>Feature sequence001 1177 401 gene locus_tag LOCUS_00010 1177 401 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766210.1 protein_id gnl|my_center|LOCUS_00010 1271 3424 gene locus_tag LOCUS_00020 1271 3424 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_00020 3417 4676 gene locus_tag LOCUS_00030 3417 4676 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_00030 5828 4686 gene locus_tag LOCUS_00040 gene hisB 5828 4686 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_00040 8269 5930 gene locus_tag LOCUS_00050 8269 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9140 8289 gene locus_tag LOCUS_00060 gene hisG 9140 8289 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_00060 9428 10897 gene locus_tag LOCUS_00070 9428 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 11136 10990 gene locus_tag LOCUS_00080 11136 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11411 11578 gene locus_tag LOCUS_00090 11411 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11683 12189 gene locus_tag LOCUS_00100 11683 12189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_00100 14059 12317 gene locus_tag LOCUS_00110 14059 12317 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_00110 15737 14082 gene locus_tag LOCUS_00120 15737 14082 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_00120 17284 15731 gene locus_tag LOCUS_00130 17284 15731 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767962.1 protein_id gnl|my_center|LOCUS_00130 17554 18666 gene locus_tag LOCUS_00140 gene ald 17554 18666 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_00140 18893 19738 gene locus_tag LOCUS_00150 18893 19738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20584 20967 gene locus_tag LOCUS_00160 20584 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00160 20883 21116 gene locus_tag LOCUS_00170 20883 21116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00170 21305 21490 gene locus_tag LOCUS_00180 21305 21490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 21853 21455 gene locus_tag LOCUS_00190 21853 21455 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_00190 21967 22521 gene locus_tag LOCUS_00200 21967 22521 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845619.1 protein_id gnl|my_center|LOCUS_00200 24930 22528 gene locus_tag LOCUS_00210 24930 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25069 25142 gene locus_tag LOCUS_t00010 25069 25142 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25204 26241 gene locus_tag LOCUS_00220 gene mltG 25204 26241 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_00220 26238 27026 gene locus_tag LOCUS_00230 gene nudC 26238 27026 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202441.1 protein_id gnl|my_center|LOCUS_00230 28383 27115 gene locus_tag LOCUS_00240 gene nqrF 28383 27115 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_00240 29028 28402 gene locus_tag LOCUS_00250 gene nqrE 29028 28402 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_00250 29677 29042 gene locus_tag LOCUS_00260 29677 29042 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_00260 30370 29699 gene locus_tag LOCUS_00270 30370 29699 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_00270 31555 30392 gene locus_tag LOCUS_00280 31555 30392 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_00280 32934 31582 gene locus_tag LOCUS_00290 32934 31582 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787198.1 protein_id gnl|my_center|LOCUS_00290 34925 33159 gene locus_tag LOCUS_00300 34925 33159 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_00300 35076 36203 gene locus_tag LOCUS_00310 gene wecB 35076 36203 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555698.1 protein_id gnl|my_center|LOCUS_00310 36274 38871 gene locus_tag LOCUS_00320 36274 38871 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_00320 38891 40162 gene locus_tag LOCUS_00330 38891 40162 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_00330 40197 41153 gene locus_tag LOCUS_00340 40197 41153 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107655.1 protein_id gnl|my_center|LOCUS_00340 41191 41448 gene locus_tag LOCUS_00350 41191 41448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 41430 42050 gene locus_tag LOCUS_00360 41430 42050 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_00360 42062 43027 gene locus_tag LOCUS_00370 42062 43027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 43644 43030 gene locus_tag LOCUS_00380 43644 43030 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788037.1 protein_id gnl|my_center|LOCUS_00380 43735 44742 gene locus_tag LOCUS_00390 43735 44742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 44791 46236 gene locus_tag LOCUS_00400 44791 46236 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787423.1 protein_id gnl|my_center|LOCUS_00400 47081 46242 gene locus_tag LOCUS_00410 47081 46242 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291581.1 protein_id gnl|my_center|LOCUS_00410 47229 47768 gene locus_tag LOCUS_00420 47229 47768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 47799 48311 gene locus_tag LOCUS_00430 47799 48311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50883 48367 gene locus_tag LOCUS_00440 50883 48367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52040 51114 gene locus_tag LOCUS_00450 52040 51114 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_00450 52604 52062 gene locus_tag LOCUS_00460 52604 52062 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_00460 53087 52694 gene locus_tag LOCUS_tm00010 53087 52694 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 55434 53299 gene locus_tag LOCUS_00470 55434 53299 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_00470 55759 56433 gene locus_tag LOCUS_00480 55759 56433 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461682.1 protein_id gnl|my_center|LOCUS_00480 56773 57864 gene locus_tag LOCUS_00490 56773 57864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57954 58871 gene locus_tag LOCUS_00500 57954 58871 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_00500 58876 59748 gene locus_tag LOCUS_00510 58876 59748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 59806 60981 gene locus_tag LOCUS_00520 59806 60981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 60998 61420 gene locus_tag LOCUS_00530 60998 61420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107329.1 protein_id gnl|my_center|LOCUS_00530 61486 61923 gene locus_tag LOCUS_00540 61486 61923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61945 63237 gene locus_tag LOCUS_00550 61945 63237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 63295 64686 gene locus_tag LOCUS_00560 gene rlmD 63295 64686 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_00560 64692 65657 gene locus_tag LOCUS_00570 64692 65657 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765521.1 protein_id gnl|my_center|LOCUS_00570 66345 65599 gene locus_tag LOCUS_00580 66345 65599 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262663.1 protein_id gnl|my_center|LOCUS_00580 66480 68237 gene locus_tag LOCUS_00590 66480 68237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 68785 69855 gene locus_tag LOCUS_00600 68785 69855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69852 71093 gene locus_tag LOCUS_00610 69852 71093 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_00610 71103 72353 gene locus_tag LOCUS_00620 71103 72353 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_00620 72390 73490 gene locus_tag LOCUS_00630 72390 73490 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_00630 73510 74856 gene locus_tag LOCUS_00640 73510 74856 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence002 605 1036 gene locus_tag LOCUS_00650 605 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 1335 3443 gene locus_tag LOCUS_00660 1335 3443 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108809.1 protein_id gnl|my_center|LOCUS_00660 3639 4787 gene locus_tag LOCUS_00670 3639 4787 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_00670 4836 6518 gene locus_tag LOCUS_00680 4836 6518 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_00680 6548 7228 gene locus_tag LOCUS_00690 6548 7228 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_00690 7234 7920 gene locus_tag LOCUS_00700 7234 7920 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_00700 7964 9502 gene locus_tag LOCUS_00710 gene araA 7964 9502 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_00710 9508 11100 gene locus_tag LOCUS_00720 9508 11100 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_00720 11112 12671 gene locus_tag LOCUS_00730 11112 12671 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_00730 12771 14723 gene locus_tag LOCUS_00740 12771 14723 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_00740 14749 15189 gene locus_tag LOCUS_00750 gene rpiB 14749 15189 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_00750 15298 16113 gene locus_tag LOCUS_00760 15298 16113 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_00760 16265 16642 gene locus_tag LOCUS_00770 16265 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 16932 16714 gene locus_tag LOCUS_00780 16932 16714 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_00780 18104 17025 gene locus_tag LOCUS_00790 18104 17025 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_00790 18685 18101 gene locus_tag LOCUS_00800 18685 18101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 19487 18825 gene locus_tag LOCUS_00810 gene queC 19487 18825 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762201.1 protein_id gnl|my_center|LOCUS_00810 20170 19490 gene locus_tag LOCUS_00820 20170 19490 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_00820 21755 20367 gene locus_tag LOCUS_00830 21755 20367 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_00830 21938 23173 gene locus_tag LOCUS_00840 21938 23173 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795332.1 protein_id gnl|my_center|LOCUS_00840 23185 23394 gene locus_tag LOCUS_00850 23185 23394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 23619 24305 gene locus_tag LOCUS_00860 gene updY 23619 24305 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_00860 24357 26732 gene locus_tag LOCUS_00870 24357 26732 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_00870 26738 27808 gene locus_tag LOCUS_00880 26738 27808 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786605.1 protein_id gnl|my_center|LOCUS_00880 27805 28359 gene locus_tag LOCUS_00890 gene rfbC 27805 28359 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_00890 28372 29088 gene locus_tag LOCUS_00900 28372 29088 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765262.1 protein_id gnl|my_center|LOCUS_00900 29102 30121 gene locus_tag LOCUS_00910 29102 30121 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_00910 30147 31112 gene locus_tag LOCUS_00920 30147 31112 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_00920 31126 32574 gene locus_tag LOCUS_00930 31126 32574 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 protein_id gnl|my_center|LOCUS_00930 32579 33712 gene locus_tag LOCUS_00940 gene glf 32579 33712 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_00940 33709 34557 gene locus_tag LOCUS_00950 33709 34557 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_00950 34830 34609 gene locus_tag LOCUS_00960 34830 34609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 35740 36432 gene locus_tag LOCUS_00970 35740 36432 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362119.1 protein_id gnl|my_center|LOCUS_00970 37275 37883 gene locus_tag LOCUS_00980 37275 37883 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966340.1 protein_id gnl|my_center|LOCUS_00980 37904 38173 gene locus_tag LOCUS_00990 37904 38173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 38170 39294 gene locus_tag LOCUS_01000 38170 39294 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107079.1 protein_id gnl|my_center|LOCUS_01000 39525 40919 gene locus_tag LOCUS_01010 39525 40919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_01010 41389 40925 gene locus_tag LOCUS_01020 41389 40925 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_01020 42281 41373 gene locus_tag LOCUS_01030 42281 41373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_01030 42652 45585 gene locus_tag LOCUS_01040 42652 45585 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_01040 45636 46001 gene locus_tag LOCUS_01050 45636 46001 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791845.1 protein_id gnl|my_center|LOCUS_01050 47455 47583 gene locus_tag LOCUS_01060 47455 47583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 47675 49456 gene locus_tag LOCUS_01070 47675 49456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 49482 51494 gene locus_tag LOCUS_01080 49482 51494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 53671 51899 gene locus_tag LOCUS_01090 53671 51899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 55679 53919 gene locus_tag LOCUS_01100 55679 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 55990 55918 gene locus_tag LOCUS_t00020 55990 55918 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 58789 56258 gene locus_tag LOCUS_01110 gene feoB 58789 56258 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795491.1 protein_id gnl|my_center|LOCUS_01110 58939 60246 gene locus_tag LOCUS_01120 gene tilS 58939 60246 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_01120 60324 62393 gene locus_tag LOCUS_01130 gene rho 60324 62393 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107884.1 protein_id gnl|my_center|LOCUS_01130 62420 63754 gene locus_tag LOCUS_01140 gene ffh 62420 63754 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_01140 63810 64691 gene locus_tag LOCUS_01150 gene folD 63810 64691 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_01150 64779 64853 gene locus_tag LOCUS_t00030 64779 64853 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 66122 64926 gene locus_tag LOCUS_01160 66122 64926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 66779 66180 gene locus_tag LOCUS_01170 66779 66180 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_01170 67579 66905 gene locus_tag LOCUS_01180 67579 66905 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence003 2020 1673 gene locus_tag LOCUS_01190 2020 1673 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_01190 2109 2729 gene locus_tag LOCUS_01200 2109 2729 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_01200 2765 3259 gene locus_tag LOCUS_01210 gene ispF 2765 3259 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_01210 3256 5844 gene locus_tag LOCUS_01220 3256 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5841 7214 gene locus_tag LOCUS_01230 5841 7214 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_01230 7235 8569 gene locus_tag LOCUS_01240 gene xseA 7235 8569 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_01240 8612 8800 gene locus_tag LOCUS_01250 gene xseB 8612 8800 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791731.1 protein_id gnl|my_center|LOCUS_01250 8867 9886 gene locus_tag LOCUS_01260 8867 9886 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_01260 9889 10647 gene locus_tag LOCUS_01270 gene trmB 9889 10647 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_01270 10709 11809 gene locus_tag LOCUS_01280 10709 11809 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_01280 13035 11866 gene locus_tag LOCUS_01290 gene dnaJ 13035 11866 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_01290 13647 13051 gene locus_tag LOCUS_01300 13647 13051 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_01300 15186 13747 gene locus_tag LOCUS_01310 15186 13747 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_01310 15263 16126 gene locus_tag LOCUS_01320 15263 16126 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659480.1 protein_id gnl|my_center|LOCUS_01320 16137 17834 gene locus_tag LOCUS_01330 16137 17834 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107667.1 protein_id gnl|my_center|LOCUS_01330 17866 19098 gene locus_tag LOCUS_01340 gene fucP 17866 19098 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_01340 20021 19032 gene locus_tag LOCUS_01350 20021 19032 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766203.1 protein_id gnl|my_center|LOCUS_01350 21140 20253 gene locus_tag LOCUS_01360 21140 20253 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_01360 22046 21195 gene locus_tag LOCUS_01370 22046 21195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 23383 22043 gene locus_tag LOCUS_01380 23383 22043 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_01380 24367 24921 gene locus_tag LOCUS_01390 24367 24921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 26900 25020 gene locus_tag LOCUS_01400 26900 25020 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_01400 27145 27993 gene locus_tag LOCUS_01410 27145 27993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_01410 27990 29195 gene locus_tag LOCUS_01420 27990 29195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 29349 30395 gene locus_tag LOCUS_01430 29349 30395 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_01430 30773 31327 gene locus_tag LOCUS_01440 30773 31327 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032850560.1 protein_id gnl|my_center|LOCUS_01440 31324 32745 gene locus_tag LOCUS_01450 31324 32745 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_01450 33424 32738 gene locus_tag LOCUS_01460 33424 32738 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_01460 35293 33464 gene locus_tag LOCUS_01470 35293 33464 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_01470 35427 36797 gene locus_tag LOCUS_01480 35427 36797 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_01480 36997 36821 gene locus_tag LOCUS_01490 36997 36821 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_01490 38027 36999 gene locus_tag LOCUS_01500 38027 36999 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_01500 39069 38020 gene locus_tag LOCUS_01510 39069 38020 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_01510 40359 39181 gene locus_tag LOCUS_01520 40359 39181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 42347 40371 gene locus_tag LOCUS_01530 42347 40371 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_01530 44909 42915 gene locus_tag LOCUS_01540 44909 42915 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_01540 45055 44983 gene locus_tag LOCUS_t00040 45055 44983 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 45134 45061 gene locus_tag LOCUS_t00050 45134 45061 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 46013 45225 gene locus_tag LOCUS_01550 46013 45225 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_01550 46762 46463 gene locus_tag LOCUS_01560 gene rplT 46762 46463 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_01560 47102 46905 gene locus_tag LOCUS_01570 gene rpmI 47102 46905 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_01570 47780 47157 gene locus_tag LOCUS_01580 gene infC 47780 47157 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_01580 49842 47896 gene locus_tag LOCUS_01590 gene thrS 49842 47896 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_01590 51928 49970 gene locus_tag LOCUS_01600 51928 49970 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202518.1 protein_id gnl|my_center|LOCUS_01600 52572 52015 gene locus_tag LOCUS_01610 gene def 52572 52015 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_01610 53007 52585 gene locus_tag LOCUS_01620 gene ruvX 53007 52585 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_01620 54294 53131 gene locus_tag LOCUS_01630 54294 53131 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202514.1 protein_id gnl|my_center|LOCUS_01630 55103 54351 gene locus_tag LOCUS_01640 55103 54351 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202515.1 