>Feature sequence001 165 446 gene locus_tag LOCUS_00010 165 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 464 1036 gene locus_tag LOCUS_00020 464 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1344 1886 gene locus_tag LOCUS_00030 1344 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1889 2401 gene locus_tag LOCUS_00040 1889 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2423 2899 gene locus_tag LOCUS_00050 2423 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 2900 3421 gene locus_tag LOCUS_00060 2900 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 3736 3948 gene locus_tag LOCUS_00070 3736 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 3977 4255 gene locus_tag LOCUS_00080 3977 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4260 4928 gene locus_tag LOCUS_00090 4260 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 4931 5461 gene locus_tag LOCUS_00100 4931 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 5721 6254 gene locus_tag LOCUS_00110 5721 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6266 6499 gene locus_tag LOCUS_00120 6266 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 6539 6877 gene locus_tag LOCUS_00130 6539 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 6885 7190 gene locus_tag LOCUS_00140 6885 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 7190 7630 gene locus_tag LOCUS_00150 7190 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 7654 7947 gene locus_tag LOCUS_00160 7654 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 7937 8206 gene locus_tag LOCUS_00170 7937 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 8203 8529 gene locus_tag LOCUS_00180 8203 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 8526 8960 gene locus_tag LOCUS_00190 8526 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 8953 9312 gene locus_tag LOCUS_00200 8953 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 9314 9967 gene locus_tag LOCUS_00210 9314 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 9957 10916 gene locus_tag LOCUS_00220 9957 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 10921 11094 gene locus_tag LOCUS_00230 10921 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 11117 11527 gene locus_tag LOCUS_00240 11117 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 11531 12718 gene locus_tag LOCUS_00250 11531 12718 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169948.1 protein_id gnl|my_center|LOCUS_00250 12715 13440 gene locus_tag LOCUS_00260 12715 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 13516 14025 gene locus_tag LOCUS_00270 13516 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 14072 15043 gene locus_tag LOCUS_00280 14072 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 15045 20432 gene locus_tag LOCUS_00290 15045 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 20528 21022 gene locus_tag LOCUS_00300 20528 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 21058 21462 gene locus_tag LOCUS_00310 21058 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 21657 23552 gene locus_tag LOCUS_00320 21657 23552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 23697 25076 gene locus_tag LOCUS_00330 23697 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 25121 26227 gene locus_tag LOCUS_00340 25121 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 26337 26864 gene locus_tag LOCUS_00350 26337 26864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 26980 27360 gene locus_tag LOCUS_00360 26980 27360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 27350 28465 gene locus_tag LOCUS_00370 27350 28465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 28470 29006 gene locus_tag LOCUS_00380 28470 29006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 29006 29428 gene locus_tag LOCUS_00390 29006 29428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 29459 30718 gene locus_tag LOCUS_00400 29459 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 30729 31907 gene locus_tag LOCUS_00410 30729 31907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 31910 32245 gene locus_tag LOCUS_00420 31910 32245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 32242 32439 gene locus_tag LOCUS_00430 32242 32439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence002 1573 485 gene locus_tag LOCUS_00440 1573 485 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_00440 3485 1653 gene locus_tag LOCUS_00450 3485 1653 CDS product polysaccharide lyase 8 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202488.1 protein_id gnl|my_center|LOCUS_00450 3939 7520 gene locus_tag LOCUS_00460 3939 7520 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_00460 7713 10979 gene locus_tag LOCUS_00470 7713 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 11007 14123 gene locus_tag LOCUS_00480 11007 14123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 14382 15500 gene locus_tag LOCUS_00490 14382 15500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 15524 18448 gene locus_tag LOCUS_00500 15524 18448 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_00500 18460 20211 gene locus_tag LOCUS_00510 18460 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 20252 22462 gene locus_tag LOCUS_00520 20252 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 22489 24999 gene locus_tag LOCUS_00530 22489 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 25035 26882 gene locus_tag LOCUS_00540 25035 26882 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_00540 27930 27019 gene locus_tag LOCUS_00550 27930 27019 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_00550 >Feature sequence003 363 794 gene locus_tag LOCUS_00560 gene rpiB 363 794 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_00560 794 1609 gene locus_tag LOCUS_00570 gene truB 794 1609 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_00570 2723 1611 gene locus_tag LOCUS_00580 2723 1611 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_00580 2799 3593 gene locus_tag LOCUS_00590 2799 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 5719 3584 gene locus_tag LOCUS_00600 5719 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 7449 5719 gene locus_tag LOCUS_00610 7449 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 8607 7546 gene locus_tag LOCUS_00620 8607 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 10498 8672 gene locus_tag LOCUS_00630 10498 8672 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_00630 13873 10511 gene locus_tag LOCUS_00640 13873 10511 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764523.1 protein_id gnl|my_center|LOCUS_00640 14228 16624 gene locus_tag LOCUS_00650 14228 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 16637 18913 gene locus_tag LOCUS_00660 16637 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 21452 19053 gene locus_tag LOCUS_00670 gene pnp 21452 19053 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_00670 21810 21535 gene locus_tag LOCUS_00680 gene rpsO 21810 21535 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_00680 22680 21904 gene locus_tag LOCUS_00690 22680 21904 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110374.1 protein_id gnl|my_center|LOCUS_00690 23453 22683 gene locus_tag LOCUS_00700 23453 22683 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015775.1 protein_id gnl|my_center|LOCUS_00700 23747 23454 gene locus_tag LOCUS_00710 23747 23454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 >Feature sequence004 251 1270 gene locus_tag LOCUS_00720 251 1270 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785419.1 protein_id gnl|my_center|LOCUS_00720 1342 4677 gene locus_tag LOCUS_00730 1342 4677 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_00730 4683 6485 gene locus_tag LOCUS_00740 4683 6485 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_00740 6498 8435 gene locus_tag LOCUS_00750 6498 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8432 9610 gene locus_tag LOCUS_00760 8432 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9643 10878 gene locus_tag LOCUS_00770 9643 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11003 11140 gene locus_tag LOCUS_00780 11003 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 11160 13625 gene locus_tag LOCUS_00790 11160 13625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 13756 15549 gene locus_tag LOCUS_00800 13756 15549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 15865 18645 gene locus_tag LOCUS_00810 15865 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 18636 19466 gene locus_tag LOCUS_00820 18636 19466 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762343.1 protein_id gnl|my_center|LOCUS_00820 19463 20635 gene locus_tag LOCUS_00830 gene uxuA 19463 20635 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_00830 21135 20854 gene locus_tag LOCUS_00840 21135 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 21356 21120 gene locus_tag LOCUS_00850 21356 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence005 474 2939 gene locus_tag LOCUS_00860 474 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 2959 4020 gene locus_tag LOCUS_00870 2959 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 4033 7131 gene locus_tag LOCUS_00880 4033 7131 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_00880 7143 8666 gene locus_tag LOCUS_00890 7143 8666 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766182.1 protein_id gnl|my_center|LOCUS_00890 8656 11121 gene locus_tag LOCUS_00900 8656 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 11172 13571 gene locus_tag LOCUS_00910 11172 13571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 13580 13708 gene locus_tag LOCUS_00920 13580 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 13724 15733 gene locus_tag LOCUS_00930 13724 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 18891 15790 gene locus_tag LOCUS_00940 18891 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence006 1153 584 gene locus_tag LOCUS_00950 gene gmk 1153 584 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_00950 1247 2251 gene locus_tag LOCUS_00960 1247 2251 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_00960 2396 3349 gene locus_tag LOCUS_00970 gene corA 2396 3349 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_00970 3346 4479 gene locus_tag LOCUS_00980 3346 4479 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770127.1 protein_id gnl|my_center|LOCUS_00980 4509 5702 gene locus_tag LOCUS_00990 4509 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 6252 5692 gene locus_tag LOCUS_01000 6252 5692 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764711.1 protein_id gnl|my_center|LOCUS_01000 6866 6255 gene locus_tag LOCUS_01010 gene recR 6866 6255 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_01010 7531 6866 gene locus_tag LOCUS_01020 7531 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 7623 9425 gene locus_tag LOCUS_01030 gene rpsA 7623 9425 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_01030 9428 10231 gene locus_tag LOCUS_01040 gene rbn 9428 10231 CDS product ribonuclease BN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817396.1 protein_id gnl|my_center|LOCUS_01040 10261 11208 gene locus_tag LOCUS_01050 10261 11208 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_01050 11205 12209 gene locus_tag LOCUS_01060 gene mltG 11205 12209 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_01060 12254 15085 gene locus_tag LOCUS_01070 12254 15085 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_01070 15481 15089 gene locus_tag LOCUS_01080 15481 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 15760 16704 gene locus_tag LOCUS_01090 15760 16704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_01090 16768 16923 gene locus_tag LOCUS_01100 16768 16923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 >Feature sequence007 720 481 gene locus_tag LOCUS_01110 720 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1356 1745 gene locus_tag LOCUS_01120 1356 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1781 2233 gene locus_tag LOCUS_01130 1781 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2226 2561 gene locus_tag LOCUS_01140 2226 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4198 3017 gene locus_tag LOCUS_01150 4198 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 4402 7422 gene locus_tag LOCUS_01160 4402 7422 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_01160 7454 8590 gene locus_tag LOCUS_01170 7454 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 8598 10118 gene locus_tag LOCUS_01180 8598 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_01180 10172 10903 gene locus_tag LOCUS_01190 10172 10903 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_01190 11012 12688 gene locus_tag LOCUS_01200 11012 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 12693 14327 gene locus_tag LOCUS_01210 12693 14327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 14331 15800 gene locus_tag LOCUS_01220 14331 15800 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_01220 16476 15790 gene locus_tag LOCUS_01230 16476 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence008 512 3610 gene locus_tag LOCUS_01240 512 3610 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_01240 3626 5431 gene locus_tag LOCUS_01250 3626 5431 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_01250 5433 7055 gene locus_tag LOCUS_01260 5433 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7156 8337 gene locus_tag LOCUS_01270 7156 8337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8350 8469 gene locus_tag LOCUS_01280 8350 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8474 10387 gene locus_tag LOCUS_01290 8474 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 10401 12914 gene locus_tag LOCUS_01300 10401 12914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13089 15563 gene locus_tag LOCUS_01310 13089 15563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence009 94 1269 gene locus_tag LOCUS_01320 94 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 1256 2011 gene locus_tag LOCUS_01330 1256 2011 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_01330 2868 2026 gene locus_tag LOCUS_01340 2868 2026 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615561.1 protein_id gnl|my_center|LOCUS_01340 7446 2872 gene locus_tag LOCUS_01350 7446 2872 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_01350 7494 9731 gene locus_tag LOCUS_01360 gene pbpC 7494 9731 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_01360 9790 10248 gene locus_tag LOCUS_01370 9790 10248 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_01370 11498 10242 gene locus_tag LOCUS_01380 11498 10242 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_01380 13120 11498 gene locus_tag LOCUS_01390 13120 11498 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791282.1 protein_id gnl|my_center|LOCUS_01390 13757 13131 gene locus_tag LOCUS_01400 13757 13131 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_01400 13805 14725 gene locus_tag LOCUS_01410 13805 14725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 14725 15660 gene locus_tag LOCUS_01420 gene rsgA 14725 15660 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_01420 15920 16672 gene locus_tag LOCUS_01430 15920 16672 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence010 <1 1083 gene locus_tag LOCUS_01440 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082995.1:sn-glycerol-1-phosphate dehydrogenase 1087 2556 gene locus_tag LOCUS_01450 1087 2556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_01450 2570 4171 gene locus_tag LOCUS_01460 2570 4171 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_01460 5216 4179 gene locus_tag LOCUS_01470 gene asnA 5216 4179 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_01470 6334 5213 gene locus_tag LOCUS_01480 gene trpS 6334 5213 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_01480 8590 6338 gene locus_tag LOCUS_01490 8590 6338 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_01490 9820 8618 gene locus_tag LOCUS_01500 9820 8618 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_01500 10823 9813 gene locus_tag LOCUS_01510 10823 9813 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_01510 11747 11079 gene locus_tag LOCUS_01520 gene trmD 11747 11079 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_01520 11816 12568 gene locus_tag LOCUS_01530 11816 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12610 14439 gene locus_tag LOCUS_01540 12610 14439 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_01540 14436 16304 gene locus_tag LOCUS_01550 gene yidC 14436 16304 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_01550 >Feature sequence011 1112 609 gene locus_tag LOCUS_01560 1112 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 1927 1109 gene locus_tag LOCUS_01570 gene mreC 1927 1109 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_01570 2926 1928 gene locus_tag LOCUS_01580 2926 1928 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_01580 3041 3712 gene locus_tag LOCUS_01590 3041 3712 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_01590 3785 5113 gene locus_tag LOCUS_01600 3785 5113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_01600 5151 8177 gene locus_tag LOCUS_01610 5151 8177 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_01610 8191 9786 gene locus_tag LOCUS_01620 8191 9786 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_01620 9802 13938 gene locus_tag LOCUS_01630 9802 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 <15451 14045 gene locus_tag LOCUS_01640 <15451 14045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051743.1:ATP-binding protein >Feature sequence012 428 853 gene locus_tag LOCUS_01650 428 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 854 2194 gene locus_tag LOCUS_01660 854 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2172 2594 gene locus_tag LOCUS_01670 2172 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 6028 2807 gene locus_tag LOCUS_01680 6028 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 8478 6037 gene locus_tag LOCUS_01690 8478 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 10007 8478 gene locus_tag LOCUS_01700 10007 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 11172 10051 gene locus_tag LOCUS_01710 11172 10051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 12294 11200 gene locus_tag LOCUS_01720 12294 11200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13487 12390 gene locus_tag LOCUS_01730 13487 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 14586 13510 gene locus_tag LOCUS_01740 14586 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence013 1772 444 gene locus_tag LOCUS_01750 1772 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2841 1786 gene locus_tag LOCUS_01760 2841 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3050 2838 gene locus_tag LOCUS_01770 3050 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4267 3053 gene locus_tag LOCUS_01780 4267 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7737 4264 gene locus_tag LOCUS_01790 7737 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 8257 7742 gene locus_tag LOCUS_01800 8257 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 13398 8314 gene locus_tag LOCUS_01810 13398 8314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 13607 13419 gene locus_tag LOCUS_01820 13607 13419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 14200 13628 gene locus_tag LOCUS_01830 14200 13628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 14857 14279 gene locus_tag LOCUS_01840 14857 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 15258 14860 gene locus_tag LOCUS_01850 15258 14860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence014 469 2697 gene locus_tag LOCUS_01860 469 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2709 4622 gene locus_tag LOCUS_01870 2709 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 4622 6355 gene locus_tag LOCUS_01880 4622 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6357 9185 gene locus_tag LOCUS_01890 6357 9185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 9185 11458 gene locus_tag LOCUS_01900 9185 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 14439 11527 gene locus_tag LOCUS_01910 14439 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 14870 14439 gene locus_tag LOCUS_01920 14870 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence015 1446 1123 gene locus_tag LOCUS_01930 1446 1123 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_01930 2271 1480 gene locus_tag LOCUS_01940 2271 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3188 2268 gene locus_tag LOCUS_01950 gene trxB 3188 2268 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_01950 4353 3190 gene locus_tag LOCUS_01960 4353 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 5465 4350 gene locus_tag LOCUS_01970 5465 4350 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_01970 6088 5471 gene locus_tag LOCUS_01980 6088 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6850 6131 gene locus_tag LOCUS_01990 6850 6131 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_01990 6914 7726 gene locus_tag LOCUS_02000 6914 7726 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_02000 7729 8409 gene locus_tag LOCUS_02010 7729 8409 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_02010 8445 11036 gene locus_tag LOCUS_02020 8445 11036 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_02020 11047 11619 gene locus_tag LOCUS_02030 11047 11619 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784365.1 protein_id gnl|my_center|LOCUS_02030 11645 13483 gene locus_tag LOCUS_02040 11645 13483 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_02040 13486 14505 gene locus_tag LOCUS_02050 13486 14505 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_02050 >Feature sequence016 4063 350 gene locus_tag LOCUS_02060 4063 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4403 5218 gene locus_tag LOCUS_02070 4403 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6729 5773 gene locus_tag LOCUS_02080 6729 5773 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_02080 6915 8870 gene locus_tag LOCUS_02090 6915 8870 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053568.1 protein_id gnl|my_center|LOCUS_02090 8885 9778 gene locus_tag LOCUS_02100 8885 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 13161 9799 gene locus_tag LOCUS_02110 13161 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 13705 13499 gene locus_tag LOCUS_02120 13705 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 13777 14052 gene locus_tag LOCUS_02130 13777 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence017 289 948 gene locus_tag LOCUS_02140 289 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1362 1742 gene locus_tag LOCUS_02150 1362 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 1755 2102 gene locus_tag LOCUS_02160 1755 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2120 6016 gene locus_tag LOCUS_02170 2120 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6018 6188 gene locus_tag LOCUS_02180 6018 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6195 6668 gene locus_tag LOCUS_02190 6195 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6665 7288 gene locus_tag LOCUS_02200 6665 7288 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_02200 7285 7926 gene locus_tag LOCUS_02210 7285 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 8136 8309 gene locus_tag LOCUS_02220 8136 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 8323 8592 gene locus_tag LOCUS_02230 8323 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 9256 8648 gene locus_tag LOCUS_02240 9256 8648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 9551 9237 gene locus_tag LOCUS_02250 9551 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 9817 9551 gene locus_tag LOCUS_02260 9817 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10389 9814 gene locus_tag LOCUS_02270 10389 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202821.1 protein_id gnl|my_center|LOCUS_02270 10678 10457 gene locus_tag LOCUS_02280 10678 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10943 10671 gene locus_tag LOCUS_02290 10943 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 11420 10956 gene locus_tag LOCUS_02300 11420 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 12066 11560 gene locus_tag LOCUS_02310 12066 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12383 12048 gene locus_tag LOCUS_02320 12383 12048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 12914 12459 gene locus_tag LOCUS_02330 12914 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 13080 12898 gene locus_tag LOCUS_02340 13080 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 13332 13084 gene locus_tag LOCUS_02350 13332 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 13928 13329 gene locus_tag LOCUS_02360 13928 13329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 >Feature sequence018 2138 1443 gene locus_tag LOCUS_02370 2138 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4735 2312 gene locus_tag LOCUS_02380 4735 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5338 4745 gene locus_tag LOCUS_02390 5338 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 6198 5341 gene locus_tag LOCUS_02400 6198 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 7738 6206 gene locus_tag LOCUS_02410 7738 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 8830 7742 gene locus_tag LOCUS_02420 8830 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9915 8833 gene locus_tag LOCUS_02430 9915 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10390 9971 gene locus_tag LOCUS_02440 10390 9971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 11407 10424 gene locus_tag LOCUS_02450 11407 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12761 11439 gene locus_tag LOCUS_02460 12761 11439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13465 12758 gene locus_tag LOCUS_02470 13465 12758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence019 592 320 gene locus_tag LOCUS_02480 592 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 964 596 gene locus_tag LOCUS_02490 964 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1122 961 gene locus_tag LOCUS_02500 1122 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1363 1091 gene locus_tag LOCUS_02510 1363 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1649 1347 gene locus_tag LOCUS_02520 1649 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2037 1642 gene locus_tag LOCUS_02530 2037 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3033 2161 gene locus_tag LOCUS_02540 3033 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 3219 3037 gene locus_tag LOCUS_02550 3219 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3943 3209 gene locus_tag LOCUS_02560 3943 3209 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_02560 4286 3948 gene locus_tag LOCUS_02570 4286 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 4476 4249 gene locus_tag LOCUS_02580 4476 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6991 4898 gene locus_tag LOCUS_02590 6991 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7437 6988 gene locus_tag LOCUS_02600 7437 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7766 7443 gene locus_tag LOCUS_02610 7766 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8212 7778 gene locus_tag LOCUS_02620 8212 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8795 8286 gene locus_tag LOCUS_02630 8795 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9776 8817 gene locus_tag LOCUS_02640 9776 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 10646 9783 gene locus_tag LOCUS_02650 10646 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 11133 10888 gene locus_tag LOCUS_02660 11133 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 12174 11260 gene locus_tag LOCUS_02670 12174 11260 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268012.