5400 4568 gene locus_tag LOCUS_06770 <5400 4568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987065.1:helix-turn-helix domain-containing protein >Feature sequence103 919 1575 gene locus_tag LOCUS_06780 919 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1590 2471 gene locus_tag LOCUS_06790 1590 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2490 2912 gene locus_tag LOCUS_06800 2490 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2900 5095 gene locus_tag LOCUS_06810 2900 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence104 2097 133 gene locus_tag LOCUS_06820 2097 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4490 2292 gene locus_tag LOCUS_06830 4490 2292 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_06830 4830 4507 gene locus_tag LOCUS_06840 4830 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence105 <1 570 gene locus_tag LOCUS_06850 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048235.1:electron transfer flavoprotein subunit alpha 984 619 gene locus_tag LOCUS_06860 984 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2083 1046 gene locus_tag LOCUS_06870 gene mglB 2083 1046 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816741.1 protein_id gnl|my_center|LOCUS_06870 2371 2997 gene locus_tag LOCUS_06880 2371 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3150 3560 gene locus_tag LOCUS_06890 3150 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3796 4944 gene locus_tag LOCUS_06900 3796 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5110 5037 gene locus_tag LOCUS_t00050 5110 5037 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 2444 636 gene locus_tag LOCUS_06910 2444 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2713 3075 gene locus_tag LOCUS_06920 2713 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 4717 3107 gene locus_tag LOCUS_06930 gene treC 4717 3107 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986524.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence107 <1 543 gene locus_tag LOCUS_06940 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425090.1:methyl-accepting chemotaxis protein 1433 621 gene locus_tag LOCUS_06950 1433 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 2542 1445 gene locus_tag LOCUS_06960 2542 1445 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_06960 3974 2607 gene locus_tag LOCUS_06970 3974 2607 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence108 898 545 gene locus_tag LOCUS_06980 898 545 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_06980 1201 929 gene locus_tag LOCUS_06990 1201 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3717 1399 gene locus_tag LOCUS_07000 gene ftsH 3717 1399 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_07000 3914 4696 gene locus_tag LOCUS_07010 gene rlmB 3914 4696 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence109 <1 736 gene locus_tag LOCUS_07020 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110323000.1:Ig-like domain-containing protein 743 2578 gene locus_tag LOCUS_07030 743 2578 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_07030 4295 2739 gene locus_tag LOCUS_07040 4295 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence110 <1 1162 gene locus_tag LOCUS_07050 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393772.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 1176 2096 gene locus_tag LOCUS_07060 gene argB 1176 2096 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_07060 2117 3088 gene locus_tag LOCUS_07070 2117 3088 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774964.1 protein_id gnl|my_center|LOCUS_07070 3085 4263 gene locus_tag LOCUS_07080 3085 4263 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence111 1643 6 gene locus_tag LOCUS_07090 gene glgA 1643 6 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546574.1 protein_id gnl|my_center|LOCUS_07090 3154 2045 gene locus_tag LOCUS_07100 gene glgD 3154 2045 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_07100 4362 3151 gene locus_tag LOCUS_07110 4362 3151 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_07110 <5135 4494 gene locus_tag LOCUS_07120 <5135 4494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272358.1:1,4-alpha-glucan branching protein GlgB >Feature sequence112 455 27 gene locus_tag LOCUS_07130 455 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 635 1774 gene locus_tag LOCUS_07140 635 1774 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_07140 2582 1863 gene locus_tag LOCUS_07150 gene deoD 2582 1863 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_07150 3140 2610 gene locus_tag LOCUS_07160 3140 2610 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_07160 3395 4207 gene locus_tag LOCUS_07170 3395 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4266 4430 gene locus_tag LOCUS_07180 4266 4430 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064374.1 protein_id gnl|my_center|LOCUS_07180 <5095 4484 gene locus_tag LOCUS_07190 <5095 4484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389614.1:patatin family protein >Feature sequence113 <1 677 gene locus_tag LOCUS_07200 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267630.1:L-arabinose ABC transporter ATP-binding protein AraG 1077 2063 gene locus_tag LOCUS_07210 1077 2063 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529527.1 protein_id gnl|my_center|LOCUS_07210 2132 3046 gene locus_tag LOCUS_07220 2132 3046 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_07220 3171 4157 gene locus_tag LOCUS_07230 3171 4157 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence114 1730 1317 gene locus_tag LOCUS_07240 gene mgsA 1730 1317 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_07240 2399 1761 gene locus_tag LOCUS_07250 gene minD 2399 1761 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016205.1 protein_id gnl|my_center|LOCUS_07250 2734 2952 gene locus_tag LOCUS_07260 2734 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2980 4866 gene locus_tag LOCUS_07270 2980 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07270 >Feature sequence115 <1 2284 gene locus_tag LOCUS_07280 <1 2284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775403.1:glycoside hydrolase family 3 C-terminal domain-containing protein 2303 2872 gene locus_tag LOCUS_07290 2303 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2923 4188 gene locus_tag LOCUS_07300 gene sstT 2923 4188 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence116 <1 689 gene locus_tag LOCUS_07310 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943755.1:PBP1A family penicillin-binding protein 708 2891 gene locus_tag LOCUS_07320 708 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2947 3216 gene locus_tag LOCUS_07330 2947 3216 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_07330 3228 4586 gene locus_tag LOCUS_07340 3228 4586 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence117 1 396 gene locus_tag LOCUS_07350 1 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1529 447 gene locus_tag LOCUS_07360 1529 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1686 3047 gene locus_tag LOCUS_07370 gene mnmE 1686 3047 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_07370 3194 3751 gene locus_tag LOCUS_07380 3194 3751 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 protein_id gnl|my_center|LOCUS_07380 3748 4620 gene locus_tag LOCUS_07390 3748 4620 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence118 1649 1260 gene locus_tag LOCUS_07400 1649 1260 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_07400 3541 1751 gene locus_tag LOCUS_07410 3541 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4390 3776 gene locus_tag LOCUS_07420 4390 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence119 1322 1101 gene locus_tag LOCUS_07430 1322 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2835 1324 gene locus_tag LOCUS_07440 gene terL 2835 1324 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_07440 3106 2825 gene locus_tag LOCUS_07450 3106 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4321 3446 gene locus_tag LOCUS_07460 4321 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4780 4451 gene locus_tag LOCUS_07470 4780 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4937 4767 gene locus_tag LOCUS_07480 4937 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence120 65 1009 gene locus_tag LOCUS_07490 gene gluQRS 65 1009 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_07490 1033 2397 gene locus_tag LOCUS_07500 gene trkA 1033 2397 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07500 2410 3873 gene locus_tag LOCUS_07510 2410 3873 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence121 <1 879 gene locus_tag LOCUS_07520 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721810.1:chemotaxis protein 911 2185 gene locus_tag LOCUS_07530 gene pdeH 911 2185 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243525.1 protein_id gnl|my_center|LOCUS_07530 2202 3701 gene locus_tag LOCUS_07540 gene glpK 2202 3701 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_07540 3776 3958 gene locus_tag LOCUS_07550 3776 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence122 <1 1375 gene locus_tag LOCUS_07560 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803715.1:DUF1593 domain-containing protein 1597 2967 gene locus_tag LOCUS_07570 1597 2967 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_07570 3240 3010 gene locus_tag LOCUS_07580 3240 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3509 3237 gene locus_tag LOCUS_07590 3509 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence123 <1 1079 gene locus_tag LOCUS_07600 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107228.1:nucleoside-diphosphate sugar epimerase/dehydratase 1183 2208 gene locus_tag LOCUS_07610 1183 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2229 3746 gene locus_tag LOCUS_07620 2229 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3746 4384 gene locus_tag LOCUS_07630 3746 4384 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_07630 4381 4866 gene locus_tag LOCUS_07640 4381 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence124 404 925 gene locus_tag LOCUS_07650 404 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1071 2021 gene locus_tag LOCUS_07660 gene rsmH 1071 2021 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_07660 2158 2703 gene locus_tag LOCUS_07670 2158 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence125 1372 308 gene locus_tag LOCUS_07680 1372 308 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_07680 1990 1385 gene locus_tag LOCUS_07690 1990 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2418 1987 gene locus_tag LOCUS_07700 2418 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2897 2415 gene locus_tag LOCUS_07710 2897 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3214 2897 gene locus_tag LOCUS_07720 3214 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4276 3224 gene locus_tag LOCUS_07730 4276 3224 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226293.1 protein_id gnl|my_center|LOCUS_07730 4872 4297 gene locus_tag LOCUS_07740 4872 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence126 1369 332 gene locus_tag LOCUS_07750 1369 332 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_07750 2547 1393 gene locus_tag LOCUS_07760 2547 1393 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_07760 4019 2604 gene locus_tag LOCUS_07770 4019 2604 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242688.1 protein_id gnl|my_center|LOCUS_07770 4527 4087 gene locus_tag LOCUS_07780 gene mce 4527 4087 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence127 <1 1342 gene locus_tag LOCUS_07790 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890804.1:carbohydrate-binding protein >Feature sequence128 1842 466 gene locus_tag LOCUS_07800 1842 466 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_07800 2900 1845 gene locus_tag LOCUS_07810 2900 1845 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_07810 3235 3011 gene locus_tag LOCUS_07820 3235 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_07820 4413 3235 gene locus_tag LOCUS_07830 gene rodA 4413 3235 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence129 >Feature sequence130 459 971 gene locus_tag LOCUS_07840 459 971 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_07840 2335 1079 gene locus_tag LOCUS_07850 2335 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 2488 3126 gene locus_tag LOCUS_07860 2488 3126 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_07860 3268 3729 gene locus_tag LOCUS_07870 3268 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3802 3999 gene locus_tag LOCUS_07880 3802 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 4658 4089 gene locus_tag LOCUS_07890 4658 4089 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence131 2016 349 gene locus_tag LOCUS_07900 2016 349 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_07900 2183 3574 gene locus_tag LOCUS_07910 2183 3574 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681107.