protein_id gnl|my_center|LOCUS_01640 56056 55154 gene locus_tag LOCUS_01650 56056 55154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence004 3428 198 gene locus_tag LOCUS_01660 gene carB 3428 198 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_01660 3946 7323 gene locus_tag LOCUS_01670 3946 7323 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106133626.1 protein_id gnl|my_center|LOCUS_01670 7418 9250 gene locus_tag LOCUS_01680 7418 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 9631 11295 gene locus_tag LOCUS_01690 9631 11295 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_01690 11349 12827 gene locus_tag LOCUS_01700 11349 12827 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 protein_id gnl|my_center|LOCUS_01700 14281 12908 gene locus_tag LOCUS_01710 14281 12908 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108334.1 protein_id gnl|my_center|LOCUS_01710 14390 15871 gene locus_tag LOCUS_01720 gene rpoN 14390 15871 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_01720 15876 16529 gene locus_tag LOCUS_01730 15876 16529 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_01730 16610 16990 gene locus_tag LOCUS_01740 gene gcvH 16610 16990 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_01740 16994 17512 gene locus_tag LOCUS_01750 gene purE 16994 17512 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_01750 17512 19344 gene locus_tag LOCUS_01760 17512 19344 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_01760 21076 19406 gene locus_tag LOCUS_01770 21076 19406 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_01770 22032 21073 gene locus_tag LOCUS_01780 22032 21073 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_01780 22141 22215 gene locus_tag LOCUS_t00060 22141 22215 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22256 22330 gene locus_tag LOCUS_t00070 22256 22330 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 22690 22388 gene locus_tag LOCUS_01790 22690 22388 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_01790 24508 22712 gene locus_tag LOCUS_01800 24508 22712 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_01800 24946 24509 gene locus_tag LOCUS_01810 24946 24509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176702.1 protein_id gnl|my_center|LOCUS_01810 25533 25048 gene locus_tag LOCUS_01820 25533 25048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 25987 28083 gene locus_tag LOCUS_01830 gene nrdD 25987 28083 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_01830 28096 28563 gene locus_tag LOCUS_01840 28096 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 31093 28649 gene locus_tag LOCUS_01850 gene topA 31093 28649 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_01850 32714 31071 gene locus_tag LOCUS_01860 gene argS 32714 31071 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_01860 33288 33025 gene locus_tag LOCUS_01870 33288 33025 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_01870 33495 34175 gene locus_tag LOCUS_01880 33495 34175 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_01880 34156 35070 gene locus_tag LOCUS_01890 34156 35070 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_01890 35278 35051 gene locus_tag LOCUS_01900 35278 35051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 35403 36167 gene locus_tag LOCUS_01910 35403 36167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 36271 39234 gene locus_tag LOCUS_01920 gene secDF 36271 39234 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_01920 39392 39464 gene locus_tag LOCUS_t00080 39392 39464 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39550 40803 gene locus_tag LOCUS_01930 39550 40803 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108551.1 protein_id gnl|my_center|LOCUS_01930 41390 40818 gene locus_tag LOCUS_01940 41390 40818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 41673 41395 gene locus_tag LOCUS_01950 41673 41395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 41864 41670 gene locus_tag LOCUS_01960 41864 41670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 42303 41836 gene locus_tag LOCUS_01970 42303 41836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 42991 42308 gene locus_tag LOCUS_01980 42991 42308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 43151 43369 gene locus_tag LOCUS_01990 43151 43369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 43356 43682 gene locus_tag LOCUS_02000 43356 43682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 43900 44184 gene locus_tag LOCUS_02010 43900 44184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 44190 46496 gene locus_tag LOCUS_02020 44190 46496 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_02020 46516 47499 gene locus_tag LOCUS_02030 46516 47499 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_02030 47519 48244 gene locus_tag LOCUS_02040 47519 48244 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 protein_id gnl|my_center|LOCUS_02040 48248 48673 gene locus_tag LOCUS_02050 48248 48673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 48828 49454 gene locus_tag LOCUS_02060 48828 49454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 49467 49892 gene locus_tag LOCUS_02070 49467 49892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 49922 50683 gene locus_tag LOCUS_02080 49922 50683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 50761 51606 gene locus_tag LOCUS_02090 50761 51606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 51506 52138 gene locus_tag LOCUS_02100 51506 52138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 52135 52713 gene locus_tag LOCUS_02110 52135 52713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 52728 53432 gene locus_tag LOCUS_02120 52728 53432 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217650.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence005 282 70 gene locus_tag LOCUS_02130 282 70 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202676.1 protein_id gnl|my_center|LOCUS_02130 660 586 gene locus_tag LOCUS_t00090 660 586 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1041 730 gene locus_tag LOCUS_02140 1041 730 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 protein_id gnl|my_center|LOCUS_02140 1516 1058 gene locus_tag LOCUS_02150 1516 1058 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_02150 2522 1674 gene locus_tag LOCUS_02160 2522 1674 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_02160 3159 2563 gene locus_tag LOCUS_02170 3159 2563 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203724.1 protein_id gnl|my_center|LOCUS_02170 3323 3988 gene locus_tag LOCUS_02180 3323 3988 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_02180 4697 3969 gene locus_tag LOCUS_02190 4697 3969 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_02190 5952 4690 gene locus_tag LOCUS_02200 5952 4690 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_02200 6930 6010 gene locus_tag LOCUS_02210 6930 6010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_02210 7829 6927 gene locus_tag LOCUS_02220 7829 6927 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963504.1 protein_id gnl|my_center|LOCUS_02220 9285 7816 gene locus_tag LOCUS_02230 9285 7816 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_02230 11374 9311 gene locus_tag LOCUS_02240 gene metG 11374 9311 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_02240 11771 11463 gene locus_tag LOCUS_02250 11771 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 12277 14547 gene locus_tag LOCUS_02260 12277 14547 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766755.1 protein_id gnl|my_center|LOCUS_02260 14694 14879 gene locus_tag LOCUS_02270 14694 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 15278 14964 gene locus_tag LOCUS_02280 15278 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15377 15592 gene locus_tag LOCUS_02290 15377 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15831 16427 gene locus_tag LOCUS_02300 15831 16427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 16484 16702 gene locus_tag LOCUS_02310 16484 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 16886 17326 gene locus_tag LOCUS_02320 16886 17326 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767830.1 protein_id gnl|my_center|LOCUS_02320 17483 19615 gene locus_tag LOCUS_02330 17483 19615 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_02330 19618 20274 gene locus_tag LOCUS_02340 19618 20274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_02340 21228 20284 gene locus_tag LOCUS_02350 21228 20284 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202005.1 protein_id gnl|my_center|LOCUS_02350 22607 21243 gene locus_tag LOCUS_02360 22607 21243 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_02360 22800 23111 gene locus_tag LOCUS_02370 22800 23111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 24422 23085 gene locus_tag LOCUS_02380 24422 23085 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_02380 24493 25347 gene locus_tag LOCUS_02390 gene folP 24493 25347 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_02390 25362 26126 gene locus_tag LOCUS_02400 gene cdaA 25362 26126 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_02400 27226 26216 gene locus_tag LOCUS_02410 27226 26216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 27320 27156 gene locus_tag LOCUS_02420 27320 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 28541 27339 gene locus_tag LOCUS_02430 28541 27339 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_02430 29575 28562 gene locus_tag LOCUS_02440 gene pta 29575 28562 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_02440 30098 29787 gene locus_tag LOCUS_02450 30098 29787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 30324 31742 gene locus_tag LOCUS_02460 30324 31742 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_02460 32458 31832 gene locus_tag LOCUS_02470 32458 31832 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_02470 33031 32465 gene locus_tag LOCUS_02480 gene pnuC 33031 32465 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_02480 35257 33035 gene locus_tag LOCUS_02490 35257 33035 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_02490 35461 36270 gene locus_tag LOCUS_02500 35461 36270 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_02500 36301 36702 gene locus_tag LOCUS_02510 36301 36702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763662.1 protein_id gnl|my_center|LOCUS_02510 36890 36808 gene locus_tag LOCUS_t00100 36890 36808 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37951 36950 gene locus_tag LOCUS_02520 37951 36950 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_02520 38766 37948 gene locus_tag LOCUS_02530 38766 37948 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762529.1 protein_id gnl|my_center|LOCUS_02530 41560 38882 gene locus_tag LOCUS_02540 41560 38882 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_02540 41701 43242 gene locus_tag LOCUS_02550 41701 43242 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_02550 43244 43861 gene locus_tag LOCUS_02560 43244 43861 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796621.1 protein_id gnl|my_center|LOCUS_02560 44732 43893 gene locus_tag LOCUS_02570 44732 43893 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_02570 46067 44793 gene locus_tag LOCUS_02580 46067 44793 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_02580 47405 46074 gene locus_tag LOCUS_02590 47405 46074 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_02590 48216 47392 gene locus_tag LOCUS_02600 48216 47392 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_02600 49562 48216 gene locus_tag LOCUS_02610 49562 48216 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_02610 51061 49580 gene locus_tag LOCUS_02620 51061 49580 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201997.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence006 1249 122 gene locus_tag LOCUS_02630 1249 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1775 1272 gene locus_tag LOCUS_02640 1775 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1947 1753 gene locus_tag LOCUS_02650 1947 1753 CDS product Arc family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_02650 2919 1966 gene locus_tag LOCUS_02660 2919 1966 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_02660 5163 3040 gene locus_tag LOCUS_02670 5163 3040 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108964.1 protein_id gnl|my_center|LOCUS_02670 7500 5323 gene locus_tag LOCUS_02680 7500 5323 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_02680 7571 9760 gene locus_tag LOCUS_02690 7571 9760 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764507.1 protein_id gnl|my_center|LOCUS_02690 11323 10046 gene locus_tag LOCUS_02700 11323 10046 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_02700 11420 12409 gene locus_tag LOCUS_02710 gene trpS 11420 12409 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_02710 13281 12451 gene locus_tag LOCUS_02720 13281 12451 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_02720 14995 13352 gene locus_tag LOCUS_02730 14995 13352 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_02730 15158 15439 gene locus_tag LOCUS_02740 15158 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788933.1 protein_id gnl|my_center|LOCUS_02740 15439 15984 gene locus_tag LOCUS_02750 15439 15984 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_02750 15987 17972 gene locus_tag LOCUS_02760 15987 17972 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203149.1 protein_id gnl|my_center|LOCUS_02760 17969 20866 gene locus_tag LOCUS_02770 17969 20866 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769700.1 protein_id gnl|my_center|LOCUS_02770 21284 20859 gene locus_tag LOCUS_02780 21284 20859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 21471 22331 gene locus_tag LOCUS_02790 gene map 21471 22331 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_02790 22328 24109 gene locus_tag LOCUS_02800 gene lepA 22328 24109 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_02800 25803 24118 gene locus_tag LOCUS_02810 25803 24118 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_02810 26611 25853 gene locus_tag LOCUS_02820 26611 25853 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_02820 26740 29202 gene locus_tag LOCUS_02830 gene pheT 26740 29202 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_02830 29320 30051 gene locus_tag LOCUS_02840 29320 30051 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_02840 31338 30160 gene locus_tag LOCUS_02850 31338 30160 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_02850 32465 31335 gene locus_tag LOCUS_02860 gene tgt 32465 31335 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_02860 34939 32465 gene locus_tag LOCUS_02870 gene lon 34939 32465 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_02870 35122 35850 gene locus_tag LOCUS_02880 35122 35850 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_02880 35907 36833 gene locus_tag LOCUS_02890 35907 36833 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_02890 38044 36908 gene locus_tag LOCUS_02900 38044 36908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 38925 38176 gene locus_tag LOCUS_02910 38925 38176 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_02910 39274 43353 gene locus_tag LOCUS_02920 39274 43353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 43384 44202 gene locus_tag LOCUS_02930 43384 44202 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_02930 44211 45239 gene locus_tag LOCUS_02940 gene thiL 44211 45239 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_02940 45334 45407 gene locus_tag LOCUS_t00110 45334 45407 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 45565 47934 gene locus_tag LOCUS_02950 45565 47934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 48603 48079 gene locus_tag LOCUS_02960 48603 48079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 48975 48775 gene locus_tag LOCUS_02970 48975 48775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 50348 49677 gene locus_tag LOCUS_02980 50348 49677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence007 759 427 gene locus_tag LOCUS_02990 759 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1962 886 gene locus_tag LOCUS_03000 1962 886 CDS product BF3164 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202017.1 protein_id gnl|my_center|LOCUS_03000 3832 2156 gene locus_tag LOCUS_03010 3832 2156 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769667.1 protein_id gnl|my_center|LOCUS_03010 4679 6718 gene locus_tag LOCUS_03020 4679 6718 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_03020 6775 7239 gene locus_tag LOCUS_03030 6775 7239 CDS product DUF4847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764457.1 protein_id gnl|my_center|LOCUS_03030 7236 7673 gene locus_tag LOCUS_03040 7236 7673 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_03040 7794 9425 gene locus_tag LOCUS_03050 7794 9425 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_03050 9481 10005 gene locus_tag LOCUS_03060 9481 10005 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109176.1 protein_id gnl|my_center|LOCUS_03060 9999 10775 gene locus_tag LOCUS_03070 9999 10775 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_03070 11058 10768 gene locus_tag LOCUS_03080 11058 10768 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_03080 12197 11055 gene locus_tag LOCUS_03090 gene recF 12197 11055 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759932.1 protein_id gnl|my_center|LOCUS_03090 12326 13015 gene locus_tag LOCUS_03100 12326 13015 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_03100 13023 13529 gene locus_tag LOCUS_03110 gene ribH 13023 13529 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_03110 13580 13663 gene locus_tag LOCUS_t00120 13580 13663 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13820 13893 gene locus_tag LOCUS_t00130 13820 13893 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14010 15182 gene locus_tag LOCUS_03120 14010 15182 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_03120 15194 16306 gene locus_tag LOCUS_03130 gene prfA 15194 16306 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759884.1 protein_id gnl|my_center|LOCUS_03130 16329 18161 gene locus_tag LOCUS_03140 16329 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 18198 19025 gene locus_tag LOCUS_03150 gene pyrF 18198 19025 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_03150 19118 20152 gene locus_tag LOCUS_03160 gene lpxD 19118 20152 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_03160 20152 21546 gene locus_tag LOCUS_03170 20152 21546 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759880.1 protein_id gnl|my_center|LOCUS_03170 21552 22331 gene locus_tag LOCUS_03180 gene lpxA 21552 22331 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_03180 22362 22934 gene locus_tag LOCUS_03190 22362 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_03190 22934 23833 gene locus_tag LOCUS_03200 gene miaA 22934 23833 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_03200 24270 24974 gene locus_tag LOCUS_03210 24270 24974 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_03210 24961 25572 gene locus_tag LOCUS_03220 24961 25572 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_03220 26929 25796 gene locus_tag LOCUS_03230 26929 25796 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_03230 27711 26977 gene locus_tag LOCUS_03240 27711 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680413.1 protein_id gnl|my_center|LOCUS_03240 28941 27733 gene locus_tag LOCUS_03250 28941 27733 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007748002.1 protein_id gnl|my_center|LOCUS_03250 30413 28971 gene locus_tag LOCUS_03260 30413 28971 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680411.1 protein_id gnl|my_center|LOCUS_03260 31760 30519 gene locus_tag