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02670 >Feature sequence020 2832 595 gene locus_tag LOCUS_02680 2832 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5301 2890 gene locus_tag LOCUS_02690 5301 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5436 5314 gene locus_tag LOCUS_02700 5436 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6333 5449 gene locus_tag LOCUS_02710 6333 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 7451 6345 gene locus_tag LOCUS_02720 7451 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11146 7505 gene locus_tag LOCUS_02730 11146 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 12521 11184 gene locus_tag LOCUS_02740 12521 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 12769 12518 gene locus_tag LOCUS_02750 12769 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence021 4627 1259 gene locus_tag LOCUS_02760 4627 1259 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798139.1 protein_id gnl|my_center|LOCUS_02760 5016 7763 gene locus_tag LOCUS_02770 5016 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7870 9987 gene locus_tag LOCUS_02780 7870 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 10781 9978 gene locus_tag LOCUS_02790 10781 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 10848 11960 gene locus_tag LOCUS_02800 10848 11960 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_02800 <12525 12012 gene locus_tag LOCUS_02810 <12525 12012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765197.1:polyribonucleotide nucleotidyltransferase >Feature sequence022 1887 1189 gene locus_tag LOCUS_02820 1887 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2560 1916 gene locus_tag LOCUS_02830 2560 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2875 2681 gene locus_tag LOCUS_02840 2875 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 2933 4573 gene locus_tag LOCUS_02850 2933 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4586 6097 gene locus_tag LOCUS_02860 4586 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 6104 6883 gene locus_tag LOCUS_02870 6104 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 7043 6843 gene locus_tag LOCUS_02880 7043 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 7501 7043 gene locus_tag LOCUS_02890 7501 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 7724 7506 gene locus_tag LOCUS_02900 7724 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9176 7833 gene locus_tag LOCUS_02910 9176 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9531 9169 gene locus_tag LOCUS_02920 9531 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 9868 9554 gene locus_tag LOCUS_02930 9868 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 11077 10487 gene locus_tag LOCUS_02940 11077 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11269 11625 gene locus_tag LOCUS_02950 11269 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 11707 11949 gene locus_tag LOCUS_02960 11707 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence023 815 540 gene locus_tag LOCUS_02970 815 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2109 886 gene locus_tag LOCUS_02980 2109 886 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_02980 3192 2113 gene locus_tag LOCUS_02990 3192 2113 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_02990 3878 3189 gene locus_tag LOCUS_03000 3878 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 4624 3869 gene locus_tag LOCUS_03010 4624 3869 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_03010 5672 4626 gene locus_tag LOCUS_03020 5672 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 5809 6570 gene locus_tag LOCUS_03030 5809 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 8737 6548 gene locus_tag LOCUS_03040 8737 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10761 8740 gene locus_tag LOCUS_03050 10761 8740 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107278.1 protein_id gnl|my_center|LOCUS_03050 <12268 10761 gene locus_tag LOCUS_03060 <12268 10761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054959197.1:phosphodiester glycosidase family protein >Feature sequence024 756 2504 gene locus_tag LOCUS_03070 756 2504 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_03070 2504 2911 gene locus_tag LOCUS_03080 2504 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2904 3674 gene locus_tag LOCUS_03090 2904 3674 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_03090 3671 4435 gene locus_tag LOCUS_03100 3671 4435 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_03100 4432 5232 gene locus_tag LOCUS_03110 4432 5232 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767685.1 protein_id gnl|my_center|LOCUS_03110 6525 5236 gene locus_tag LOCUS_03120 6525 5236 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_03120 6556 7647 gene locus_tag LOCUS_03130 6556 7647 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_03130 8282 7644 gene locus_tag LOCUS_03140 8282 7644 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813856.1 protein_id gnl|my_center|LOCUS_03140 8754 8287 gene locus_tag LOCUS_03150 gene queF 8754 8287 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_03150 9173 8757 gene locus_tag LOCUS_03160 9173 8757 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_03160 10160 9177 gene locus_tag LOCUS_03170 10160 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 10633 10166 gene locus_tag LOCUS_03180 10633 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 <12251 10716 gene locus_tag LOCUS_03190 <12251 10716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005680415.1:cytochrome c biogenesis protein CcsA >Feature sequence025 1718 561 gene locus_tag LOCUS_03200 1718 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 1904 2992 gene locus_tag LOCUS_03210 1904 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2989 4347 gene locus_tag LOCUS_03220 2989 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 4344 4724 gene locus_tag LOCUS_03230 4344 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 6457 4721 gene locus_tag LOCUS_03240 6457 4721 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_03240 7389 6457 gene locus_tag LOCUS_03250 7389 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 7452 8915 gene locus_tag LOCUS_03260 gene aspA 7452 8915 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791488.1 protein_id gnl|my_center|LOCUS_03260 8963 11488 gene locus_tag LOCUS_03270 8963 11488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 11485 12072 gene locus_tag LOCUS_03280 11485 12072 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence026 1274 432 gene locus_tag LOCUS_03290 1274 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3064 1271 gene locus_tag LOCUS_03300 3064 1271 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_03300 4764 3061 gene locus_tag LOCUS_03310 4764 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5696 4761 gene locus_tag LOCUS_03320 5696 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 7773 5701 gene locus_tag LOCUS_03330 gene ligA 7773 5701 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_03330 7911 9401 gene locus_tag LOCUS_03340 7911 9401 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_03340 9398 9640 gene locus_tag LOCUS_03350 9398 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 10940 9711 gene locus_tag LOCUS_03360 gene pfp 10940 9711 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_03360 11049 12167 gene locus_tag LOCUS_03370 11049 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence027 3179 2139 gene locus_tag LOCUS_03380 3179 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4774 3176 gene locus_tag LOCUS_03390 4774 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 6737 4800 gene locus_tag LOCUS_03400 6737 4800 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764446.1 protein_id gnl|my_center|LOCUS_03400 10124 6744 gene locus_tag LOCUS_03410 10124 6744 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764447.1 protein_id gnl|my_center|LOCUS_03410 11254 10130 gene locus_tag LOCUS_03420 11254 10130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 <11946 11295 gene locus_tag LOCUS_03430 <11946 11295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203441.1:RNA polymerase sigma-70 factor >Feature sequence028 <1 1395 gene locus_tag LOCUS_03440 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108912.1:fimbrillin family protein 2935 1448 gene locus_tag LOCUS_03450 2935 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4176 2968 gene locus_tag LOCUS_03460 4176 2968 CDS product DUF4876 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004312956.1 protein_id gnl|my_center|LOCUS_03460 6977 4173 gene locus_tag LOCUS_03470 6977 4173 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005829323.1 protein_id gnl|my_center|LOCUS_03470 9054 6961 gene locus_tag LOCUS_03480 9054 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311265.1 protein_id gnl|my_center|LOCUS_03480 11435 9051 gene locus_tag LOCUS_03490 11435 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11586 11464 gene locus_tag LOCUS_03500 11586 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence029 1629 1051 gene locus_tag LOCUS_03510 1629 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1994 1656 gene locus_tag LOCUS_03520 1994 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4980 2017 gene locus_tag LOCUS_03530 4980 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 5473 5141 gene locus_tag LOCUS_03540 5473 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 5742 7403 gene locus_tag LOCUS_03550 5742 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 8885 7404 gene locus_tag LOCUS_03560 8885 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 10544 8907 gene locus_tag LOCUS_03570 10544 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 11533 10559 gene locus_tag LOCUS_03580 11533 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence030 410 1687 gene locus_tag LOCUS_03590 410 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1690 3231 gene locus_tag LOCUS_03600 1690 3231 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234705053.1 protein_id gnl|my_center|LOCUS_03600 4052 3273 gene locus_tag LOCUS_03610 gene nagB 4052 3273 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237064.1 protein_id gnl|my_center|LOCUS_03610 5990 4056 gene locus_tag LOCUS_03620 5990 4056 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766195.1 protein_id gnl|my_center|LOCUS_03620 7771 6002 gene locus_tag LOCUS_03630 gene mtlA 7771 6002 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093287.1 protein_id gnl|my_center|LOCUS_03630 7835 8983 gene locus_tag LOCUS_03640 7835 8983 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861528.1 protein_id gnl|my_center|LOCUS_03640 9790 8984 gene locus_tag LOCUS_03650 9790 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11049 9871 gene locus_tag LOCUS_03660 11049 9871 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_03660 <11686 11079 gene locus_tag LOCUS_03670 <11686 11079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103365.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence031 2045 192 gene locus_tag LOCUS_03680 2045 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2103 3731 gene locus_tag LOCUS_03690 2103 3731 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853666.1 protein_id gnl|my_center|LOCUS_03690 3731 5044 gene locus_tag LOCUS_03700 3731 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 5049 6260 gene locus_tag LOCUS_03710 5049 6260 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_03710 6257 6919 gene locus_tag LOCUS_03720 gene tsaA 6257 6919 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03720 6922 8115 gene locus_tag LOCUS_03730 6922 8115 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109296.1 protein_id gnl|my_center|LOCUS_03730 8563 8108 gene locus_tag LOCUS_03740 8563 8108 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026616068.1 protein_id gnl|my_center|LOCUS_03740 9018 8566 gene locus_tag LOCUS_03750 9018 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9878 9021 gene locus_tag LOCUS_03760 9878 9021 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_03760 10142 10783 gene locus_tag LOCUS_03770 gene rpe 10142 10783 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence032 2182 1322 gene locus_tag LOCUS_03780 2182 1322 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_03780 3704 2283 gene locus_tag LOCUS_03790 3704 2283 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_03790 3810 4928 gene locus_tag LOCUS_03800 gene dnaN 3810 4928 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_03800 4933 5766 gene locus_tag LOCUS_03810 4933 5766 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_03810 5770 7185 gene locus_tag LOCUS_03820 gene nhaA 5770 7185 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_03820 7190 7873 gene locus_tag LOCUS_03830 7190 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 8063 7990 gene locus_tag LOCUS_t00010 8063 7990 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8845 8117 gene locus_tag LOCUS_03840 8845 8117 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_03840 8879 9307 gene locus_tag LOCUS_03850 8879 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 9285 11045 gene locus_tag LOCUS_03860 9285 11045 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_03860 <11609 11042 gene locus_tag LOCUS_03870 <11609 11042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072067041.1:Tex family protein >Feature sequence033 251 1270 gene locus_tag LOCUS_03880 251 1270 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785419.1 protein_id gnl|my_center|LOCUS_03880 1457 3205 gene locus_tag LOCUS_03890 1457 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3375 5183 gene locus_tag LOCUS_03900 3375 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 5214 8579 gene locus_tag LOCUS_03910 5214 8579 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_03910 8592 10391 gene locus_tag LOCUS_03920 8592 10391 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681494.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence034 1615 332 gene locus_tag LOCUS_03930 gene rimO 1615 332 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_03930 2573 1599 gene locus_tag LOCUS_03940 2573 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3499 2570 gene locus_tag LOCUS_03950 3499 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3865 3500 gene locus_tag LOCUS_03960 gene yajC 3865 3500 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_03960 4792 3872 gene locus_tag LOCUS_03970 gene nusB 4792 3872 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_03970 4884 5201 gene locus_tag LOCUS_03980 4884 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5205 6473 gene locus_tag LOCUS_03990 5205 6473 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_03990 6478 7305 gene locus_tag LOCUS_04000 6478 7305 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_04000 7637 8383 gene locus_tag LOCUS_04010 7637 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 8484 9335 gene locus_tag LOCUS_04020 8484 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 <11232 9742 gene locus_tag LOCUS_04030 <11232 9742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202946.1:excinuclease ABC subunit UvrB >Feature sequence035 28 447 gene locus_tag LOCUS_04040 gene rplP 28 447 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_04040 466 660 gene locus_tag LOCUS_04050 gene rpmC 466 660 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_04050 672 926 gene locus_tag LOCUS_04060 gene rpsQ 672 926 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_04060 929 1294 gene locus_tag LOCUS_04070 gene rplN 929 1294 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_04070 1307 1618 gene locus_tag LOCUS_04080 gene rplX 1307 1618 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_04080 1621 2217 gene locus_tag LOCUS_04090 gene rplE 1621 2217 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_04090 2224 2493 gene locus_tag LOCUS_04100 gene rpsN 2224 2493 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_04100 2513 2908 gene locus_tag LOCUS_04110 gene rpsH 2513 2908 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_04110 2929 3489 gene locus_tag LOCUS_04120 gene rplF 2929 3489 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_04120 3505 3867 gene locus_tag LOCUS_04130 gene rplR 3505 3867 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_04130 3879 4397 gene locus_tag LOCUS_04140 gene rpsE 3879 4397 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_04140 4410 4592 gene locus_tag LOCUS_04150 4410 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4607 5056 gene locus_tag LOCUS_04160 gene rplO 4607 5056 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_04160 5062 6399 gene locus_tag LOCUS_04170 gene secY 5062 6399 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_04170 6423 7202 gene locus_tag LOCUS_04180 gene map 6423 7202 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_04180 7215 7433 gene locus_tag LOCUS_04190 gene infA 7215 7433 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_04190 7595 7972 gene locus_tag LOCUS_04200 gene rpsM 7595 7972 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_04200 7984 8370 gene locus_tag LOCUS_04210 gene rpsK 7984 8370 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_04210 8390 8992 gene locus_tag LOCUS_04220 gene rpsD 8390 8992 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_04220 9016 10026 gene locus_tag LOCUS_04230 9016 10026 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_04230 10029 10511 gene locus_tag LOCUS_04240 gene rplQ 10029 10511 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence036 1161 319 gene locus_tag LOCUS_04250 1161 319 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978652.1 protein_id gnl|my_center|LOCUS_04250 3344 1167 gene locus_tag LOCUS_04260 3344 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 5350 3341 gene locus_tag LOCUS_04270 5350 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6896 5385 gene locus_tag LOCUS_04280 gene nanU 6896 5385 CDS product SusD family outer membrane lipoprotein NanU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795011.1 protein_id gnl|my_center|LOCUS_04280 10466 6909 gene locus_tag LOCUS_04290 10466 6909 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202528.1 protein_id gnl|my_center|LOCUS_04290 <11170 10479 gene locus_tag LOCUS_04300 <11170 10479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766892.1:FecR family protein >Feature sequence037 1852 827 gene locus_tag LOCUS_04310 1852 827 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_04310 3223 1859 gene locus_tag LOCUS_04320 3223 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4941 3223 gene locus_tag LOCUS_04330 4941 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 6787 4964 gene locus_tag LOCUS_04340 6787 4964 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_04340 10097 6789 gene locus_tag LOCUS_04350 10097 6789 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence038 2271 403 gene locus_tag LOCUS_04360 2271 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4037 2268 gene locus_tag LOCUS_04370 4037 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5652 4222 gene locus_tag LOCUS_04380 5652 4222 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_04380 6734 5658 gene locus_tag LOCUS_04390 6734 5658 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814336.1 protein_id gnl|my_center|LOCUS_04390 8474 6747 gene locus_tag LOCUS_04400 8474 6747 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_04400 8508 8912 gene locus_tag LOCUS_04410 8508 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 8915 9952 gene locus_tag LOCUS_04420 gene pheS 8915 9952 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence039 970 236 gene locus_tag LOCUS_04430 gene fabG 970 236 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_04430 2391 976 gene locus_tag LOCUS_04440 2391 976 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839227.1 protein_id gnl|my_center|LOCUS_04440 3551 2388 gene locus_tag LOCUS_04450 3551 2388 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_04450 4638 3553 gene locus_tag LOCUS_04460 4638 3553 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_04460 7106 4635 gene locus_tag LOCUS_04470 7106 4635 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_04470 7872 7096 gene locus_tag LOCUS_04480 gene cdaA 7872 7096 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_04480 8895 7894 gene locus_tag LOCUS_04490 gene murB 8895 7894 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_04490 <10631 8909 gene locus_tag LOCUS_04500 <10631 8909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263541.1:ATP-grasp domain-containing protein >Feature sequence040 92 1420 gene locus_tag LOCUS_04510 92 1420 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_04510 2359 1553 gene locus_tag LOCUS_04520 gene truA 2359 1553 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_04520 2495 3487 gene locus_tag LOCUS_04530 2495 3487 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_04530 3487 4371 gene locus_tag LOCUS_04540 3487 4371 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_04540 4368 5363 gene locus_tag LOCUS_04550 4368 5363 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_04550 5363 6346 gene locus_tag LOCUS_04560 5363 6346 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_04560 6346 7347 gene locus_tag LOCUS_04570 6346 7347 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_04570 7344 8078 gene locus_tag LOCUS_04580 7344 8078 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence041 1050 1874 gene locus_tag LOCUS_04590 1050 1874 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_04590 1887 3368 gene locus_tag LOCUS_04600 1887 3368 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_04600 3372 4928 gene locus_tag LOCUS_04610 3372 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5441 5001 gene locus_tag LOCUS_04620 gene rplI 5441 5001 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933786.1 protein_id gnl|my_center|LOCUS_04620 5724 5452 gene locus_tag LOCUS_04630 gene rpsR 5724 5452 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_04630 6135 5728 gene locus_tag LOCUS_04640 gene rpsF 6135 5728 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_04640 6261 6959 gene locus_tag LOCUS_04650 6261 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6963 8033 gene locus_tag LOCUS_04660 6963 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 8037 9056 gene locus_tag LOCUS_04670 8037 9056 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_04670 9049 9375 gene locus_tag LOCUS_04680 9049 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence042 494 4000 gene locus_tag LOCUS_04690 494 4000 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_04690 4006 5832 gene locus_tag LOCUS_04700 4006 5832 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_04700 5848 7605 gene locus_tag LOCUS_04710 5848 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 7607 8854 gene locus_tag LOCUS_04720 7607 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 8872 10011 gene locus_tag LOCUS_04730 8872 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence043 747 3401 gene locus_tag LOCUS_04740 747 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4611 3388 gene locus_tag LOCUS_04750 4611 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 5471 4608 gene locus_tag LOCUS_04760 5471 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 5581 5991 gene locus_tag LOCUS_04770 5581 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 7301 5988 gene locus_tag LOCUS_04780 7301 5988 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_04780 7341 7760 gene locus_tag LOCUS_04790 gene umuD 7341 7760 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_04790 7764 9029 gene locus_tag LOCUS_04800 7764 9029 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence044 <1 1734 gene locus_tag LOCUS_04810 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202133.1:alpha-2-macroglobulin family protein 1752 2789 gene locus_tag LOCUS_04820 1752 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2796 4169 gene locus_tag LOCUS_04830 2796 4169 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_04830 4246 6966 gene locus_tag LOCUS_04840 gene ppdK 4246 6966 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_04840 7093 7494 gene locus_tag LOCUS_04850 7093 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7513 8730 gene locus_tag LOCUS_04860 7513 8730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991765.