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence132 1961 1158 gene locus_tag LOCUS_07920 1961 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3348 2002 gene locus_tag LOCUS_07930 3348 2002 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_07930 3481 4374 gene locus_tag LOCUS_07940 3481 4374 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence133 84 1025 gene locus_tag LOCUS_07950 84 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1050 2054 gene locus_tag LOCUS_07960 1050 2054 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_07960 2070 2414 gene locus_tag LOCUS_07970 2070 2414 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_07970 2401 4362 gene locus_tag LOCUS_07980 2401 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence134 <1 669 gene locus_tag LOCUS_07990 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088615.1:galactarate dehydratase 2195 843 gene locus_tag LOCUS_08000 2195 843 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185933582.1 protein_id gnl|my_center|LOCUS_08000 3114 2215 gene locus_tag LOCUS_08010 gene dapA 3114 2215 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_08010 3997 3119 gene locus_tag LOCUS_08020 gene garR 3997 3119 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178106.1 protein_id gnl|my_center|LOCUS_08020 <4682 4052 gene locus_tag LOCUS_08030 <4682 4052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047747.1:gluconate:H+ symporter >Feature sequence135 1231 626 gene locus_tag LOCUS_08040 1231 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1645 1304 gene locus_tag LOCUS_08050 gene rplS 1645 1304 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_08050 2457 1825 gene locus_tag LOCUS_08060 gene nth 2457 1825 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 protein_id gnl|my_center|LOCUS_08060 2497 3372 gene locus_tag LOCUS_08070 2497 3372 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_08070 3394 4092 gene locus_tag LOCUS_08080 3394 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4547 4071 gene locus_tag LOCUS_08090 gene nrdR 4547 4071 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence136 2278 2892 gene locus_tag LOCUS_08100 2278 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2912 3601 gene locus_tag LOCUS_08110 2912 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence137 3 302 gene locus_tag LOCUS_08120 3 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 292 1107 gene locus_tag LOCUS_08130 gene trmD 292 1107 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_08130 1113 2147 gene locus_tag LOCUS_08140 1113 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2198 3112 gene locus_tag LOCUS_08150 2198 3112 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_08150 3155 4396 gene locus_tag LOCUS_08160 3155 4396 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence138 >Feature sequence139 1 1464 gene locus_tag LOCUS_08170 gene mtlA 1 1464 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 protein_id gnl|my_center|LOCUS_08170 1461 1691 gene locus_tag LOCUS_08180 1461 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 2183 1737 gene locus_tag LOCUS_08190 2183 1737 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_08190 3014 2289 gene locus_tag LOCUS_08200 3014 2289 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_08200 3319 4194 gene locus_tag LOCUS_08210 3319 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence140 703 482 gene locus_tag LOCUS_08220 703 482 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08220 932 720 gene locus_tag LOCUS_08230 932 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3158 1149 gene locus_tag LOCUS_08240 3158 1149 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948968.1 protein_id gnl|my_center|LOCUS_08240 4027 3320 gene locus_tag LOCUS_08250 gene deoD 4027 3320 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843292.1 protein_id gnl|my_center|LOCUS_08250 <4631 4029 gene locus_tag LOCUS_08260 <4631 4029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002989112.1:phospho-sugar mutase >Feature sequence141 3399 487 gene locus_tag LOCUS_08270 3399 487 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_08270 3618 4157 gene locus_tag LOCUS_08280 gene nrdG 3618 4157 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence142 <1 609 gene locus_tag LOCUS_08290 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527991.1:ABC transporter permease subunit 606 1406 gene locus_tag LOCUS_08300 606 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 1403 2137 gene locus_tag LOCUS_08310 1403 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08310 2231 2464 gene locus_tag LOCUS_08320 2231 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2461 2880 gene locus_tag LOCUS_08330 2461 2880 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence143 138 680 gene locus_tag LOCUS_08340 138 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 686 1186 gene locus_tag LOCUS_08350 686 1186 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862020.1 protein_id gnl|my_center|LOCUS_08350 1269 1973 gene locus_tag LOCUS_08360 1269 1973 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234511.1 protein_id gnl|my_center|LOCUS_08360 1992 2354 gene locus_tag LOCUS_08370 1992 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2416 3366 gene locus_tag LOCUS_08380 2416 3366 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965821.1 protein_id gnl|my_center|LOCUS_08380 4513 3515 gene locus_tag LOCUS_08390 gene rbsC 4513 3515 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence144 150 1328 gene locus_tag LOCUS_08400 150 1328 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_08400 3076 1556 gene locus_tag LOCUS_08410 gene malQ 3076 1556 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence145 295 1443 gene locus_tag LOCUS_08420 gene fliG 295 1443 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_08420 1476 2411 gene locus_tag LOCUS_08430 1476 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 2610 3917 gene locus_tag LOCUS_08440 gene fliI 2610 3917 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_08440 3939 4394 gene locus_tag LOCUS_08450 3939 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence146 1 699 gene locus_tag LOCUS_08460 1 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 696 2243 gene locus_tag LOCUS_08470 696 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2260 2844 gene locus_tag LOCUS_08480 2260 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2841 3398 gene locus_tag LOCUS_08490 2841 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3946 3470 gene locus_tag LOCUS_08500 3946 3470 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence147 541 1377 gene locus_tag LOCUS_08510 gene rsmI 541 1377 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_08510 1707 1498 gene locus_tag LOCUS_08520 1707 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2849 1704 gene locus_tag LOCUS_08530 2849 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3730 2846 gene locus_tag LOCUS_08540 3730 2846 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209550464.1 protein_id gnl|my_center|LOCUS_08540 <4563 3831 gene locus_tag LOCUS_08550 <4563 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804267.1:sugar ABC transporter substrate-binding protein >Feature sequence148 1648 368 gene locus_tag LOCUS_08560 1648 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2381 1869 gene locus_tag LOCUS_08570 2381 1869 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356248.1 protein_id gnl|my_center|LOCUS_08570 3199 2483 gene locus_tag LOCUS_08580 3199 2483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_08580 4034 3213 gene locus_tag LOCUS_08590 4034 3213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_08590 <4544 4035 gene locus_tag LOCUS_08600 <4544 4035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815200.1:branched-chain amino acid ABC transporter permease >Feature sequence149 >Feature sequence150 2469 70 gene locus_tag LOCUS_08610 2469 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2939 2466 gene locus_tag LOCUS_08620 gene ribE 2939 2466 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_08620 4166 2967 gene locus_tag LOCUS_08630 4166 2967 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_08630 4357 4187 gene locus_tag LOCUS_08640 4357 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence151 1 2043 gene locus_tag LOCUS_08650 1 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2095 2718 gene locus_tag LOCUS_08660 2095 2718 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_08660 2731 3045 gene locus_tag LOCUS_08670 2731 3045 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_08670 3032 3424 gene locus_tag LOCUS_08680 3032 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3440 4030 gene locus_tag LOCUS_08690 3440 4030 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869350.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence152 2911 3792 gene locus_tag LOCUS_08700 gene era 2911 3792 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_08700 3906 4418 gene locus_tag LOCUS_08710 3906 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence153 1225 155 gene locus_tag LOCUS_08720 1225 155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_08720 2085 1240 gene locus_tag LOCUS_08730 2085 1240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678776.1 protein_id gnl|my_center|LOCUS_08730 3049 2099 gene locus_tag LOCUS_08740 3049 2099 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678777.1 protein_id gnl|my_center|LOCUS_08740 3358 3119 gene locus_tag LOCUS_08750 3358 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 <4454 3425 gene locus_tag LOCUS_08760 <4454 3425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003816050.1:ABC transporter substrate-binding protein >Feature sequence154 3584 2286 gene locus_tag LOCUS_08770 3584 2286 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665496.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence155 <1 1645 gene locus_tag LOCUS_08780 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000288195.1:S-layer homology domain-containing protein 1773 2834 gene locus_tag LOCUS_08790 gene mutY 1773 2834 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931673.1 protein_id gnl|my_center|LOCUS_08790 2831 3769 gene locus_tag LOCUS_08800 2831 3769 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_08800 3948 4039 gene locus_tag LOCUS_t00060 3948 4039 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4185 4261 gene locus_tag LOCUS_t00070 4185 4261 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 1030 164 gene locus_tag LOCUS_08810 gene ispE 1030 164 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_08810 2392 1103 gene locus_tag LOCUS_08820 2392 1103 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_08820 3017 2418 gene locus_tag LOCUS_08830 gene thrH 3017 2418 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_08830 3524 3135 gene locus_tag LOCUS_08840 3524 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 <4414 3521 gene locus_tag LOCUS_08850 <4414 3521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230010.1:AAA family ATPase >Feature sequence157 1953 415 gene locus_tag LOCUS_08860 1953 415 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_08860 2117 2024 gene locus_tag LOCUS_t00080 2117 2024 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2242 2152 gene locus_tag LOCUS_t00090 2242 2152 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2516 3148 gene locus_tag LOCUS_08870 2516 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3145 4047 gene locus_tag LOCUS_08880 3145 4047 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence158 <1 1390 gene locus_tag LOCUS_08890 <1 1390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272522.1:flavocytochrome c 1476 2132 gene locus_tag LOCUS_08900 1476 2132 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_08900 2168 2740 gene locus_tag LOCUS_08910 2168 2740 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_08910 2810 3604 gene locus_tag LOCUS_08920 2810 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3613 4191 gene locus_tag LOCUS_08930 3613 4191 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence159 2133 598 gene locus_tag LOCUS_08940 2133 598 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_08940 3703 2147 gene locus_tag LOCUS_08950 3703 2147 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867846.1 protein_id gnl|my_center|LOCUS_08950 4094 3705 gene locus_tag LOCUS_08960 4094 3705 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence160 317 3 gene locus_tag LOCUS_08970 317 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 835 395 gene locus_tag LOCUS_08980 gene aroQ 835 395 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860435.1 protein_id gnl|my_center|LOCUS_08980 1981 845 gene locus_tag LOCUS_08990 gene pheA 1981 845 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417818.1 protein_id gnl|my_center|LOCUS_08990 3109 2006 gene locus_tag LOCUS_09000 gene aroC 3109 2006 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_09000 4268 3099 gene locus_tag LOCUS_09010 gene aroA 4268 3099 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence161 <1 1717 gene locus_tag LOCUS_09020 <1 1717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000150916.1:ABC-F type ribosomal protection protein 1714 2487 gene locus_tag LOCUS_09030 1714 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2544 3599 gene locus_tag LOCUS_09040 gene prfA 2544 3599 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence162 <1 969 gene locus_tag LOCUS_09050 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003549977.1:asparaginase 985 2100 gene locus_tag LOCUS_09060 gene wecB 985 2100 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_09060 2565 2146 gene locus_tag LOCUS_09070 2565 2146 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680115.1 protein_id gnl|my_center|LOCUS_09070 2641 3027 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaatccctcatagggaaggtatgac 3197 3631 gene locus_tag LOCUS_09080 3197 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence163 1330 155 gene locus_tag LOCUS_09090 1330 155 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383734.1 protein_id gnl|my_center|LOCUS_09090 1444 2631 gene locus_tag LOCUS_09100 1444 2631 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_09100 2649 3377 gene locus_tag LOCUS_09110 2649 3377 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_09110 4338 3640 gene locus_tag LOCUS_09120 4338 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence164 <4325 731 gene locus_tag LOCUS_09130 <4325 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094015776.1:S-layer homology domain-containing protein >Feature sequence165 1087 383 gene locus_tag