LOCUS_03270 31760 30519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 33139 31793 gene locus_tag LOCUS_03280 33139 31793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_03280 33809 33423 gene locus_tag LOCUS_03290 33809 33423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 34813 33806 gene locus_tag LOCUS_03300 34813 33806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 35412 35143 gene locus_tag LOCUS_03310 35412 35143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 36343 35423 gene locus_tag LOCUS_03320 36343 35423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 37562 36348 gene locus_tag LOCUS_03330 37562 36348 CDS product 4Fe-4S cluster-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460830.1 protein_id gnl|my_center|LOCUS_03330 38239 37952 gene locus_tag LOCUS_03340 38239 37952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 38904 38359 gene locus_tag LOCUS_03350 38904 38359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 40237 42447 gene locus_tag LOCUS_03360 40237 42447 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_03360 42450 43304 gene locus_tag LOCUS_03370 gene lipA 42450 43304 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_03370 43314 44039 gene locus_tag LOCUS_03380 43314 44039 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764403.1 protein_id gnl|my_center|LOCUS_03380 44059 44709 gene locus_tag LOCUS_03390 44059 44709 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_03390 45764 44808 gene locus_tag LOCUS_03400 45764 44808 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833065.1 protein_id gnl|my_center|LOCUS_03400 49145 45786 gene locus_tag LOCUS_03410 49145 45786 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence008 513 340 gene locus_tag LOCUS_03420 513 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 924 526 gene locus_tag LOCUS_03430 924 526 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_03430 1407 952 gene locus_tag LOCUS_03440 1407 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 1579 2445 gene locus_tag LOCUS_03450 1579 2445 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_03450 2442 3077 gene locus_tag LOCUS_03460 2442 3077 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600787.1 protein_id gnl|my_center|LOCUS_03460 4254 3028 gene locus_tag LOCUS_03470 4254 3028 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_03470 4685 4305 gene locus_tag LOCUS_03480 gene rbfA 4685 4305 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_03480 6899 4743 gene locus_tag LOCUS_03490 6899 4743 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303083.1 protein_id gnl|my_center|LOCUS_03490 9451 6896 gene locus_tag LOCUS_03500 9451 6896 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108484.1 protein_id gnl|my_center|LOCUS_03500 10649 9537 gene locus_tag LOCUS_03510 gene dprA 10649 9537 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_03510 11072 10671 gene locus_tag LOCUS_03520 11072 10671 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_03520 12343 11069 gene locus_tag LOCUS_03530 12343 11069 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_03530 12476 12919 gene locus_tag LOCUS_03540 12476 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 12916 13902 gene locus_tag LOCUS_03550 gene dusB 12916 13902 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_03550 14829 13876 gene locus_tag LOCUS_03560 14829 13876 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_03560 15830 14820 gene locus_tag LOCUS_03570 15830 14820 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_03570 17241 16039 gene locus_tag LOCUS_03580 17241 16039 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_03580 17506 18354 gene locus_tag LOCUS_03590 17506 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_03590 19032 18358 gene locus_tag LOCUS_03600 19032 18358 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_03600 19153 19653 gene locus_tag LOCUS_03610 19153 19653 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_03610 19727 20461 gene locus_tag LOCUS_03620 19727 20461 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922506.1 protein_id gnl|my_center|LOCUS_03620 20503 22464 gene locus_tag LOCUS_03630 20503 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 23890 22439 gene locus_tag LOCUS_03640 23890 22439 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_03640 24713 23958 gene locus_tag LOCUS_03650 24713 23958 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109255.1 protein_id gnl|my_center|LOCUS_03650 24817 26709 gene locus_tag LOCUS_03660 gene speA 24817 26709 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_03660 26730 27515 gene locus_tag LOCUS_03670 gene argB 26730 27515 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_03670 27573 28082 gene locus_tag LOCUS_03680 27573 28082 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_03680 28072 28563 gene locus_tag LOCUS_03690 28072 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108812.1 protein_id gnl|my_center|LOCUS_03690 30578 28737 gene locus_tag LOCUS_03700 30578 28737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_03700 30662 31267 gene locus_tag LOCUS_03710 30662 31267 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_03710 31264 32298 gene locus_tag LOCUS_03720 31264 32298 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_03720 32295 33047 gene locus_tag LOCUS_03730 32295 33047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108792.1 protein_id gnl|my_center|LOCUS_03730 33617 33042 gene locus_tag LOCUS_03740 gene purN 33617 33042 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796813.1 protein_id gnl|my_center|LOCUS_03740 33836 34081 gene locus_tag LOCUS_03750 33836 34081 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_03750 34101 35363 gene locus_tag LOCUS_03760 gene fabF 34101 35363 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762962.1 protein_id gnl|my_center|LOCUS_03760 35353 36192 gene locus_tag LOCUS_03770 gene rnc 35353 36192 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_03770 37117 36104 gene locus_tag LOCUS_03780 37117 36104 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_03780 37342 38775 gene locus_tag LOCUS_03790 37342 38775 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_03790 38783 40258 gene locus_tag LOCUS_03800 gene cysS 38783 40258 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_03800 40275 43688 gene locus_tag LOCUS_03810 40275 43688 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108712.1 protein_id gnl|my_center|LOCUS_03810 43688 44365 gene locus_tag LOCUS_03820 43688 44365 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_03820 46066 45524 gene locus_tag LOCUS_03830 46066 45524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 >Feature sequence009 860 1363 gene locus_tag LOCUS_03840 860 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 1374 2468 gene locus_tag LOCUS_03850 1374 2468 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_03850 3413 3270 gene locus_tag LOCUS_03860 3413 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3811 3515 gene locus_tag LOCUS_03870 3811 3515 CDS product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837143.1 protein_id gnl|my_center|LOCUS_03870 5940 3877 gene locus_tag LOCUS_03880 5940 3877 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_03880 6120 8051 gene locus_tag LOCUS_03890 6120 8051 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_03890 10683 8128 gene locus_tag LOCUS_03900 10683 8128 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_03900 10793 16594 gene locus_tag LOCUS_03910 10793 16594 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_03910 16626 17372 gene locus_tag LOCUS_03920 16626 17372 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_03920 18482 17397 gene locus_tag LOCUS_03930 18482 17397 CDS product TIGR04133 family radical SAM/SPASM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803875.1 protein_id gnl|my_center|LOCUS_03930 19020 18475 gene locus_tag LOCUS_03940 19020 18475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 20140 19244 gene locus_tag LOCUS_03950 20140 19244 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_03950 20225 20707 gene locus_tag LOCUS_03960 20225 20707 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_03960 21591 20704 gene locus_tag LOCUS_03970 gene fabD 21591 20704 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_03970 22485 21694 gene locus_tag LOCUS_03980 22485 21694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 22944 22492 gene locus_tag LOCUS_03990 22944 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 23486 23037 gene locus_tag LOCUS_04000 23486 23037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202710.1 protein_id gnl|my_center|LOCUS_04000 23570 24229 gene locus_tag LOCUS_04010 23570 24229 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761373.1 protein_id gnl|my_center|LOCUS_04010 24210 25175 gene locus_tag LOCUS_04020 24210 25175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 25567 25205 gene locus_tag LOCUS_04030 25567 25205 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_04030 27783 25564 gene locus_tag LOCUS_04040 27783 25564 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_04040 28180 27788 gene locus_tag LOCUS_04050 28180 27788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 28388 28591 gene locus_tag LOCUS_04060 28388 28591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 29710 28610 gene locus_tag LOCUS_04070 29710 28610 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_04070 29930 31423 gene locus_tag LOCUS_04080 29930 31423 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_04080 31420 32586 gene locus_tag LOCUS_04090 gene purT 31420 32586 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_04090 32761 33135 gene locus_tag LOCUS_04100 32761 33135 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787945.1 protein_id gnl|my_center|LOCUS_04100 33230 33305 gene locus_tag LOCUS_t00140 33230 33305 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34056 33361 gene locus_tag LOCUS_04110 34056 33361 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_04110 35726 34095 gene locus_tag LOCUS_04120 35726 34095 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282029.1 protein_id gnl|my_center|LOCUS_04120 35849 37015 gene locus_tag LOCUS_04130 35849 37015 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_04130 37029 38630 gene locus_tag LOCUS_04140 37029 38630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203079.1 protein_id gnl|my_center|LOCUS_04140 38633 41533 gene locus_tag LOCUS_04150 38633 41533 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203078.1 protein_id gnl|my_center|LOCUS_04150 41538 42368 gene locus_tag LOCUS_04160 41538 42368 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203077.1 protein_id gnl|my_center|LOCUS_04160 42365 44710 gene locus_tag LOCUS_04170 42365 44710 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203076.1 protein_id gnl|my_center|LOCUS_04170 44729 45772 gene locus_tag LOCUS_04180 44729 45772 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_04180 45853 45927 gene locus_tag LOCUS_t00150 45853 45927 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 1124 1666 gene locus_tag LOCUS_04190 1124 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1709 2125 gene locus_tag LOCUS_04200 1709 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2109 4361 gene locus_tag LOCUS_04210 2109 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4469 4978 gene locus_tag LOCUS_04220 4469 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6699 6169 gene locus_tag LOCUS_04230 gene cobC 6699 6169 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_04230 8466 6712 gene locus_tag LOCUS_04240 8466 6712 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_04240 10330 8594 gene locus_tag LOCUS_04250 10330 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 11165 10488 gene locus_tag LOCUS_04260 gene trmD 11165 10488 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_04260 11243 11740 gene locus_tag LOCUS_04270 11243 11740 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_04270 12520 13377 gene locus_tag LOCUS_04280 12520 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 13387 13611 gene locus_tag LOCUS_04290 13387 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 13563 13751 gene locus_tag LOCUS_04300 13563 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 14312 15415 gene locus_tag LOCUS_04310 14312 15415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 17581 15494 gene locus_tag LOCUS_04320 17581 15494 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_04320 17725 19725 gene locus_tag LOCUS_04330 gene ligA 17725 19725 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_04330 19780 20673 gene locus_tag LOCUS_04340 gene dapA 19780 20673 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761561.1 protein_id gnl|my_center|LOCUS_04340 21741 20710 gene locus_tag LOCUS_04350 21741 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04350 22317 21769 gene locus_tag LOCUS_04360 22317 21769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04360 22505 22431 gene locus_tag LOCUS_t00160 22505 22431 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22604 22530 gene locus_tag LOCUS_t00170 22604 22530 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 24733 22685 gene locus_tag LOCUS_04370 gene htpG 24733 22685 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_04370 27399 24859 gene locus_tag LOCUS_04380 27399 24859 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_04380 27601 30150 gene locus_tag LOCUS_04390 gene gyrA 27601 30150 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_04390 30202 31383 gene locus_tag LOCUS_04400 30202 31383 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765728.1 protein_id gnl|my_center|LOCUS_04400 31553 32722 gene locus_tag LOCUS_04410 31553 32722 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_04410 32725 33729 gene locus_tag LOCUS_04420 32725 33729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 35736 33862 gene locus_tag LOCUS_04430 gene cbiD 35736 33862 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993058.1 protein_id gnl|my_center|LOCUS_04430 37651 35858 gene locus_tag LOCUS_04440 gene cobM 37651 35858 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788023.1 protein_id gnl|my_center|LOCUS_04440 38844 37648 gene locus_tag LOCUS_04450 38844 37648 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788021.1 protein_id gnl|my_center|LOCUS_04450 40274 38847 gene locus_tag LOCUS_04460 gene cobJ 40274 38847 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788019.1 protein_id gnl|my_center|LOCUS_04460 41046 40300 gene locus_tag LOCUS_04470 41046 40300 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202902.1 protein_id gnl|my_center|LOCUS_04470 43120 41138 gene locus_tag LOCUS_04480 43120 41138 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_04480 <44179 43327 gene locus_tag LOCUS_04490 <44179 43327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937953.1:sirohydrochlorin cobaltochelatase >Feature sequence011 448 1437 gene locus_tag LOCUS_04500 448 1437 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_04500 1660 2616 gene locus_tag LOCUS_04510 1660 2616 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764604.1 protein_id gnl|my_center|LOCUS_04510 2697 3086 gene locus_tag LOCUS_04520 2697 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3092 3700 gene locus_tag LOCUS_04530 3092 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3829 5346 gene locus_tag LOCUS_04540 gene gpmI 3829 5346 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_04540 5346 5930 gene locus_tag LOCUS_04550 5346 5930 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_04550 7986 6028 gene locus_tag LOCUS_04560 gene gyrB 7986 6028 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_04560 8424 8170 gene locus_tag LOCUS_04570 gene rpsT 8424 8170 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_04570 8543 8471 gene locus_tag LOCUS_t00180 8543 8471 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8688 9419 gene locus_tag LOCUS_04580 gene recO 8688 9419 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_04580 10225 9434 gene locus_tag LOCUS_04590 gene djlA 10225 9434 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417332.1 protein_id gnl|my_center|LOCUS_04590 10860 10414 gene locus_tag LOCUS_04600 10860 10414 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_04600 12191 10887 gene locus_tag LOCUS_04610 gene ftsZ 12191 10887 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_04610 13670 12207 gene locus_tag LOCUS_04620 gene ftsA 13670 12207 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108835.1 protein_id gnl|my_center|LOCUS_04620 14429 13689 gene locus_tag LOCUS_04630 14429 13689 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_04630 15799 14426 gene locus_tag LOCUS_04640 gene murC 15799 14426 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_04640 16950 15796 gene locus_tag LOCUS_04650 gene murG 16950 15796 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_04650 18331 16997 gene locus_tag LOCUS_04660 18331 16997 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_04660 19659 18334 gene locus_tag LOCUS_04670 gene murD 19659 18334 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_04670 21023 19755 gene locus_tag LOCUS_04680 gene mraY 21023 19755 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763716.1 protein_id gnl|my_center|LOCUS_04680 22508 21057 gene locus_tag LOCUS_04690 22508 21057 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108839.1 protein_id gnl|my_center|LOCUS_04690 24637 22520 gene locus_tag LOCUS_04700 24637 22520 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_04700 25056 24712 gene locus_tag LOCUS_04710 25056 24712 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784014.1 protein_id gnl|my_center|LOCUS_04710 26010 25096 gene locus_tag LOCUS_04720 gene rsmH 26010 25096 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_04720 26551 26000 gene locus_tag LOCUS_04730 gene mraZ 26551 26000 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_04730 27226 26705 gene locus_tag LOCUS_04740 27226 26705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 27963 27520 gene locus_tag LOCUS_04750 27963 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 29184 28297 gene locus_tag LOCUS_04760 29184 28297 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765456.1 protein_id gnl|my_center|LOCUS_04760 29570 29214 gene locus_tag LOCUS_04770 29570 29214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 29760 30602 gene locus_tag LOCUS_04780 29760 30602 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_04780 30638 31630 gene locus_tag LOCUS_04790 30638 31630 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_04790 32976 31657 gene locus_tag LOCUS_04800 32976 31657 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_04800 33070 33504 gene locus_tag LOCUS_04810 gene dut 33070 33504 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_04810 33581 35245 gene locus_tag LOCUS_04820 33581 35245 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_04820 35322 35858 gene locus_tag LOCUS_04830 35322 35858 CDS product DUF4292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784040.1 protein_id gnl|my_center|LOCUS_04830 35855 37192 gene locus_tag LOCUS_04840 35855 37192 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_04840 38258 37164 gene locus_tag LOCUS_04850 38258 37164 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_04850 38372 40189 gene locus_tag LOCUS_04860 38372 40189 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_04860 40216 40359 gene locus_tag LOCUS_04870 40216 40359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 40365 40844 gene locus_tag LOCUS_04880 40365 40844 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_04880 40885 41997 gene locus_tag LOCUS_04890 