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence045 349 2310 gene locus_tag LOCUS_04870 349 2310 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_04870 2353 5643 gene locus_tag LOCUS_04880 2353 5643 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039975.1 protein_id gnl|my_center|LOCUS_04880 5655 7520 gene locus_tag LOCUS_04890 5655 7520 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_04890 7527 9776 gene locus_tag LOCUS_04900 7527 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence046 1540 470 gene locus_tag LOCUS_04910 1540 470 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704481.1 protein_id gnl|my_center|LOCUS_04910 2631 1537 gene locus_tag LOCUS_04920 2631 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3581 2628 gene locus_tag LOCUS_04930 3581 2628 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_04930 4650 3571 gene locus_tag LOCUS_04940 gene gmd 4650 3571 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_04940 6125 4659 gene locus_tag LOCUS_04950 6125 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 6907 6158 gene locus_tag LOCUS_04960 6907 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 7896 6904 gene locus_tag LOCUS_04970 7896 6904 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403392.1 protein_id gnl|my_center|LOCUS_04970 8633 7896 gene locus_tag LOCUS_04980 8633 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9160 8921 gene locus_tag LOCUS_04990 9160 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9224 9454 gene locus_tag LOCUS_05000 9224 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence047 1261 125 gene locus_tag LOCUS_05010 gene rfbB 1261 125 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_05010 2140 1262 gene locus_tag LOCUS_05020 gene rfbA 2140 1262 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_05020 3003 2137 gene locus_tag LOCUS_05030 gene rfbD 3003 2137 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_05030 3512 3000 gene locus_tag LOCUS_05040 3512 3000 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107226.1 protein_id gnl|my_center|LOCUS_05040 5923 3524 gene locus_tag LOCUS_05050 5923 3524 CDS product tyrosine-protein kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765281.1 protein_id gnl|my_center|LOCUS_05050 6712 5930 gene locus_tag LOCUS_05060 6712 5930 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107248.1 protein_id gnl|my_center|LOCUS_05060 8234 6819 gene locus_tag LOCUS_05070 8234 6819 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_05070 8360 9526 gene locus_tag LOCUS_05080 8360 9526 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence048 3003 1321 gene locus_tag LOCUS_05090 3003 1321 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_05090 4093 3050 gene locus_tag LOCUS_05100 gene holA 4093 3050 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_05100 4672 4097 gene locus_tag LOCUS_05110 4672 4097 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_05110 5211 4669 gene locus_tag LOCUS_05120 gene hpt 5211 4669 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_05120 5442 5215 gene locus_tag LOCUS_05130 gene acpP 5442 5215 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_05130 6470 5451 gene locus_tag LOCUS_05140 gene plsX 6470 5451 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_05140 7588 6467 gene locus_tag LOCUS_05150 7588 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_05150 8462 7596 gene locus_tag LOCUS_05160 8462 7596 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084954.1 protein_id gnl|my_center|LOCUS_05160 <9763 8459 gene locus_tag LOCUS_05170 <9763 8459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245033.1:DAK2 domain-containing protein >Feature sequence049 939 88 gene locus_tag LOCUS_05180 939 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3506 936 gene locus_tag LOCUS_05190 3506 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4212 3520 gene locus_tag LOCUS_05200 4212 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5183 4281 gene locus_tag LOCUS_05210 5183 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6702 5203 gene locus_tag LOCUS_05220 6702 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 9723 6715 gene locus_tag LOCUS_05230 9723 6715 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence050 3090 2689 gene locus_tag LOCUS_05240 3090 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 4922 3087 gene locus_tag LOCUS_05250 4922 3087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_05250 6002 4926 gene locus_tag LOCUS_05260 6002 4926 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_05260 6656 6006 gene locus_tag LOCUS_05270 6656 6006 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109354.1 protein_id gnl|my_center|LOCUS_05270 8119 6662 gene locus_tag LOCUS_05280 8119 6662 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840087.1 protein_id gnl|my_center|LOCUS_05280 9280 8123 gene locus_tag LOCUS_05290 gene lysA 9280 8123 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_05290 9659 9303 gene locus_tag LOCUS_05300 9659 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence051 276 205 gene locus_tag LOCUS_t00020 276 205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 303 2708 gene locus_tag LOCUS_05310 303 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2705 3472 gene locus_tag LOCUS_05320 2705 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4342 3458 gene locus_tag LOCUS_05330 4342 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5207 4332 gene locus_tag LOCUS_05340 5207 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5294 8575 gene locus_tag LOCUS_05350 gene secA 5294 8575 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_05350 8556 8990 gene locus_tag LOCUS_05360 8556 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 9332 8967 gene locus_tag LOCUS_05370 9332 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence052 <1 1359 gene locus_tag LOCUS_05380 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein 1356 2252 gene locus_tag LOCUS_05390 1356 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2512 5043 gene locus_tag LOCUS_05400 2512 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5193 7292 gene locus_tag LOCUS_05410 5193 7292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 7396 8937 gene locus_tag LOCUS_05420 7396 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence053 <1 1006 gene locus_tag LOCUS_05430 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000117561.1:phage minor head protein 1828 1142 gene locus_tag LOCUS_05440 1828 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 3026 2508 gene locus_tag LOCUS_05450 3026 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3580 3023 gene locus_tag LOCUS_05460 3580 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3794 3567 gene locus_tag LOCUS_05470 3794 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4448 3798 gene locus_tag LOCUS_05480 4448 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 4788 4561 gene locus_tag LOCUS_05490 4788 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5260 4790 gene locus_tag LOCUS_05500 5260 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 5897 5262 gene locus_tag LOCUS_05510 5897 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 6796 5912 gene locus_tag LOCUS_05520 6796 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8733 6817 gene locus_tag LOCUS_05530 8733 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence054 1713 1306 gene locus_tag LOCUS_05540 1713 1306 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016387.1 protein_id gnl|my_center|LOCUS_05540 5569 1703 gene locus_tag LOCUS_05550 5569 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5657 6814 gene locus_tag LOCUS_05560 gene pseC 5657 6814 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_05560 6811 7650 gene locus_tag LOCUS_05570 6811 7650 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_05570 7647 8420 gene locus_tag LOCUS_05580 7647 8420 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence055 319 1395 gene locus_tag LOCUS_05590 319 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1675 1941 gene locus_tag LOCUS_05600 1675 1941 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203578.1 protein_id gnl|my_center|LOCUS_05600 1945 2310 gene locus_tag LOCUS_05610 1945 2310 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_05610 2756 3154 gene locus_tag LOCUS_05620 2756 3154 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793630.1 protein_id gnl|my_center|LOCUS_05620 3425 4591 gene locus_tag LOCUS_05630 3425 4591 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202736.1 protein_id gnl|my_center|LOCUS_05630 4798 4637 gene locus_tag LOCUS_05640 4798 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5551 4910 gene locus_tag LOCUS_05650 5551 4910 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_05650 6206 5535 gene locus_tag LOCUS_05660 6206 5535 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_05660 6301 6549 gene locus_tag LOCUS_05670 6301 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6546 6788 gene locus_tag LOCUS_05680 6546 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 6917 7180 gene locus_tag LOCUS_05690 6917 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7187 7537 gene locus_tag LOCUS_05700 7187 7537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8771 7545 gene locus_tag LOCUS_05710 8771 7545 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence056 <1 565 gene locus_tag LOCUS_05720 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202859.1:molecular chaperone HtpG 683 1258 gene locus_tag LOCUS_05730 683 1258 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_05730 1261 1863 gene locus_tag LOCUS_05740 gene pth 1261 1863 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_05740 1963 2139 gene locus_tag LOCUS_05750 1963 2139 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_05750 2272 3996 gene locus_tag LOCUS_05760 2272 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3993 4403 gene locus_tag LOCUS_05770 3993 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 5150 4395 gene locus_tag LOCUS_05780 gene tpiA 5150 4395 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_05780 5238 6530 gene locus_tag LOCUS_05790 gene tyrS 5238 6530 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_05790 6523 6876 gene locus_tag LOCUS_05800 gene rbfA 6523 6876 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_05800 6873 8072 gene locus_tag LOCUS_05810 6873 8072 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_05810 9051 8059 gene locus_tag LOCUS_05820 9051 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence057 73 681 gene locus_tag LOCUS_05830 73 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 987 697 gene locus_tag LOCUS_05840 987 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2859 994 gene locus_tag LOCUS_05850 2859 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2913 4100 gene locus_tag LOCUS_05860 2913 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5714 4014 gene locus_tag LOCUS_05870 5714 4014 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_05870 6145 5711 gene locus_tag LOCUS_05880 6145 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6888 6142 gene locus_tag LOCUS_05890 6888 6142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_05890 <9063 6895 gene locus_tag LOCUS_05900 <9063 6895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108148.1:putative LPS assembly protein LptD >Feature sequence058 <1 1320 gene locus_tag LOCUS_05910 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109110.1:pectate lyase 1358 4603 gene locus_tag LOCUS_05920 1358 4603 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_05920 4616 6448 gene locus_tag LOCUS_05930 4616 6448 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence059 <1 894 gene locus_tag LOCUS_05940 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943812.1:thiamine-phosphate kinase 1691 891 gene locus_tag LOCUS_05950 1691 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1769 2308 gene locus_tag LOCUS_05960 1769 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3983 2376 gene locus_tag LOCUS_05970 3983 2376 CDS product putative Ig domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797457.1 protein_id gnl|my_center|LOCUS_05970 4084 5340 gene locus_tag LOCUS_05980 gene galK 4084 5340 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049364.1 protein_id gnl|my_center|LOCUS_05980 5337 6260 gene locus_tag LOCUS_05990 5337 6260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 6257 7285 gene locus_tag LOCUS_06000 6257 7285 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203518.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence060 3030 2848 gene locus_tag LOCUS_06010 3030 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3148 3002 gene locus_tag LOCUS_06020 3148 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4296 3226 gene locus_tag LOCUS_06030 4296 3226 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474082.1 protein_id gnl|my_center|LOCUS_06030 4387 5142 gene locus_tag LOCUS_06040 4387 5142 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972695.1 protein_id gnl|my_center|LOCUS_06040 5181 6401 gene locus_tag LOCUS_06050 5181 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6404 7462 gene locus_tag LOCUS_06060 6404 7462 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_06060 7459 8865 gene locus_tag LOCUS_06070 gene gnd 7459 8865 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263332.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence061 360 598 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgctgttgccgccctgaggaggccg 1908 994 gene locus_tag LOCUS_06080 1908 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 2023 5091 gene locus_tag LOCUS_06090 2023 5091 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_06090 5104 7134 gene locus_tag LOCUS_06100 5104 7134 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_06100 7124 8482 gene locus_tag LOCUS_06110 7124 8482 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence062 369 929 gene locus_tag LOCUS_06120 369 929 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_06120 926 2092 gene locus_tag LOCUS_06130 926 2092 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_06130 2147 2623 gene locus_tag LOCUS_06140 2147 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3660 3085 gene locus_tag LOCUS_06150 3660 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4716 3691 gene locus_tag LOCUS_06160 4716 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 4869 5630 gene locus_tag LOCUS_06170 4869 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5683 8046 gene locus_tag LOCUS_06180 gene feoB 5683 8046 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence063 1881 958 gene locus_tag LOCUS_06190 1881 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3284 1878 gene locus_tag LOCUS_06200 3284 1878 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771251.1 protein_id gnl|my_center|LOCUS_06200 4605 3262 gene locus_tag LOCUS_06210 4605 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 5714 4602 gene locus_tag LOCUS_06220 5714 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 8326 5720 gene locus_tag LOCUS_06230 8326 5720 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence064 21 980 gene locus_tag LOCUS_06240 21 980 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_06240 982 2274 gene locus_tag LOCUS_06250 982 2274 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_06250 2873 2271 gene locus_tag LOCUS_06260 2873 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3400 2873 gene locus_tag LOCUS_06270 3400 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3525 4661 gene locus_tag LOCUS_06280 3525 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_06280 4716 5966 gene locus_tag LOCUS_06290 4716 5966 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_06290 5963 7216 gene locus_tag LOCUS_06300 5963 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 7226 7771 gene locus_tag LOCUS_06310 gene rfbC 7226 7771 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_06310 8427 7768 gene locus_tag LOCUS_06320 8427 7768 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence065 2147 60 gene locus_tag LOCUS_06330 2147 60 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_06330 2805 2197 gene locus_tag LOCUS_06340 2805 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4175 2835 gene locus_tag LOCUS_06350 4175 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5478 4186 gene locus_tag LOCUS_06360 5478 4186 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_06360 6199 5483 gene locus_tag LOCUS_06370 6199 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 <8483 6248 gene locus_tag LOCUS_06380 <8483 6248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766199.1:transcription-repair coupling factor >Feature sequence066 262 906 gene locus_tag LOCUS_06390 262 906 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081900.1 protein_id gnl|my_center|LOCUS_06390 909 2576 gene locus_tag LOCUS_06400 909 2576 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_06400 3625 2573 gene locus_tag LOCUS_06410 3625 2573 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_06410 3781 5229 gene locus_tag LOCUS_06420 3781 5229 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_06420 5226 6908 gene locus_tag LOCUS_06430 5226 6908 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474328.1 protein_id gnl|my_center|LOCUS_06430 6905 8074 gene locus_tag LOCUS_06440 6905 8074 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760990.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence067 977 63 gene locus_tag LOCUS_06450 977 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2806 989 gene locus_tag LOCUS_06460 2806 989 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_06460 3540 2803 gene locus_tag LOCUS_06470 gene nadE 3540 2803 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_06470 3682 4278 gene locus_tag LOCUS_06480 gene rplC 3682 4278 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_06480 4283 4906 gene locus_tag LOCUS_06490 gene rplD 4283 4906 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_06490 4918 5208 gene locus_tag LOCUS_06500 gene rplW 4918 5208 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_06500 5223 6047 gene locus_tag LOCUS_06510 gene rplB 5223 6047 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_06510 6071 6343 gene locus_tag LOCUS_06520 gene rpsS 6071 6343 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_06520 6349 6765 gene locus_tag LOCUS_06530 gene rplV 6349 6765 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_06530 6767 7522 gene locus_tag LOCUS_06540 gene rpsC 6767 7522 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_06540 8018 7593 gene locus_tag LOCUS_06550 gene tsaE 8018 7593 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence068 1751 660 gene locus_tag LOCUS_06560 gene pdxA 1751 660 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_06560 2210 1758 gene locus_tag LOCUS_06570 gene rnhA 2210 1758 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_06570 2643 2200 gene locus_tag LOCUS_06580 2643 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5149 2645 gene locus_tag LOCUS_06590 5149 2645 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_06590 6078 5071 gene locus_tag LOCUS_06600 gene rlmN 6078 5071 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_06600 6151 7179 gene locus_tag LOCUS_06610 gene recA 6151 7179 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence069 1042 263 gene locus_tag LOCUS_06620 gene argB 1042 263 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_06620 2001 1039 gene locus_tag LOCUS_06630 2001 1039 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_06630 3119 1998 gene locus_tag LOCUS_06640 3119 1998 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_06640 4083 3121 gene locus_tag LOCUS_06650 gene argC 4083 3121 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_06650 5282 4083 gene locus_tag LOCUS_06660 5282 4083 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_06660 5848 5285 gene locus_tag LOCUS_06670 5848 5285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_06670 8102 6081 gene locus_tag LOCUS_06680 8102 6081 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence070 1224 406 gene locus_tag LOCUS_06690 1224 406 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_06690 1299 2399 gene locus_tag LOCUS_06700 gene ychF 1299 2399 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_06700 2412 3554 gene locus_tag LOCUS_06710 gene galK 2412 3554 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_06710 3558 6500 gene locus_tag LOCUS_06720 3558 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_06720 6504 7544 gene locus_tag LOCUS_06730 6504 7544 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence071 4049 3672 gene locus_tag LOCUS_06740 gene rplL 4049 3672 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_06740 4688 4083 gene locus_tag LOCUS_06750 gene rplJ 4688 4083 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963314.1 protein_id gnl|my_center|LOCUS_06750 5405 4701 gene locus_tag LOCUS_06760 gene rplA 5405 4701 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_06760 5861 5418 gene locus_tag LOCUS_06770 gene rplK 5861 5418 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_06770 6437 5871 gene locus_tag LOCUS_06780 gene nusG 6437 5871 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_06780 6639 6451 gene locus_tag LOCUS_06790 6639 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 6794 6721 gene locus_tag LOCUS_t00030 6794 6721 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <7989 6844 gene locus_tag LOCUS_06800 <7989 6844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762026.1:elongation factor Tu >Feature sequence072 2602 3627 gene locus_tag LOCUS_06810 2602 3627 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658101.1 protein_id gnl|my_center|LOCUS_06810 3740 6148 gene locus_tag LOCUS_06820 3740 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 7680 6145 gene locus_tag LOCUS_06830 7680 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence073 1284 793 gene locus_tag LOCUS_06840 1284 793 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005928359.1 protein_id gnl|my_center|LOCUS_06840 3600 1288 gene locus_tag LOCUS_06850 gene topA 3600 1288 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_06850 3688 6039 gene locus_tag LOCUS_06860 3688 6039 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_06860 6042 7052 gene locus_tag LOCUS_06870 6042 7052 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence074 425 249 gene locus_tag LOCUS_06880 425 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3299 438 gene locus_tag LOCUS_06890 3299 438 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_06890 4185 3304 gene locus_tag LOCUS_06900 gene era 4185 3304 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_06900 5483 4185 gene locus_tag LOCUS_06910 5483 4185 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_06910 6289 5507 gene locus_tag LOCUS_06920 6289 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6696 6286 gene locus_tag LOCUS_06930 6696 6286 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_06930 7400 6696 gene locus_tag LOCUS_06940 7400 6696 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence075 666 151 gene locus_tag LOCUS_06950 666 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 983 1246 gene locus_tag LOCUS_06960 983 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1513 2010 gene locus_tag LOCUS_06970 1513 2010 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767492.1 protein_id gnl|my_center|LOCUS_06970 2055 2555 gene locus_tag LOCUS_06980 2055 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4716 2623 gene locus_tag LOCUS_06990 4716 2623 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_06990 4941 4753 gene locus_tag LOCUS_07000 4941 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5135 5476 gene locus_tag LOCUS_07010 5135 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 5555 6133 gene locus_tag LOCUS_07020 5555 6133 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence076 2612 1269 gene locus_tag LOCUS_07030 gene murD 2612 1269 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_07030 3779 2622 gene locus_tag LOCUS_07040 gene mraY 3779 2622 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_07040 5236 3761 gene locus_tag LOCUS_07050 5236 3761 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_07050 7116 5233 gene locus_tag LOCUS_07060 7116 5233 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_07060 7470 7123 gene locus_tag LOCUS_07070 7470 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence077 1361 900 gene locus_tag LOCUS_07080 1361 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2840 1428 gene locus_tag LOCUS_07090 2840 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 3895 2954 gene locus_tag LOCUS_07100 3895 2954 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705389.1 protein_id gnl|my_center|LOCUS_07100 4003 4893 gene locus_tag LOCUS_07110 4003 4893 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_07110 5341 4901 gene locus_tag LOCUS_07120 5341 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 6297 5344 gene locus_tag LOCUS_07130 6297 5344 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_07130 6780 7472 gene locus_tag LOCUS_07140 6780 7472 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence078 1248 2336 gene locus_tag LOCUS_07150 1248 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 2336 3619 gene locus_tag LOCUS_07160 2336 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3629 4837 gene locus_tag LOCUS_07170 3629 4837 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836560.1 protein_id gnl|my_center|LOCUS_07170 5760 4834 gene locus_tag LOCUS_07180 5760 4834 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence079 257 1390 gene locus_tag LOCUS_07190 257 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1387 2688 gene locus_tag LOCUS_07200 1387 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2692 3420 gene locus_tag LOCUS_07210 2692 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3425 4252 gene locus_tag LOCUS_07220 3425 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 4257 5066 gene locus_tag LOCUS_07230 4257 5066 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379605.1 protein_id gnl|my_center|LOCUS_07230 5068 6609 gene locus_tag LOCUS_07240 5068 6609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203002.