LOCUS_09140 gene ftsE 1087 383 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_09140 1235 2263 gene locus_tag LOCUS_09150 1235 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2759 2346 gene locus_tag LOCUS_09160 2759 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3228 2740 gene locus_tag LOCUS_09170 3228 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence166 >Feature sequence167 1636 647 gene locus_tag LOCUS_09180 1636 647 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence168 1116 1481 gene locus_tag LOCUS_09190 1116 1481 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_09190 1484 4027 gene locus_tag LOCUS_09200 1484 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence169 332 820 gene locus_tag LOCUS_09210 332 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 845 1666 gene locus_tag LOCUS_09220 845 1666 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_09220 1743 2792 gene locus_tag LOCUS_09230 1743 2792 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_09230 3122 3310 gene locus_tag LOCUS_09240 3122 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 3311 3763 gene locus_tag LOCUS_09250 3311 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence170 363 1478 gene locus_tag LOCUS_09260 363 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1503 2531 gene locus_tag LOCUS_09270 1503 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2570 3499 gene locus_tag LOCUS_09280 2570 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence171 247 1515 gene locus_tag LOCUS_09290 247 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2817 1588 gene locus_tag LOCUS_09300 2817 1588 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964765.1 protein_id gnl|my_center|LOCUS_09300 3506 2832 gene locus_tag LOCUS_09310 3506 2832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705044.1 protein_id gnl|my_center|LOCUS_09310 <4265 3499 gene locus_tag LOCUS_09320 <4265 3499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964763.1:sensor histidine kinase >Feature sequence172 1665 337 gene locus_tag LOCUS_09330 1665 337 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_09330 3628 1736 gene locus_tag LOCUS_09340 gene mnmG 3628 1736 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_09340 <4261 3650 gene locus_tag LOCUS_09350 <4261 3650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721880.1:metallophosphoesterase >Feature sequence173 >Feature sequence174 643 239 gene locus_tag LOCUS_09360 gene rpsI 643 239 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_09360 1081 656 gene locus_tag LOCUS_09370 gene rplM 1081 656 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_09370 1574 1329 gene locus_tag LOCUS_09380 1574 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1724 2254 gene locus_tag LOCUS_09390 gene tadA 1724 2254 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence175 1447 887 gene locus_tag LOCUS_09400 gene thiT 1447 887 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966211.1 protein_id gnl|my_center|LOCUS_09400 1738 2040 gene locus_tag LOCUS_09410 1738 2040 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_09410 2027 2377 gene locus_tag LOCUS_09420 2027 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2517 2762 gene locus_tag LOCUS_09430 gene acpP 2517 2762 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 protein_id gnl|my_center|LOCUS_09430 2799 3500 gene locus_tag LOCUS_09440 gene rnc 2799 3500 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_09440 3722 3916 gene locus_tag LOCUS_09450 3722 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence176 2491 374 gene locus_tag LOCUS_09460 2491 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4056 2596 gene locus_tag LOCUS_09470 4056 2596 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102053.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence177 706 1968 gene locus_tag LOCUS_09480 706 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986675.1 protein_id gnl|my_center|LOCUS_09480 1965 3578 gene locus_tag LOCUS_09490 gene cas10 1965 3578 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986674.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence178 827 303 gene locus_tag LOCUS_09500 gene nusG 827 303 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_09500 1052 837 gene locus_tag LOCUS_09510 gene secE 1052 837 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881261.1 protein_id gnl|my_center|LOCUS_09510 1217 1068 gene locus_tag LOCUS_09520 gene rpmG 1217 1068 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_09520 3357 1507 gene locus_tag LOCUS_09530 3357 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3975 3550 gene locus_tag LOCUS_09540 3975 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence179 <1 691 gene locus_tag LOCUS_09550 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080275.1:MoxR family ATPase 688 1743 gene locus_tag LOCUS_09560 688 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1822 4146 gene locus_tag LOCUS_09570 1822 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence180 1987 434 gene locus_tag LOCUS_09580 1987 434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948025.1 protein_id gnl|my_center|LOCUS_09580 3137 2025 gene locus_tag LOCUS_09590 3137 2025 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence181 <1 511 gene locus_tag LOCUS_09600 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000111483.1:30S ribosomal protein S2 538 1458 gene locus_tag LOCUS_09610 gene tsf 538 1458 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_09610 2398 1664 gene locus_tag LOCUS_09620 2398 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2503 2772 gene locus_tag LOCUS_09630 2503 2772 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_09630 2762 2959 gene locus_tag LOCUS_09640 2762 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence182 >Feature sequence183 <1 1161 gene locus_tag LOCUS_09650 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880620.1:AMP-binding protein 1274 1981 gene locus_tag LOCUS_09660 1274 1981 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_09660 2053 3885 gene locus_tag LOCUS_09670 2053 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence184 3591 805 gene locus_tag LOCUS_09680 3591 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence185 965 1258 gene locus_tag LOCUS_09690 965 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence186 189 872 gene locus_tag LOCUS_09700 gene fliP 189 872 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_09700 889 1146 gene locus_tag LOCUS_09710 gene fliQ 889 1146 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_09710 1151 1921 gene locus_tag LOCUS_09720 gene fliR 1151 1921 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_09720 1979 3031 gene locus_tag LOCUS_09730 gene flhB 1979 3031 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816211.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence187 981 124 gene locus_tag LOCUS_09740 gene rfbA 981 124 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_09740 1499 1011 gene locus_tag LOCUS_09750 1499 1011 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 protein_id gnl|my_center|LOCUS_09750 2004 1534 gene locus_tag LOCUS_09760 2004 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 3422 2034 gene locus_tag LOCUS_09770 gene glmM 3422 2034 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521476.1 protein_id gnl|my_center|LOCUS_09770 4101 3415 gene locus_tag LOCUS_09780 4101 3415 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence188 1117 191 gene locus_tag LOCUS_09790 gene hprK 1117 191 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_09790 1378 1530 gene locus_tag LOCUS_09800 1378 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence189 26 1105 gene locus_tag LOCUS_09810 26 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1098 2504 gene locus_tag LOCUS_09820 1098 2504 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence190 223 2196 gene locus_tag LOCUS_09830 223 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2275 3474 gene locus_tag LOCUS_09840 2275 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence191 551 775 gene locus_tag LOCUS_09850 551 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 1087 3090 gene locus_tag LOCUS_09860 1087 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence192 676 3069 gene locus_tag LOCUS_09870 676 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3715 3125 gene locus_tag LOCUS_09880 3715 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence193 2319 238 gene locus_tag LOCUS_09890 gene recJ 2319 238 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_09890 3529 2501 gene locus_tag LOCUS_09900 gene tsaD 3529 2501 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence194 868 1506 gene locus_tag LOCUS_09910 868 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1643 2230 gene locus_tag LOCUS_09920 1643 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941688.1 protein_id gnl|my_center|LOCUS_09920 2298 3170 gene locus_tag LOCUS_09930 2298 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 <4084 3209 gene locus_tag LOCUS_09940 <4084 3209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584101.1:iron-containing alcohol dehydrogenase >Feature sequence195 <1 2165 gene locus_tag LOCUS_09950 <1 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001107329.1:S-layer homology domain-containing protein 2385 3824 gene locus_tag LOCUS_09960 2385 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence196 553 1005 gene locus_tag LOCUS_09970 gene ctsR 553 1005 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_09970 1054 1566 gene locus_tag LOCUS_09980 1054 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence197 <1 1079 gene locus_tag LOCUS_09990 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020940.1:sodium-dependent transporter 1162 1923 gene locus_tag LOCUS_10000 gene tpiA 1162 1923 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_10000 2176 2778 gene locus_tag LOCUS_10010 2176 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2989 3327 gene locus_tag LOCUS_10020 2989 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3970 3401 gene locus_tag LOCUS_10030 3970 3401 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence198 2399 813 gene locus_tag LOCUS_10040 gene cls 2399 813 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_10040 2951 2475 gene locus_tag LOCUS_10050 2951 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 <3978 2955 gene locus_tag LOCUS_10060 <3978 2955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948757.1:MBL fold metallo-hydrolase >Feature sequence199 <1 1083 gene locus_tag LOCUS_10070 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963844.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 2335 2841 gene locus_tag LOCUS_10080 gene infC 2335 2841 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_10080 2881 3078 gene locus_tag LOCUS_10090 gene rpmI 2881 3078 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_10090 3107 3457 gene locus_tag LOCUS_10100 gene rplT 3107 3457 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence200 <1 871 gene locus_tag LOCUS_10110 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286852.1:AraC family transcriptional regulator 873 3071 gene locus_tag LOCUS_10120 873 3071 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102184.1 protein_id gnl|my_center|LOCUS_10120 3073 3753 gene locus_tag LOCUS_10130 3073 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence201 1135 188 gene locus_tag LOCUS_10140 gene metA 1135 188 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080711.1 protein_id gnl|my_center|LOCUS_10140 2549 1263 gene locus_tag LOCUS_10150 2549 1263 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_10150 3403 2567 gene locus_tag LOCUS_10160 3403 2567 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence202 735 304 gene locus_tag LOCUS_10170 735 304 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_10170 2431 761 gene locus_tag LOCUS_10180 gene recN 2431 761 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_10180 3016 2552 gene locus_tag LOCUS_10190 3016 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3906 3031 gene locus_tag LOCUS_10200 3906 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence203 1021 836 gene locus_tag LOCUS_10210 1021 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1178 2050 gene locus_tag LOCUS_10220 1178 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2224 3117 gene locus_tag LOCUS_10230 2224 3117 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence204 <1 1018 gene locus_tag LOCUS_10240 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000572274.1:helicase-exonuclease AddAB subunit AddA 2255 1113 gene locus_tag LOCUS_10250 2255 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459067.1 protein_id gnl|my_center|LOCUS_10250 2573 2887 gene locus_tag LOCUS_10260 2573 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence205 1561 167 gene locus_tag LOCUS_10270 1561 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1996 1592 gene locus_tag LOCUS_10280 gene ytfJ 1996 1592 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_10280 2599 2015 gene locus_tag LOCUS_10290 2599 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 3684 2557 gene locus_tag LOCUS_10300 3684 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence206 <1 1358 gene locus_tag LOCUS_10310 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392842.1:bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 2707 1424 gene locus_tag LOCUS_10320 2707 1424 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_10320 2904 3200 gene locus_tag LOCUS_10330 gene rpsF 2904 3200 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence207 1352 993 gene locus_tag LOCUS_10340 1352 993 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_10340 2638 1412 gene locus_tag LOCUS_10350 2638 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3178 