gene prfB 40885 41997 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_04890 42028 43332 gene locus_tag LOCUS_04900 42028 43332 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767135.1 protein_id gnl|my_center|LOCUS_04900 43427 43591 gene locus_tag LOCUS_04910 43427 43591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence012 1500 505 gene locus_tag LOCUS_04920 1500 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 2548 1511 gene locus_tag LOCUS_04930 gene hisC 2548 1511 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_04930 3305 2577 gene locus_tag LOCUS_04940 3305 2577 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_04940 3935 3375 gene locus_tag LOCUS_04950 3935 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5404 4103 gene locus_tag LOCUS_04960 5404 4103 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_04960 6119 5511 gene locus_tag LOCUS_04970 gene udk 6119 5511 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_04970 6270 6566 gene locus_tag LOCUS_04980 6270 6566 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_04980 6619 8622 gene locus_tag LOCUS_04990 6619 8622 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_04990 8658 10067 gene locus_tag LOCUS_05000 8658 10067 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_05000 10186 11409 gene locus_tag LOCUS_05010 gene pepT 10186 11409 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786005.1 protein_id gnl|my_center|LOCUS_05010 11443 12306 gene locus_tag LOCUS_05020 11443 12306 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_05020 12311 13108 gene locus_tag LOCUS_05030 12311 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 13610 13140 gene locus_tag LOCUS_05040 13610 13140 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_05040 13707 14363 gene locus_tag LOCUS_05050 13707 14363 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109273.1 protein_id gnl|my_center|LOCUS_05050 14408 15046 gene locus_tag LOCUS_05060 14408 15046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_05060 15190 15666 gene locus_tag LOCUS_05070 15190 15666 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840622.1 protein_id gnl|my_center|LOCUS_05070 15785 17290 gene locus_tag LOCUS_05080 15785 17290 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992604.1 protein_id gnl|my_center|LOCUS_05080 17942 17361 gene locus_tag LOCUS_05090 17942 17361 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790401.1 protein_id gnl|my_center|LOCUS_05090 19326 17944 gene locus_tag LOCUS_05100 19326 17944 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790403.1 protein_id gnl|my_center|LOCUS_05100 20063 19323 gene locus_tag LOCUS_05110 20063 19323 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790405.1 protein_id gnl|my_center|LOCUS_05110 20262 20558 gene locus_tag LOCUS_05120 20262 20558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 protein_id gnl|my_center|LOCUS_05120 20571 20861 gene locus_tag LOCUS_05130 20571 20861 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790425.1 protein_id gnl|my_center|LOCUS_05130 20970 22505 gene locus_tag LOCUS_05140 gene rny 20970 22505 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_05140 22767 22612 gene locus_tag LOCUS_05150 22767 22612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 23434 24030 gene locus_tag LOCUS_05160 23434 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 27451 24215 gene locus_tag LOCUS_05170 27451 24215 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_05170 27917 27465 gene locus_tag LOCUS_05180 gene bcp 27917 27465 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_05180 28591 27944 gene locus_tag LOCUS_05190 28591 27944 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 protein_id gnl|my_center|LOCUS_05190 30417 28588 gene locus_tag LOCUS_05200 30417 28588 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761012.1 protein_id gnl|my_center|LOCUS_05200 31242 30445 gene locus_tag LOCUS_05210 31242 30445 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_05210 32033 31239 gene locus_tag LOCUS_05220 gene nagB 32033 31239 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_05220 33321 32131 gene locus_tag LOCUS_05230 33321 32131 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764349.1 protein_id gnl|my_center|LOCUS_05230 33972 33628 gene locus_tag LOCUS_05240 33972 33628 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_05240 34305 33991 gene locus_tag LOCUS_05250 34305 33991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 35058 34345 gene locus_tag LOCUS_05260 35058 34345 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_05260 35182 36447 gene locus_tag LOCUS_05270 35182 36447 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_05270 38009 36480 gene locus_tag LOCUS_05280 38009 36480 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_05280 39099 38014 gene locus_tag LOCUS_05290 39099 38014 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_05290 39817 39374 gene locus_tag LOCUS_05300 39817 39374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 40910 40011 gene locus_tag LOCUS_05310 40910 40011 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_05310 41073 41969 gene locus_tag LOCUS_05320 41073 41969 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_05320 42054 43304 gene locus_tag LOCUS_05330 gene ectB 42054 43304 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040099.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence013 353 700 gene locus_tag LOCUS_05340 353 700 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785477.1 protein_id gnl|my_center|LOCUS_05340 931 1740 gene locus_tag LOCUS_05350 931 1740 CDS product DUF3805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107812.1 protein_id gnl|my_center|LOCUS_05350 1740 3539 gene locus_tag LOCUS_05360 1740 3539 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_05360 4310 5518 gene locus_tag LOCUS_05370 4310 5518 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108610.1 protein_id gnl|my_center|LOCUS_05370 5515 6756 gene locus_tag LOCUS_05380 5515 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 6797 7723 gene locus_tag LOCUS_05390 6797 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 7792 8136 gene locus_tag LOCUS_05400 7792 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 8268 9254 gene locus_tag LOCUS_05410 8268 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 9340 11121 gene locus_tag LOCUS_05420 9340 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 11450 14035 gene locus_tag LOCUS_05430 11450 14035 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679058.1 protein_id gnl|my_center|LOCUS_05430 14052 15278 gene locus_tag LOCUS_05440 14052 15278 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_05440 15287 17116 gene locus_tag LOCUS_05450 15287 17116 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203684.1 protein_id gnl|my_center|LOCUS_05450 17113 18120 gene locus_tag LOCUS_05460 17113 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 18580 19539 gene locus_tag LOCUS_05470 18580 19539 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_05470 19706 25471 gene locus_tag LOCUS_05480 19706 25471 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202133.1 protein_id gnl|my_center|LOCUS_05480 25525 26595 gene locus_tag LOCUS_05490 25525 26595 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_05490 26634 27740 gene locus_tag LOCUS_05500 gene meaB 26634 27740 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_05500 27793 28617 gene locus_tag LOCUS_05510 27793 28617 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_05510 28835 29830 gene locus_tag LOCUS_05520 28835 29830 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760937.1 protein_id gnl|my_center|LOCUS_05520 31986 29884 gene locus_tag LOCUS_05530 31986 29884 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_05530 32110 32319 gene locus_tag LOCUS_05540 32110 32319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 33977 32715 gene locus_tag LOCUS_05550 33977 32715 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_05550 35465 34014 gene locus_tag LOCUS_05560 35465 34014 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 protein_id gnl|my_center|LOCUS_05560 36805 35465 gene locus_tag LOCUS_05570 gene trkA 36805 35465 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_05570 38726 36741 gene locus_tag LOCUS_05580 gene dxs 38726 36741 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_05580 39160 39834 gene locus_tag LOCUS_05590 39160 39834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 39804 42281 gene locus_tag LOCUS_05600 39804 42281 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_05600 42310 42525 gene locus_tag LOCUS_05610 gene tatA 42310 42525 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760985.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence014 <1 610 gene locus_tag LOCUS_05620 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759796.1:methylmalonyl-CoA mutase 886 2022 gene locus_tag LOCUS_05630 gene nagA 886 2022 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_05630 2004 3125 gene locus_tag LOCUS_05640 2004 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 3139 3819 gene locus_tag LOCUS_05650 3139 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05650 4051 4572 gene locus_tag LOCUS_05660 4051 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 5235 6494 gene locus_tag LOCUS_05670 5235 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6582 8798 gene locus_tag LOCUS_05680 6582 8798 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_05680 10191 8842 gene locus_tag LOCUS_05690 10191 8842 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_05690 11264 10188 gene locus_tag LOCUS_05700 gene aroC 11264 10188 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_05700 11361 12656 gene locus_tag LOCUS_05710 11361 12656 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_05710 13308 12724 gene locus_tag LOCUS_05720 13308 12724 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_05720 13462 13535 gene locus_tag LOCUS_t00190 13462 13535 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14381 13599 gene locus_tag LOCUS_05730 14381 13599 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525749.1 protein_id gnl|my_center|LOCUS_05730 16971 14476 gene locus_tag LOCUS_05740 16971 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 18202 17069 gene locus_tag LOCUS_05750 18202 17069 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336377.1 protein_id gnl|my_center|LOCUS_05750 18659 18231 gene locus_tag LOCUS_05760 18659 18231 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931805.1 protein_id gnl|my_center|LOCUS_05760 19984 18671 gene locus_tag LOCUS_05770 19984 18671 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760705.1 protein_id gnl|my_center|LOCUS_05770 21297 19987 gene locus_tag LOCUS_05780 21297 19987 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_05780 22615 21311 gene locus_tag LOCUS_05790 22615 21311 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_05790 23174 22599 gene locus_tag LOCUS_05800 23174 22599 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_05800 24769 23171 gene locus_tag LOCUS_05810 24769 23171 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_05810 25573 24800 gene locus_tag LOCUS_05820 25573 24800 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111965864.1 protein_id gnl|my_center|LOCUS_05820 26170 27900 gene locus_tag LOCUS_05830 26170 27900 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_05830 27900 29696 gene locus_tag LOCUS_05840 27900 29696 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_05840 29715 30401 gene locus_tag LOCUS_05850 29715 30401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 30435 31961 gene locus_tag LOCUS_05860 30435 31961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 33199 32108 gene locus_tag LOCUS_05870 33199 32108 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_05870 33832 33242 gene locus_tag LOCUS_05880 33832 33242 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_05880 33927 34616 gene locus_tag LOCUS_05890 gene rsmI 33927 34616 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_05890 34629 35525 gene locus_tag LOCUS_05900 34629 35525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_05900 35580 36518 gene locus_tag LOCUS_05910 35580 36518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 36598 37878 gene locus_tag LOCUS_05920 gene hflX 36598 37878 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_05920 37853 39847 gene locus_tag LOCUS_05930 37853 39847 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796342.1 protein_id gnl|my_center|LOCUS_05930 39929 41539 gene locus_tag LOCUS_05940 39929 41539 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_05940 41536 41916 gene locus_tag LOCUS_05950 41536 41916 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_05950 42637 41990 gene locus_tag LOCUS_05960 42637 41990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence015 1123 668 gene locus_tag LOCUS_05970 1123 668 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_05970 1227 1550 gene locus_tag LOCUS_05980 1227 1550 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_05980 2628 1564 gene locus_tag LOCUS_05990 2628 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2759 3427 gene locus_tag LOCUS_06000 2759 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4204 4395 gene locus_tag LOCUS_06010 4204 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5159 4392 gene locus_tag LOCUS_06020 5159 4392 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_06020 5566 5156 gene locus_tag LOCUS_06030 5566 5156 CDS product WbuC family cupin fold metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786607.1 protein_id gnl|my_center|LOCUS_06030 6137 5619 gene locus_tag LOCUS_06040 6137 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6255 7349 gene locus_tag LOCUS_06050 6255 7349 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203638.1 protein_id gnl|my_center|LOCUS_06050 7391 8140 gene locus_tag LOCUS_06060 7391 8140 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_06060 8177 8887 gene locus_tag LOCUS_06070 8177 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8884 10101 gene locus_tag LOCUS_06080 8884 10101 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339900.1 protein_id gnl|my_center|LOCUS_06080 10108 11664 gene locus_tag LOCUS_06090 10108 11664 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120684.1 protein_id gnl|my_center|LOCUS_06090 11674 12540 gene locus_tag LOCUS_06100 11674 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12537 14261 gene locus_tag LOCUS_06110 12537 14261 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099260488.1 protein_id gnl|my_center|LOCUS_06110 14280 15491 gene locus_tag LOCUS_06120 14280 15491 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922307.1 protein_id gnl|my_center|LOCUS_06120 15505 16938 gene locus_tag LOCUS_06130 15505 16938 CDS product PQQ-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121949.1 protein_id gnl|my_center|LOCUS_06130 16957 18021 gene locus_tag LOCUS_06140 16957 18021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 18030 18611 gene locus_tag LOCUS_06150 18030 18611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 18608 19840 gene locus_tag LOCUS_06160 18608 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 19856 21688 gene locus_tag LOCUS_06170 19856 21688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 21691 24084 gene locus_tag LOCUS_06180 gene nuoF 21691 24084 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_06180 24086 25057 gene locus_tag LOCUS_06190 24086 25057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 25082 26206 gene locus_tag LOCUS_06200 25082 26206 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921978.1 protein_id gnl|my_center|LOCUS_06200 26226 26891 gene locus_tag LOCUS_06210 26226 26891 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_06210 26888 29992 gene locus_tag LOCUS_06220 26888 29992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 29994 31271 gene locus_tag LOCUS_06230 29994 31271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 31277 32560 gene locus_tag LOCUS_06240 31277 32560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 32633 33856 gene locus_tag LOCUS_06250 32633 33856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 33920 34288 gene locus_tag LOCUS_06260 33920 34288 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_06260 34702 34412 gene locus_tag LOCUS_06270 34702 34412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 35154 35468 gene locus_tag LOCUS_06280 35154 35468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 35627 35472 gene locus_tag LOCUS_06290 35627 35472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 35642 36430 gene locus_tag LOCUS_06300 35642 36430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 36601 37686 gene locus_tag LOCUS_06310 36601 37686 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272563.1 protein_id gnl|my_center|LOCUS_06310 37706 38227 gene locus_tag LOCUS_06320 37706 38227 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107123.1 protein_id gnl|my_center|LOCUS_06320 38234 39448 gene locus_tag LOCUS_06330 38234 39448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201881.1 protein_id gnl|my_center|LOCUS_06330 40343 39630 gene locus_tag LOCUS_06340 40343 39630 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267339.1 protein_id gnl|my_center|LOCUS_06340 40495 40569 gene locus_tag LOCUS_t00200 40495 40569 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 40926 40801 gene locus_tag LOCUS_06350 40926 40801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 >Feature sequence016 742 1089 gene locus_tag LOCUS_06360 742 1089 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_06360 1114 2367 gene locus_tag LOCUS_06370 1114 2367 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_06370 2421 3110 gene locus_tag LOCUS_06380 2421 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_06380 4311 3235 gene locus_tag LOCUS_06390 4311 3235 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483085.1 protein_id gnl|my_center|LOCUS_06390 5266 4436 gene locus_tag LOCUS_06400 5266 4436 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764605.1 protein_id gnl|my_center|LOCUS_06400 6865 5396 gene locus_tag LOCUS_06410 6865 5396 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_06410 7991 6906 gene locus_tag LOCUS_06420 7991 6906 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764608.1 protein_id gnl|my_center|LOCUS_06420 9784 8201 gene locus_tag LOCUS_06430 9784 8201 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840466.1 protein_id gnl|my_center|LOCUS_06430 11160 9823 gene locus_tag LOCUS_06440 gene rseP 11160 9823 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_06440 12730 11273 gene locus_tag LOCUS_06450 12730 11273 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_06450 15270 12796 gene locus_tag LOCUS_06460 15270 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 15473 16819 gene locus_tag LOCUS_06470 gene purB 15473 16819 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760796.1 protein_id gnl|my_center|LOCUS_06470 16908 18284 gene locus_tag LOCUS_06480 16908 18284 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760797.1 protein_id gnl|my_center|LOCUS_06480 18359 19762 gene locus_tag LOCUS_06490 gene asnS 18359 19762 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_06490 19927 20388 gene locus_tag LOCUS_06500 gene rplM 19927 20388 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_06500 20398 20784 gene locus_tag LOCUS_06510 gene rpsI 20398 20784 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_06510 20910 21752 gene locus_tag LOCUS_06520 gene rpsB 20910 21752 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_06520 21783 22775 gene locus_tag LOCUS_06530 gene tsf 21783 22775 