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence080 1494 445 gene locus_tag LOCUS_07250 1494 445 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001362455.1 protein_id gnl|my_center|LOCUS_07250 2541 1528 gene locus_tag LOCUS_07260 2541 1528 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_07260 3926 2550 gene locus_tag LOCUS_07270 gene fucP 3926 2550 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201906.1 protein_id gnl|my_center|LOCUS_07270 5714 3939 gene locus_tag LOCUS_07280 5714 3939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_07280 7447 5714 gene locus_tag LOCUS_07290 7447 5714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence081 909 1709 gene locus_tag LOCUS_07300 909 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3064 1742 gene locus_tag LOCUS_07310 3064 1742 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_07310 4167 3061 gene locus_tag LOCUS_07320 4167 3061 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_07320 5430 4183 gene locus_tag LOCUS_07330 5430 4183 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_07330 6692 5427 gene locus_tag LOCUS_07340 6692 5427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_07340 7411 6689 gene locus_tag LOCUS_07350 7411 6689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence082 374 1648 gene locus_tag LOCUS_07360 374 1648 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_07360 1645 2826 gene locus_tag LOCUS_07370 1645 2826 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_07370 2879 5443 gene locus_tag LOCUS_07380 2879 5443 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_07380 5434 6420 gene locus_tag LOCUS_07390 5434 6420 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_07390 6435 7142 gene locus_tag LOCUS_07400 6435 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence083 651 229 gene locus_tag LOCUS_07410 651 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 971 648 gene locus_tag LOCUS_07420 971 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1226 975 gene locus_tag LOCUS_07430 1226 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1284 1356 gene locus_tag LOCUS_t00040 1284 1356 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2240 1419 gene locus_tag LOCUS_07440 2240 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2448 2245 gene locus_tag LOCUS_07450 2448 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2727 2452 gene locus_tag LOCUS_07460 2727 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3423 2731 gene locus_tag LOCUS_07470 3423 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4688 3651 gene locus_tag LOCUS_07480 4688 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4917 4702 gene locus_tag LOCUS_07490 4917 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5706 5050 gene locus_tag LOCUS_07500 5706 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6192 5815 gene locus_tag LOCUS_07510 6192 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 6537 6304 gene locus_tag LOCUS_07520 6537 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 6845 6624 gene locus_tag LOCUS_07530 6845 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 7081 6860 gene locus_tag LOCUS_07540 7081 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence084 254 1444 gene locus_tag LOCUS_07550 254 1444 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_07550 1448 3382 gene locus_tag LOCUS_07560 1448 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5301 3379 gene locus_tag LOCUS_07570 5301 3379 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_07570 6423 5302 gene locus_tag LOCUS_07580 6423 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence085 1146 1991 gene locus_tag LOCUS_07590 1146 1991 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_07590 2748 1999 gene locus_tag LOCUS_07600 2748 1999 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_07600 3431 2751 gene locus_tag LOCUS_07610 3431 2751 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_07610 3510 4619 gene locus_tag LOCUS_07620 gene recF 3510 4619 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759932.1 protein_id gnl|my_center|LOCUS_07620 4606 4938 gene locus_tag LOCUS_07630 4606 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4935 5969 gene locus_tag LOCUS_07640 gene pdxB 4935 5969 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence086 391 11 gene locus_tag LOCUS_07650 391 11 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_07650 1716 394 gene locus_tag LOCUS_07660 1716 394 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_07660 1788 2354 gene locus_tag LOCUS_07670 1788 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2406 4997 gene locus_tag LOCUS_07680 2406 4997 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_07680 4994 6700 gene locus_tag LOCUS_07690 4994 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence087 3154 4776 gene locus_tag LOCUS_07700 gene lnt 3154 4776 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_07700 4778 5437 gene locus_tag LOCUS_07710 4778 5437 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_07710 5440 6234 gene locus_tag LOCUS_07720 5440 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6212 7270 gene locus_tag LOCUS_07730 6212 7270 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence088 76 3102 gene locus_tag LOCUS_07740 76 3102 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_07740 3115 4593 gene locus_tag LOCUS_07750 3115 4593 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_07750 4590 6833 gene locus_tag LOCUS_07760 4590 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence089 147 1214 gene locus_tag LOCUS_07770 gene prfB 147 1214 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_07770 1234 4032 gene locus_tag LOCUS_07780 1234 4032 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201991.1 protein_id gnl|my_center|LOCUS_07780 4171 5817 gene locus_tag LOCUS_07790 4171 5817 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_07790 5818 7026 gene locus_tag LOCUS_07800 gene serB 5818 7026 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence090 625 92 gene locus_tag LOCUS_07810 625 92 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_07810 717 4064 gene locus_tag LOCUS_07820 gene ileS 717 4064 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_07820 4067 4468 gene locus_tag LOCUS_07830 4067 4468 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_07830 4465 5031 gene locus_tag LOCUS_07840 4465 5031 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_07840 5117 6370 gene locus_tag LOCUS_07850 5117 6370 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_07850 6439 6524 gene locus_tag LOCUS_t00050 6439 6524 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 108 425 gene locus_tag LOCUS_07860 108 425 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_07860 476 1300 gene locus_tag LOCUS_07870 476 1300 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_07870 1300 2802 gene locus_tag LOCUS_07880 gene dnaB 1300 2802 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_07880 2802 3209 gene locus_tag LOCUS_07890 2802 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3206 4141 gene locus_tag LOCUS_07900 3206 4141 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_07900 4134 5483 gene locus_tag LOCUS_07910 gene rsxC 4134 5483 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_07910 5488 6471 gene locus_tag LOCUS_07920 5488 6471 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_07920 6475 7029 gene locus_tag LOCUS_07930 6475 7029 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence092 1552 251 gene locus_tag LOCUS_07940 1552 251 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_07940 1983 1549 gene locus_tag LOCUS_07950 gene dut 1983 1549 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_07950 3290 1983 gene locus_tag LOCUS_07960 3290 1983 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_07960 3324 4457 gene locus_tag LOCUS_07970 gene tgt 3324 4457 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_07970 4457 5557 gene locus_tag LOCUS_07980 4457 5557 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_07980 6958 5654 gene locus_tag LOCUS_07990 6958 5654 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence093 2146 410 gene locus_tag LOCUS_08000 2146 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3093 2143 gene locus_tag LOCUS_08010 3093 2143 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262586.1 protein_id gnl|my_center|LOCUS_08010 5240 3312 gene locus_tag LOCUS_08020 gene dnaK 5240 3312 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_08020 5376 6083 gene locus_tag LOCUS_08030 5376 6083 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_08030 7010 6084 gene locus_tag LOCUS_08040 7010 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence094 668 1867 gene locus_tag LOCUS_08050 668 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1880 3142 gene locus_tag LOCUS_08060 1880 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3252 6563 gene locus_tag LOCUS_08070 3252 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence095 2476 1691 gene locus_tag LOCUS_08080 gene miaA 2476 1691 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_08080 3104 2469 gene locus_tag LOCUS_08090 gene nth 3104 2469 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_08090 3818 3108 gene locus_tag LOCUS_08100 3818 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4680 3838 gene locus_tag LOCUS_08110 4680 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5117 4677 gene locus_tag LOCUS_08120 5117 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 5815 5114 gene locus_tag LOCUS_08130 5815 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 6223 5819 gene locus_tag LOCUS_08140 6223 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 <7014 6287 gene locus_tag LOCUS_08150 <7014 6287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987112.1:FprA family A-type flavoprotein >Feature sequence096 931 2265 gene locus_tag LOCUS_08160 931 2265 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_08160 2262 4946 gene locus_tag LOCUS_08170 2262 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4999 5751 gene locus_tag LOCUS_08180 gene sufC 4999 5751 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_08180 5744 6304 gene locus_tag LOCUS_08190 5744 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence097 121 2079 gene locus_tag LOCUS_08200 121 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2072 2923 gene locus_tag LOCUS_08210 2072 2923 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110374.1 protein_id gnl|my_center|LOCUS_08210 2925 4772 gene locus_tag LOCUS_08220 2925 4772 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_08220 4769 5752 gene locus_tag LOCUS_08230 4769 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 6340 5753 gene locus_tag LOCUS_08240 6340 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence098 2636 693 gene locus_tag LOCUS_08250 2636 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3850 2633 gene locus_tag LOCUS_08260 gene pepT 3850 2633 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_08260 5691 3847 gene locus_tag LOCUS_08270 5691 3847 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_08270 <6931 5636 gene locus_tag LOCUS_08280 <6931 5636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993642.1:OstA-like protein >Feature sequence099 <1 692 gene locus_tag LOCUS_08290 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403976.1:polyprenyl synthetase family protein 689 1666 gene locus_tag LOCUS_08300 689 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1666 2973 gene locus_tag LOCUS_08310 1666 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2973 3380 gene locus_tag LOCUS_08320 2973 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4423 3428 gene locus_tag LOCUS_08330 gene tsf 4423 3428 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_08330 5311 4454 gene locus_tag LOCUS_08340 gene rpsB 5311 4454 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791748.1 protein_id gnl|my_center|LOCUS_08340 5863 5474 gene locus_tag LOCUS_08350 gene rpsI 5863 5474 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_08350 6325 5873 gene locus_tag LOCUS_08360 gene rplM 6325 5873 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_08360 6484 6558 gene locus_tag LOCUS_t00060 6484 6558 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence100 1581 1435 gene locus_tag LOCUS_08370 1581 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2196 1642 gene locus_tag LOCUS_08380 gene def 2196 1642 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_08380 2606 2193 gene locus_tag LOCUS_08390 gene ruvX 2606 2193 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_08390 2631 3005 gene locus_tag LOCUS_08400 2631 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3005 4159 gene locus_tag LOCUS_08410 3005 4159 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_08410 4143 5444 gene locus_tag LOCUS_08420 gene rseP 4143 5444 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_08420 5453 6433 gene locus_tag LOCUS_08430 5453 6433 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence101 1153 887 gene locus_tag LOCUS_08440 1153 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2495 1158 gene locus_tag LOCUS_08450 2495 1158 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871908.1 protein_id gnl|my_center|LOCUS_08450 3877 2504 gene locus_tag LOCUS_08460 3877 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5906 3954 gene locus_tag LOCUS_08470 5906 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6854 5916 gene locus_tag LOCUS_08480 6854 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence102 1548 298 gene locus_tag LOCUS_08490 1548 298 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_08490 3006 1561 gene locus_tag LOCUS_08500 gene rhaB 3006 1561 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_08500 3065 3658 gene locus_tag LOCUS_08510 3065 3658 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107376.1 protein_id gnl|my_center|LOCUS_08510 4609 3668 gene locus_tag LOCUS_08520 4609 3668 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108275.1 protein_id gnl|my_center|LOCUS_08520 5518 4613 gene locus_tag LOCUS_08530 5518 4613 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202975.1 protein_id gnl|my_center|LOCUS_08530 5689 6408 gene locus_tag LOCUS_08540 5689 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence103 1200 493 gene locus_tag LOCUS_08550 1200 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2244 1264 gene locus_tag LOCUS_08560 2244 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3757 2252 gene locus_tag LOCUS_08570 3757 2252 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_08570 6789 3769 gene locus_tag LOCUS_08580 6789 3769 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107165.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence104 1611 247 gene locus_tag LOCUS_08590 1611 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2180 1617 gene locus_tag LOCUS_08600 gene efp 2180 1617 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_08600 3102 2236 gene locus_tag LOCUS_08610 3102 2236 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108114.1 protein_id gnl|my_center|LOCUS_08610 3782 3099 gene locus_tag LOCUS_08620 gene cmk 3782 3099 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_08620 3867 4973 gene locus_tag LOCUS_08630 3867 4973 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_08630 5384 4968 gene locus_tag LOCUS_08640 5384 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5454 5924 gene locus_tag LOCUS_08650 gene rlmH 5454 5924 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence105 472 1161 gene locus_tag LOCUS_08660 472 1161 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_08660 1237 3762 gene locus_tag LOCUS_08670 1237 3762 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_08670 3759 4886 gene locus_tag LOCUS_08680 3759 4886 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_08680 4883 6037 gene locus_tag LOCUS_08690 4883 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence106 182 256 gene locus_tag LOCUS_t00070 182 256 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1149 319 gene locus_tag LOCUS_08700 1149 319 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_08700 3548 1149 gene locus_tag LOCUS_08710 3548 1149 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021036893.1 protein_id gnl|my_center|LOCUS_08710 3599 6055 gene locus_tag LOCUS_08720 3599 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_08720 <6607 6074 gene locus_tag LOCUS_08730 <6607 6074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence107 1232 843 gene locus_tag LOCUS_08740 1232 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1316 1726 gene locus_tag LOCUS_08750 gene mutT 1316 1726 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_08750 2611 1739 gene locus_tag LOCUS_08760 2611 1739 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 protein_id gnl|my_center|LOCUS_08760 2676 3602 gene locus_tag LOCUS_08770 2676 3602 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_08770 3640 4872 gene locus_tag LOCUS_08780 3640 4872 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_08780 4865 6286 gene locus_tag LOCUS_08790 4865 6286 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence108 88 2772 gene locus_tag LOCUS_08800 88 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2776 3786 gene locus_tag LOCUS_08810 2776 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3783 4925 gene locus_tag LOCUS_08820 3783 4925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_08820 5849 4926 gene locus_tag LOCUS_08830 5849 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 <6517 5846 gene locus_tag LOCUS_08840 <6517 5846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108106.1:rRNA cytosine-C5-methyltransferase >Feature sequence109 <1 1149 gene locus_tag LOCUS_08850 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005834079.1:ATP-binding protein 1203 1532 gene locus_tag LOCUS_08860 1203 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1764 1501 gene locus_tag LOCUS_08870 1764 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2084 2012 gene locus_tag LOCUS_t00080 2084 2012 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2282 2100 gene locus_tag LOCUS_08880 gene rpmF 2282 2100 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_08880 2691 2305 gene locus_tag LOCUS_08890 2691 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4522 2714 gene locus_tag LOCUS_08900 gene typA 4522 2714 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_08900 5947 4586 gene locus_tag LOCUS_08910 5947 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence110 1129 254 gene locus_tag LOCUS_08920 gene lipA 1129 254 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_08920 1474 1148 gene locus_tag LOCUS_08930 1474 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2403 1471 gene locus_tag LOCUS_08940 2403 1471 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_08940 3521 2400 gene locus_tag LOCUS_08950 3521 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4202 3588 gene locus_tag LOCUS_08960 4202 3588 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_08960 4387 4199 gene locus_tag LOCUS_08970 4387 4199 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_08970 4507 4932 gene locus_tag LOCUS_08980 4507 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence111 537 1808 gene locus_tag LOCUS_08990 537 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1920 2459 gene locus_tag LOCUS_09000 1920 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3833 2475 gene locus_tag LOCUS_09010 3833 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4347 3826 gene locus_tag LOCUS_09020 4347 3826 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_09020 4960 4364 gene locus_tag LOCUS_09030 4960 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence112 159 1106 gene locus_tag LOCUS_09040 159 1106 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_09040 1076 1999 gene locus_tag LOCUS_09050 1076 1999 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_09050 2027 4291 gene locus_tag LOCUS_09060 2027 4291 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_09060 5124 4396 gene locus_tag LOCUS_09070 5124 4396 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203143.1 protein_id gnl|my_center|LOCUS_09070 <6429 5136 gene locus_tag LOCUS_09080 <6429 5136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942610.1:DUF4910 domain-containing protein >Feature sequence113 1722 319 gene locus_tag LOCUS_09090 1722 319 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_09090 2825 1719 gene locus_tag LOCUS_09100 2825 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3728 2832 gene locus_tag LOCUS_09110 3728 2832 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_09110 5509 3728 gene locus_tag LOCUS_09120 5509 3728 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_09120 5639 6322 gene locus_tag LOCUS_09130 gene radC 5639 6322 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_09130 6354 6427 gene locus_tag LOCUS_t00090 6354 6427 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence114 2846 861 gene locus_tag LOCUS_09140 gene dnaG 2846 861 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_09140 5059 2843 gene locus_tag LOCUS_09150 gene recQ 5059 2843 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_09150 6365 5067 gene locus_tag LOCUS_09160 6365 5067 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence115 521 246 gene locus_tag LOCUS_09170 521 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1070 558 gene locus_tag LOCUS_09180 1070 558 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766431.1 protein_id gnl|my_center|LOCUS_09180 1640 1077 gene locus_tag LOCUS_09190 1640 1077 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_09190 2329 1637 gene locus_tag LOCUS_09200 2329 1637 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_09200 4162 2333 gene locus_tag LOCUS_09210 gene mutL 4162 2333 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_09210 4464 4162 gene locus_tag LOCUS_09220 4464 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 4511 5206 gene locus_tag LOCUS_09230 4511 5206 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947707.1 protein_id gnl|my_center|LOCUS_09230 5594 5199 gene locus_tag LOCUS_09240 5594 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6283 5648 gene locus_tag LOCUS_09250 6283 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence116 2210 1290 gene locus_tag LOCUS_09260 2210 1290 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_09260 3289 2216 gene locus_tag LOCUS_09270 gene serC 3289 2216 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_09270 3894 3304 gene locus_tag LOCUS_09280 3894 3304 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_09280 3954 4508 gene locus_tag LOCUS_09290 3954 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4489 5901 gene locus_tag LOCUS_09300 4489 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence117 <1 1054 gene locus_tag LOCUS_09310 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797422.1:tetratricopeptide repeat protein 1064 2653 gene locus_tag LOCUS_09320 1064 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2791 4701 gene locus_tag LOCUS_09330 gene gyrB 2791 4701 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_09330 4707 5972 gene locus_tag LOCUS_09340 4707 5972 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence118 1640 1080 gene locus_tag LOCUS_09350 1640 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1700 2542 gene locus_tag LOCUS_09360 1700 2542 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203064.1 protein_id gnl|my_center|LOCUS_09360 2599 2672 gene locus_tag LOCUS_t00100 2599 2672 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2690 2763 gene locus_tag LOCUS_t00110 2690 2763 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2772 2847 gene locus_tag LOCUS_t00120 2772 2847 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6089 2901 gene locus_tag LOCUS_09370 6089 2901 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence119 1441 575 gene locus_tag LOCUS_09380 1441 575 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786594.1 protein_id gnl|my_center|LOCUS_09380 2635 1442 gene locus_tag LOCUS_09390 2635 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2709 3911 gene locus_tag LOCUS_09400 2709 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3908 5263 gene locus_tag LOCUS_09410 3908 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5463 5771 gene locus_tag LOCUS_09420 5463 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence120 <1 1274 gene locus_tag LOCUS_09430 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788185.1:peptide MFS transporter 1279 2382 gene locus_tag LOCUS_09440 1279 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2379 3071 gene locus_tag LOCUS_09450 2379 3071 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_09450 3071 3655 gene locus_tag LOCUS_09460 3071 3655 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_09460 3639 5045 gene locus_tag LOCUS_09470 3639 5045 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence121 1841 171 gene locus_tag LOCUS_09480 1841 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2392 1880 gene locus_tag LOCUS_09490 2392 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4749 2416 gene locus_tag LOCUS_09500 4749 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5518 4751 gene locus_tag LOCUS_09510 5518 4751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence122 32 126 gene locus_tag LOCUS_r00010 32 126 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1798 584 gene locus_tag LOCUS_09520 1798 584 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_09520 1819 4071 gene locus_tag LOCUS_09530 1819 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_09530 4073 5275 gene locus_tag LOCUS_09540 4073 5275 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_09540 5272 5886 gene locus_tag LOCUS_09550 5272 5886 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203180.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence123 1565 366 gene locus_tag LOCUS_09560 1565 366 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_09560 1637 2455 gene locus_tag LOCUS_09570 1637 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2430 3884 gene locus_tag LOCUS_09580 2430 3884 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_09580 3884 5308 gene locus_tag LOCUS_09590 3884 5308 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence124 1740 94 gene locus_tag LOCUS_09600 1740 94 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_09600 1806 2993 gene locus_tag LOCUS_09610 1806 2993 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_09610 2990 3487 gene locus_tag LOCUS_09620 2990 3487 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_09620 3481 4050 gene locus_tag LOCUS_09630 3481 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4054 4404 gene locus_tag LOCUS_09640 4054 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence125 1574 1933 gene locus_tag LOCUS_09650 1574 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1993 3024 gene locus_tag LOCUS_09660 1993 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3031 4413 gene locus_tag LOCUS_09670 gene potA 3031 4413 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_09670 4406 5176 gene locus_tag LOCUS_09680 4406 5176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_09680 5176 5973 gene locus_tag LOCUS_09690 5176 5973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762999.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence126 <1 633 gene locus_tag LOCUS_09700 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108201.