2660 gene locus_tag LOCUS_10360 3178 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3871 3215 gene locus_tag LOCUS_10370 3871 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence208 1822 446 gene locus_tag LOCUS_10380 1822 446 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_10380 3846 1816 gene locus_tag LOCUS_10390 3846 1816 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence209 2743 1292 gene locus_tag LOCUS_10400 2743 1292 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_10400 3606 2740 gene locus_tag LOCUS_10410 3606 2740 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence210 <1 1436 gene locus_tag LOCUS_10420 <1 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392068.1:endopeptidase La 1454 2050 gene locus_tag LOCUS_10430 gene yihA 1454 2050 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_10430 2179 3225 gene locus_tag LOCUS_10440 2179 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence211 1027 1174 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtggttctccgctcccaggggtgttac 1335 1601 gene locus_tag LOCUS_10450 1335 1601 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_10450 1612 1878 gene locus_tag LOCUS_10460 1612 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3415 1925 gene locus_tag LOCUS_10470 3415 1925 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence212 951 73 gene locus_tag LOCUS_10480 951 73 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357950.1 protein_id gnl|my_center|LOCUS_10480 2543 1059 gene locus_tag LOCUS_10490 2543 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence213 1329 55 gene locus_tag LOCUS_10500 1329 55 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_10500 1397 2347 gene locus_tag LOCUS_10510 1397 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence214 2141 1350 gene locus_tag LOCUS_10520 2141 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3640 2204 gene locus_tag LOCUS_10530 3640 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence215 225 4 gene locus_tag LOCUS_10540 225 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1236 229 gene locus_tag LOCUS_10550 1236 229 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_10550 3102 1249 gene locus_tag LOCUS_10560 3102 1249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_10560 <3721 3095 gene locus_tag LOCUS_10570 <3721 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814402.1:ABC transporter ATP-binding protein >Feature sequence216 165 911 gene locus_tag LOCUS_10580 gene cobJ 165 911 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_10580 947 1693 gene locus_tag LOCUS_10590 gene cobK 947 1693 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_10590 1775 3034 gene locus_tag LOCUS_10600 1775 3034 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence217 771 265 gene locus_tag LOCUS_10610 771 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 834 1592 gene locus_tag LOCUS_10620 834 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 <3704 1629 gene locus_tag LOCUS_10630 <3704 1629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933192.1:leucine-rich repeat domain-containing protein >Feature sequence218 2 2143 gene locus_tag LOCUS_10640 2 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2140 3198 gene locus_tag LOCUS_10650 2140 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence219 578 348 gene locus_tag LOCUS_10660 gene secG 578 348 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727926.1 protein_id gnl|my_center|LOCUS_10660 3324 661 gene locus_tag LOCUS_10670 3324 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence220 2060 162 gene locus_tag LOCUS_10680 2060 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 2250 2873 gene locus_tag LOCUS_10690 2250 2873 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964741.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence221 591 1673 gene locus_tag LOCUS_10700 591 1673 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147451.1 protein_id gnl|my_center|LOCUS_10700 2308 1715 gene locus_tag LOCUS_10710 2308 1715 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965678.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence222 909 85 gene locus_tag LOCUS_10720 gene cysT 909 85 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227884.1 protein_id gnl|my_center|LOCUS_10720 2060 1002 gene locus_tag LOCUS_10730 2060 1002 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_10730 3223 2345 gene locus_tag LOCUS_10740 3223 2345 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941867.1 protein_id gnl|my_center|LOCUS_10740 3663 3238 gene locus_tag LOCUS_10750 3663 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence223 2495 1509 gene locus_tag LOCUS_10760 gene galE 2495 1509 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987061.1 protein_id gnl|my_center|LOCUS_10760 3551 2514 gene locus_tag LOCUS_10770 gene galK 3551 2514 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence224 1061 471 gene locus_tag LOCUS_10780 1061 471 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_10780 1765 1058 gene locus_tag LOCUS_10790 1765 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2382 1765 gene locus_tag LOCUS_10800 2382 1765 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_10800 <3629 2434 gene locus_tag LOCUS_10810 <3629 2434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392969.1:S-layer homology domain-containing protein >Feature sequence225 36 1433 gene locus_tag LOCUS_10820 36 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1447 1797 gene locus_tag LOCUS_10830 1447 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2242 2538 gene locus_tag LOCUS_10840 2242 2538 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_10840 2535 3308 gene locus_tag LOCUS_10850 2535 3308 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence226 1872 214 gene locus_tag LOCUS_10860 1872 214 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_10860 <3620 2288 gene locus_tag LOCUS_10870 <3620 2288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963830.1:excinuclease ABC subunit UvrC >Feature sequence227 635 2371 gene locus_tag LOCUS_10880 635 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence228 1840 992 gene locus_tag LOCUS_10890 1840 992 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_10890 2003 3325 gene locus_tag LOCUS_10900 2003 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence229 2534 837 gene locus_tag LOCUS_10910 2534 837 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425090.1 protein_id gnl|my_center|LOCUS_10910 <3556 2778 gene locus_tag LOCUS_10920 <3556 2778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860980.1:MBL fold metallo-hydrolase >Feature sequence230 1718 879 gene locus_tag LOCUS_10930 gene dapF 1718 879 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_10930 1936 3141 gene locus_tag LOCUS_10940 1936 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3207 3518 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcataccttccctatgagggattaaaact >Feature sequence231 1708 791 gene locus_tag LOCUS_10950 1708 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2545 1712 gene locus_tag LOCUS_10960 2545 1712 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972097.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence232 349 1638 gene locus_tag LOCUS_10970 349 1638 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393686.1 protein_id gnl|my_center|LOCUS_10970 1669 2484 gene locus_tag LOCUS_10980 gene ccsB 1669 2484 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_10980 2544 2699 gene locus_tag LOCUS_10990 2544 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence233 <1 772 gene locus_tag LOCUS_11000 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000101106.1:AAA family ATPase 873 2021 gene locus_tag LOCUS_11010 873 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2700 2065 gene locus_tag LOCUS_11020 gene upp 2700 2065 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_11020 3453 2737 gene locus_tag LOCUS_11030 gene tsaB 3453 2737 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence234 >Feature sequence235 <1 1137 gene locus_tag LOCUS_11040 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393917.1:preprotein translocase subunit SecY 1152 1784 gene locus_tag LOCUS_11050 1152 1784 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_11050 1788 2585 gene locus_tag LOCUS_11060 gene map 1788 2585 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_11060 2590 2865 gene locus_tag LOCUS_11070 2590 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2869 3087 gene locus_tag LOCUS_11080 gene infA 2869 3087 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_11080 3047 3211 gene locus_tag LOCUS_11090 3047 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence236 2 940 gene locus_tag LOCUS_11100 2 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 <3460 1162 gene locus_tag LOCUS_11110 <3460 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680864.1:heavy metal translocating P-type ATPase >Feature sequence237 <1 673 gene locus_tag LOCUS_11120 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004453976.1:DNA repair protein RadA <3457 945 gene locus_tag LOCUS_11130 <3457 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229784.1:SMC family ATPase >Feature sequence238 1256 774 gene locus_tag LOCUS_11140 1256 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1726 1250 gene locus_tag LOCUS_11150 gene fliW 1726 1250 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860685.1 protein_id gnl|my_center|LOCUS_11150 2365 1757 gene locus_tag LOCUS_11160 2365 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence239 398 1099 gene locus_tag LOCUS_11170 gene sigE 398 1099 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_11170 1371 1712 gene locus_tag LOCUS_11180 1371 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1789 2700 gene locus_tag LOCUS_11190 1789 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 <3444 2796 gene locus_tag LOCUS_11200 <3444 2796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256783.1:substrate-binding domain-containing protein >Feature sequence240 959 243 gene locus_tag LOCUS_11210 959 243 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_11210 2391 970 gene locus_tag LOCUS_11220 2391 970 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_11220 2908 2405 gene locus_tag LOCUS_11230 gene purE 2908 2405 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence241 <1 950 gene locus_tag LOCUS_11240 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase >Feature sequence242 <1 1807 gene locus_tag LOCUS_11250 <1 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' 1858 2841 gene locus_tag LOCUS_11260 1858 2841 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762189.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence243 345 503 gene locus_tag LOCUS_11270 345 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 591 770 gene locus_tag LOCUS_11280 591 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2515 905 gene locus_tag LOCUS_11290 2515 905 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_11290 2938 2663 gene locus_tag LOCUS_11300 2938 2663 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_11300 3215 2931 gene locus_tag LOCUS_11310 3215 2931 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence244 2525 687 gene locus_tag LOCUS_11320 gene glmS 2525 687 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence245 <1 1450 gene locus_tag LOCUS_11330 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229473.1:threonine--tRNA ligase >Feature sequence246 <1 973 gene locus_tag LOCUS_11340 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948416.1:DUF4317 domain-containing protein 1347 943 gene locus_tag LOCUS_11350 1347 943 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651198.1 protein_id gnl|my_center|LOCUS_11350 2554 1367 gene locus_tag LOCUS_11360 2554 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 <3400 2570 gene locus_tag LOCUS_11370 <3400 2570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963807.1:YhjD/YihY/BrkB family envelope integrity protein >Feature sequence247 <1 3381 gene locus_tag LOCUS_11380 <1 3381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892173.1:carbamoyl-phosphate synthase large subunit >Feature sequence248 <1 570 gene locus_tag LOCUS_11390 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723741.1:bifunctional tRNA lysidine(34) synthetase TilS/hypoxanthine phosphoribosyltransferase HprT 598 3237 gene locus_tag LOCUS_11400 598 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence249 305 1027 gene locus_tag LOCUS_11410 305 1027 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_11410 1056 2075 gene locus_tag LOCUS_11420 1056 2075 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028324.1 protein_id gnl|my_center|LOCUS_11420 2097 2795 gene locus_tag LOCUS_11430 2097 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11430 >Feature sequence250 >Feature sequence251 1760 2734 gene locus_tag LOCUS_11440 gene dctP 1760 2734 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389894.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence252 112 684 gene locus_tag LOCUS_11450 112 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1614 748 gene locus_tag LOCUS_11460 1614 748 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_11460 3237 1633 gene locus_tag LOCUS_11470 gene cysN 3237 1633 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206077.