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_06530 23315 22872 gene locus_tag LOCUS_06540 23315 22872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_06540 24426 23380 gene locus_tag LOCUS_06550 24426 23380 CDS product DUF6340 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785441.1 protein_id gnl|my_center|LOCUS_06550 27841 24479 gene locus_tag LOCUS_06560 gene secA 27841 24479 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_06560 29437 27956 gene locus_tag LOCUS_06570 29437 27956 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_06570 30711 29434 gene locus_tag LOCUS_06580 30711 29434 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_06580 30884 32137 gene locus_tag LOCUS_06590 30884 32137 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_06590 32169 33488 gene locus_tag LOCUS_06600 32169 33488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_06600 33488 34210 gene locus_tag LOCUS_06610 gene lptC 33488 34210 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_06610 34207 35463 gene locus_tag LOCUS_06620 34207 35463 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_06620 35626 37758 gene locus_tag LOCUS_06630 35626 37758 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_06630 38028 38462 gene locus_tag LOCUS_06640 38028 38462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 >Feature sequence017 1353 10 gene locus_tag LOCUS_06650 1353 10 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_06650 1525 2217 gene locus_tag LOCUS_06660 1525 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_06660 2198 2974 gene locus_tag LOCUS_06670 2198 2974 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769417.1 protein_id gnl|my_center|LOCUS_06670 2971 3537 gene locus_tag LOCUS_06680 2971 3537 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_06680 4948 3509 gene locus_tag LOCUS_06690 gene cls 4948 3509 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796243.1 protein_id gnl|my_center|LOCUS_06690 7894 4955 gene locus_tag LOCUS_06700 7894 4955 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_06700 8127 9128 gene locus_tag LOCUS_06710 gene aroB 8127 9128 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_06710 10086 9184 gene locus_tag LOCUS_06720 10086 9184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 10389 10464 gene locus_tag LOCUS_t00210 10389 10464 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14544 10516 gene locus_tag LOCUS_06730 14544 10516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16056 14581 gene locus_tag LOCUS_06740 16056 14581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 17511 16108 gene locus_tag LOCUS_06750 17511 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 18972 17521 gene locus_tag LOCUS_06760 18972 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 20668 19094 gene locus_tag LOCUS_06770 20668 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 22161 20737 gene locus_tag LOCUS_06780 22161 20737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 22757 22614 gene locus_tag LOCUS_06790 22757 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 24062 22767 gene locus_tag LOCUS_06800 24062 22767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 25455 24163 gene locus_tag LOCUS_06810 25455 24163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 26020 27330 gene locus_tag LOCUS_06820 26020 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 29645 27825 gene locus_tag LOCUS_06830 gene mutL 29645 27825 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_06830 30029 29742 gene locus_tag LOCUS_06840 30029 29742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791850.1 protein_id gnl|my_center|LOCUS_06840 31666 30098 gene locus_tag LOCUS_06850 31666 30098 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_06850 33138 31807 gene locus_tag LOCUS_06860 33138 31807 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_06860 34543 33260 gene locus_tag LOCUS_06870 34543 33260 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108995.1 protein_id gnl|my_center|LOCUS_06870 36195 34720 gene locus_tag LOCUS_06880 gene guaB 36195 34720 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760772.1 protein_id gnl|my_center|LOCUS_06880 36766 36350 gene locus_tag LOCUS_06890 36766 36350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 38506 37187 gene locus_tag LOCUS_06900 38506 37187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 38914 38669 gene locus_tag LOCUS_06910 38914 38669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence018 1272 4934 gene locus_tag LOCUS_06920 1272 4934 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_06920 5835 4942 gene locus_tag LOCUS_06930 5835 4942 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_06930 7100 5943 gene locus_tag LOCUS_06940 7100 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8127 7108 gene locus_tag LOCUS_06950 8127 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 8285 9481 gene locus_tag LOCUS_06960 8285 9481 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946621.1 protein_id gnl|my_center|LOCUS_06960 11901 9844 gene locus_tag LOCUS_06970 11901 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 13482 11923 gene locus_tag LOCUS_06980 13482 11923 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_06980 13655 13580 gene locus_tag LOCUS_t00220 13655 13580 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13775 15130 gene locus_tag LOCUS_06990 13775 15130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 16518 15331 gene locus_tag LOCUS_07000 16518 15331 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_07000 17237 16632 gene locus_tag LOCUS_07010 gene yihA 17237 16632 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_07010 17918 17241 gene locus_tag LOCUS_07020 gene lipB 17918 17241 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765857.1 protein_id gnl|my_center|LOCUS_07020 18063 18860 gene locus_tag LOCUS_07030 18063 18860 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_07030 18863 19525 gene locus_tag LOCUS_07040 gene rsmG 18863 19525 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_07040 19522 20163 gene locus_tag LOCUS_07050 19522 20163 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_07050 20213 23065 gene locus_tag LOCUS_07060 gene gcvP 20213 23065 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_07060 23665 23066 gene locus_tag LOCUS_07070 23665 23066 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794496.1 protein_id gnl|my_center|LOCUS_07070 24579 23662 gene locus_tag LOCUS_07080 24579 23662 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_07080 25658 24591 gene locus_tag LOCUS_07090 gene serC 25658 24591 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_07090 27105 25762 gene locus_tag LOCUS_07100 27105 25762 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_07100 27700 27092 gene locus_tag LOCUS_07110 27700 27092 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_07110 28621 27746 gene locus_tag LOCUS_07120 28621 27746 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_07120 28785 29603 gene locus_tag LOCUS_07130 28785 29603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228103.1 protein_id gnl|my_center|LOCUS_07130 30699 29611 gene locus_tag LOCUS_07140 gene dinB 30699 29611 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760075.1 protein_id gnl|my_center|LOCUS_07140 32047 30692 gene locus_tag LOCUS_07150 32047 30692 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_07150 32873 32049 gene locus_tag LOCUS_07160 32873 32049 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797836.1 protein_id gnl|my_center|LOCUS_07160 33010 33177 gene locus_tag LOCUS_07170 33010 33177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776430.1 protein_id gnl|my_center|LOCUS_07170 33246 35315 gene locus_tag LOCUS_07180 33246 35315 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_07180 35308 36126 gene locus_tag LOCUS_07190 35308 36126 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202508.1 protein_id gnl|my_center|LOCUS_07190 36301 37272 gene locus_tag LOCUS_07200 36301 37272 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795918.1 protein_id gnl|my_center|LOCUS_07200 37389 38174 gene locus_tag LOCUS_07210 gene mazG 37389 38174 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence019 1345 932 gene locus_tag LOCUS_07220 1345 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1484 2392 gene locus_tag LOCUS_07230 1484 2392 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295301.1 protein_id gnl|my_center|LOCUS_07230 2498 3208 gene locus_tag LOCUS_07240 2498 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3304 3867 gene locus_tag LOCUS_07250 3304 3867 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_07250 3968 6439 gene locus_tag LOCUS_07260 3968 6439 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626185.1 protein_id gnl|my_center|LOCUS_07260 6444 7070 gene locus_tag LOCUS_07270 6444 7070 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_07270 7656 7156 gene locus_tag LOCUS_07280 7656 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 8706 8338 gene locus_tag LOCUS_07290 8706 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 10342 8900 gene locus_tag LOCUS_07300 10342 8900 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100235.1 protein_id gnl|my_center|LOCUS_07300 14019 10339 gene locus_tag LOCUS_07310 14019 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 14233 14478 gene locus_tag LOCUS_07320 14233 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 14478 16121 gene locus_tag LOCUS_07330 gene menD 14478 16121 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786027.1 protein_id gnl|my_center|LOCUS_07330 16118 16843 gene locus_tag LOCUS_07340 16118 16843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 16915 17307 gene locus_tag LOCUS_07350 16915 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 17527 17904 gene locus_tag LOCUS_07360 17527 17904 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_07360 17920 19581 gene locus_tag LOCUS_07370 17920 19581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 21494 19650 gene locus_tag LOCUS_07380 gene glmS 21494 19650 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_07380 22180 21641 gene locus_tag LOCUS_07390 22180 21641 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791456.1 protein_id gnl|my_center|LOCUS_07390 22433 23776 gene locus_tag LOCUS_07400 22433 23776 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_07400 24641 24126 gene locus_tag LOCUS_07410 24641 24126 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107474.1 protein_id gnl|my_center|LOCUS_07410 24905 26116 gene locus_tag LOCUS_07420 24905 26116 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_07420 26837 26121 gene locus_tag LOCUS_07430 26837 26121 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107473.1 protein_id gnl|my_center|LOCUS_07430 27201 28250 gene locus_tag LOCUS_07440 27201 28250 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_07440 28408 29898 gene locus_tag LOCUS_07450 28408 29898 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_07450 29920 30906 gene locus_tag LOCUS_07460 29920 30906 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_07460 30946 32130 gene locus_tag LOCUS_07470 30946 32130 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_07470 32133 33389 gene locus_tag LOCUS_07480 32133 33389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_07480 33727 35850 gene locus_tag LOCUS_07490 33727 35850 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555650.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence020 1669 182 gene locus_tag LOCUS_07500 1669 182 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_07500 2580 1666 gene locus_tag LOCUS_07510 2580 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3403 3330 gene locus_tag LOCUS_t00230 3403 3330 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3545 4159 gene locus_tag LOCUS_07520 3545 4159 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792010.1 protein_id gnl|my_center|LOCUS_07520 4191 4937 gene locus_tag LOCUS_07530 gene fabG 4191 4937 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762708.1 protein_id gnl|my_center|LOCUS_07530 4937 5608 gene locus_tag LOCUS_07540 4937 5608 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_07540 5624 6433 gene locus_tag LOCUS_07550 5624 6433 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_07550 6423 7655 gene locus_tag LOCUS_07560 6423 7655 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_07560 7652 8992 gene locus_tag LOCUS_07570 7652 8992 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_07570 9044 13573 gene locus_tag LOCUS_07580 9044 13573 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_07580 13570 15933 gene locus_tag LOCUS_07590 13570 15933 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_07590 16009 16920 gene locus_tag LOCUS_07600 16009 16920 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_07600 18668 17019 gene locus_tag LOCUS_07610 18668 17019 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203709.1 protein_id gnl|my_center|LOCUS_07610 19174 18905 gene locus_tag LOCUS_07620 gene rpsO 19174 18905 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_07620 19298 21100 gene locus_tag LOCUS_07630 gene typA 19298 21100 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_07630 21287 22561 gene locus_tag LOCUS_07640 21287 22561 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291923.1 protein_id gnl|my_center|LOCUS_07640 22602 23906 gene locus_tag LOCUS_07650 22602 23906 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202445.1 protein_id gnl|my_center|LOCUS_07650 23976 25301 gene locus_tag LOCUS_07660 23976 25301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202446.1 protein_id gnl|my_center|LOCUS_07660 25405 26079 gene locus_tag LOCUS_07670 25405 26079 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786290.1 protein_id gnl|my_center|LOCUS_07670 26108 27436 gene locus_tag LOCUS_07680 26108 27436 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202445.1 protein_id gnl|my_center|LOCUS_07680 27449 28729 gene locus_tag LOCUS_07690 27449 28729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202446.1 protein_id gnl|my_center|LOCUS_07690 28781 30229 gene locus_tag LOCUS_07700 28781 30229 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795271.1 protein_id gnl|my_center|LOCUS_07700 30288 31652 gene locus_tag LOCUS_07710 30288 31652 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762237.1 protein_id gnl|my_center|LOCUS_07710 31649 32989 gene locus_tag LOCUS_07720 31649 32989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107842.1 protein_id gnl|my_center|LOCUS_07720 34048 33002 gene locus_tag LOCUS_07730 34048 33002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence021 451 2199 gene locus_tag LOCUS_07740 451 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3656 2253 gene locus_tag LOCUS_07750 gene uxaC 3656 2253 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_07750 4285 3653 gene locus_tag LOCUS_07760 4285 3653 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_07760 5767 4589 gene locus_tag LOCUS_07770 gene uxuA 5767 4589 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050396645.1 protein_id gnl|my_center|LOCUS_07770 6727 5882 gene locus_tag LOCUS_07780 6727 5882 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_07780 8834 6741 gene locus_tag LOCUS_07790 8834 6741 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201964.1 protein_id gnl|my_center|LOCUS_07790 9898 8834 gene locus_tag LOCUS_07800 9898 8834 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_07800 10005 11426 gene locus_tag LOCUS_07810 10005 11426 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_07810 11462 12307 gene locus_tag LOCUS_07820 11462 12307 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_07820 12577 12963 gene locus_tag LOCUS_07830 12577 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 12950 14110 gene locus_tag LOCUS_07840 12950 14110 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_07840 14243 16039 gene locus_tag LOCUS_07850 gene sppA 14243 16039 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_07850 16051 17139 gene locus_tag LOCUS_07860 gene lpxK 16051 17139 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_07860 17395 17634 gene locus_tag LOCUS_07870 17395 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 19550 18060 gene locus_tag LOCUS_07880 gene proS 19550 18060 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_07880 20119 19619 gene locus_tag LOCUS_07890 20119 19619 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_07890 21734 20181 gene locus_tag LOCUS_07900 21734 20181 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_07900 24661 21827 gene locus_tag LOCUS_07910 gene uvrA 24661 21827 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_07910 24826 26649 gene locus_tag LOCUS_07920 24826 26649 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 protein_id gnl|my_center|LOCUS_07920 26649 27341 gene locus_tag LOCUS_07930 26649 27341 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765085.1 protein_id gnl|my_center|LOCUS_07930 27338 28018 gene locus_tag LOCUS_07940 27338 28018 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690635.1 protein_id gnl|my_center|LOCUS_07940 28050 28904 gene locus_tag LOCUS_07950 28050 28904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 29434 28901 gene locus_tag LOCUS_07960 29434 28901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_07960 30781 29438 gene locus_tag LOCUS_07970 30781 29438 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167439.1 protein_id gnl|my_center|LOCUS_07970 30984 32147 gene locus_tag LOCUS_07980 30984 32147 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108770.1 protein_id gnl|my_center|LOCUS_07980 32203 33963 gene locus_tag LOCUS_07990 gene aspS 32203 33963 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence022 284 826 gene locus_tag LOCUS_08000 284 826 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_08000 839 1024 gene locus_tag LOCUS_08010 gene rpmF 839 1024 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_08010 1126 2163 gene locus_tag LOCUS_08020 1126 2163 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_08020 2241 3125 gene locus_tag LOCUS_08030 gene era 2241 3125 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_08030 3170 4480 gene locus_tag LOCUS_08040 gene der 3170 4480 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_08040 4477 5253 gene locus_tag LOCUS_08050 4477 5253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_08050 7385 6000 gene locus_tag LOCUS_08060 gene glmM 7385 6000 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_08060 8002 7382 gene locus_tag LOCUS_08070 8002 7382 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109033.1 protein_id gnl|my_center|LOCUS_08070 9144 8092 gene locus_tag LOCUS_08080 9144 8092 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_08080 10348 9203 gene locus_tag LOCUS_08090 10348 9203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 11438 10788 gene locus_tag LOCUS_08100 gene rpe 11438 10788 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802152.1 protein_id gnl|my_center|LOCUS_08100 12387 11446 gene locus_tag LOCUS_08110 gene fmt 12387 11446 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_08110 14296 12500 gene locus_tag LOCUS_08120 14296 12500 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_08120 14871 14299 gene locus_tag LOCUS_08130 14871 14299 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_08130 14929 15387 gene locus_tag LOCUS_08140 14929 15387 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_08140 15552 17267 gene locus_tag LOCUS_08150 gene recJ 15552 17267 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_08150 17286 19178 gene locus_tag LOCUS_08160 17286 19178 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_08160 19238 20194 gene locus_tag