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase 608 1516 gene locus_tag LOCUS_09710 608 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2187 1522 gene locus_tag LOCUS_09720 2187 1522 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_09720 2240 3400 gene locus_tag LOCUS_09730 2240 3400 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_09730 3840 3403 gene locus_tag LOCUS_09740 3840 3403 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095464.1 protein_id gnl|my_center|LOCUS_09740 4391 3840 gene locus_tag LOCUS_09750 4391 3840 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983897.1 protein_id gnl|my_center|LOCUS_09750 4851 4396 gene locus_tag LOCUS_09760 gene bfr 4851 4396 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212327.1 protein_id gnl|my_center|LOCUS_09760 5559 4984 gene locus_tag LOCUS_09770 5559 4984 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence127 1407 1183 gene locus_tag LOCUS_09780 1407 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1663 1412 gene locus_tag LOCUS_09790 1663 1412 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_09790 4273 1721 gene locus_tag LOCUS_09800 4273 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5336 4278 gene locus_tag LOCUS_09810 5336 4278 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_09810 <5992 5329 gene locus_tag LOCUS_09820 <5992 5329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791020.1:phosphoglucosamine mutase >Feature sequence128 48 392 gene locus_tag LOCUS_09830 48 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 684 1811 gene locus_tag LOCUS_09840 684 1811 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_09840 1850 2593 gene locus_tag LOCUS_09850 1850 2593 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_09850 2711 3775 gene locus_tag LOCUS_09860 2711 3775 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_09860 3891 4652 gene locus_tag LOCUS_09870 gene proC 3891 4652 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_09870 4656 5258 gene locus_tag LOCUS_09880 4656 5258 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_09880 5490 5296 gene locus_tag LOCUS_09890 5490 5296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence129 329 718 gene locus_tag LOCUS_09900 329 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 658 1926 gene locus_tag LOCUS_09910 658 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1923 2360 gene locus_tag LOCUS_09920 1923 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2406 4349 gene locus_tag LOCUS_09930 2406 4349 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_09930 5803 4346 gene locus_tag LOCUS_09940 gene preA 5803 4346 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence130 1006 536 gene locus_tag LOCUS_09950 1006 536 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_09950 1605 1024 gene locus_tag LOCUS_09960 1605 1024 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_09960 2036 1608 gene locus_tag LOCUS_09970 2036 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2816 2058 gene locus_tag LOCUS_09980 2816 2058 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_09980 3975 2938 gene locus_tag LOCUS_09990 3975 2938 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_09990 4751 3972 gene locus_tag LOCUS_10000 4751 3972 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_10000 5911 4754 gene locus_tag LOCUS_10010 gene dprA 5911 4754 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence131 813 1859 gene locus_tag LOCUS_10020 813 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1863 2441 gene locus_tag LOCUS_10030 1863 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2438 3274 gene locus_tag LOCUS_10040 2438 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3271 5466 gene locus_tag LOCUS_10050 3271 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5469 5777 gene locus_tag LOCUS_10060 5469 5777 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176701.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence132 <1 809 gene locus_tag LOCUS_10070 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108580.1:glycoside hydrolase family 3 C-terminal domain-containing protein 2056 815 gene locus_tag LOCUS_10080 2056 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3256 2111 gene locus_tag LOCUS_10090 gene zinU 3256 2111 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_10090 3626 5683 gene locus_tag LOCUS_10100 3626 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence133 1761 358 gene locus_tag LOCUS_10110 gene rpoN 1761 358 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108333.1 protein_id gnl|my_center|LOCUS_10110 2195 1761 gene locus_tag LOCUS_10120 2195 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2659 2192 gene locus_tag LOCUS_10130 2659 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4130 2721 gene locus_tag LOCUS_10140 4130 2721 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_10140 4799 4134 gene locus_tag LOCUS_10150 4799 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5248 4799 gene locus_tag LOCUS_10160 5248 4799 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905993.1 protein_id gnl|my_center|LOCUS_10160 <5897 5245 gene locus_tag LOCUS_10170 <5897 5245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107738.1:DNA repair protein RecN >Feature sequence134 3522 2500 gene locus_tag LOCUS_10180 3522 2500 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence135 2027 174 gene locus_tag LOCUS_10190 2027 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2966 2172 gene locus_tag LOCUS_10200 2966 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4573 2969 gene locus_tag LOCUS_10210 4573 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5067 4570 gene locus_tag LOCUS_10220 5067 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence136 805 614 gene locus_tag LOCUS_10230 805 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2241 823 gene locus_tag LOCUS_10240 2241 823 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_10240 2305 2745 gene locus_tag LOCUS_10250 2305 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3861 2746 gene locus_tag LOCUS_10260 3861 2746 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785425.1 protein_id gnl|my_center|LOCUS_10260 4331 5122 gene locus_tag LOCUS_10270 4331 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence137 154 363 gene locus_tag LOCUS_10280 154 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1673 351 gene locus_tag LOCUS_10290 1673 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4212 1693 gene locus_tag LOCUS_10300 gene gyrA 4212 1693 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_10300 4280 4840 gene locus_tag LOCUS_10310 4280 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5706 4837 gene locus_tag LOCUS_10320 5706 4837 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence138 697 152 gene locus_tag LOCUS_10330 697 152 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868100.1 protein_id gnl|my_center|LOCUS_10330 801 2090 gene locus_tag LOCUS_10340 801 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_10340 2099 3322 gene locus_tag LOCUS_10350 2099 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3323 5098 gene locus_tag LOCUS_10360 3323 5098 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992419.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence139 384 1352 gene locus_tag LOCUS_10370 384 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1349 3661 gene locus_tag LOCUS_10380 1349 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3661 5562 gene locus_tag LOCUS_10390 3661 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108191.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence140 3474 205 gene locus_tag LOCUS_10400 3474 205 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_10400 3564 5354 gene locus_tag LOCUS_10410 3564 5354 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence141 <1 1255 gene locus_tag LOCUS_10420 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032813763.1:excinuclease ABC subunit UvrA 1910 1260 gene locus_tag LOCUS_10430 gene recO 1910 1260 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_10430 2912 1917 gene locus_tag LOCUS_10440 2912 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3591 2905 gene locus_tag LOCUS_10450 3591 2905 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694389.1 protein_id gnl|my_center|LOCUS_10450 3651 4265 gene locus_tag LOCUS_10460 3651 4265 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_10460 4299 4922 gene locus_tag LOCUS_10470 4299 4922 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence142 720 1196 gene locus_tag LOCUS_10480 720 1196 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_10480 1817 1203 gene locus_tag LOCUS_10490 1817 1203 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_10490 2794 1862 gene locus_tag LOCUS_10500 2794 1862 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_10500 2965 4572 gene locus_tag LOCUS_10510 2965 4572 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_10510 4592 5575 gene locus_tag LOCUS_10520 4592 5575 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence143 2336 1542 gene locus_tag LOCUS_10530 2336 1542 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_10530 3523 2333 gene locus_tag LOCUS_10540 3523 2333 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202847.1 protein_id gnl|my_center|LOCUS_10540 3630 4907 gene locus_tag LOCUS_10550 3630 4907 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766478.1 protein_id gnl|my_center|LOCUS_10550 <5589 4888 gene locus_tag LOCUS_10560 <5589 4888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108187.1:MATE family efflux transporter >Feature sequence144 <1 717 gene locus_tag LOCUS_10570 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202102.1:alpha-N-acetylglucosaminidase 3862 701 gene locus_tag LOCUS_10580 3862 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4806 3916 gene locus_tag LOCUS_10590 4806 3916 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_10590 <5527 4811 gene locus_tag LOCUS_10600 <5527 4811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802230.1:lysine--tRNA ligase >Feature sequence145 1019 216 gene locus_tag LOCUS_10610 1019 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 1880 1065 gene locus_tag LOCUS_10620 1880 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1924 3987 gene locus_tag LOCUS_10630 1924 3987 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_10630 3974 4789 gene locus_tag LOCUS_10640 3974 4789 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_10640 <5456 4750 gene locus_tag LOCUS_10650 <5456 4750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769700.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence146 <1 1345 gene locus_tag LOCUS_10660 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922720.1:cysteine proteinase exotoxin SpeB 2233 1346 gene locus_tag LOCUS_10670 2233 1346 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765023.1 protein_id gnl|my_center|LOCUS_10670 2334 3407 gene locus_tag LOCUS_10680 2334 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3394 4164 gene locus_tag LOCUS_10690 3394 4164 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_10690 4130 5317 gene locus_tag LOCUS_10700 4130 5317 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence147 2104 2772 gene locus_tag LOCUS_10710 2104 2772 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_10710 2769 4439 gene locus_tag LOCUS_10720 2769 4439 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_10720 4474 4947 gene locus_tag LOCUS_10730 gene cdd 4474 4947 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence148 374 1147 gene locus_tag LOCUS_10740 374 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1153 3837 gene locus_tag LOCUS_10750 1153 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 4451 3804 gene locus_tag LOCUS_10760 4451 3804 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_10760 4518 4982 gene locus_tag LOCUS_10770 4518 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence149 1250 978 gene locus_tag LOCUS_10780 1250 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1362 2108 gene locus_tag LOCUS_10790 1362 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2675 2004 gene locus_tag LOCUS_10800 2675 2004 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_10800 3487 2675 gene locus_tag LOCUS_10810 gene lpxA 3487 2675 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_10810 4386 3490 gene locus_tag LOCUS_10820 4386 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 <5383 4433 gene locus_tag LOCUS_10830 <5383 4433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948760.1:aldehyde dehydrogenase >Feature sequence150 1574 1005 gene locus_tag LOCUS_10840 1574 1005 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_10840 1649 2818 gene locus_tag LOCUS_10850 1649 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2815 4011 gene locus_tag LOCUS_10860 2815 4011 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_10860 4668 4012 gene locus_tag LOCUS_10870 4668 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence151 4991 2259 gene locus_tag LOCUS_10880 4991 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence152 202 1512 gene locus_tag LOCUS_10890 gene murA 202 1512 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_10890 1520 3604 gene locus_tag LOCUS_10900 1520 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 3614 4279 gene locus_tag LOCUS_10910 gene dapB 3614 4279 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_10910 4276 5151 gene locus_tag LOCUS_10920 gene dapA 4276 5151 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence153 135 1394 gene locus_tag LOCUS_10930 135 1394 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_10930 1381 2844 gene locus_tag LOCUS_10940 1381 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2857 4698 gene locus_tag LOCUS_10950 2857 4698 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence154 568 1848 gene locus_tag LOCUS_10960 568 1848 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10960 1845 2432 gene locus_tag LOCUS_10970 1845 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2437 4833 gene locus_tag LOCUS_10980 2437 4833 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence155 3170 1524 gene locus_tag LOCUS_10990 3170 1524 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_10990 3298 4140 gene locus_tag LOCUS_11000 3298 4140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 4724 4137 gene locus_tag LOCUS_11010 gene folE 4724 4137 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_11010 4805 5026 gene locus_tag LOCUS_11020 4805 5026 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence156 269 1222 gene locus_tag LOCUS_11030 269 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1258 2295 gene locus_tag LOCUS_11040 1258 2295 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_11040 2273 3982 gene locus_tag LOCUS_11050 2273 3982 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_11050 <5113 3992 gene locus_tag LOCUS_11060 <5113 3992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303098.1:DUF5722 domain-containing protein >Feature sequence157 <1 1152 gene locus_tag LOCUS_11070 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765057.1:glutamine synthetase III 1161 2060 gene locus_tag LOCUS_11080 1161 2060 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_11080 2053 3417 gene locus_tag LOCUS_11090 gene gdhA 2053 3417 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence158 168 2768 gene locus_tag LOCUS_11100 gene polA 168 2768 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence159 <1 1213 gene locus_tag LOCUS_11110 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000786864.1:DUF5982 domain-containing protein 2248 1292 gene locus_tag LOCUS_11120 2248 1292 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_11120 4436 2340 gene locus_tag LOCUS_11130 4436 2340 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence160 958 518 gene locus_tag LOCUS_11140 958 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1919 945 gene locus_tag LOCUS_11150 1919 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2448 2287 gene locus_tag LOCUS_11160 2448 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2656 3288 gene locus_tag LOCUS_11170 2656 3288 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_11170 4577 3285 gene locus_tag LOCUS_11180 gene rodA 4577 3285 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_11180 <5083 4577 gene locus_tag LOCUS_11190 <5083 4577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792058.1:penicillin-binding protein 2 >Feature sequence161 1740 622 gene locus_tag LOCUS_11200 1740 622 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_11200 1949 1737 gene locus_tag LOCUS_11210 1949 1737 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672276.1 protein_id gnl|my_center|LOCUS_11210 2115 3149 gene locus_tag LOCUS_11220 2115 3149 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795918.1 protein_id gnl|my_center|LOCUS_11220 3399 3151 gene locus_tag LOCUS_11230 3399 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4447 3524 gene locus_tag LOCUS_11240 4447 3524 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence162 2024 1170 gene locus_tag LOCUS_11250 2024 1170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_11250 2184 3917 gene locus_tag LOCUS_11260 2184 3917 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_11260 4409 3990 gene locus_tag LOCUS_11270 4409 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 4824 4558 gene locus_tag LOCUS_11280 4824 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence163 <1 1735 gene locus_tag LOCUS_11290 <1 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926994.1:AMP-dependent synthetase/ligase 1743 3014 gene locus_tag LOCUS_11300 1743 3014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_11300 3019 3978 gene locus_tag LOCUS_11310 3019 3978 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_11310 4002 4808 gene locus_tag LOCUS_11320 gene fkpA 4002 4808 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838241.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence164 2122 1334 gene locus_tag LOCUS_11330 gene lptB 2122 1334 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_11330 3900 2119 gene locus_tag LOCUS_11340 3900 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3980 4648 gene locus_tag LOCUS_11350 3980 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4648 4923 gene locus_tag LOCUS_11360 4648 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence165 2886 520 gene locus_tag LOCUS_11370 2886 520 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_11370 3041 4405 gene locus_tag LOCUS_11380 gene eno 3041 4405 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence166 <1 1783 gene locus_tag LOCUS_11390 <1 1783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105929761.1:pectinesterase family protein 2705 1785 gene locus_tag LOCUS_11400 gene kduI 2705 1785 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_11400 4096 2708 gene locus_tag LOCUS_11410 4096 2708 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_11410 4903 4100 gene locus_tag LOCUS_11420 4903 4100 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence167 1028 4309 gene locus_tag LOCUS_11430 1028 4309 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence168 <1 2521 gene locus_tag LOCUS_11440 <1 2521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009039975.1:SusC/RagA family TonB-linked outer membrane protein 2528 4348 gene locus_tag LOCUS_11450 2528 4348 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107068.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence169 1141 281 gene locus_tag LOCUS_11460 1141 281 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403269.1 protein_id gnl|my_center|LOCUS_11460 2397 1138 gene locus_tag LOCUS_11470 gene mtaB 2397 1138 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_11470 <4924 2397 gene locus_tag LOCUS_11480 <4924 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107519.1:translocation/assembly module TamB domain-containing protein >Feature sequence170 1553 567 gene locus_tag LOCUS_11490 gene lpxD 1553 567 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_11490 3267 1555 gene locus_tag LOCUS_11500 3267 1555 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_11500 4179 3298 gene locus_tag LOCUS_11510 4179 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence171 56 190 gene locus_tag LOCUS_11520 56 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 203 2143 gene locus_tag LOCUS_11530 203 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3611 2226 gene locus_tag LOCUS_11540 3611 2226 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_11540 3729 4886 gene locus_tag LOCUS_11550 3729 4886 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108906.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence172 1094 345 gene locus_tag LOCUS_11560 gene rsmI 1094 345 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_11560 1191 1712 gene locus_tag LOCUS_11570 1191 1712 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_11570 2580 1714 gene locus_tag LOCUS_11580 gene xerD 2580 1714 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_11580 2618 3823 gene locus_tag LOCUS_11590 2618 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence173 <1 525 gene locus_tag LOCUS_11600 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762559.1:glycine--tRNA ligase 525 1637 gene locus_tag LOCUS_11610 525 1637 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_11610 1703 4726 gene locus_tag LOCUS_11620 gene secDF 1703 4726 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence174 2157 1690 gene locus_tag LOCUS_11630 gene rimM 2157 1690 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_11630 2714 2160 gene locus_tag LOCUS_11640 2714 2160 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_11640 4189 2936 gene locus_tag LOCUS_11650 4189 2936 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_11650 4244 4648 gene locus_tag LOCUS_11660 4244 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence175 2466 1093 gene locus_tag LOCUS_11670 gene gcvPB 2466 1093 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861288.1 protein_id gnl|my_center|LOCUS_11670 3776 2463 gene locus_tag LOCUS_11680 3776 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 4155 3778 gene locus_tag LOCUS_11690 gene gcvH 4155 3778 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_11690 <4782 4152 gene locus_tag LOCUS_11700 <4782 4152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986167.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence176 1074 172 gene locus_tag LOCUS_11710 gene rbsK 1074 172 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_11710 4496 2442 gene locus_tag LOCUS_11720 4496 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence177 1515 334 gene locus_tag LOCUS_11730 1515 334 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_11730 2361 1519 gene locus_tag LOCUS_11740 2361 1519 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_11740 3976 2342 gene locus_tag LOCUS_11750 3976 2342 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_11750 4533 3976 gene locus_tag LOCUS_11760 4533 3976 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence178 1691 1224 gene locus_tag LOCUS_11770 gene purE 1691 1224 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165488.1 protein_id gnl|my_center|LOCUS_11770 2397 1693 gene locus_tag LOCUS_11780 2397 1693 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_11780 2592 3878 gene locus_tag LOCUS_11790 gene pyrC 2592 3878 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence179 1826 264 gene locus_tag LOCUS_11800 1826 264 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_11800 2266 1991 gene locus_tag LOCUS_11810 2266 1991 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence180 1272 2168 gene locus_tag LOCUS_11820 1272 2168 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_11820 2546 4156 gene locus_tag LOCUS_11830 2546 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 4202 4555 gene locus_tag LOCUS_11840 4202 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence181 <1 600 gene locus_tag LOCUS_11850 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001262439.1:phosphoribosylformylglycinamidine cyclo-ligase 597 1160 gene locus_tag LOCUS_11860 gene purN 597 1160 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_11860 1163 2695 gene locus_tag LOCUS_11870 gene purH 1163 2695 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706668.1 protein_id gnl|my_center|LOCUS_11870 2697 3941 gene locus_tag LOCUS_11880 gene purD 2697 3941 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101962.