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence253 <1 1079 gene locus_tag LOCUS_11480 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357329.1:acetyl-CoA C-acetyltransferase 1092 1271 gene locus_tag LOCUS_11490 1092 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1342 1908 gene locus_tag LOCUS_11500 1342 1908 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 protein_id gnl|my_center|LOCUS_11500 1913 2347 gene locus_tag LOCUS_11510 1913 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2682 2380 gene locus_tag LOCUS_11520 2682 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 <3308 2751 gene locus_tag LOCUS_11530 <3308 2751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289093.1:50S ribosomal protein L11 methyltransferase >Feature sequence254 1194 310 gene locus_tag LOCUS_11540 gene flgF 1194 310 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671871.1 protein_id gnl|my_center|LOCUS_11540 1970 1212 gene locus_tag LOCUS_11550 1970 1212 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457739.1 protein_id gnl|my_center|LOCUS_11550 <3299 1967 gene locus_tag LOCUS_11560 <3299 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231947.1:flagellar biosynthesis protein FlhA >Feature sequence255 1359 148 gene locus_tag LOCUS_11570 1359 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2431 1544 gene locus_tag LOCUS_11580 gene modA 2431 1544 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393324.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence256 75 764 gene locus_tag LOCUS_11590 75 764 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_11590 761 1141 gene locus_tag LOCUS_11600 761 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2395 1169 gene locus_tag LOCUS_11610 gene tyrS 2395 1169 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_11610 3064 3255 gene locus_tag LOCUS_11620 3064 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence257 1038 2009 gene locus_tag LOCUS_11630 1038 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2029 2610 gene locus_tag LOCUS_11640 2029 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence258 >Feature sequence259 325 2928 gene locus_tag LOCUS_11650 325 2928 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence260 490 3132 gene locus_tag LOCUS_11660 gene alaS 490 3132 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986885.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence261 <1 1369 gene locus_tag LOCUS_11670 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104950.1:molecular chaperone HscC 1366 3048 gene locus_tag LOCUS_11680 1366 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence262 944 132 gene locus_tag LOCUS_11690 944 132 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_11690 <3246 1067 gene locus_tag LOCUS_11700 <3246 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256672.1:helicase >Feature sequence263 <1 855 gene locus_tag LOCUS_11710 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196793289.1:PAS domain-containing hybrid sensor histidine kinase/response regulator 893 2935 gene locus_tag LOCUS_11720 893 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence264 142 1035 gene locus_tag LOCUS_11730 142 1035 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_11730 1102 1686 gene locus_tag LOCUS_11740 1102 1686 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_11740 1714 2259 gene locus_tag LOCUS_11750 1714 2259 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235430.1 protein_id gnl|my_center|LOCUS_11750 2490 2269 gene locus_tag LOCUS_11760 2490 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 <3219 2551 gene locus_tag LOCUS_11770 <3219 2551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428216.1:ribonuclease Y >Feature sequence265 2790 100 gene locus_tag LOCUS_11780 2790 100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence266 <1 639 gene locus_tag LOCUS_11790 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011673966.1:anthranilate phosphoribosyltransferase 636 1565 gene locus_tag LOCUS_11800 gene trpC 636 1565 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_11800 1562 2182 gene locus_tag LOCUS_11810 1562 2182 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence267 1059 1880 gene locus_tag LOCUS_11820 1059 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3034 1877 gene locus_tag LOCUS_11830 3034 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence268 3 629 gene locus_tag LOCUS_11840 3 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 847 1158 gene locus_tag LOCUS_11850 gene rplU 847 1158 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_11850 1160 1495 gene locus_tag LOCUS_11860 1160 1495 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_11860 1520 1801 gene locus_tag LOCUS_11870 gene rpmA 1520 1801 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_11870 2562 1906 gene locus_tag LOCUS_11880 gene ung 2562 1906 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106436.1 protein_id gnl|my_center|LOCUS_11880 <3204 2579 gene locus_tag LOCUS_11890 <3204 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393959.1:FAD-dependent thymidylate synthase >Feature sequence269 647 2740 gene locus_tag LOCUS_11900 647 2740 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_11900 3161 2820 gene locus_tag LOCUS_11910 3161 2820 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence270 462 1700 gene locus_tag LOCUS_11920 gene ugpC 462 1700 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_11920 2383 1781 gene locus_tag LOCUS_11930 2383 1781 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975255.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence271 2349 376 gene locus_tag LOCUS_11940 gene dxs 2349 376 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_11940 2926 2366 gene locus_tag LOCUS_11950 2926 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence272 547 344 gene locus_tag LOCUS_11960 547 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 805 1071 gene locus_tag LOCUS_11970 gene rpsO 805 1071 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence273 1520 2395 gene locus_tag LOCUS_11980 gene cdaA 1520 2395 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence274 1400 402 gene locus_tag LOCUS_11990 1400 402 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_11990 1635 2183 gene locus_tag LOCUS_12000 1635 2183 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_12000 2194 2793 gene locus_tag LOCUS_12010 gene recR 2194 2793 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_12010 3140 2898 gene locus_tag LOCUS_12020 3140 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence275 753 2603 gene locus_tag LOCUS_12030 753 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence276 92 733 gene locus_tag LOCUS_12040 92 733 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258429.1 protein_id gnl|my_center|LOCUS_12040 1535 843 gene locus_tag LOCUS_12050 1535 843 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_12050 <3128 1542 gene locus_tag LOCUS_12060 <3128 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338483.1:CpsD/CapB family tyrosine-protein kinase >Feature sequence277 <1 781 gene locus_tag LOCUS_12070 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393048.1:Xaa-Pro peptidase family protein 1188 2771 gene locus_tag LOCUS_12080 1188 2771 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence278 1219 821 gene locus_tag LOCUS_12090 1219 821 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356887.1 protein_id gnl|my_center|LOCUS_12090 <3122 1244 gene locus_tag LOCUS_12100 <3122 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence279 2609 618 gene locus_tag LOCUS_12110 2609 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence280 61 1509 gene locus_tag LOCUS_12120 61 1509 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746428.1 protein_id gnl|my_center|LOCUS_12120 1502 2182 gene locus_tag LOCUS_12130 1502 2182 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030483.1 protein_id gnl|my_center|LOCUS_12130 3042 2218 gene locus_tag LOCUS_12140 3042 2218 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence281 <1 2893 gene locus_tag LOCUS_12150 <1 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076327552.1:carbohydrate binding domain-containing protein >Feature sequence282 730 86 gene locus_tag LOCUS_12160 730 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1485 724 gene locus_tag LOCUS_12170 1485 724 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_12170 1985 1611 gene locus_tag LOCUS_12180 1985 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2257 2430 gene locus_tag LOCUS_12190 2257 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2415 2612 gene locus_tag LOCUS_12200 2415 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence283 502 125 gene locus_tag LOCUS_12210 502 125 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_12210 <3067 646 gene locus_tag LOCUS_12220 <3067 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962351.1:leucine-rich repeat domain-containing protein >Feature sequence284 1210 23 gene locus_tag LOCUS_12230 gene nifS 1210 23 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_12230 1357 3051 gene locus_tag LOCUS_12240 1357 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence285 332 2176 gene locus_tag LOCUS_12250 332 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence286 <1 1064 gene locus_tag LOCUS_12260 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001160526.1:class II fumarate hydratase 1182 1775 gene locus_tag LOCUS_12270 1182 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2136 2972 gene locus_tag LOCUS_12280 2136 2972 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence287 2593 824 gene locus_tag LOCUS_12290 gene aspS 2593 824 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence288 183 1970 gene locus_tag LOCUS_12300 183 1970 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_12300 2634 2089 gene locus_tag LOCUS_12310 2634 2089 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764711.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence289 <1 2052 gene locus_tag LOCUS_12320 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813282.1:type I DNA topoisomerase 1780 1979 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgacgcgcagaaagtcggtgga >Feature sequence290 1055 411 gene locus_tag LOCUS_12330 1055 411 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_12330 1661 1197 gene locus_tag LOCUS_12340 1661 1197 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence291 625 146 gene locus_tag LOCUS_12350 gene greA 625 146 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_12350 1010 1273 gene locus_tag LOCUS_12360 1010 1273 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_12360 1279 1839 gene locus_tag LOCUS_12370 1279 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1877 2068 gene locus_tag LOCUS_12380 gene rpmF 1877 2068 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence292 2695 2405 gene locus_tag LOCUS_12390 2695 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence293 <1 833 gene locus_tag LOCUS_12400 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383862.1:ABC transporter permease 835 1704 gene locus_tag LOCUS_12410 835 1704 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence294 658 1836 gene locus_tag LOCUS_12420 gene thiI 658 1836 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence295 <2944 1567 gene locus_tag LOCUS_12430 <2944 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963336.1:DNA gyrase subunit A >Feature sequence296 <1 1250 gene locus_tag LOCUS_12440 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897443.1:PTS fructose transporter subunit IIABC 1427 2503 gene locus_tag LOCUS_12450 1427 2503 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence297 356 1336 gene locus_tag LOCUS_12460 356 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1515 2027 gene locus_tag LOCUS_12470 1515 2027 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence298 1933 530 gene locus_tag LOCUS_12480 1933 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence299 2878 842 gene locus_tag LOCUS_12490 2878 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence300 <1 590 gene locus_tag LOCUS_12500 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003645028.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO 610 1635 gene locus_tag LOCUS_12510 gene plsX 610 1635 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723870.1 protein_id gnl|my_center|LOCUS_12510 <2923 1738 gene locus_tag LOCUS_12520 <2923 1738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010774154.1:GH25 family lysozyme >Feature sequence301 7 285 gene locus_tag LOCUS_12530 7 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 282 536 gene locus_tag LOCUS_12540 282 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 543 1100 gene locus_tag LOCUS_12550 543 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12550 1452 2564 gene locus_tag LOCUS_12560 1452 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence302 699 1385 gene locus_tag LOCUS_12570 699 1385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356531.1 protein_id gnl|my_center|LOCUS_12570 1391 2839 gene locus_tag LOCUS_12580 1391 2839 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence303 <1 776 gene locus_tag LOCUS_12590 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027626.1:RNA methyltransferase 800 2014 gene locus_tag LOCUS_12600 gene dprA 800 2014 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence304 <1 509 gene locus_tag LOCUS_12610 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005649894.1:Cof-type HAD-IIB family hydrolase 665 741 gene locus_tag LOCUS_t00100 665 741 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 775 849 gene locus_tag LOCUS_t00110 775 849 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 892 968 gene locus_tag LOCUS_t00120 892 968 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence305 >Feature sequence306 1712 984 gene locus_tag LOCUS_12620 1712 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1970 1776 gene locus_tag LOCUS_12630 1970 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence307 964 149 gene locus_tag LOCUS_12640 964 149 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287979.1 protein_id gnl|my_center|LOCUS_12640 1524 1156 gene locus_tag LOCUS_12650 1524 1156 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_12650 2860 1643 gene locus_tag LOCUS_12660 gene alr 2860 1643 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence308 >Feature sequence309 >Feature sequence310 <1 717 gene locus_tag LOCUS_12670 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962345.1:leucine-rich repeat domain-containing protein 1055 753 gene locus_tag LOCUS_12680 1055 753 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966115.1 protein_id gnl|my_center|LOCUS_12680 1768 1082 gene locus_tag LOCUS_12690 1768 1082 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_12690 2130 2660 gene locus_tag LOCUS_12700 gene rplJ 2130 2660 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence311 1232 186 gene locus_tag LOCUS_12710 1232 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1872 1246 gene locus_tag LOCUS_12720 1872 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2401 1886 gene locus_tag LOCUS_12730 2401 1886 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817206.