LOCUS_08170 19238 20194 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764184.1 protein_id gnl|my_center|LOCUS_08170 20397 21296 gene locus_tag LOCUS_08180 20397 21296 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_08180 21289 22461 gene locus_tag LOCUS_08190 21289 22461 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_08190 22502 23569 gene locus_tag LOCUS_08200 22502 23569 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_08200 23591 24367 gene locus_tag LOCUS_08210 23591 24367 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_08210 24369 24998 gene locus_tag LOCUS_08220 24369 24998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 25917 25039 gene locus_tag LOCUS_08230 25917 25039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 26930 26139 gene locus_tag LOCUS_08240 26930 26139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 27431 27799 gene locus_tag LOCUS_08250 27431 27799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 27974 29152 gene locus_tag LOCUS_08260 27974 29152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896664.1 protein_id gnl|my_center|LOCUS_08260 29154 30821 gene locus_tag LOCUS_08270 29154 30821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223609.1 protein_id gnl|my_center|LOCUS_08270 30814 32595 gene locus_tag LOCUS_08280 30814 32595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence023 212 1336 gene locus_tag LOCUS_08290 gene dnaN 212 1336 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762412.1 protein_id gnl|my_center|LOCUS_08290 1340 2113 gene locus_tag LOCUS_08300 1340 2113 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_08300 2122 3819 gene locus_tag LOCUS_08310 gene recN 2122 3819 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_08310 3833 5554 gene locus_tag LOCUS_08320 3833 5554 CDS product tetratricopeptide repeat-containing serine protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788738.1 protein_id gnl|my_center|LOCUS_08320 7088 5850 gene locus_tag LOCUS_08330 7088 5850 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_08330 7184 8626 gene locus_tag LOCUS_08340 gene aldA 7184 8626 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225842.1 protein_id gnl|my_center|LOCUS_08340 8749 10956 gene locus_tag LOCUS_08350 8749 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 12035 11052 gene locus_tag LOCUS_08360 12035 11052 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_08360 12721 12047 gene locus_tag LOCUS_08370 12721 12047 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_08370 13199 12738 gene locus_tag LOCUS_08380 13199 12738 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_08380 13843 13205 gene locus_tag LOCUS_08390 13843 13205 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_08390 15167 13854 gene locus_tag LOCUS_08400 15167 13854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 16939 15200 gene locus_tag LOCUS_08410 16939 15200 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_08410 17378 17980 gene locus_tag LOCUS_08420 17378 17980 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_08420 19805 18450 gene locus_tag LOCUS_08430 19805 18450 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_08430 22110 19819 gene locus_tag LOCUS_08440 22110 19819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 23321 22137 gene locus_tag LOCUS_08450 23321 22137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_08450 24571 23534 gene locus_tag LOCUS_08460 gene pheS 24571 23534 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_08460 24651 24974 gene locus_tag LOCUS_08470 24651 24974 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767861.1 protein_id gnl|my_center|LOCUS_08470 24971 25543 gene locus_tag LOCUS_08480 gene ruvC 24971 25543 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_08480 25660 27570 gene locus_tag LOCUS_08490 gene pulA 25660 27570 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_08490 27626 28357 gene locus_tag LOCUS_08500 27626 28357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08500 28402 29013 gene locus_tag LOCUS_08510 28402 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08510 29118 30941 gene locus_tag LOCUS_08520 29118 30941 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_08520 30945 31598 gene locus_tag LOCUS_08530 30945 31598 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_08530 31622 32434 gene locus_tag LOCUS_08540 31622 32434 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705781.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence024 677 3853 gene locus_tag LOCUS_08550 677 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4023 4772 gene locus_tag LOCUS_08560 4023 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 5736 5347 gene locus_tag LOCUS_08570 5736 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6354 8468 gene locus_tag LOCUS_08580 6354 8468 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108809.1 protein_id gnl|my_center|LOCUS_08580 9909 8476 gene locus_tag LOCUS_08590 9909 8476 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109272.1 protein_id gnl|my_center|LOCUS_08590 9985 12105 gene locus_tag LOCUS_08600 gene dnaG 9985 12105 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_08600 12712 12131 gene locus_tag LOCUS_08610 gene folE 12712 12131 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791113.1 protein_id gnl|my_center|LOCUS_08610 13314 12757 gene locus_tag LOCUS_08620 13314 12757 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_08620 15404 13356 gene locus_tag LOCUS_08630 15404 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 15936 15394 gene locus_tag LOCUS_08640 15936 15394 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203534.1 protein_id gnl|my_center|LOCUS_08640 16881 16045 gene locus_tag LOCUS_08650 16881 16045 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760846.1 protein_id gnl|my_center|LOCUS_08650 19153 17063 gene locus_tag LOCUS_08660 gene recG 19153 17063 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_08660 19874 19179 gene locus_tag LOCUS_08670 19874 19179 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_08670 20422 19871 gene locus_tag LOCUS_08680 20422 19871 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_08680 21936 20470 gene locus_tag LOCUS_08690 21936 20470 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_08690 24212 22032 gene locus_tag LOCUS_08700 gene recQ 24212 22032 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_08700 25600 24362 gene locus_tag LOCUS_08710 gene clpX 25600 24362 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_08710 26279 25608 gene locus_tag LOCUS_08720 gene clpP 26279 25608 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_08720 27742 26375 gene locus_tag LOCUS_08730 gene tig 27742 26375 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_08730 28532 27825 gene locus_tag LOCUS_08740 28532 27825 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_08740 28644 29402 gene locus_tag LOCUS_08750 gene lptB 28644 29402 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_08750 30356 29484 gene locus_tag LOCUS_08760 30356 29484 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_08760 30502 31467 gene locus_tag LOCUS_08770 30502 31467 CDS product Tsr19 family tyrosine-type DNA invertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293248.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence025 <1 642 gene locus_tag LOCUS_08780 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230165.1:MBL fold metallo-hydrolase 652 1101 gene locus_tag LOCUS_08790 652 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1133 1585 gene locus_tag LOCUS_08800 1133 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3273 1669 gene locus_tag LOCUS_08810 3273 1669 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_08810 3472 4761 gene locus_tag LOCUS_08820 3472 4761 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_08820 4846 5916 gene locus_tag LOCUS_08830 4846 5916 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_08830 9185 6147 gene locus_tag LOCUS_08840 9185 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10527 9271 gene locus_tag LOCUS_08850 10527 9271 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_08850 11468 10698 gene locus_tag LOCUS_08860 gene lpxA 11468 10698 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_08860 12870 11488 gene locus_tag LOCUS_08870 12870 11488 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_08870 16101 12880 gene locus_tag LOCUS_08880 16101 12880 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767547.1 protein_id gnl|my_center|LOCUS_08880 17268 16162 gene locus_tag LOCUS_08890 17268 16162 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_08890 17539 19503 gene locus_tag LOCUS_08900 17539 19503 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_08900 19500 20321 gene locus_tag LOCUS_08910 19500 20321 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_08910 20360 22333 gene locus_tag LOCUS_08920 20360 22333 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_08920 22341 24362 gene locus_tag LOCUS_08930 22341 24362 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_08930 24518 26044 gene locus_tag LOCUS_08940 gene purH 24518 26044 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_08940 26076 27098 gene locus_tag LOCUS_08950 26076 27098 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_08950 27126 27962 gene locus_tag LOCUS_08960 gene mreC 27126 27962 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_08960 27980 28492 gene locus_tag LOCUS_08970 27980 28492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 28504 30369 gene locus_tag LOCUS_08980 gene mrdA 28504 30369 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_08980 30400 31869 gene locus_tag LOCUS_08990 gene rodA 30400 31869 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_08990 32375 31866 gene locus_tag LOCUS_09000 32375 31866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence026 2405 3 gene locus_tag LOCUS_09010 2405 3 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_09010 3022 2441 gene locus_tag LOCUS_09020 3022 2441 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_09020 3222 3037 gene locus_tag LOCUS_09030 3222 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4003 3134 gene locus_tag LOCUS_09040 4003 3134 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764420.1 protein_id gnl|my_center|LOCUS_09040 4980 4084 gene locus_tag LOCUS_09050 4980 4084 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_09050 5846 5100 gene locus_tag LOCUS_09060 5846 5100 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_09060 6603 5866 gene locus_tag LOCUS_09070 gene ubiE 6603 5866 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764422.1 protein_id gnl|my_center|LOCUS_09070 7549 6608 gene locus_tag LOCUS_09080 7549 6608 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_09080 8513 7527 gene locus_tag LOCUS_09090 8513 7527 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_09090 9163 8552 gene locus_tag LOCUS_09100 9163 8552 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760060.1 protein_id gnl|my_center|LOCUS_09100 9825 9160 gene locus_tag LOCUS_09110 9825 9160 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109233.1 protein_id gnl|my_center|LOCUS_09110 10677 9865 gene locus_tag LOCUS_09120 gene pgeF 10677 9865 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109232.1 protein_id gnl|my_center|LOCUS_09120 10804 11703 gene locus_tag LOCUS_09130 10804 11703 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658736.1 protein_id gnl|my_center|LOCUS_09130 11786 12418 gene locus_tag LOCUS_09140 11786 12418 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_09140 13548 12430 gene locus_tag LOCUS_09150 13548 12430 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_09150 13748 15310 gene locus_tag LOCUS_09160 13748 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 15355 17019 gene locus_tag LOCUS_09170 15355 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 17065 17589 gene locus_tag LOCUS_09180 17065 17589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 17606 20146 gene locus_tag LOCUS_09190 17606 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 21769 20180 gene locus_tag LOCUS_09200 21769 20180 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_09200 21659 21994 gene locus_tag LOCUS_09210 21659 21994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 22271 23740 gene locus_tag LOCUS_09220 22271 23740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 23967 25517 gene locus_tag LOCUS_09230 23967 25517 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_09230 27495 25570 gene locus_tag LOCUS_09240 27495 25570 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_09240 27613 28176 gene locus_tag LOCUS_09250 27613 28176 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760531.1 protein_id gnl|my_center|LOCUS_09250 30381 28537 gene locus_tag LOCUS_09260 30381 28537 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203224.1 protein_id gnl|my_center|LOCUS_09260 31636 30476 gene locus_tag LOCUS_09270 31636 30476 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_09270 32080 31643 gene locus_tag LOCUS_09280 32080 31643 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence027 1668 19 gene locus_tag LOCUS_09290 1668 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 2446 1709 gene locus_tag LOCUS_09300 2446 1709 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767685.1 protein_id gnl|my_center|LOCUS_09300 3120 2467 gene locus_tag LOCUS_09310 3120 2467 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_09310 3869 3117 gene locus_tag LOCUS_09320 3869 3117 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_09320 4135 4064 gene locus_tag LOCUS_t00240 4135 4064 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4273 7518 gene locus_tag LOCUS_09330 4273 7518 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_09330 9100 7796 gene locus_tag LOCUS_09340 gene tyrS 9100 7796 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_09340 9804 9163 gene locus_tag LOCUS_09350 9804 9163 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783653.1 protein_id gnl|my_center|LOCUS_09350 10022 9801 gene locus_tag LOCUS_09360 gene yidD 10022 9801 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_09360 10431 10003 gene locus_tag LOCUS_09370 gene rnpA 10431 10003 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_09370 11161 10424 gene locus_tag LOCUS_09380 11161 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 12503 11871 gene locus_tag LOCUS_09390 12503 11871 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_09390 13243 12500 gene locus_tag LOCUS_09400 13243 12500 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_09400 14519 13227 gene locus_tag LOCUS_09410 gene metK 14519 13227 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_09410 15952 14675 gene locus_tag LOCUS_09420 15952 14675 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_09420 16416 15949 gene locus_tag LOCUS_09430 gene folK 16416 15949 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_09430 17507 16449 gene locus_tag LOCUS_09440 gene queA 17507 16449 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_09440 18340 17540 gene locus_tag LOCUS_09450 gene truB 18340 17540 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_09450 19154 18354 gene locus_tag LOCUS_09460 19154 18354 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_09460 19385 19158 gene locus_tag LOCUS_09470 19385 19158 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_09470 20295 19429 gene locus_tag LOCUS_09480 20295 19429 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_09480 21247 20348 gene locus_tag LOCUS_09490 21247 20348 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_09490 22730 21366 gene locus_tag LOCUS_09500 gene miaB 22730 21366 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_09500 23069 23416 gene locus_tag LOCUS_09510 23069 23416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 23432 24937 gene locus_tag LOCUS_09520 23432 24937 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_09520 26449 24992 gene locus_tag LOCUS_09530 gene dacB 26449 24992 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_09530 28509 26482 gene locus_tag LOCUS_09540 28509 26482 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_09540 29948 28602 gene locus_tag LOCUS_09550 gene lpdA 29948 28602 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797088.1 protein_id gnl|my_center|LOCUS_09550 30399 29986 gene locus_tag LOCUS_09560 30399 29986 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783575.1 protein_id gnl|my_center|LOCUS_09560 30463 32052 gene locus_tag LOCUS_09570 gene nadB 30463 32052 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108697.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence028 697 242 gene locus_tag LOCUS_09580 697 242 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107510.1 protein_id gnl|my_center|LOCUS_09580 2451 1429 gene locus_tag LOCUS_09590 gene holA 2451 1429 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_09590 3231 2455 gene locus_tag LOCUS_09600 3231 2455 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_09600 3287 3736 gene locus_tag LOCUS_09610 3287 3736 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761554.1 protein_id gnl|my_center|LOCUS_09610 4611 3784 gene locus_tag LOCUS_09620 4611 3784 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_09620 5405 4617 gene locus_tag LOCUS_09630 5405 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5529 5882 gene locus_tag LOCUS_09640 5529 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6037 8538 gene locus_tag LOCUS_09650 6037 8538 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_09650 9848 8532 gene locus_tag LOCUS_09660 9848 8532 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_09660 10904 9915 gene locus_tag LOCUS_09670 10904 9915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_09670 11961 10897 gene locus_tag LOCUS_09680 11961 10897 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_09680 13139 11976 gene locus_tag LOCUS_09690 13139 11976 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202774.1 protein_id gnl|my_center|LOCUS_09690 13316 13681 gene locus_tag LOCUS_09700 13316 13681 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794475.1 protein_id gnl|my_center|LOCUS_09700 13714 15711 gene locus_tag LOCUS_09710 13714 15711 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_09710 15782 16513 gene locus_tag LOCUS_09720 15782 16513 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_09720 18121 16568 gene locus_tag LOCUS_09730 gene dnaB 18121 16568 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_09730 18249 19079 gene locus_tag LOCUS_09740 gene ispE 18249 19079 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_09740 20153 19038 gene locus_tag LOCUS_09750 20153 19038 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_09750 20497 20183 gene locus_tag LOCUS_09760 20497 20183 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_09760 21970 20936 gene locus_tag LOCUS_09770 gene galE 21970 20936 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_09770 22114 25302 gene locus_tag LOCUS_09780 22114 25302 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_09780 25299 28181 gene locus_tag LOCUS_09790 25299 28181 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_09790 28209 28826 gene locus_tag LOCUS_09800 gene recR 28209 28826 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_09800 30210 28882 gene locus_tag LOCUS_09810 30210 28882 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107229.1 protein_id gnl|my_center|LOCUS_09810 <31342 30523 gene locus_tag LOCUS_09820 <31342 30523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288210.