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence182 61 133 gene locus_tag LOCUS_t00130 61 133 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 314 1348 gene locus_tag LOCUS_11890 314 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1722 4604 gene locus_tag LOCUS_11900 1722 4604 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence183 <1 1081 gene locus_tag LOCUS_11910 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008770039.1:M23 family metallopeptidase 1081 2388 gene locus_tag LOCUS_11920 gene miaB 1081 2388 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_11920 4406 2391 gene locus_tag LOCUS_11930 4406 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 4613 4539 gene locus_tag LOCUS_t00140 4613 4539 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence184 1110 1634 gene locus_tag LOCUS_11940 1110 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 2253 1609 gene locus_tag LOCUS_11950 gene rpe 2253 1609 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_11950 3683 2256 gene locus_tag LOCUS_11960 3683 2256 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_11960 <4666 3700 gene locus_tag LOCUS_11970 <4666 3700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034099187.1:chromosomal replication initiator protein DnaA >Feature sequence185 <1 2520 gene locus_tag LOCUS_11980 <1 2520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804147.1:efflux RND transporter permease subunit 2517 2810 gene locus_tag LOCUS_11990 2517 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_11990 2842 3156 gene locus_tag LOCUS_12000 gene trxA 2842 3156 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759608.1 protein_id gnl|my_center|LOCUS_12000 3153 3677 gene locus_tag LOCUS_12010 3153 3677 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_12010 3674 4645 gene locus_tag LOCUS_12020 3674 4645 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence186 1101 661 gene locus_tag LOCUS_12030 1101 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2617 1115 gene locus_tag LOCUS_12040 2617 1115 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_12040 <4642 2634 gene locus_tag LOCUS_12050 <4642 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202528.1:TonB-dependent receptor >Feature sequence187 787 2115 gene locus_tag LOCUS_12060 787 2115 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_12060 2122 3240 gene locus_tag LOCUS_12070 2122 3240 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_12070 3243 4031 gene locus_tag LOCUS_12080 3243 4031 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence188 <1 861 gene locus_tag LOCUS_12090 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681494.1:RagB/SusD family nutrient uptake outer membrane protein 874 2025 gene locus_tag LOCUS_12100 874 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2139 3533 gene locus_tag LOCUS_12110 2139 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence189 <1 1065 gene locus_tag LOCUS_12120 <1 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109116.1:glycoside hydrolase family 28 protein 1667 1062 gene locus_tag LOCUS_12130 1667 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 <4536 1672 gene locus_tag LOCUS_12140 <4536 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658550.1:GH92 family glycosyl hydrolase >Feature sequence190 3428 318 gene locus_tag LOCUS_12150 3428 318 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_12150 4501 3425 gene locus_tag LOCUS_12160 gene lpxK 4501 3425 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence191 506 237 gene locus_tag LOCUS_12170 506 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1047 541 gene locus_tag LOCUS_12180 1047 541 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_12180 3601 1094 gene locus_tag LOCUS_12190 3601 1094 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_12190 <4474 3605 gene locus_tag LOCUS_12200 <4474 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765513.1:translation elongation factor 4 >Feature sequence192 3675 2812 gene locus_tag LOCUS_12210 3675 2812 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_12210 <4451 3677 gene locus_tag LOCUS_12220 <4451 3677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107939.1:sodium ion-translocating decarboxylase subunit beta >Feature sequence193 1614 1075 gene locus_tag LOCUS_12230 1614 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2030 1611 gene locus_tag LOCUS_12240 2030 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3027 2053 gene locus_tag LOCUS_12250 3027 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4002 3031 gene locus_tag LOCUS_12260 4002 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence194 370 3237 gene locus_tag LOCUS_12270 370 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence195 556 1725 gene locus_tag LOCUS_12280 556 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <4427 1740 gene locus_tag LOCUS_12290 <4427 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962512.1:DNA polymerase III subunit alpha >Feature sequence196 2066 867 gene locus_tag LOCUS_12300 2066 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence197 <1 679 gene locus_tag LOCUS_12310 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767133.1:DNA/RNA non-specific endonuclease 1366 695 gene locus_tag LOCUS_12320 1366 695 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_12320 4005 1411 gene locus_tag LOCUS_12330 4005 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4080 4154 gene locus_tag LOCUS_t00150 4080 4154 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence198 1475 2389 gene locus_tag LOCUS_12340 1475 2389 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764105.1 protein_id gnl|my_center|LOCUS_12340 2391 3635 gene locus_tag LOCUS_12350 2391 3635 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839735.1 protein_id gnl|my_center|LOCUS_12350 4301 3669 gene locus_tag LOCUS_12360 4301 3669 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence199 <1 700 gene locus_tag LOCUS_12370 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203293.1:signal peptide peptidase SppA 1692 697 gene locus_tag LOCUS_12380 1692 697 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_12380 2380 1706 gene locus_tag LOCUS_12390 2380 1706 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111910.1 protein_id gnl|my_center|LOCUS_12390 2703 2383 gene locus_tag LOCUS_12400 2703 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2750 3679 gene locus_tag LOCUS_12410 2750 3679 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence200 <1 2326 gene locus_tag LOCUS_12420 <1 2326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202754.1:PD-(D/E)XK nuclease family protein >Feature sequence201 2371 1013 gene locus_tag LOCUS_12430 gene purF 2371 1013 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_12430 3084 2368 gene locus_tag LOCUS_12440 3084 2368 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_12440 <4372 3087 gene locus_tag LOCUS_12450 <4372 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494805.1:phosphoribosylformylglycinamidine synthase >Feature sequence202 1 1038 gene locus_tag LOCUS_12460 1 1038 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456217.1 protein_id gnl|my_center|LOCUS_12460 1068 1718 gene locus_tag LOCUS_12470 1068 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1756 2424 gene locus_tag LOCUS_12480 gene hypB 1756 2424 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence203 1093 545 gene locus_tag LOCUS_12490 1093 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1149 2936 gene locus_tag LOCUS_12500 gene thrS 1149 2936 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_12500 2936 3526 gene locus_tag LOCUS_12510 gene infC 2936 3526 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_12510 3560 3754 gene locus_tag LOCUS_12520 gene rpmI 3560 3754 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_12520 3767 4111 gene locus_tag LOCUS_12530 gene rplT 3767 4111 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence204 2158 911 gene locus_tag LOCUS_12540 2158 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3679 2162 gene locus_tag LOCUS_12550 gene ftsA 3679 2162 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565166.1 protein_id gnl|my_center|LOCUS_12550 4335 3661 gene locus_tag LOCUS_12560 4335 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence205 721 404 gene locus_tag LOCUS_12570 721 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1513 761 gene locus_tag LOCUS_12580 1513 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2673 1510 gene locus_tag LOCUS_12590 2673 1510 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_12590 3824 2718 gene locus_tag LOCUS_12600 3824 2718 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_12600 4199 3897 gene locus_tag LOCUS_12610 4199 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence206 2398 2574 gene locus_tag LOCUS_12620 2398 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2597 3055 gene locus_tag LOCUS_12630 2597 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3315 4037 gene locus_tag LOCUS_12640 3315 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence207 769 2067 gene locus_tag LOCUS_12650 769 2067 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_12650 3498 2104 gene locus_tag LOCUS_12660 3498 2104 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_12660 <4302 3505 gene locus_tag LOCUS_12670 <4302 3505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963267.1:DUF5683 domain-containing protein >Feature sequence208 833 318 gene locus_tag LOCUS_12680 833 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1761 997 gene locus_tag LOCUS_12690 gene djlA 1761 997 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_12690 2846 1758 gene locus_tag LOCUS_12700 2846 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 <4278 2843 gene locus_tag LOCUS_12710 <4278 2843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071301.1:amino acid ABC transporter permease >Feature sequence209 491 1813 gene locus_tag LOCUS_12720 491 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence210 622 534 gene locus_tag LOCUS_t00160 622 534 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 679 2787 gene locus_tag LOCUS_12730 679 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4112 2793 gene locus_tag LOCUS_12740 4112 2793 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_12740 4244 4113 gene locus_tag LOCUS_12750 4244 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence211 1302 3047 gene locus_tag LOCUS_12760 1302 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3054 4094 gene locus_tag LOCUS_12770 3054 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence212 <1 2187 gene locus_tag LOCUS_12780 <1 2187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796226.1:alanine--tRNA ligase >Feature sequence213 2973 1456 gene locus_tag LOCUS_12790 2973 1456 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_12790 <4222 2975 gene locus_tag LOCUS_12800 <4222 2975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817018.1:TonB-dependent receptor >Feature sequence214 1578 4187 gene locus_tag LOCUS_12810 1578 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence215 1885 1277 gene locus_tag LOCUS_12820 1885 1277 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_12820 3210 1885 gene locus_tag LOCUS_12830 3210 1885 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_12830 <4214 3200 gene locus_tag LOCUS_12840 <4214 3200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788434.1:V-type ATP synthase subunit A >Feature sequence216 71 3262 gene locus_tag LOCUS_12850 71 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence217 249 1403 gene locus_tag LOCUS_12860 249 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1625 1413 gene locus_tag LOCUS_12870 1625 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1911 1756 gene locus_tag LOCUS_12880 1911 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 3352 2060 gene locus_tag LOCUS_12890 3352 2060 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_12890 3672 3968 gene locus_tag LOCUS_12900 3672 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence218 734 1600 gene locus_tag LOCUS_12910 734 1600 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_12910 1606 2934 gene locus_tag LOCUS_12920 1606 2934 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_12920 3681 2938 gene locus_tag LOCUS_12930 3681 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence219 1293 682 gene locus_tag LOCUS_12940 1293 682 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_12940 2264 1272 gene locus_tag LOCUS_12950 gene obgE 2264 1272 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_12950 3333 2635 gene locus_tag LOCUS_12960 3333 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence220 19 711 gene locus_tag LOCUS_12970 19 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_12970 717 1172 gene locus_tag LOCUS_12980 717 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1169 1708 gene locus_tag LOCUS_12990 1169 1708 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_12990 2602 1862 gene locus_tag LOCUS_13000 gene mazG 2602 1862 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_13000 3576 2665 gene locus_tag LOCUS_13010 gene ptb 3576 2665 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_13010 <4122 3582 gene locus_tag LOCUS_13020 <4122 3582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438096.1:acetate kinase >Feature sequence221 2133 31 gene locus_tag LOCUS_13030 2133 31 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_13030 2756 2130 gene locus_tag LOCUS_13040 2756 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 3692 2763 gene locus_tag LOCUS_13050 3692 2763 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence222 1611 577 gene locus_tag LOCUS_13060 1611 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 <4095 1680 gene locus_tag LOCUS_13070 <4095 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107841.1:DUF5686 and carboxypeptidase-like regulatory domain-containing protein >Feature sequence223 119 493 gene locus_tag LOCUS_13080 gene rpsL 119 493 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_13080 530 1006 gene locus_tag LOCUS_13090 gene rpsG 530 1006 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_13090 1020 3137 gene locus_tag LOCUS_13100 gene fusA 1020 3137 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_13100 3165 3470 gene locus_tag LOCUS_13110 gene rpsJ 3165 3470 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_13110 3537 3611 gene locus_tag LOCUS_t00170 3537 3611 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence224 431 685 gene locus_tag LOCUS_13120 431 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 679 2208 gene locus_tag LOCUS_13130 679 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2226 3002 gene locus_tag LOCUS_13140 2226 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3752 3015 gene locus_tag LOCUS_13150 3752 3015 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence225 300 530 gene locus_tag LOCUS_13160 300 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 593 3202 gene locus_tag LOCUS_13170 gene mutS 593 3202 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence226 <1 843 gene locus_tag LOCUS_13180 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202260.1:polysaccharide biosynthesis protein 2510 897 gene locus_tag LOCUS_13190 2510 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2664 2521 gene locus_tag LOCUS_13200 2664 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3947 2745 gene locus_tag LOCUS_13210 3947 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence227 <1 1768 gene locus_tag LOCUS_13220 <1 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107269.1:RagB/SusD family nutrient uptake outer membrane protein 1770 3773 gene locus_tag LOCUS_13230 1770 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence228 1473 538 gene locus_tag LOCUS_13240 1473 538 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_13240 2291 1470 gene locus_tag LOCUS_13250 2291 1470 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_13250 3854 2316 gene locus_tag LOCUS_13260 3854 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence229 2185 458 gene locus_tag LOCUS_13270 2185 458 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_13270 2749 2198 gene locus_tag LOCUS_13280 2749 2198 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_13280 <4028 2782 gene locus_tag LOCUS_13290 <4028 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109022.1:ATP-dependent DNA helicase RecG >Feature sequence230 <1 1345 gene locus_tag LOCUS_13300 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061157.1:succinate dehydrogenase/fumarate reductase iron-sulfur subunit 3243 1342 gene locus_tag LOCUS_13310 3243 1342 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_13310 <4026 3289 gene locus_tag LOCUS_13320 <4026 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787468.1:RelA/SpoT family protein >Feature sequence231 1526 270 gene locus_tag LOCUS_13330 gene lpdA 1526 270 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_13330 3130 1523 gene locus_tag LOCUS_13340 3130 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3206 3279 gene locus_tag LOCUS_t00180 3206 3279 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 <3992 3333 gene locus_tag LOCUS_13350 <3992 3333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003019891.1:MIP/aquaporin family protein >Feature sequence232 2 727 gene locus_tag LOCUS_13360 2 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1588 731 gene locus_tag LOCUS_13370 1588 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2046 1588 gene locus_tag LOCUS_13380 2046 1588 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_13380 2174 3520 gene locus_tag LOCUS_13390 2174 3520 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence233 1077 1547 gene locus_tag LOCUS_13400 gene greA 1077 1547 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_13400 1544 1945 gene locus_tag LOCUS_13410 1544 1945 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_13410 1998 3023 gene locus_tag LOCUS_13420 1998 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence234 1434 43 gene locus_tag LOCUS_13430 1434 43 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_13430 1487 1924 gene locus_tag LOCUS_13440 1487 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1924 2958 gene locus_tag LOCUS_13450 1924 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3457 2969 gene locus_tag LOCUS_13460 3457 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 <3973 3470 gene locus_tag LOCUS_13470 <3973 3470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962553.1:S46 family peptidase >Feature sequence235 925 1944 gene locus_tag LOCUS_13480 925 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 <3942 1947 gene locus_tag LOCUS_13490 <3942 1947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814533.1:M13 family metallopeptidase >Feature sequence236 <1 510 gene locus_tag LOCUS_13500 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203088.1:glycine C-acetyltransferase 579 1301 gene locus_tag LOCUS_13510 579 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2255 1332 gene locus_tag LOCUS_13520 2255 1332 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_13520 3145 2252 gene locus_tag LOCUS_13530 3145 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3237 3633 gene locus_tag LOCUS_tm00010 3237 3633 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence237 679 1443 gene locus_tag LOCUS_13540 679 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 2168 2084 gene locus_tag LOCUS_t00190 2168 2084 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2853 2221 gene locus_tag LOCUS_13550 2853 2221 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905879.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence238 941 57 gene locus_tag LOCUS_13560 941 57 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_13560 2506 920 gene locus_tag LOCUS_13570 gene atpA 2506 920 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107412.1 protein_id gnl|my_center|LOCUS_13570 2985 2509 gene locus_tag LOCUS_13580 2985 2509 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921279.1 protein_id gnl|my_center|LOCUS_13580 3493 2987 gene locus_tag LOCUS_13590 gene atpF 3493 2987 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_13590 3739 3497 gene locus_tag LOCUS_13600 3739 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence239 1351 161 gene locus_tag LOCUS_13610 gene kbl 1351 161 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_13610 1421 2374 gene locus_tag LOCUS_13620 1421 2374 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_13620 2719 2426 gene locus_tag LOCUS_13630 2719 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3629 2709 gene locus_tag LOCUS_13640 gene xerC 3629 2709 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence240 329 249 gene locus_tag LOCUS_t00200 329 249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1273 356 gene locus_tag LOCUS_13650 1273 356 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066162.1 protein_id gnl|my_center|LOCUS_13650 2007 1297 gene locus_tag LOCUS_13660 gene ubiE 2007 1297 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_13660 2071 2550 gene locus_tag LOCUS_13670 gene upfY 2071 2550 CDS product capsular polysaccharide transcription antiterminator UpfY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202460.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence241 1067 156 gene locus_tag LOCUS_13680 1067 156 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_13680 2587 1067 gene locus_tag LOCUS_13690 gene gpmI 2587 1067 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence242 2746 1748 gene locus_tag LOCUS_13700 gene gap 2746 1748 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_13700 2844 3671 gene locus_tag LOCUS_13710 gene surE 2844 3671 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812070.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence243 >Feature sequence244 <1 675 gene locus_tag LOCUS_13720 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202321.1:site-specific integrase 682 1716 gene locus_tag LOCUS_13730 682 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1861 2322 gene locus_tag LOCUS_13740 1861 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2326 3261 gene locus_tag LOCUS_13750 2326 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence245 <1 628 gene locus_tag LOCUS_13760 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767234.1:glycosyltransferase family 4 protein 625 1503 gene locus_tag LOCUS_13770 625 1503 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_13770 1500 2045 gene locus_tag LOCUS_13780 1500 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2045 2701 gene locus_tag LOCUS_13790 2045 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence246 2525 150 gene locus_tag LOCUS_13800 2525 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence247 995 42 gene locus_tag LOCUS_13810 995 42 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_13810 1603 992 gene locus_tag LOCUS_13820 1603 992 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_13820 1925 1620 gene locus_tag LOCUS_13830 1925 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 <3718 1930 gene locus_tag LOCUS_13840 <3718 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765710.1:aspartate--tRNA ligase >Feature sequence248 2501 1902 gene locus_tag LOCUS_13850 2501 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence249 390 4 gene locus_tag LOCUS_13860 390 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1505 396 gene locus_tag LOCUS_13870 1505 396 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810429.1 protein_id gnl|my_center|LOCUS_13870 1579 2841 gene locus_tag LOCUS_13880 1579 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 <3689 2842 gene locus_tag LOCUS_13890 <3689 2842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203666.1:metallophosphoesterase >Feature sequence250 28 816 gene locus_tag LOCUS_13900 28 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13900 892 1239 gene locus_tag LOCUS_13910 892 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13910 3246 1582 gene locus_tag LOCUS_13920 3246 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3589 3455 gene locus_tag LOCUS_13930 3589 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence251 <3659 671 gene locus_tag LOCUS_13940 <3659 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107268.1:TonB-dependent receptor >Feature sequence252 2849 3286 gene locus_tag LOCUS_13950 2849 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence253 <1 688 gene locus_tag LOCUS_13960 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760986.1:twin-arginine translocase subunit TatC 675 2576 gene locus_tag LOCUS_13970 675 2576 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_13970 2581 3510 gene locus_tag LOCUS_13980 2581 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence254 484 245 gene locus_tag LOCUS_13990 gene yidD 484 245 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_13990 687 481 gene locus_tag LOCUS_14000 687 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1568 834 gene locus_tag LOCUS_14010 1568 834 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_14010 2269 1565 gene locus_tag LOCUS_14020 2269 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2617 2273 gene locus_tag LOCUS_14030 2617 2273 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_14030 3425 2619 gene locus_tag LOCUS_14040 3425 2619 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279795.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence255 <1 588 gene locus_tag LOCUS_14050 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107765.1:cytochrome c nitrite reductase small subunit 600 2105 gene locus_tag LOCUS_14060 gene nrfA 600 2105 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_14060 2111 2578 gene locus_tag LOCUS_14070 2111 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14070 2645 2998 gene locus_tag LOCUS_14080 2645 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14080 >Feature sequence256 151 402 gene locus_tag LOCUS_14090 151 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3228 364 gene locus_tag LOCUS_14100 3228 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 3404 3243 gene locus_tag LOCUS_14110 3404 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence257 2212 650 gene locus_tag LOCUS_14120 2212 650 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_14120 2776 2297 gene locus_tag LOCUS_14130 2776 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 <3593 2773 gene locus_tag LOCUS_14140 <3593 2773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963929.1:quinone-dependent dihydroorotate dehydrogenase >Feature sequence258 1698 46 gene locus_tag LOCUS_14150 1698 46 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_14150 1954 1700 gene locus_tag LOCUS_14160 1954 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 <3593 1956 gene locus_tag LOCUS_14170 <3593 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055269995.1:TonB-dependent receptor >Feature sequence259 <1 1818 gene locus_tag LOCUS_14180 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001126116.1:carbamoyl-phosphate synthase large subunit 1818 2546 gene locus_tag LOCUS_14190 1818 2546 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_14190 2540 3454 gene locus_tag LOCUS_14200 2540 3454 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence260 2773 1046 gene locus_tag LOCUS_14210 2773 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2895 2767 gene locus_tag LOCUS_14220 2895 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence261 <1 726 gene locus_tag LOCUS_14230 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107406.1:DUF4301 family protein 1382 729 gene locus_tag LOCUS_14240 1382 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2209 1379 gene locus_tag LOCUS_14250 2209 1379 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_14250 <3520 2202 gene locus_tag LOCUS_14260 <3520 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695721.