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence312 1124 663 gene locus_tag LOCUS_12740 1124 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1378 1845 gene locus_tag LOCUS_12750 1378 1845 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence313 >Feature sequence314 2621 1875 gene locus_tag LOCUS_12760 2621 1875 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence315 678 142 gene locus_tag LOCUS_12770 678 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 748 1236 gene locus_tag LOCUS_12780 748 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1791 1258 gene locus_tag LOCUS_12790 1791 1258 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_12790 2310 1813 gene locus_tag LOCUS_12800 gene smpB 2310 1813 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence316 >Feature sequence317 536 345 gene locus_tag LOCUS_12810 536 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 631 969 gene locus_tag LOCUS_12820 631 969 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_12820 954 1682 gene locus_tag LOCUS_12830 954 1682 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence318 22 588 gene locus_tag LOCUS_12840 22 588 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_12840 1553 627 gene locus_tag LOCUS_12850 1553 627 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_12850 2299 1547 gene locus_tag LOCUS_12860 2299 1547 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence319 196 513 gene locus_tag LOCUS_12870 196 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 798 2147 gene locus_tag LOCUS_12880 gene gdhA 798 2147 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence320 1682 315 gene locus_tag LOCUS_12890 gene leuC 1682 315 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_12890 2254 1673 gene locus_tag LOCUS_12900 2254 1673 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_12900 <2792 2264 gene locus_tag LOCUS_12910 <2792 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393738.1:2-isopropylmalate synthase >Feature sequence321 598 110 gene locus_tag LOCUS_12920 598 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 963 616 gene locus_tag LOCUS_12930 963 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2096 1032 gene locus_tag LOCUS_12940 2096 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence322 3 1280 gene locus_tag LOCUS_12950 3 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence323 2 406 gene locus_tag LOCUS_12960 2 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 403 1134 gene locus_tag LOCUS_12970 403 1134 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_12970 1260 1949 gene locus_tag LOCUS_12980 gene yunB 1260 1949 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence324 1819 884 gene locus_tag LOCUS_12990 gene argC 1819 884 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_12990 <2748 1816 gene locus_tag LOCUS_13000 <2748 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808617.1:argininosuccinate lyase >Feature sequence325 1678 239 gene locus_tag LOCUS_13010 gene cysS 1678 239 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_13010 2456 1767 gene locus_tag LOCUS_13020 gene cysE 2456 1767 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence326 281 2227 gene locus_tag LOCUS_13030 281 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence327 <2715 473 gene locus_tag LOCUS_13040 <2715 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542538.1:DNA helicase PcrA >Feature sequence328 381 1097 gene locus_tag LOCUS_13050 gene dapB 381 1097 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698231.1 protein_id gnl|my_center|LOCUS_13050 1174 1899 gene locus_tag LOCUS_13060 gene dapD 1174 1899 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence329 362 583 gene locus_tag LOCUS_13070 362 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 580 2409 gene locus_tag LOCUS_13080 580 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence330 2688 1663 gene locus_tag LOCUS_13090 2688 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence331 2457 595 gene locus_tag LOCUS_13100 2457 595 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence332 193 348 gene locus_tag LOCUS_13110 193 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 657 2222 gene locus_tag LOCUS_13120 657 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence333 783 145 gene locus_tag LOCUS_13130 783 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1634 801 gene locus_tag LOCUS_13140 1634 801 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_13140 2344 1631 gene locus_tag LOCUS_13150 2344 1631 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943614.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence334 >Feature sequence335 1437 2237 gene locus_tag LOCUS_13160 1437 2237 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272484.1 protein_id gnl|my_center|LOCUS_13160 2263 2520 gene locus_tag LOCUS_13170 2263 2520 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence336 1358 1083 gene locus_tag LOCUS_13180 1358 1083 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 protein_id gnl|my_center|LOCUS_13180 <2661 1518 gene locus_tag LOCUS_13190 <2661 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027722.1:PTS beta-glucoside transporter subunit IIBCA >Feature sequence337 <1 2587 gene locus_tag LOCUS_13200 <1 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011114777.1:ankyrin repeat domain-containing protein >Feature sequence338 312 1145 gene locus_tag LOCUS_13210 gene murI 312 1145 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_13210 1132 1704 gene locus_tag LOCUS_13220 1132 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence339 257 844 gene locus_tag LOCUS_13230 gene pth 257 844 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence340 <1 648 gene locus_tag LOCUS_13240 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein 794 2197 gene locus_tag LOCUS_13250 794 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2215 2628 gene locus_tag LOCUS_13260 2215 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence341 1274 924 gene locus_tag LOCUS_13270 1274 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1581 1276 gene locus_tag LOCUS_13280 1581 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence342 157 858 gene locus_tag LOCUS_13290 157 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 >Feature sequence343 1517 360 gene locus_tag LOCUS_13300 1517 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 <2599 1786 gene locus_tag LOCUS_13310 <2599 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964598.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence344 <1 896 gene locus_tag LOCUS_13320 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393887.1:arginine--tRNA ligase 965 2359 gene locus_tag LOCUS_13330 965 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence345 1948 1169 gene locus_tag LOCUS_13340 1948 1169 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence346 <1 876 gene locus_tag LOCUS_13350 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962356.1:leucine-rich repeat domain-containing protein 1572 967 gene locus_tag LOCUS_13360 1572 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1650 2384 gene locus_tag LOCUS_13370 1650 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence347 984 205 gene locus_tag LOCUS_13380 984 205 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382117.1 protein_id gnl|my_center|LOCUS_13380 1676 981 gene locus_tag LOCUS_13390 1676 981 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902869.1 protein_id gnl|my_center|LOCUS_13390 1963 2274 gene locus_tag LOCUS_13400 1963 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence348 <1 1943 gene locus_tag LOCUS_13410 <1 1943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein <2558 2030 gene locus_tag LOCUS_13420 <2558 2030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583839.1:MBL fold metallo-hydrolase >Feature sequence349 <1 779 gene locus_tag LOCUS_13430 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356056.1:F0F1 ATP synthase subunit alpha 779 1684 gene locus_tag LOCUS_13440 gene atpG 779 1684 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence350 3 677 gene locus_tag LOCUS_13450 3 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 746 976 gene locus_tag LOCUS_13460 746 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1104 1652 gene locus_tag LOCUS_13470 1104 1652 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_13470 2154 1756 gene locus_tag LOCUS_13480 2154 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence351 572 1402 gene locus_tag LOCUS_13490 572 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 1857 1444 gene locus_tag LOCUS_13500 1857 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_13500 2454 1888 gene locus_tag LOCUS_13510 gene efp 2454 1888 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence352 <2490 1802 gene locus_tag LOCUS_13520 <2490 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861865.1:AEC family transporter >Feature sequence353 711 1724 gene locus_tag LOCUS_13530 711 1724 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_13530 1858 2202 gene locus_tag LOCUS_13540 1858 2202 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence354 376 80 gene locus_tag LOCUS_13550 376 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 564 373 gene locus_tag LOCUS_13560 564 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 791 561 gene locus_tag LOCUS_13570 791 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1222 788 gene locus_tag LOCUS_13580 1222 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1434 1219 gene locus_tag LOCUS_13590 1434 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1622 1446 gene locus_tag LOCUS_13600 1622 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2086 1619 gene locus_tag LOCUS_13610 2086 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence355 <1 807 gene locus_tag LOCUS_13620 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965561.1:helicase-exonuclease AddAB subunit AddB >Feature sequence356 <2458 1021 gene locus_tag LOCUS_13630 <2458 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393139.1:endolytic transglycosylase MltG >Feature sequence357 2213 1224 gene locus_tag LOCUS_13640 2213 1224 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933309.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence358 >Feature sequence359 999 433 gene locus_tag LOCUS_13650 999 433 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_13650 1440 1009 gene locus_tag LOCUS_13660 gene dutA 1440 1009 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_13660 <2440 1449 gene locus_tag LOCUS_13670 <2440 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860926.1:U32 family peptidase >Feature sequence360 1458 724 gene locus_tag LOCUS_13680 1458 724 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_13680 2438 1455 gene locus_tag LOCUS_13690 2438 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence361 199 927 gene locus_tag LOCUS_13700 199 927 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101294608.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence362 1847 450 gene locus_tag LOCUS_13710 1847 450 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_13710 <2417 1868 gene locus_tag LOCUS_13720 <2417 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890735.1:carboxylesterase/lipase family protein >Feature sequence363 <1 618 gene locus_tag LOCUS_13730 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000194527.1:sucrose-6-phosphate hydrolase >Feature sequence364 2 1537 gene locus_tag LOCUS_13740 2 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence365 372 503 gene locus_tag LOCUS_13750 372 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence366 243 1211 gene locus_tag LOCUS_13760 gene dusB 243 1211 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_13760 1208 1843 gene locus_tag LOCUS_13770 1208 1843 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence367 >Feature sequence368 <1 1891 gene locus_tag LOCUS_13780 <1 1891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460242.1:ferrous iron transport protein B 1913 2101 gene locus_tag LOCUS_13790 1913 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2098 2352 gene locus_tag LOCUS_13800 2098 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence369 1614 88 gene locus_tag LOCUS_13810 1614 88 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_13810 <2368 1696 gene locus_tag LOCUS_13820 <2368 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965676.