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence029 663 325 gene locus_tag LOCUS_09830 663 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 797 2119 gene locus_tag LOCUS_09840 gene mtaB 797 2119 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_09840 2116 2997 gene locus_tag LOCUS_09850 2116 2997 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_09850 2990 4006 gene locus_tag LOCUS_09860 2990 4006 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_09860 4359 4003 gene locus_tag LOCUS_09870 gene folB 4359 4003 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_09870 7055 4365 gene locus_tag LOCUS_09880 7055 4365 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_09880 9713 7167 gene locus_tag LOCUS_09890 9713 7167 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_09890 11147 9738 gene locus_tag LOCUS_09900 gene dnaA 11147 9738 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_09900 12364 11459 gene locus_tag LOCUS_09910 12364 11459 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_09910 13638 12400 gene locus_tag LOCUS_09920 13638 12400 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_09920 13743 14291 gene locus_tag LOCUS_09930 13743 14291 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_09930 14435 17116 gene locus_tag LOCUS_09940 14435 17116 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_09940 19122 17455 gene locus_tag LOCUS_09950 19122 17455 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_09950 22115 19146 gene locus_tag LOCUS_09960 22115 19146 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_09960 22316 22840 gene locus_tag LOCUS_09970 22316 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048697209.1 protein_id gnl|my_center|LOCUS_09970 22851 23411 gene locus_tag LOCUS_09980 22851 23411 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_09980 23485 23706 gene locus_tag LOCUS_09990 23485 23706 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_09990 23890 26298 gene locus_tag LOCUS_10000 23890 26298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 26295 27362 gene locus_tag LOCUS_10010 26295 27362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 27782 29077 gene locus_tag LOCUS_10020 27782 29077 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361992.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence030 1759 2964 gene locus_tag LOCUS_10030 1759 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_10030 4424 2958 gene locus_tag LOCUS_10040 4424 2958 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789610.1 protein_id gnl|my_center|LOCUS_10040 4564 5979 gene locus_tag LOCUS_10050 4564 5979 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_10050 6173 7369 gene locus_tag LOCUS_10060 6173 7369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 7472 10156 gene locus_tag LOCUS_10070 7472 10156 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_10070 10267 11430 gene locus_tag LOCUS_10080 10267 11430 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_10080 11427 13223 gene locus_tag LOCUS_10090 11427 13223 CDS product DUF4980 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767782.1 protein_id gnl|my_center|LOCUS_10090 13474 14595 gene locus_tag LOCUS_10100 13474 14595 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_10100 14602 15486 gene locus_tag LOCUS_10110 14602 15486 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_10110 16439 15564 gene locus_tag LOCUS_10120 16439 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_10120 16722 18521 gene locus_tag LOCUS_10130 16722 18521 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_10130 19662 18676 gene locus_tag LOCUS_10140 19662 18676 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_10140 20655 19789 gene locus_tag LOCUS_10150 20655 19789 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_10150 20794 22194 gene locus_tag LOCUS_10160 gene radA 20794 22194 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_10160 22196 23848 gene locus_tag LOCUS_10170 22196 23848 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108284.1 protein_id gnl|my_center|LOCUS_10170 23890 24492 gene locus_tag LOCUS_10180 23890 24492 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763753.1 protein_id gnl|my_center|LOCUS_10180 24579 26999 gene locus_tag LOCUS_10190 24579 26999 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303106.1 protein_id gnl|my_center|LOCUS_10190 <29450 27026 gene locus_tag LOCUS_10200 <29450 27026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109093.1:glycoside hydrolase family 78 protein >Feature sequence031 1327 542 gene locus_tag LOCUS_10210 1327 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2863 1349 gene locus_tag LOCUS_10220 2863 1349 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768282.1 protein_id gnl|my_center|LOCUS_10220 5998 2888 gene locus_tag LOCUS_10230 5998 2888 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_10230 6834 9851 gene locus_tag LOCUS_10240 6834 9851 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_10240 9872 11260 gene locus_tag LOCUS_10250 9872 11260 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764026.1 protein_id gnl|my_center|LOCUS_10250 11405 12757 gene locus_tag LOCUS_10260 11405 12757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051743.1 protein_id gnl|my_center|LOCUS_10260 13850 13095 gene locus_tag LOCUS_10270 13850 13095 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_10270 15869 13890 gene locus_tag LOCUS_10280 15869 13890 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_10280 16477 15890 gene locus_tag LOCUS_10290 16477 15890 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_10290 16755 17354 gene locus_tag LOCUS_10300 16755 17354 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783481.1 protein_id gnl|my_center|LOCUS_10300 19055 17466 gene locus_tag LOCUS_10310 19055 17466 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797168.1 protein_id gnl|my_center|LOCUS_10310 19564 19106 gene locus_tag LOCUS_10320 gene coaD 19564 19106 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783477.1 protein_id gnl|my_center|LOCUS_10320 21462 19561 gene locus_tag LOCUS_10330 21462 19561 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761752.1 protein_id gnl|my_center|LOCUS_10330 22628 21489 gene locus_tag LOCUS_10340 22628 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_10340 23585 22632 gene locus_tag LOCUS_10350 23585 22632 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_10350 24018 27179 gene locus_tag LOCUS_10360 24018 27179 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813423.1 protein_id gnl|my_center|LOCUS_10360 27195 28748 gene locus_tag LOCUS_10370 27195 28748 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence032 2303 987 gene locus_tag LOCUS_10380 2303 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10380 3608 2337 gene locus_tag LOCUS_10390 3608 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10390 3694 4071 gene locus_tag LOCUS_10400 3694 4071 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_10400 6370 4127 gene locus_tag LOCUS_10410 6370 4127 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_10410 7799 6447 gene locus_tag LOCUS_10420 7799 6447 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_10420 8487 7840 gene locus_tag LOCUS_10430 8487 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 9411 8533 gene locus_tag LOCUS_10440 9411 8533 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_10440 10232 9468 gene locus_tag LOCUS_10450 10232 9468 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_10450 10401 11165 gene locus_tag LOCUS_10460 gene surE 10401 11165 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_10460 11169 12308 gene locus_tag LOCUS_10470 gene lpxB 11169 12308 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_10470 13134 12301 gene locus_tag LOCUS_10480 13134 12301 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_10480 15203 13131 gene locus_tag LOCUS_10490 gene ftsH 15203 13131 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_10490 15585 15226 gene locus_tag LOCUS_10500 gene rsfS 15585 15226 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784862.1 protein_id gnl|my_center|LOCUS_10500 15797 15870 gene locus_tag LOCUS_t00250 15797 15870 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17861 15978 gene locus_tag LOCUS_10510 17861 15978 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_10510 19380 18034 gene locus_tag LOCUS_10520 gene mgtE 19380 18034 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_10520 20177 19386 gene locus_tag LOCUS_10530 gene rsmA 20177 19386 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_10530 20237 21211 gene locus_tag LOCUS_10540 20237 21211 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_10540 22290 21208 gene locus_tag LOCUS_10550 gene mnmA 22290 21208 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202407.1 protein_id gnl|my_center|LOCUS_10550 22362 23612 gene locus_tag LOCUS_10560 22362 23612 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_10560 23626 25140 gene locus_tag LOCUS_10570 23626 25140 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_10570 25859 25191 gene locus_tag LOCUS_10580 25859 25191 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759894.1 protein_id gnl|my_center|LOCUS_10580 26001 26642 gene locus_tag LOCUS_10590 gene truA 26001 26642 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_10590 27768 26647 gene locus_tag LOCUS_10600 27768 26647 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence033 2037 730 gene locus_tag LOCUS_10610 gene hisS 2037 730 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_10610 2842 2147 gene locus_tag LOCUS_10620 2842 2147 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_10620 4194 2911 gene locus_tag LOCUS_10630 4194 2911 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_10630 5527 4259 gene locus_tag LOCUS_10640 5527 4259 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_10640 6018 5524 gene locus_tag LOCUS_10650 6018 5524 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_10650 6753 6082 gene locus_tag LOCUS_10660 6753 6082 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_10660 8817 6781 gene locus_tag LOCUS_10670 8817 6781 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_10670 9735 8860 gene locus_tag LOCUS_10680 9735 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 10022 10858 gene locus_tag LOCUS_10690 10022 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 10855 13005 gene locus_tag LOCUS_10700 10855 13005 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_10700 13010 15178 gene locus_tag LOCUS_10710 13010 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 15227 16069 gene locus_tag LOCUS_10720 15227 16069 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_10720 16208 17605 gene locus_tag LOCUS_10730 16208 17605 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761349.1 protein_id gnl|my_center|LOCUS_10730 18263 17610 gene locus_tag LOCUS_10740 18263 17610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 18408 20210 gene locus_tag LOCUS_10750 gene recQ 18408 20210 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_10750 21079 20225 gene locus_tag LOCUS_10760 21079 20225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 22233 21172 gene locus_tag LOCUS_10770 gene leuB 22233 21172 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_10770 23804 22245 gene locus_tag LOCUS_10780 23804 22245 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_10780 24399 23788 gene locus_tag LOCUS_10790 gene leuD 24399 23788 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_10790 25801 24407 gene locus_tag LOCUS_10800 gene leuC 25801 24407 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_10800 27316 25805 gene locus_tag LOCUS_10810 27316 25805 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence034 1586 306 gene locus_tag LOCUS_10820 1586 306 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_10820 2217 1648 gene locus_tag LOCUS_10830 2217 1648 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_10830 2722 2255 gene locus_tag LOCUS_10840 gene pyrI 2722 2255 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_10840 3789 2722 gene locus_tag LOCUS_10850 gene pyrB 3789 2722 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_10850 4988 3807 gene locus_tag LOCUS_10860 4988 3807 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_10860 5181 7598 gene locus_tag LOCUS_10870 5181 7598 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_10870 9743 7599 gene locus_tag LOCUS_10880 9743 7599 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_10880 11614 9743 gene locus_tag LOCUS_10890 11614 9743 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_10890 11803 12609 gene locus_tag LOCUS_10900 11803 12609 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_10900 12712 14022 gene locus_tag LOCUS_10910 gene eno 12712 14022 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_10910 14104 14595 gene locus_tag LOCUS_10920 14104 14595 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_10920 17235 14662 gene locus_tag LOCUS_10930 17235 14662 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_10930 18941 17274 gene locus_tag LOCUS_10940 18941 17274 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_10940 19515 19090 gene locus_tag LOCUS_10950 19515 19090 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_10950 21399 19564 gene locus_tag LOCUS_10960 21399 19564 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100251.1 protein_id gnl|my_center|LOCUS_10960 22001 21396 gene locus_tag LOCUS_10970 22001 21396 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681263.1 protein_id gnl|my_center|LOCUS_10970 23344 22025 gene locus_tag LOCUS_10980 23344 22025 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_10980 25142 23358 gene locus_tag LOCUS_10990 25142 23358 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_10990 26012 25164 gene locus_tag LOCUS_11000 26012 25164 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_11000 26620 26027 gene locus_tag LOCUS_11010 26620 26027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence035 1751 456 gene locus_tag LOCUS_11020 1751 456 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_11020 1917 2378 gene locus_tag LOCUS_11030 1917 2378 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_11030 2381 3190 gene locus_tag LOCUS_11040 2381 3190 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_11040 4378 3545 gene locus_tag LOCUS_11050 4378 3545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759988.1 protein_id gnl|my_center|LOCUS_11050 5900 4416 gene locus_tag LOCUS_11060 5900 4416 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759989.1 protein_id gnl|my_center|LOCUS_11060 8797 5954 gene locus_tag LOCUS_11070 8797 5954 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_11070 9641 8832 gene locus_tag LOCUS_11080 gene kdsA 9641 8832 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_11080 10581 9622 gene locus_tag LOCUS_11090 gene miaA 10581 9622 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_11090 10659 13088 gene locus_tag LOCUS_11100 10659 13088 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_11100 13631 13125 gene locus_tag LOCUS_11110 13631 13125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 16141 13691 gene locus_tag LOCUS_11120 16141 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 16680 16222 gene locus_tag LOCUS_11130 16680 16222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 16978 16685 gene locus_tag LOCUS_11140 16978 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 17976 17173 gene locus_tag LOCUS_11150 17976 17173 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680804.1 protein_id gnl|my_center|LOCUS_11150 18034 19422 gene locus_tag LOCUS_11160 18034 19422 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187233.1 protein_id gnl|my_center|LOCUS_11160 20978 19419 gene locus_tag LOCUS_11170 20978 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 22101 20989 gene locus_tag LOCUS_11180 22101 20989 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108152.1 protein_id gnl|my_center|LOCUS_11180 23612 22098 gene locus_tag LOCUS_11190 23612 22098 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_11190 25952 23619 gene locus_tag LOCUS_11200 25952 23619 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_11200 26605 26138 gene locus_tag LOCUS_11210 26605 26138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence036 1192 2226 gene locus_tag LOCUS_11220 1192 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3895 2234 gene locus_tag LOCUS_11230 3895 2234 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840466.1 protein_id gnl|my_center|LOCUS_11230 4055 6553 gene locus_tag LOCUS_11240 4055 6553 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109202.1 protein_id gnl|my_center|LOCUS_11240 6664 7212 gene locus_tag LOCUS_11250 6664 7212 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_11250 7275 8213 gene locus_tag LOCUS_11260 gene trxB 7275 8213 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_11260 8356 9057 gene locus_tag LOCUS_11270 8356 9057 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_11270 9161 10393 gene locus_tag LOCUS_11280 9161 10393 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107763.1 protein_id gnl|my_center|LOCUS_11280 10406 11233 gene locus_tag LOCUS_11290 gene ccsA 10406 11233 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_11290 11267 11713 gene locus_tag LOCUS_11300 11267 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 12421 11714 gene locus_tag LOCUS_11310 12421 11714 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_11310 13009 12431 gene locus_tag LOCUS_11320 13009 12431 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202239.1 protein_id gnl|my_center|LOCUS_11320 14284 13019 gene locus_tag LOCUS_11330 14284 13019 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760003.1 protein_id gnl|my_center|LOCUS_11330 15687 14503 gene locus_tag LOCUS_11340 15687 14503 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_11340 16330 15680 gene locus_tag LOCUS_11350 16330 15680 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_11350 16857 16330 gene locus_tag LOCUS_11360 16857 16330 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109201.1 protein_id gnl|my_center|LOCUS_11360 18536 16968 gene locus_tag LOCUS_11370 18536 16968 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_11370 19073 18798 gene locus_tag LOCUS_11380 19073 18798 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_11380 19245 20279 gene locus_tag LOCUS_11390 gene mutY 19245 20279 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_11390 20349 20759 gene locus_tag LOCUS_11400 20349 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 20788 22113 gene locus_tag LOCUS_11410 20788 22113 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_11410 23821 22118 gene locus_tag LOCUS_11420 23821 22118 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_11420 24044 25933 gene locus_tag LOCUS_11430 24044 25933 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203543.