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence262 3357 2803 gene locus_tag LOCUS_14270 gene ruvC 3357 2803 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence263 820 266 gene locus_tag LOCUS_14280 820 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1027 2481 gene locus_tag LOCUS_14290 1027 2481 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence264 1079 1849 gene locus_tag LOCUS_14300 1079 1849 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_14300 1856 3415 gene locus_tag LOCUS_14310 1856 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence265 1871 1728 gene locus_tag LOCUS_14320 1871 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2925 1879 gene locus_tag LOCUS_14330 2925 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence266 2576 1371 gene locus_tag LOCUS_14340 2576 1371 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence267 1672 392 gene locus_tag LOCUS_14350 1672 392 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_14350 2272 1820 gene locus_tag LOCUS_14360 gene dtd 2272 1820 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_14360 2933 2280 gene locus_tag LOCUS_14370 2933 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence268 848 303 gene locus_tag LOCUS_14380 848 303 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_14380 1385 915 gene locus_tag LOCUS_14390 gene coaD 1385 915 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_14390 1427 2095 gene locus_tag LOCUS_14400 gene ung 1427 2095 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067035.1 protein_id gnl|my_center|LOCUS_14400 2140 2814 gene locus_tag LOCUS_14410 2140 2814 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence269 2 466 gene locus_tag LOCUS_14420 2 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 468 896 gene locus_tag LOCUS_14430 468 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 917 1777 gene locus_tag LOCUS_14440 917 1777 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_14440 1777 3156 gene locus_tag LOCUS_14450 gene gltA 1777 3156 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence270 1785 433 gene locus_tag LOCUS_14460 1785 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_14460 1962 2780 gene locus_tag LOCUS_14470 1962 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence271 54 2657 gene locus_tag LOCUS_14480 54 2657 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence272 <1 1113 gene locus_tag LOCUS_14490 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168196249.1:LuxR C-terminal-related transcriptional regulator 1136 2536 gene locus_tag LOCUS_14500 1136 2536 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201962.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence273 <1 1823 gene locus_tag LOCUS_14510 <1 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202942.1:S9 family peptidase 1827 2555 gene locus_tag LOCUS_14520 1827 2555 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence274 <1 859 gene locus_tag LOCUS_14530 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005776885.1:energy-dependent translational throttle protein EttA 908 1636 gene locus_tag LOCUS_14540 908 1636 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence275 310 1920 gene locus_tag LOCUS_14550 310 1920 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015673.1 protein_id gnl|my_center|LOCUS_14550 2558 2118 gene locus_tag LOCUS_14560 2558 2118 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_14560 <3399 2587 gene locus_tag LOCUS_14570 <3399 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105100251.1:V-type ATPase 116kDa subunit family protein >Feature sequence276 76 2 gene locus_tag LOCUS_t00210 76 2 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1228 146 gene locus_tag LOCUS_14580 1228 146 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_14580 1338 1718 gene locus_tag LOCUS_14590 1338 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 1730 2329 gene locus_tag LOCUS_14600 1730 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence277 1318 227 gene locus_tag LOCUS_14610 1318 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 1475 2908 gene locus_tag LOCUS_14620 gene rlmD 1475 2908 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence278 882 1931 gene locus_tag LOCUS_14630 882 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3387 1924 gene locus_tag LOCUS_14640 3387 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence279 163 26 gene locus_tag LOCUS_14650 163 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2867 180 gene locus_tag LOCUS_14660 2867 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3026 2871 gene locus_tag LOCUS_14670 3026 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence280 7 783 gene locus_tag LOCUS_14680 7 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 800 937 gene locus_tag LOCUS_14690 800 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 950 3259 gene locus_tag LOCUS_14700 950 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence281 603 2558 gene locus_tag LOCUS_14710 603 2558 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence282 <1 1045 gene locus_tag LOCUS_14720 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107663.1:AMP-binding protein 1042 1443 gene locus_tag LOCUS_14730 1042 1443 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_14730 1445 2971 gene locus_tag LOCUS_14740 1445 2971 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764456.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence283 5 826 gene locus_tag LOCUS_14750 5 826 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 protein_id gnl|my_center|LOCUS_14750 1491 820 gene locus_tag LOCUS_14760 1491 820 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_14760 2544 1507 gene locus_tag LOCUS_14770 2544 1507 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence284 1449 202 gene locus_tag LOCUS_14780 1449 202 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_14780 2657 1392 gene locus_tag LOCUS_14790 2657 1392 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_14790 <3350 2641 gene locus_tag LOCUS_14800 <3350 2641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201993.1:SpoIID/LytB domain-containing protein >Feature sequence285 1372 572 gene locus_tag LOCUS_14810 1372 572 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767449.1 protein_id gnl|my_center|LOCUS_14810 1612 1376 gene locus_tag LOCUS_14820 1612 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2492 1614 gene locus_tag LOCUS_14830 2492 1614 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence286 2847 1141 gene locus_tag LOCUS_14840 2847 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence287 <1 3077 gene locus_tag LOCUS_14850 <1 3077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108912.1:fimbrillin family protein >Feature sequence288 1377 2306 gene locus_tag LOCUS_14860 1377 2306 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_14860 2761 2381 gene locus_tag LOCUS_14870 2761 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence289 91 1452 gene locus_tag LOCUS_14880 91 1452 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_14880 2055 1498 gene locus_tag LOCUS_14890 2055 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3151 2093 gene locus_tag LOCUS_14900 3151 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 >Feature sequence290 792 436 gene locus_tag LOCUS_14910 792 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence291 1631 588 gene locus_tag LOCUS_14920 1631 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3089 1635 gene locus_tag LOCUS_14930 3089 1635 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence292 777 1013 gene locus_tag LOCUS_14940 777 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2813 3034 gene locus_tag LOCUS_14950 2813 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence293 >Feature sequence294 479 679 gene locus_tag LOCUS_14960 479 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 676 1005 gene locus_tag LOCUS_14970 676 1005 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784907.1 protein_id gnl|my_center|LOCUS_14970 998 1975 gene locus_tag LOCUS_14980 998 1975 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015531930.1 protein_id gnl|my_center|LOCUS_14980 <3236 2455 gene locus_tag LOCUS_14990 <3236 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003581611.1:alpha/beta hydrolase >Feature sequence295 <1 972 gene locus_tag LOCUS_15000 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760893.1:TonB-dependent receptor 1083 1010 gene locus_tag LOCUS_t00220 1083 1010 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1634 1158 gene locus_tag LOCUS_15010 gene ispF 1634 1158 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_15010 2241 1636 gene locus_tag LOCUS_15020 gene rsxA 2241 1636 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_15020 2825 2244 gene locus_tag LOCUS_15030 2825 2244 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence296 619 1578 gene locus_tag LOCUS_15040 619 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1921 1658 gene locus_tag LOCUS_15050 1921 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2002 3066 gene locus_tag LOCUS_15060 2002 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence297 3096 2203 gene locus_tag LOCUS_15070 gene fabD 3096 2203 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_15070 3138 3210 gene locus_tag LOCUS_t00230 3138 3210 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence298 815 9 gene locus_tag LOCUS_15080 815 9 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279795.1 protein_id gnl|my_center|LOCUS_15080 1615 812 gene locus_tag LOCUS_15090 1615 812 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921844.1 protein_id gnl|my_center|LOCUS_15090 1896 2483 gene locus_tag LOCUS_15100 1896 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence299 >Feature sequence300 <1 1263 gene locus_tag LOCUS_15110 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790424.1:ribonuclease Y 2132 1344 gene locus_tag LOCUS_15120 2132 1344 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453864.1 protein_id gnl|my_center|LOCUS_15120 <3201 2135 gene locus_tag LOCUS_15130 <3201 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027423.1:FAD-dependent oxidoreductase >Feature sequence301 <1 771 gene locus_tag LOCUS_15140 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785877.1:TrpB-like pyridoxal phosphate-dependent enzyme 1818 790 gene locus_tag LOCUS_15150 1818 790 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_15150 2679 1828 gene locus_tag LOCUS_15160 2679 1828 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_15160 <3197 2669 gene locus_tag LOCUS_15170 <3197 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964216.1:shikimate kinase >Feature sequence302 <1 2251 gene locus_tag LOCUS_15180 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766219.1:subtilase family N-terminal domain-containing protein 2258 3103 gene locus_tag LOCUS_15190 2258 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence303 909 454 gene locus_tag LOCUS_15200 909 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2021 906 gene locus_tag LOCUS_15210 2021 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2578 2024 gene locus_tag LOCUS_15220 2578 2024 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence304 2710 209 gene locus_tag LOCUS_15230 2710 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence305 1239 151 gene locus_tag LOCUS_15240 1239 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1415 2605 gene locus_tag LOCUS_15250 1415 2605 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence306 1459 521 gene locus_tag LOCUS_15260 1459 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1775 2128 gene locus_tag LOCUS_15270 1775 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence307 1956 679 gene locus_tag LOCUS_15280 1956 679 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_15280 2865 1960 gene locus_tag LOCUS_15290 gene cysD 2865 1960 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence308 <3151 197 gene locus_tag LOCUS_15300 <3151 197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860311.1:GLUG motif-containing protein >Feature sequence309 <1 2057 gene locus_tag LOCUS_15310 <1 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072067209.1:GH92 family glycosyl hydrolase >Feature sequence310 2965 17 gene locus_tag LOCUS_15320 2965 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence311 909 1334 gene locus_tag LOCUS_15330 909 1334 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108669.1 protein_id gnl|my_center|LOCUS_15330 2954 1323 gene locus_tag LOCUS_15340 2954 1323 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence312 2195 3 gene locus_tag LOCUS_15350 2195 3 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence313 1723 929 gene locus_tag LOCUS_15360 1723 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2685 1720 gene locus_tag LOCUS_15370 2685 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence314 809 1063 gene locus_tag LOCUS_15380 809 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence315 1600 335 gene locus_tag LOCUS_15390 1600 335 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_15390 <3099 1636 gene locus_tag LOCUS_15400 <3099 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107463.1:BamA/TamA family outer membrane protein >Feature sequence316 <1 1653 gene locus_tag LOCUS_15410 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789604.1:excinuclease ABC subunit UvrA 1650 2819 gene locus_tag LOCUS_15420 1650 2819 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence317 <1 852 gene locus_tag LOCUS_15430 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860311.1:GLUG motif-containing protein 969 1568 gene locus_tag LOCUS_15440 969 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_15440 1561 2133 gene locus_tag LOCUS_15450 1561 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence318 <1 1030 gene locus_tag LOCUS_15460 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964061.1:urocanate hydratase 1027 2514 gene locus_tag LOCUS_15470 gene hutH 1027 2514 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797649.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence319 2376 403 gene locus_tag LOCUS_15480 2376 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2510 2373 gene locus_tag LOCUS_15490 2510 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence320 1150 1899 gene locus_tag LOCUS_15500 1150 1899 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_15500 2505 1903 gene locus_tag LOCUS_15510 2505 1903 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761975.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence321 116 2125 gene locus_tag LOCUS_15520 116 2125 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_15520 <2985 2110 gene locus_tag LOCUS_15530 <2985 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963738.1:tRNA lysidine(34) synthetase TilS >Feature sequence322 1865 231 gene locus_tag LOCUS_15540 1865 231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_15540 2134 1865 gene locus_tag LOCUS_15550 2134 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2589 2131 gene locus_tag LOCUS_15560 2589 2131 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence323 1043 615 gene locus_tag LOCUS_15570 1043 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 1097 1708 gene locus_tag LOCUS_15580 1097 1708 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_15580 1761 2810 gene locus_tag LOCUS_15590 gene queA 1761 2810 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence324 1751 1155 gene locus_tag LOCUS_15600 1751 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <2951 2219 gene locus_tag LOCUS_15610 <2951 2219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963142.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence325 218 790 gene locus_tag LOCUS_15620 218 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1656 808 gene locus_tag LOCUS_15630 1656 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 <2940 1714 gene locus_tag LOCUS_15640 <2940 1714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072114.1:DNA recombination protein RmuC >Feature sequence326 2278 965 gene locus_tag LOCUS_15650 gene kbaZ 2278 965 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098887.1 protein_id gnl|my_center|LOCUS_15650 <2937 2290 gene locus_tag LOCUS_15660 <2937 2290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082995.1:sn-glycerol-1-phosphate dehydrogenase >Feature sequence327 >Feature sequence328 1507 506 gene locus_tag LOCUS_15670 gene thiL 1507 506 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence329 3 1070 gene locus_tag LOCUS_15680 3 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1183 1389 gene locus_tag LOCUS_15690 gene rpmB 1183 1389 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_15690 1401 1589 gene locus_tag LOCUS_15700 gene rpmG 1401 1589 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_15700 1607 1768 gene locus_tag LOCUS_15710 1607 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1854 2732 gene locus_tag LOCUS_15720 gene ftsY 1854 2732 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence330 <1 2251 gene locus_tag LOCUS_15730 <1 2251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766219.1:subtilase family N-terminal domain-containing protein >Feature sequence331 1331 132 gene locus_tag LOCUS_15740 1331 132 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_15740 2803 1337 gene locus_tag LOCUS_15750 2803 1337 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180983106.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence332 1648 950 gene locus_tag LOCUS_15760 1648 950 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_15760 2680 1655 gene locus_tag LOCUS_15770 2680 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence333 94 2295 gene locus_tag LOCUS_15780 gene nrdD 94 2295 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_15780 2288 2740 gene locus_tag LOCUS_15790 2288 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2788 2861 gene locus_tag LOCUS_t00240 2788 2861 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence334 188 751 gene locus_tag LOCUS_15800 188 751 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence335 2279 1074 gene locus_tag LOCUS_15810 2279 1074 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence336 122 685 gene locus_tag LOCUS_15820 122 685 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence337 635 1654 gene locus_tag LOCUS_15830 gene galE 635 1654 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence338 425 1666 gene locus_tag LOCUS_15840 425 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1927 1745 gene locus_tag LOCUS_15850 1927 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2807 1998 gene locus_tag LOCUS_15860 2807 1998 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435784.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence339 1170 1820 gene locus_tag LOCUS_15870 gene queC 1170 1820 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533307.1 protein_id gnl|my_center|LOCUS_15870 1827 2159 gene locus_tag LOCUS_15880 gene queD 1827 2159 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790409.1 protein_id gnl|my_center|LOCUS_15880 2159 2731 gene locus_tag LOCUS_15890 2159 2731 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence340 >Feature sequence341 >Feature sequence342 1149 169 gene locus_tag LOCUS_15900 1149 169 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_15900 <2790 1357 gene locus_tag LOCUS_15910 <2790 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816446.1:endonuclease/exonuclease/phosphatase family protein >Feature sequence343 203 988 gene locus_tag LOCUS_15920 203 988 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_15920 991 1602 gene locus_tag LOCUS_15930 991 1602 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_15930 1615 2229 gene locus_tag LOCUS_15940 gene nqrE 1615 2229 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence344 <1 864 gene locus_tag LOCUS_15950 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707892.1:cysteine desulfurase 861 1271 gene locus_tag LOCUS_15960 861 1271 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_15960 1264 1620 gene locus_tag LOCUS_15970 1264 1620 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_15970 1617 2069 gene locus_tag LOCUS_15980 gene folK 1617 2069 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_15980 2211 2666 gene locus_tag LOCUS_15990 2211 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence345 2516 432 gene locus_tag LOCUS_16000 2516 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence346 562 11 gene locus_tag LOCUS_16010 562 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 677 2437 gene locus_tag LOCUS_16020 677 2437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence347 1418 324 gene locus_tag LOCUS_16030 gene pheA 1418 324 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583989.1 protein_id gnl|my_center|LOCUS_16030 1627 1493 gene locus_tag LOCUS_16040 1627 1493 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_16040 1895 2332 gene locus_tag LOCUS_16050 1895 2332 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence348 2447 1260 gene locus_tag LOCUS_16060 2447 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence349 <1 822 gene locus_tag LOCUS_16070 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963824.1:endopeptidase La 1129 893 gene locus_tag LOCUS_16080 1129 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1922 1107 gene locus_tag LOCUS_16090 1922 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 <2739 1977 gene locus_tag LOCUS_16100 <2739 1977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584016.1:serpin family protein >Feature sequence350 231 40 gene locus_tag LOCUS_16110 231 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 787 314 gene locus_tag LOCUS_16120 787 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 <2737 1057 gene locus_tag LOCUS_16130 <2737 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109138.1:beta-galactosidase >Feature sequence351 1 378 gene locus_tag LOCUS_16140 1 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1753 371 gene locus_tag LOCUS_16150 gene radA 1753 371 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_16150 2624 1743 gene locus_tag LOCUS_16160 2624 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 >Feature sequence352 <2713 197 gene locus_tag LOCUS_16170 <2713 197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113036.1:GLUG motif-containing protein >Feature sequence353 1063 2415 gene locus_tag LOCUS_16180 gene hisS 1063 2415 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_16180 2485 2558 gene locus_tag LOCUS_t00250 2485 2558 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence354 1438 737 gene locus_tag LOCUS_16190 1438 737 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_16190 2470 1445 gene locus_tag LOCUS_16200 2470 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence355 2145 2023 gene locus_tag LOCUS_16210 2145 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence356 2506 239 gene locus_tag LOCUS_16220 2506 239 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022605.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence357 <1 885 gene locus_tag LOCUS_16230 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796464.1:TolC family protein 882 1907 gene locus_tag LOCUS_16240 882 1907 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence358 >Feature sequence359 691 68 gene locus_tag LOCUS_16250 691 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 <2622 691 gene locus_tag LOCUS_16260 <2622 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202920.1:phenylalanine--tRNA ligase subunit beta >Feature sequence360 <1 1013 gene locus_tag LOCUS_16270 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769080.1:DUF5119 domain-containing protein 1016 2101 gene locus_tag LOCUS_16280 1016 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence361 595 1857 gene locus_tag LOCUS_16290 595 1857 CDS product anaerobic sulfatase-maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789094.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence362 1825 827 gene locus_tag LOCUS_16300 1825 827 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence363 504 151 gene locus_tag LOCUS_16310 504 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1365 1030 gene locus_tag LOCUS_16320 1365 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 <2575 1381 gene locus_tag LOCUS_16330 <2575 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107228.1:nucleoside-diphosphate sugar epimerase/dehydratase >Feature sequence364 876 2078 gene locus_tag LOCUS_16340 876 2078 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence365 351 1886 gene locus_tag LOCUS_16350 351 1886 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_16350 <2572 1883 gene locus_tag LOCUS_16360 <2572 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055217507.1:lytic transglycosylase domain-containing protein >Feature sequence366 1529 2128 gene locus_tag LOCUS_16370 gene upp 1529 2128 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437840.1 protein_id gnl|my_center|LOCUS_16370 2566 2138 gene locus_tag LOCUS_16380 2566 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence367 1192 446 gene locus_tag LOCUS_16390 gene murI 1192 446 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence368 253 1071 gene locus_tag LOCUS_16400 253 1071 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence369 <2554 433 gene locus_tag LOCUS_16410 <2554 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein >Feature sequence370 1067 231 gene locus_tag LOCUS_16420 1067 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence371 430 1311 gene locus_tag LOCUS_16430 gene lgt 430 1311 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_16430 2003 1314 gene locus_tag LOCUS_16440 2003 1314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence372 >Feature sequence373 1797 751 gene locus_tag LOCUS_16450 1797 751 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_16450 <2531 1817 gene locus_tag LOCUS_16460 <2531 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027423.1:FAD-dependent oxidoreductase >Feature sequence374 1570 185 gene locus_tag LOCUS_16470 1570 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 <2527 1675 gene locus_tag LOCUS_16480 <2527 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108647.1:sialate O-acetylesterase note possible pseudo, frameshifted >Feature sequence375 25 2271 gene locus_tag LOCUS_16490 25 2271 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence376 2110 911 gene locus_tag LOCUS_16500 2110 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2515 2165 gene locus_tag LOCUS_16510 2515 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence377 <1 1992 gene locus_tag LOCUS_16520 <1 1992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108335.1:glycoside hydrolase family 78 protein >Feature sequence378 >Feature sequence379 >Feature sequence380 125 1222 gene locus_tag LOCUS_16530 125 1222 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence381 <1 786 gene locus_tag LOCUS_16540 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963938.1:metallophosphatase 790 1677 gene locus_tag LOCUS_16550 790 1677 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence382 2212 797 gene locus_tag LOCUS_16560 gene uxaC 2212 797 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence383 <2475 1207 gene locus_tag LOCUS_16570 <2475 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765142.1:TonB-dependent receptor >Feature sequence384 2041 419 gene locus_tag LOCUS_16580 gene groL 2041 419 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_16580 2310 2044 gene locus_tag LOCUS_16590 2310 2044 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence385 57 1928 gene locus_tag LOCUS_16600 57 1928 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_16600 <2473 1942 gene locus_tag LOCUS_16610 <2473 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109177.1:M3 family metallopeptidase >Feature sequence386 345 2306 gene locus_tag LOCUS_16620 345 2306 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence387 1530 367 gene locus_tag LOCUS_16630 1530 367 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993669.1 protein_id gnl|my_center|LOCUS_16630 2323 1544 gene locus_tag LOCUS_16640 2323 1544 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674858.