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence370 1123 485 gene locus_tag LOCUS_13830 gene pyrE 1123 485 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_13830 1519 1136 gene locus_tag LOCUS_13840 1519 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 2243 1533 gene locus_tag LOCUS_13850 gene pyrF 2243 1533 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence371 196 561 gene locus_tag LOCUS_13860 gene rpsM 196 561 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_13860 577 981 gene locus_tag LOCUS_13870 gene rpsK 577 981 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_13870 1002 1604 gene locus_tag LOCUS_13880 gene rpsD 1002 1604 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence372 1056 247 gene locus_tag LOCUS_13890 1056 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13890 1872 1084 gene locus_tag LOCUS_13900 1872 1084 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_13900 2353 1889 gene locus_tag LOCUS_13910 2353 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence373 >Feature sequence374 561 4 gene locus_tag LOCUS_13920 gene frr 561 4 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_13920 1301 576 gene locus_tag LOCUS_13930 gene pyrH 1301 576 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640737.1 protein_id gnl|my_center|LOCUS_13930 1966 1361 gene locus_tag LOCUS_13940 1966 1361 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965893.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence375 299 2239 gene locus_tag LOCUS_13950 299 2239 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence376 566 982 gene locus_tag LOCUS_13960 566 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1511 1074 gene locus_tag LOCUS_13970 1511 1074 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_13970 2109 1561 gene locus_tag LOCUS_13980 2109 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence377 1278 157 gene locus_tag LOCUS_13990 1278 157 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_13990 2264 1299 gene locus_tag LOCUS_14000 2264 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence378 657 1625 gene locus_tag LOCUS_14010 gene fucO 657 1625 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14010 <2328 1725 gene locus_tag LOCUS_14020 <2328 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012028020.1:glycoside hydrolase family 3 protein >Feature sequence379 168 782 gene locus_tag LOCUS_14030 168 782 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_14030 2020 848 gene locus_tag LOCUS_14040 2020 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence380 <1 762 gene locus_tag LOCUS_14050 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870104.1:type II restriction endonuclease 1700 804 gene locus_tag LOCUS_14060 gene gpr 1700 804 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence381 1062 568 gene locus_tag LOCUS_14070 1062 568 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_14070 1682 1059 gene locus_tag LOCUS_14080 1682 1059 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_14080 <2314 1711 gene locus_tag LOCUS_14090 <2314 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082164.1:flagellar basal-body rod protein FlgG >Feature sequence382 347 787 gene locus_tag LOCUS_14100 347 787 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 protein_id gnl|my_center|LOCUS_14100 812 1594 gene locus_tag LOCUS_14110 812 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence383 359 1264 gene locus_tag LOCUS_14120 359 1264 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101944.1 protein_id gnl|my_center|LOCUS_14120 1464 2231 gene locus_tag LOCUS_14130 1464 2231 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001388628.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence384 994 641 gene locus_tag LOCUS_14140 994 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2191 1013 gene locus_tag LOCUS_14150 2191 1013 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368732.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence385 653 1462 gene locus_tag LOCUS_14160 653 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1592 1873 gene locus_tag LOCUS_14170 1592 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence386 1869 385 gene locus_tag LOCUS_14180 1869 385 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence387 1208 876 gene locus_tag LOCUS_14190 1208 876 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_14190 1695 1228 gene locus_tag LOCUS_14200 gene rlmH 1695 1228 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_14200 <2280 1695 gene locus_tag LOCUS_14210 <2280 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359322.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence388 560 832 gene locus_tag LOCUS_14220 560 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1270 2106 gene locus_tag LOCUS_14230 1270 2106 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence389 2 943 gene locus_tag LOCUS_14240 2 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence390 <1 1218 gene locus_tag LOCUS_14250 <1 1218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094015776.1:S-layer homology domain-containing protein >Feature sequence391 <1 568 gene locus_tag LOCUS_14260 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033065833.1:aminoacyl-histidine dipeptidase 565 1533 gene locus_tag LOCUS_14270 565 1533 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_14270 <2245 1568 gene locus_tag LOCUS_14280 <2245 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014636419.1:alkaline phosphatase family protein >Feature sequence392 199 47 gene locus_tag LOCUS_14290 199 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1469 213 gene locus_tag LOCUS_14300 1469 213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963643.1 protein_id gnl|my_center|LOCUS_14300 2073 1489 gene locus_tag LOCUS_14310 2073 1489 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence393 1926 1255 gene locus_tag LOCUS_14320 gene yycF 1926 1255 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722907.1 protein_id gnl|my_center|LOCUS_14320 2076 1988 gene locus_tag LOCUS_t00130 2076 1988 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence394 2235 1102 gene locus_tag LOCUS_14330 2235 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence395 <2233 1656 gene locus_tag LOCUS_14340 <2233 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986283.1:iron-containing alcohol dehydrogenase >Feature sequence396 >Feature sequence397 <1 893 gene locus_tag LOCUS_14350 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545691.1:phosphoribosylamine--glycine ligase >Feature sequence398 >Feature sequence399 348 842 gene locus_tag LOCUS_14360 348 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 928 1869 gene locus_tag LOCUS_14370 928 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence400 >Feature sequence401 <1 1369 gene locus_tag LOCUS_14380 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898459.1:Na/Pi cotransporter family protein >Feature sequence402 2050 1529 gene locus_tag LOCUS_14390 2050 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence403 467 907 gene locus_tag LOCUS_14400 467 907 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_14400 1399 1085 gene locus_tag LOCUS_14410 1399 1085 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_14410 1664 1380 gene locus_tag LOCUS_14420 1664 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1929 1684 gene locus_tag LOCUS_14430 1929 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence404 520 1494 gene locus_tag LOCUS_14440 520 1494 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_14440 1773 1531 gene locus_tag LOCUS_14450 1773 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence405 266 1342 gene locus_tag LOCUS_14460 gene rseP 266 1342 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_14460 1352 1873 gene locus_tag LOCUS_14470 1352 1873 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence406 500 763 gene locus_tag LOCUS_14480 gene rpsT 500 763 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_14480 830 1597 gene locus_tag LOCUS_14490 830 1597 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence407 >Feature sequence408 <1 2139 gene locus_tag LOCUS_14500 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120647683.1:ATP-binding protein >Feature sequence409 692 72 gene locus_tag LOCUS_14510 692 72 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_14510 1567 689 gene locus_tag LOCUS_14520 1567 689 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_14520 1704 2090 gene locus_tag LOCUS_14530 1704 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence410 1047 1457 gene locus_tag LOCUS_14540 1047 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence411 413 30 gene locus_tag LOCUS_14550 413 30 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_14550 1659 415 gene locus_tag LOCUS_14560 1659 415 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228734.1 protein_id gnl|my_center|LOCUS_14560 2056 2141 gene locus_tag LOCUS_t00140 2056 2141 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence412 <2136 952 gene locus_tag LOCUS_14570 <2136 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987111.1:MATE family efflux transporter >Feature sequence413 >Feature sequence414 1817 987 gene locus_tag LOCUS_14580 gene amrS 1817 987 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence415 41 904 gene locus_tag LOCUS_14590 gene truB 41 904 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400189.1 protein_id gnl|my_center|LOCUS_14590 920 1822 gene locus_tag LOCUS_14600 920 1822 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence416 387 989 gene locus_tag LOCUS_14610 387 989 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422659.1 protein_id gnl|my_center|LOCUS_14610 1001 1987 gene locus_tag LOCUS_14620 1001 1987 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence417 <1 801 gene locus_tag LOCUS_14630 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968282.1:ribose ABC transporter permease RbsC >Feature sequence418 956 231 gene locus_tag LOCUS_14640 gene cwlD 956 231 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399672.1 protein_id gnl|my_center|LOCUS_14640 1088 1798 gene locus_tag LOCUS_14650 1088 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence419 >Feature sequence420 >Feature sequence421 <1 1210 gene locus_tag LOCUS_14660 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070564.1:type II secretion system ATPase GspE >Feature sequence422 >Feature sequence423 1043 360 gene locus_tag LOCUS_14670 1043 360 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_14670 1672 1055 gene locus_tag LOCUS_14680 1672 1055 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence424 <1 742 gene locus_tag LOCUS_14690 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286870.1:M20 family metallopeptidase >Feature sequence425 <1 2045 gene locus_tag LOCUS_14700 <1 2045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966366.1:Ig-like domain-containing protein >Feature sequence426 709 1812 gene locus_tag LOCUS_14710 gene mglB 709 1812 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365711.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence427 1320 127 gene locus_tag LOCUS_14720 1320 127 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence428 456 1667 gene locus_tag LOCUS_14730 456 1667 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence429 >Feature sequence430 338 1819 gene locus_tag LOCUS_14740 gene gatA 338 1819 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence431 >Feature sequence432 15 857 gene locus_tag LOCUS_14750 15 857 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921761.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence433 1674 1051 gene locus_tag LOCUS_14760 1674 1051 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964741.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence434 214 1641 gene locus_tag LOCUS_14770 gene gatB 214 1641 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933868.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence435 <1 861 gene locus_tag LOCUS_14780 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399999.1:phage terminase large subunit 992 1222 gene locus_tag LOCUS_14790 992 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence436 163 1836 gene locus_tag LOCUS_14800 163 1836 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986179.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence437 1 1587 gene locus_tag LOCUS_14810 1 1587 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813906.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence438 >Feature sequence439 >Feature sequence440 187 474 gene locus_tag LOCUS_14820 187 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 591 995 gene locus_tag LOCUS_14830 591 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 992 1951 gene locus_tag LOCUS_14840 992 1951 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence441 <1 1381 gene locus_tag LOCUS_14850 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949018.1:rod shape-determining protein >Feature sequence442 171 458 gene locus_tag LOCUS_14860 171 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 448 801 gene locus_tag LOCUS_14870 448 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 798 1598 gene locus_tag LOCUS_14880 798 1598 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence443 48 839 gene locus_tag LOCUS_14890 48 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 836 1597 gene locus_tag LOCUS_14900 gene trpA 836 1597 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640398.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence444 1586 612 gene locus_tag LOCUS_14910 1586 612 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence445 304 522 gene locus_tag LOCUS_14920 304 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 522 1850 gene locus_tag LOCUS_14930 522 1850 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391589.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence446 404 1957 gene locus_tag LOCUS_14940 404 1957 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830011.