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence388 2345 1176 gene locus_tag LOCUS_16650 2345 1176 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence389 <1 1995 gene locus_tag LOCUS_16660 <1 1995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461428.1:InlB B-repeat-containing protein 2157 2294 gene locus_tag LOCUS_16670 2157 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence390 <1 915 gene locus_tag LOCUS_16680 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202193.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase 1038 1862 gene locus_tag LOCUS_16690 1038 1862 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002332402.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence391 446 1984 gene locus_tag LOCUS_16700 446 1984 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680054.1 protein_id gnl|my_center|LOCUS_16700 2111 2036 gene locus_tag LOCUS_t00260 2111 2036 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence392 451 1581 gene locus_tag LOCUS_16710 gene murG 451 1581 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence393 1713 658 gene locus_tag LOCUS_16720 1713 658 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226428.1 protein_id gnl|my_center|LOCUS_16720 <2416 1703 gene locus_tag LOCUS_16730 <2416 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902958.1:MATE family efflux transporter >Feature sequence394 1471 401 gene locus_tag LOCUS_16740 1471 401 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772519.1 protein_id gnl|my_center|LOCUS_16740 <2412 1534 gene locus_tag LOCUS_16750 <2412 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787210.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F >Feature sequence395 1557 472 gene locus_tag LOCUS_16760 1557 472 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence396 <1 2382 gene locus_tag LOCUS_16770 <1 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405558.1:histidine kinase >Feature sequence397 1589 360 gene locus_tag LOCUS_16780 1589 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 <2377 1664 gene locus_tag LOCUS_16790 <2377 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767105.1:NPCBM/NEW2 domain-containing protein >Feature sequence398 1246 1109 gene locus_tag LOCUS_16800 1246 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 <2372 1269 gene locus_tag LOCUS_16810 <2372 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054959405.1:Sb-PDE family phosphodiesterase >Feature sequence399 <1 588 gene locus_tag LOCUS_16820 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760772.1:IMP dehydrogenase 610 1593 gene locus_tag LOCUS_16830 610 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence400 438 181 gene locus_tag LOCUS_16840 438 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1426 440 gene locus_tag LOCUS_16850 1426 440 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_16850 2027 1428 gene locus_tag LOCUS_16860 gene yihA 2027 1428 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence401 2066 1101 gene locus_tag LOCUS_16870 2066 1101 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107159.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence402 <1 1087 gene locus_tag LOCUS_16880 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784854.1:lipid-A-disaccharide synthase 1084 1860 gene locus_tag LOCUS_16890 1084 1860 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107141.1 protein_id gnl|my_center|LOCUS_16890 2341 1844 gene locus_tag LOCUS_16900 2341 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence403 531 2078 gene locus_tag LOCUS_16910 531 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence404 533 606 gene locus_tag LOCUS_t00270 533 606 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1390 659 gene locus_tag LOCUS_16920 1390 659 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_16920 2328 1396 gene locus_tag LOCUS_16930 2328 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence405 <1 630 gene locus_tag LOCUS_16940 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761051.1:energy transducer TonB 698 1870 gene locus_tag LOCUS_16950 gene hflX 698 1870 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence406 1677 337 gene locus_tag LOCUS_16960 1677 337 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_16960 <2317 1679 gene locus_tag LOCUS_16970 <2317 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203639.1:4Fe-4S binding protein >Feature sequence407 1436 252 gene locus_tag LOCUS_16980 1436 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence408 526 918 gene locus_tag LOCUS_16990 526 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1985 969 gene locus_tag LOCUS_17000 1985 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence409 1 159 gene locus_tag LOCUS_17010 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 324 947 gene locus_tag LOCUS_17020 324 947 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_17020 1117 2046 gene locus_tag LOCUS_17030 1117 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence410 2299 848 gene locus_tag LOCUS_17040 2299 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence411 701 823 gene locus_tag LOCUS_17050 701 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence412 111 524 gene locus_tag LOCUS_17060 111 524 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209627004.1 protein_id gnl|my_center|LOCUS_17060 1554 487 gene locus_tag LOCUS_17070 1554 487 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence413 995 42 gene locus_tag LOCUS_17080 995 42 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_17080 1974 982 gene locus_tag LOCUS_17090 1974 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence414 <2281 536 gene locus_tag LOCUS_17100 <2281 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966681.1:GH3 auxin-responsive promoter family protein >Feature sequence415 2205 1078 gene locus_tag LOCUS_17110 2205 1078 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence416 >Feature sequence417 2169 1147 gene locus_tag LOCUS_17120 2169 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence418 77 1504 gene locus_tag LOCUS_17130 77 1504 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence419 1649 171 gene locus_tag LOCUS_17140 1649 171 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence420 2227 839 gene locus_tag LOCUS_17150 2227 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence421 1609 1031 gene locus_tag LOCUS_17160 1609 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 <2223 1596 gene locus_tag LOCUS_17170 <2223 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211491.1:anaerobic glycerol-3-phosphate dehydrogenase subunit A >Feature sequence422 201 64 gene locus_tag LOCUS_17180 201 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1814 207 gene locus_tag LOCUS_17190 1814 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1959 1828 gene locus_tag LOCUS_17200 1959 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence423 2149 1481 gene locus_tag LOCUS_17210 2149 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence424 1013 78 gene locus_tag LOCUS_17220 1013 78 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence425 288 692 gene locus_tag LOCUS_17230 288 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1649 759 gene locus_tag LOCUS_17240 gene deoC 1649 759 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence426 1080 583 gene locus_tag LOCUS_17250 1080 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 <2187 1092 gene locus_tag LOCUS_17260 <2187 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202242.1:DNA translocase FtsK >Feature sequence427 3 767 gene locus_tag LOCUS_17270 3 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 769 1242 gene locus_tag LOCUS_17280 769 1242 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_17280 1730 1317 gene locus_tag LOCUS_17290 1730 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence428 272 583 gene locus_tag LOCUS_17300 gene rplU 272 583 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_17300 589 852 gene locus_tag LOCUS_17310 gene rpmA 589 852 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence429 >Feature sequence430 <1 908 gene locus_tag LOCUS_17320 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107187.1:YgiQ family radical SAM protein 911 1882 gene locus_tag LOCUS_17330 911 1882 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence431 1356 7 gene locus_tag LOCUS_17340 1356 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 <2169 1446 gene locus_tag LOCUS_17350 <2169 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762587.1:sodium-dependent transporter >Feature sequence432 1111 770 gene locus_tag LOCUS_17360 1111 770 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_17360 <2166 1111 gene locus_tag LOCUS_17370 <2166 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948194.1:FAD-dependent oxidoreductase >Feature sequence433 <2159 749 gene locus_tag LOCUS_17380 <2159 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870575.1:UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase >Feature sequence434 322 612 gene locus_tag LOCUS_17390 322 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 628 1950 gene locus_tag LOCUS_17400 628 1950 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_17400 >Feature sequence435 <1 2001 gene locus_tag LOCUS_17410 <1 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109139.1:glycosyl hydrolase family 28 protein >Feature sequence436 <1 1133 gene locus_tag LOCUS_17420 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787605.1:alpha amylase C-terminal domain-containing protein >Feature sequence437 >Feature sequence438 357 980 gene locus_tag LOCUS_17430 357 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1758 1276 gene locus_tag LOCUS_17440 1758 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence439 2003 312 gene locus_tag LOCUS_17450 2003 312 CDS product calcineurin-like phosphoesterase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766056.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence440 >Feature sequence441 >Feature sequence442 1316 234 gene locus_tag LOCUS_17460 1316 234 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_17460 <2104 1318 gene locus_tag LOCUS_17470 <2104 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766006.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence443 859 98 gene locus_tag LOCUS_17480 859 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence444 >Feature sequence445 1890 712 gene locus_tag LOCUS_17490 gene pncB 1890 712 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766265.1 protein_id gnl|my_center|LOCUS_17490 2090 1902 gene locus_tag LOCUS_17500 2090 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence446 <2087 323 gene locus_tag LOCUS_17510 <2087 323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202910.1:3'-5' exonuclease >Feature sequence447 1458 754 gene locus_tag LOCUS_17520 1458 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence448 >Feature sequence449 575 1855 gene locus_tag LOCUS_17530 gene fabF 575 1855 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence450 >Feature sequence451 <2028 766 gene locus_tag LOCUS_17540 <2028 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761732.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence452 >Feature sequence453 1 759 gene locus_tag LOCUS_17550 1 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence454 >Feature sequence455 >Feature sequence456 <2011 227 gene locus_tag LOCUS_17560 <2011 227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence457 >Feature sequence458 >Feature sequence459 1712 120 gene locus_tag LOCUS_17570 1712 120 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence460 >Feature sequence461 1341 211 gene locus_tag LOCUS_17580 1341 211 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_17580 1649 1338 gene locus_tag LOCUS_17590 1649 1338 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767134.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence462 1333 536 gene locus_tag LOCUS_17600 1333 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1930 1397 gene locus_tag LOCUS_17610 1930 1397 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence463 1834 782 gene locus_tag LOCUS_17620 1834 782 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence464 440 1582 gene locus_tag LOCUS_17630 440 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence465 >Feature sequence466 421 573 gene locus_tag LOCUS_17640 gene rpmH 421 573 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_17640 669 1319 gene locus_tag LOCUS_17650 669 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1462 1387 gene locus_tag LOCUS_t00280 1462 1387 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence467 980 1417 gene locus_tag LOCUS_17660 980 1417 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005641953.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence468 1651 1938 gene locus_tag LOCUS_17670 1651 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence469 <1 1461 gene locus_tag LOCUS_17680 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107896.1:arylsulfatase >Feature sequence470 1269 220 gene locus_tag LOCUS_17690 1269 220 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence471 415 690 gene locus_tag LOCUS_17700 415 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence472 >Feature sequence473 1108 155 gene locus_tag LOCUS_17710 1108 155 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_17710 1952 1113 gene locus_tag LOCUS_17720 1952 1113 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence474 284 93 gene locus_tag LOCUS_17730 284 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 573 1802 gene locus_tag LOCUS_17740 573 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence475 <1944 989 gene locus_tag LOCUS_17750 <1944 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434910.1:class I SAM-dependent methyltransferase >Feature sequence476 <1943 102 gene locus_tag LOCUS_17760 <1943 102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005680416.1:fimbrillin family protein >Feature sequence477 <1 648 gene locus_tag LOCUS_17770 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027423.1:FAD-dependent oxidoreductase >Feature sequence478 1150 68 gene locus_tag LOCUS_17780 1150 68 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_17780 <1938 1152 gene locus_tag LOCUS_17790 <1938 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766006.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence479 454 170 gene locus_tag LOCUS_17800 454 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 726 457 gene locus_tag LOCUS_17810 726 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <1926 751 gene locus_tag LOCUS_17820 <1926 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107286.1:nucleotidyltransferase family protein >Feature sequence480 109 852 gene locus_tag LOCUS_17830 109 852 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706750.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence481 <1 920 gene locus_tag LOCUS_17840 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438014.1:ABC transporter ATP-binding protein 923 1786 gene locus_tag LOCUS_17850 923 1786 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence482 <1 926 gene locus_tag LOCUS_17860 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962828.1:ABC transporter permease 928 1752 gene locus_tag LOCUS_17870 928 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence483 831 31 gene locus_tag LOCUS_17880 831 31 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_17880 904 1671 gene locus_tag LOCUS_17890 gene folP 904 1671 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence484 314 389 gene locus_tag LOCUS_t00290 314 389 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <1916 441 gene locus_tag LOCUS_17900 <1916 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680054.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence485 <1901 302 gene locus_tag LOCUS_17910 <1901 302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109177.1:M3 family metallopeptidase >Feature sequence486 >Feature sequence487 >Feature sequence488 1816 1889 gene locus_tag LOCUS_t00300 1816 1889 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence489 >Feature sequence490 >Feature sequence491 247 1614 gene locus_tag LOCUS_17920 247 1614 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence492 <1 1230 gene locus_tag LOCUS_17930 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766607.1:MATE family efflux transporter 1233 1847 gene locus_tag LOCUS_17940 1233 1847 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence493 >Feature sequence494 1756 857 gene locus_tag LOCUS_17950 1756 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17950 >Feature sequence495 <1 739 gene locus_tag LOCUS_17960 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762954.1:cysteine--tRNA ligase 741 1715 gene locus_tag LOCUS_17970 741 1715 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence496 <1 748 gene locus_tag LOCUS_17980 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008661626.1:YifB family Mg chelatase-like AAA ATPase 1036 1380 gene locus_tag LOCUS_17990 1036 1380 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence497 >Feature sequence498 >Feature sequence499 <1 1141 gene locus_tag LOCUS_18000 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062695564.1:family 20 glycosylhydrolase >Feature sequence500 <1 877 gene locus_tag LOCUS_18010 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763952.1:radical SAM family heme chaperone HemW >Feature sequence501 1645 491 gene locus_tag LOCUS_18020 gene cls 1645 491 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence502 160 1812 gene locus_tag LOCUS_18030 160 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence503 <1 1164 gene locus_tag LOCUS_18040 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022835601.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence504 <1 1184 gene locus_tag LOCUS_18050 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964213.1:3-phosphoshikimate 1-carboxyvinyltransferase <1820 1203 gene locus_tag LOCUS_18060 <1820 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767612.1:sodium-translocating pyrophosphatase >Feature sequence505 >Feature sequence506 <1807 835 gene locus_tag LOCUS_18070 <1807 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785386.1:family 20 glycosylhydrolase >Feature sequence507 228 1709 gene locus_tag LOCUS_18080 228 1709 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence508 <1 609 gene locus_tag LOCUS_18090 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760990.1:glycoside hydrolase family 88 protein >Feature sequence509 516 591 gene locus_tag LOCUS_t00310 516 591 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1526 1014 gene locus_tag LOCUS_18100 1526 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence510 1178 132 gene locus_tag LOCUS_18110 1178 132 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_18110 <1789 1179 gene locus_tag LOCUS_18120 <1789 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790721.1:FKBP-type peptidyl-prolyl cis-trans isomerase >Feature sequence511 >Feature sequence512 <1778 490 gene locus_tag LOCUS_18130 <1778 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118830048.1:calcineurin-like phosphoesterase family protein >Feature sequence513 >Feature sequence514 >Feature sequence515 <1 773 gene locus_tag LOCUS_18140 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000967516.1:anaerobic C4-dicarboxylate transporter <1770 1048 gene locus_tag LOCUS_18150 <1770 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765418.1:glutamate--tRNA ligase >Feature sequence516 <1 772 gene locus_tag LOCUS_18160 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789096.1:S46 family peptidase >Feature sequence517 <1 599 gene locus_tag LOCUS_18170 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035249689.1:DNA polymerase IV 635 1144 gene locus_tag LOCUS_18180 635 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765751.1 protein_id gnl|my_center|LOCUS_18180 1141 1698 gene locus_tag LOCUS_18190 1141 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence518 >Feature sequence519 483 740 gene locus_tag LOCUS_18200 gene atpC 483 740 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence520 1237 407 gene locus_tag LOCUS_18210 1237 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence521 <1 957 gene locus_tag LOCUS_18220 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002456217.1:low specificity L-threonine aldolase 987 1637 gene locus_tag LOCUS_18230 987 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence522 >Feature sequence523 517 1626 gene locus_tag LOCUS_18240 517 1626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence524 1531 230 gene locus_tag LOCUS_18250 1531 230 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence525 >Feature sequence526 195 1385 gene locus_tag LOCUS_18260 gene gluP 195 1385 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785331.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence527 1291 251 gene locus_tag LOCUS_18270 gene ruvB 1291 251 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence528 >Feature sequence529 >Feature sequence530 376 837 gene locus_tag LOCUS_18280 gene smpB 376 837 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_18280 1703 834 gene locus_tag LOCUS_18290 1703 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 >Feature sequence531 1448 258 gene locus_tag LOCUS_18300 1448 258 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence532 >Feature sequence533 <1 952 gene locus_tag LOCUS_18310 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767132.1:endonuclease >Feature sequence534 161 688 gene locus_tag LOCUS_18320 161 688 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_18320 672 1250 gene locus_tag LOCUS_18330 672 1250 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence535 1242 682 gene locus_tag LOCUS_18340 1242 682 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109055.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence536 1270 278 gene locus_tag LOCUS_18350 1270 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence537 <1 962 gene locus_tag LOCUS_18360 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107412.1:F0F1 ATP synthase subunit alpha >Feature sequence538 <1 601 gene locus_tag LOCUS_18370 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766271.1:MBL fold metallo-hydrolase 598 1107 gene locus_tag LOCUS_18380 598 1107 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203239.1 protein_id gnl|my_center|LOCUS_18380 <1654 1141 gene locus_tag LOCUS_18390 <1654 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948196.1:DUF5692 family protein >Feature sequence539 <1654 300 gene locus_tag LOCUS_18400 <1654 300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100479.1:sodium:solute symporter >Feature sequence540 266 1036 gene locus_tag LOCUS_18410 266 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence541 >Feature sequence542 1421 804 gene locus_tag LOCUS_18420 1421 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence543 82 531 gene locus_tag LOCUS_18430 gene mraZ 82 531 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678680.1 protein_id gnl|my_center|LOCUS_18430 547 1449 gene locus_tag LOCUS_18440 gene rsmH 547 1449 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence544 >Feature sequence545 787 65 gene locus_tag LOCUS_18450 787 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1561 821 gene locus_tag LOCUS_18460 1561 821 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence546 >Feature sequence547 >Feature sequence548 <1 897 gene locus_tag LOCUS_18470 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766012.1:dehydrogenase 894 1529 gene locus_tag LOCUS_18480 gene gmhA 894 1529 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence549 <1 681 gene locus_tag LOCUS_18490 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763047.1:altronate dehydratase family protein 709 840 gene locus_tag LOCUS_18500 709 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence550 <1 1584 gene locus_tag LOCUS_18510 <1 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002431748.1:DASS family sodium-coupled anion symporter >Feature sequence551 <1 1056 gene locus_tag LOCUS_18520 <1 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760798.1:asparagine--tRNA ligase >Feature sequence552 222 1286 gene locus_tag LOCUS_18530 222 1286 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence553 >Feature sequence554 >Feature sequence555 350 541 gene locus_tag LOCUS_18540 350 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 614 1339 gene locus_tag LOCUS_18550 614 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence556 1143 1003 gene locus_tag LOCUS_18560 1143 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence557 >Feature sequence558 <1 678 gene locus_tag LOCUS_18570 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202271.1:transglutaminase domain-containing protein 675 1367 gene locus_tag LOCUS_18580 675 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence559 83 1069 gene locus_tag LOCUS_18590 83 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence560 >Feature sequence561 >Feature sequence562 >Feature sequence563 702 226 gene locus_tag LOCUS_18600 702 226 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_18600 1345 707 gene locus_tag LOCUS_18610 1345 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence564 <1 1344 gene locus_tag LOCUS_18620 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764324.1:Trk system potassium transporter TrkA >Feature sequence565 <1 833 gene locus_tag LOCUS_18630 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763710.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence566 1 270 gene locus_tag LOCUS_18640 1 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 <1516 262 gene locus_tag LOCUS_18650 <1516 262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460214.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence567 <1 896 gene locus_tag LOCUS_18660 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004313940.1:BT4734/BF3469 family protein 893 1450 gene locus_tag LOCUS_18670 893 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence568 >Feature sequence569 >Feature sequence570 <1 982 gene locus_tag LOCUS_18680 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793720.1:proline--tRNA ligase