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence447 1641 286 gene locus_tag LOCUS_14950 gene murD 1641 286 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence448 75 434 gene locus_tag LOCUS_14960 gene rplR 75 434 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_14960 452 949 gene locus_tag LOCUS_14970 gene rpsE 452 949 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_14970 961 1155 gene locus_tag LOCUS_14980 961 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1152 1592 gene locus_tag LOCUS_14990 gene rplO 1152 1592 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence449 <1 1244 gene locus_tag LOCUS_15000 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775562.1:ABC transporter substrate-binding protein >Feature sequence450 >Feature sequence451 1095 325 gene locus_tag LOCUS_15010 gene cobM 1095 325 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_15010 <1930 1097 gene locus_tag LOCUS_15020 <1930 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836528.1:cobalt-precorrin-5B (C(1))-methyltransferase CbiD >Feature sequence452 <1 1824 gene locus_tag LOCUS_15030 <1 1824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein >Feature sequence453 <1 1720 gene locus_tag LOCUS_15040 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056426.1:1,4-alpha-glucan branching enzyme >Feature sequence454 408 722 gene locus_tag LOCUS_15050 408 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 736 1065 gene locus_tag LOCUS_15060 736 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1034 1501 gene locus_tag LOCUS_15070 1034 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1498 1716 gene locus_tag LOCUS_15080 1498 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence455 588 1679 gene locus_tag LOCUS_15090 gene ychF 588 1679 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence456 1037 366 gene locus_tag LOCUS_15100 gene plsY 1037 366 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160822.1 protein_id gnl|my_center|LOCUS_15100 <1888 1040 gene locus_tag LOCUS_15110 <1888 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460200.1:ribosome biogenesis GTPase Der >Feature sequence457 <1 1614 gene locus_tag LOCUS_15120 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898067.1:V-type ATP synthase subunit I >Feature sequence458 1863 226 gene locus_tag LOCUS_15130 1863 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence459 >Feature sequence460 <1 1095 gene locus_tag LOCUS_15140 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258398.1:alpha-amylase family glycosyl hydrolase >Feature sequence461 <1 1093 gene locus_tag LOCUS_15150 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860851.1:chemotaxis protein CheA 1100 1594 gene locus_tag LOCUS_15160 1100 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence462 >Feature sequence463 >Feature sequence464 <1 1544 gene locus_tag LOCUS_15170 <1 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231540.1:endo-1,4-beta-glucanase EglS >Feature sequence465 1436 1717 gene locus_tag LOCUS_15180 1436 1717 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence466 <1 984 gene locus_tag LOCUS_15190 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357154.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence467 1061 291 gene locus_tag LOCUS_15200 gene sigG 1061 291 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_15200 1207 1509 gene locus_tag LOCUS_15210 1207 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence468 1219 188 gene locus_tag LOCUS_15220 gene sppA 1219 188 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_15220 1730 1341 gene locus_tag LOCUS_15230 1730 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence469 1433 567 gene locus_tag LOCUS_15240 1433 567 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_15240 1621 1430 gene locus_tag LOCUS_15250 1621 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence470 1615 536 gene locus_tag LOCUS_15260 gene ispG 1615 536 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence471 1599 142 gene locus_tag LOCUS_15270 1599 142 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence472 1562 795 gene locus_tag LOCUS_15280 gene yecC 1562 795 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096023.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence473 803 366 gene locus_tag LOCUS_15290 803 366 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_15290 1411 863 gene locus_tag LOCUS_15300 1411 863 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence474 <1 822 gene locus_tag LOCUS_15310 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809087.1:FAD-dependent oxidoreductase >Feature sequence475 <1 902 gene locus_tag LOCUS_15320 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246126.1:heat-inducible transcriptional repressor HrcA 880 1443 gene locus_tag LOCUS_15330 gene grpE 880 1443 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence476 103 876 gene locus_tag LOCUS_15340 103 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 873 1631 gene locus_tag LOCUS_15350 873 1631 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence477 >Feature sequence478 141 761 gene locus_tag LOCUS_15360 141 761 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_15360 1153 971 gene locus_tag LOCUS_15370 gene rpsU 1153 971 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence479 260 66 gene locus_tag LOCUS_15380 260 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1409 291 gene locus_tag LOCUS_15390 1409 291 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_15390 1772 1428 gene locus_tag LOCUS_15400 1772 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence480 91 1074 gene locus_tag LOCUS_15410 91 1074 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence481 176 940 gene locus_tag LOCUS_15420 176 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 <1759 983 gene locus_tag LOCUS_15430 <1759 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392833.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence482 1644 658 gene locus_tag LOCUS_15440 gene galE 1644 658 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102181.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence483 <1 1199 gene locus_tag LOCUS_15450 <1 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964572.1:GTPase ObgE 1207 1647 gene locus_tag LOCUS_15460 1207 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence484 <1 927 gene locus_tag LOCUS_15470 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905672.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 930 1568 gene locus_tag LOCUS_15480 930 1568 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence485 1 540 gene locus_tag LOCUS_15490 gene spoVT 1 540 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_15490 <1745 633 gene locus_tag LOCUS_15500 <1745 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722393.1:glucose-6-phosphate isomerase >Feature sequence486 <1741 238 gene locus_tag LOCUS_15510 <1741 238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288851.1:cell wall metabolism sensor histidine kinase WalK >Feature sequence487 <1 867 gene locus_tag LOCUS_15520 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein >Feature sequence488 <1738 443 gene locus_tag LOCUS_15530 <1738 443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949007.1:nicotinate phosphoribosyltransferase >Feature sequence489 846 106 gene locus_tag LOCUS_15540 846 106 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_15540 1659 865 gene locus_tag LOCUS_15550 1659 865 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223077.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence490 <1730 444 gene locus_tag LOCUS_15560 <1730 444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943967.1:GGDEF domain-containing protein >Feature sequence491 1728 652 gene locus_tag LOCUS_15570 1728 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence492 <1 716 gene locus_tag LOCUS_15580 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003426762.1:V-type ATP synthase subunit A >Feature sequence493 <1 1074 gene locus_tag LOCUS_15590 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064307.1:BMP family ABC transporter substrate-binding protein 1077 1667 gene locus_tag LOCUS_15600 1077 1667 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence494 <1 1657 gene locus_tag LOCUS_15610 <1 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243950.1:minor protease Epr >Feature sequence495 >Feature sequence496 <1 844 gene locus_tag LOCUS_15620 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494076.1:glycogen phosphorylase 1270 1055 gene locus_tag LOCUS_15630 1270 1055 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence497 481 1500 gene locus_tag LOCUS_15640 gene cbiG 481 1500 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence498 1287 553 gene locus_tag LOCUS_15650 1287 553 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence499 26 385 gene locus_tag LOCUS_15660 26 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence500 575 853 gene locus_tag LOCUS_15670 575 853 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_15670 843 1472 gene locus_tag LOCUS_15680 843 1472 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence501 2 235 gene locus_tag LOCUS_15690 2 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 374 1465 gene locus_tag LOCUS_15700 374 1465 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence502 792 478 gene locus_tag LOCUS_15710 792 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1517 789 gene locus_tag LOCUS_15720 1517 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence503 >Feature sequence504 134 1171 gene locus_tag LOCUS_15730 134 1171 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence505 <1 1386 gene locus_tag LOCUS_15740 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012028020.1:glycoside hydrolase family 3 protein >Feature sequence506 >Feature sequence507 >Feature sequence508 <1658 547 gene locus_tag LOCUS_15750 <1658 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016931.1:acyl-CoA dehydratase activase >Feature sequence509 852 607 gene locus_tag LOCUS_15760 852 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence510 <1641 980 gene locus_tag LOCUS_15770 <1641 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393742.1:dihydroxy-acid dehydratase >Feature sequence511 1169 450 gene locus_tag LOCUS_15780 1169 450 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_15780 1235 1570 gene locus_tag LOCUS_15790 1235 1570 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence512 174 1520 gene locus_tag LOCUS_15800 174 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence513 >Feature sequence514 >Feature sequence515 674 1564 gene locus_tag LOCUS_15810 674 1564 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939305.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence516 >Feature sequence517 >Feature sequence518 1111 383 gene locus_tag LOCUS_15820 1111 383 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence519 <1 712 gene locus_tag LOCUS_15830 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861882.1:glycine betaine ABC transporter substrate-binding protein 705 1439 gene locus_tag LOCUS_15840 705 1439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438780.1 protein_id gnl|my_center|LOCUS_15840 >Feature sequence520 >Feature sequence521 >Feature sequence522 <1 649 gene locus_tag LOCUS_15850 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682008.1:iron ABC transporter permease >Feature sequence523 465 250 gene locus_tag LOCUS_15860 465 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 749 462 gene locus_tag LOCUS_15870 749 462 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence524 82 774 gene locus_tag LOCUS_15880 82 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence525 1077 277 gene locus_tag LOCUS_15890 1077 277 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence526 >Feature sequence527 >Feature sequence528 2 289 gene locus_tag LOCUS_15900 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 286 1191 gene locus_tag LOCUS_15910 gene rsgA 286 1191 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence529 <1 1187 gene locus_tag LOCUS_15920 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392969.1:S-layer homology domain-containing protein >Feature sequence530 463 1056 gene locus_tag LOCUS_15930 gene rsxA 463 1056 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence531 636 959 gene locus_tag LOCUS_15940 636 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence532 2 1099 gene locus_tag LOCUS_15950 2 1099 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence533 1347 289 gene locus_tag LOCUS_15960 1347 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence534 >Feature sequence535 930 367 gene locus_tag LOCUS_15970 930 367 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence536 >Feature sequence537 1318 149 gene locus_tag LOCUS_15980 1318 149 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence538 <1 553 gene locus_tag LOCUS_15990 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_191976281.1:peptide chain release factor 2 >Feature sequence539 1047 316 gene locus_tag LOCUS_16000 gene cas6 1047 316 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_16000 1330 1500 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacacaacccgcgcccctcacggggattaaaact >Feature sequence540 >Feature sequence541 1510 230 gene locus_tag LOCUS_16010 1510 230 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence542 2 733 gene locus_tag LOCUS_16020 2 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence543 1246 50 gene locus_tag LOCUS_16030 1246 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence544 1231 452 gene locus_tag LOCUS_16040 1231 452 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000213463.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence545 <1508 876 gene locus_tag LOCUS_16050 <1508 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964762.1:sugar ABC transporter substrate-binding protein >Feature sequence546 1012 788 gene locus_tag LOCUS_16060 1012 788 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016430.1 protein_id gnl|my_center|LOCUS_16060