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence037 368 1825 gene locus_tag LOCUS_11440 368 1825 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_11440 2872 1886 gene locus_tag LOCUS_11450 2872 1886 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_11450 3802 2969 gene locus_tag LOCUS_11460 3802 2969 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108322.1 protein_id gnl|my_center|LOCUS_11460 3919 3992 gene locus_tag LOCUS_t00260 3919 3992 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4006 4081 gene locus_tag LOCUS_t00270 4006 4081 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4234 6102 gene locus_tag LOCUS_11470 4234 6102 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_11470 6161 7627 gene locus_tag LOCUS_11480 6161 7627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 7640 8413 gene locus_tag LOCUS_11490 7640 8413 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788251.1 protein_id gnl|my_center|LOCUS_11490 8520 9230 gene locus_tag LOCUS_11500 gene pyrH 8520 9230 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_11500 9308 9868 gene locus_tag LOCUS_11510 gene frr 9308 9868 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_11510 9873 10811 gene locus_tag LOCUS_11520 gene rsgA 9873 10811 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_11520 10905 14777 gene locus_tag LOCUS_11530 10905 14777 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202905.1 protein_id gnl|my_center|LOCUS_11530 14774 15325 gene locus_tag LOCUS_11540 14774 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788013.1 protein_id gnl|my_center|LOCUS_11540 15329 15916 gene locus_tag LOCUS_11550 15329 15916 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788015.1 protein_id gnl|my_center|LOCUS_11550 15913 16236 gene locus_tag LOCUS_11560 15913 16236 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788017.1 protein_id gnl|my_center|LOCUS_11560 17369 16311 gene locus_tag LOCUS_11570 17369 16311 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_11570 19302 17428 gene locus_tag LOCUS_11580 19302 17428 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583023.1 protein_id gnl|my_center|LOCUS_11580 20089 19343 gene locus_tag LOCUS_11590 20089 19343 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_11590 21507 20170 gene locus_tag LOCUS_11600 21507 20170 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_11600 22740 21538 gene locus_tag LOCUS_11610 22740 21538 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817724.1 protein_id gnl|my_center|LOCUS_11610 22813 24048 gene locus_tag LOCUS_11620 22813 24048 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_11620 24086 24595 gene locus_tag LOCUS_11630 24086 24595 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence038 1269 394 gene locus_tag LOCUS_11640 1269 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3276 1297 gene locus_tag LOCUS_11650 3276 1297 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616102.1 protein_id gnl|my_center|LOCUS_11650 3979 3308 gene locus_tag LOCUS_11660 3979 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 4234 4022 gene locus_tag LOCUS_11670 4234 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 6062 4407 gene locus_tag LOCUS_11680 6062 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 7692 6190 gene locus_tag LOCUS_11690 7692 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 8357 7701 gene locus_tag LOCUS_11700 8357 7701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 9499 8360 gene locus_tag LOCUS_11710 9499 8360 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_11710 10531 9551 gene locus_tag LOCUS_11720 10531 9551 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_11720 11598 10528 gene locus_tag LOCUS_11730 11598 10528 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_11730 12262 11612 gene locus_tag LOCUS_11740 12262 11612 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784340.1 protein_id gnl|my_center|LOCUS_11740 16755 12433 gene locus_tag LOCUS_11750 gene rpoC 16755 12433 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108455.1 protein_id gnl|my_center|LOCUS_11750 20600 16791 gene locus_tag LOCUS_11760 gene rpoB 20600 16791 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_11760 21087 20710 gene locus_tag LOCUS_11770 gene rplL 21087 20710 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_11770 21680 21159 gene locus_tag LOCUS_11780 gene rplJ 21680 21159 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_11780 22394 21693 gene locus_tag LOCUS_11790 gene rplA 22394 21693 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782161.1 protein_id gnl|my_center|LOCUS_11790 22855 22415 gene locus_tag LOCUS_11800 gene rplK 22855 22415 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_11800 23463 22918 gene locus_tag LOCUS_11810 gene nusG 23463 22918 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296362.1 protein_id gnl|my_center|LOCUS_11810 23667 23479 gene locus_tag LOCUS_11820 gene secE 23667 23479 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782157.1 protein_id gnl|my_center|LOCUS_11820 23754 23681 gene locus_tag LOCUS_t00280 23754 23681 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 654 1097 gene locus_tag LOCUS_11830 gene mscL 654 1097 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_11830 1236 1712 gene locus_tag LOCUS_11840 1236 1712 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_11840 1725 2324 gene locus_tag LOCUS_11850 1725 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2454 3998 gene locus_tag LOCUS_11860 gene guaA 2454 3998 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764459.1 protein_id gnl|my_center|LOCUS_11860 4654 3953 gene locus_tag LOCUS_11870 4654 3953 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_11870 4802 5407 gene locus_tag LOCUS_11880 4802 5407 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759972.1 protein_id gnl|my_center|LOCUS_11880 5570 7513 gene locus_tag LOCUS_11890 5570 7513 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_11890 7532 8797 gene locus_tag LOCUS_11900 7532 8797 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_11900 8867 10177 gene locus_tag LOCUS_11910 8867 10177 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785317.1 protein_id gnl|my_center|LOCUS_11910 11758 10286 gene locus_tag LOCUS_11920 11758 10286 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_11920 12705 11902 gene locus_tag LOCUS_11930 12705 11902 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_11930 15134 12840 gene locus_tag LOCUS_11940 15134 12840 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_11940 16619 15303 gene locus_tag LOCUS_11950 gene serS 16619 15303 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_11950 16988 16716 gene locus_tag LOCUS_11960 gene rpmA 16988 16716 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_11960 17327 17010 gene locus_tag LOCUS_11970 gene rplU 17327 17010 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_11970 19038 17464 gene locus_tag LOCUS_11980 19038 17464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 20753 19392 gene locus_tag LOCUS_11990 20753 19392 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_11990 23934 20761 gene locus_tag LOCUS_12000 23934 20761 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015696820.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence040 1529 150 gene locus_tag LOCUS_12010 gene mnmE 1529 150 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_12010 2014 1526 gene locus_tag LOCUS_12020 2014 1526 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_12020 2892 2011 gene locus_tag LOCUS_12030 2892 2011 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_12030 3886 2897 gene locus_tag LOCUS_12040 gene floA 3886 2897 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_12040 4362 3892 gene locus_tag LOCUS_12050 4362 3892 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785717.1 protein_id gnl|my_center|LOCUS_12050 5804 4377 gene locus_tag LOCUS_12060 5804 4377 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764708.1 protein_id gnl|my_center|LOCUS_12060 5865 6269 gene locus_tag LOCUS_12070 5865 6269 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_12070 7304 6273 gene locus_tag LOCUS_12080 7304 6273 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_12080 7882 7301 gene locus_tag LOCUS_12090 7882 7301 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_12090 8610 7879 gene locus_tag LOCUS_12100 8610 7879 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764712.1 protein_id gnl|my_center|LOCUS_12100 9028 8618 gene locus_tag LOCUS_12110 9028 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 10085 9135 gene locus_tag LOCUS_12120 10085 9135 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_12120 10590 10087 gene locus_tag LOCUS_12130 10590 10087 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_12130 10904 10978 gene locus_tag LOCUS_t00290 10904 10978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12096 11131 gene locus_tag LOCUS_12140 12096 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 13125 14288 gene locus_tag LOCUS_12150 13125 14288 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_12150 14341 14472 gene locus_tag LOCUS_12160 14341 14472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 14473 14781 gene locus_tag LOCUS_12170 14473 14781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 15334 14873 gene locus_tag LOCUS_12180 15334 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 18163 15407 gene locus_tag LOCUS_12190 gene metH 18163 15407 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203181.1 protein_id gnl|my_center|LOCUS_12190 18612 18160 gene locus_tag LOCUS_12200 gene smpB 18612 18160 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_12200 19192 18617 gene locus_tag LOCUS_12210 19192 18617 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769654.1 protein_id gnl|my_center|LOCUS_12210 19914 19201 gene locus_tag LOCUS_12220 19914 19201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693181.1 protein_id gnl|my_center|LOCUS_12220 20519 20010 gene locus_tag LOCUS_12230 20519 20010 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789167.1 protein_id gnl|my_center|LOCUS_12230 <23732 20531 gene locus_tag LOCUS_12240 <23732 20531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767197.1:glycosyl hydrolase >Feature sequence041 348 1328 gene locus_tag LOCUS_12250 348 1328 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_12250 2835 1525 gene locus_tag LOCUS_12260 2835 1525 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_12260 3931 2924 gene locus_tag LOCUS_12270 3931 2924 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_12270 4134 4385 gene locus_tag LOCUS_12280 4134 4385 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_12280 4456 5553 gene locus_tag LOCUS_12290 gene gcvT 4456 5553 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764743.1 protein_id gnl|my_center|LOCUS_12290 6237 5647 gene locus_tag LOCUS_12300 6237 5647 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_12300 6484 6281 gene locus_tag LOCUS_12310 6484 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789240.1 protein_id gnl|my_center|LOCUS_12310 6582 8045 gene locus_tag LOCUS_12320 6582 8045 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_12320 8157 9128 gene locus_tag LOCUS_12330 8157 9128 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_12330 10353 9187 gene locus_tag LOCUS_12340 10353 9187 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789244.1 protein_id gnl|my_center|LOCUS_12340 10523 11998 gene locus_tag LOCUS_12350 10523 11998 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_12350 12727 12122 gene locus_tag LOCUS_12360 gene ruvA 12727 12122 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_12360 12826 13725 gene locus_tag LOCUS_12370 12826 13725 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_12370 15223 13904 gene locus_tag LOCUS_12380 gene gdhA 15223 13904 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_12380 15553 16614 gene locus_tag LOCUS_12390 15553 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 16649 19615 gene locus_tag LOCUS_12400 16649 19615 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_12400 19660 20571 gene locus_tag LOCUS_12410 19660 20571 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797932.1 protein_id gnl|my_center|LOCUS_12410 21712 20573 gene locus_tag LOCUS_12420 gene rfbB 21712 20573 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203413.1 protein_id gnl|my_center|LOCUS_12420 <22447 21736 gene locus_tag LOCUS_12430 <22447 21736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790602.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence042 1084 710 gene locus_tag LOCUS_12440 1084 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2762 1314 gene locus_tag LOCUS_12450 2762 1314 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_12450 2848 4545 gene locus_tag LOCUS_12460 gene ettA 2848 4545 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_12460 4669 8022 gene locus_tag LOCUS_12470 4669 8022 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_12470 8267 8839 gene locus_tag LOCUS_12480 8267 8839 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_12480 8836 10305 gene locus_tag LOCUS_12490 8836 10305 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202363.1 protein_id gnl|my_center|LOCUS_12490 10310 10804 gene locus_tag LOCUS_12500 10310 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 10817 11311 gene locus_tag LOCUS_12510 10817 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 11357 12604 gene locus_tag LOCUS_12520 11357 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 12777 13787 gene locus_tag LOCUS_12530 gene rlmN 12777 13787 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_12530 13874 14917 gene locus_tag LOCUS_12540 13874 14917 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_12540 14983 16089 gene locus_tag LOCUS_12550 gene pdxA 14983 16089 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_12550 16086 17345 gene locus_tag LOCUS_12560 16086 17345 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_12560 17332 17859 gene locus_tag LOCUS_12570 17332 17859 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_12570 17861 18553 gene locus_tag LOCUS_12580 17861 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_12580 18607 18936 gene locus_tag LOCUS_12590 18607 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 18960 20582 gene locus_tag LOCUS_12600 18960 20582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 20642 22015 gene locus_tag LOCUS_12610 20642 22015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence043 1418 2536 gene locus_tag LOCUS_12620 1418 2536 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_12620 2605 4173 gene locus_tag LOCUS_12630 2605 4173 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_12630 5198 4194 gene locus_tag LOCUS_12640 5198 4194 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767845.1 protein_id gnl|my_center|LOCUS_12640 5262 5792 gene locus_tag LOCUS_12650 5262 5792 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_12650 5881 6396 gene locus_tag LOCUS_12660 5881 6396 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_12660 8562 6373 gene locus_tag LOCUS_12670 8562 6373 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_12670 9650 8622 gene locus_tag LOCUS_12680 9650 8622 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_12680 11015 9744 gene locus_tag LOCUS_12690 11015 9744 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_12690 11724 11086 gene locus_tag LOCUS_12700 gene nth 11724 11086 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_12700 11800 12009 gene locus_tag LOCUS_12710 11800 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 11999 13864 gene locus_tag LOCUS_12720 gene ilvD 11999 13864 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761033.1 protein_id gnl|my_center|LOCUS_12720 13946 15610 gene locus_tag LOCUS_12730 gene ilvB 13946 15610 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_12730 15612 16172 gene locus_tag LOCUS_12740 gene ilvN 15612 16172 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_12740 16169 16918 gene locus_tag LOCUS_12750 16169 16918 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_12750 17003 18046 gene locus_tag LOCUS_12760 gene ilvC 17003 18046 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_12760 20323 18143 gene locus_tag LOCUS_12770 20323 18143 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203147.1 protein_id gnl|my_center|LOCUS_12770 21912 20524 gene locus_tag LOCUS_12780 21912 20524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence044 2265 301 gene locus_tag LOCUS_12790 2265 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2985 4232 gene locus_tag LOCUS_12800 2985 4232 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_12800 4238 4684 gene locus_tag LOCUS_12810 gene umuD 4238 4684 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_12810 4827 6206 gene locus_tag LOCUS_12820 4827 6206 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_12820 7191 6088 gene locus_tag LOCUS_12830 7191 6088 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_12830 7294 7806 gene locus_tag LOCUS_12840 7294 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 8991 7831 gene locus_tag LOCUS_12850 8991 7831 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_12850 10330 9044 gene locus_tag LOCUS_12860 10330 9044 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_12860 11399 10332 gene locus_tag LOCUS_12870 11399 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 13884 11563 gene locus_tag LOCUS_12880 13884 11563 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_12880 14036 15400 gene locus_tag LOCUS_12890 14036 15400 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759920.1 protein_id gnl|my_center|LOCUS_12890 15397 16482 gene locus_tag LOCUS_12900 15397 16482 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_12900 16479 17360 gene locus_tag LOCUS_12910 16479 17360 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_12910 17357 18058 gene locus_tag LOCUS_12920 17357 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 19254 18109 gene locus_tag LOCUS_12930 gene cydB 19254 18109 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_12930 20876 19323 gene locus_tag LOCUS_12940 20876 19323 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_12940 21439 20906 gene locus_tag LOCUS_12950 21439 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 22006 21473 gene locus_tag LOCUS_12960 22006 21473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence045 1302 346 gene locus_tag LOCUS_12970 1302 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2487 1312 gene locus_tag LOCUS_12980 2487 1312 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925751.1 protein_id gnl|my_center|LOCUS_12980 2954 3619 gene locus_tag LOCUS_12990 2954 3619 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787603.1 protein_id gnl|my_center|LOCUS_12990 3634 5658 gene locus_tag LOCUS_13000 3634 5658 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107440.1 protein_id gnl|my_center|LOCUS_13000 5700 8030 gene locus_tag LOCUS_13010 5700 8030 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_13010 8217 8558 gene locus_tag LOCUS_13020 8217 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 8638 10779 gene locus_tag LOCUS_13030 8638 10779 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107868.1 protein_id gnl|my_center|LOCUS_13030 10819 11436 gene locus_tag LOCUS_13040 10819 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 11429 11713 gene locus_tag LOCUS_13050 11429 11713 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_13050 11718 12263 gene locus_tag LOCUS_13060 11718 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948624.1 protein_id gnl|my_center|LOCUS_13060 12336 14339 gene locus_tag LOCUS_13070 12336 14339 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_13070 14519 15640 gene locus_tag LOCUS_13080 gene yiaY 14519 15640 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071675.1 protein_id gnl|my_center|LOCUS_13080 15747 16778 gene locus_tag LOCUS_13090 15747 16778 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461701.1 protein_id gnl|my_center|LOCUS_13090 16790 18316 gene locus_tag LOCUS_13100 gene glpK 16790 18316 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_13100 18336 19046 gene locus_tag LOCUS_13110 18336 19046 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019891.1 protein_id gnl|my_center|LOCUS_13110 19223 20251 gene locus_tag LOCUS_13120 19223 20251 CDS product MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214676.1 protein_id gnl|my_center|LOCUS_13120 20324 20545 gene locus_tag LOCUS_13130 20324 20545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 20756 20586 gene locus_tag LOCUS_13140 20756 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 21696 20731 gene locus_tag LOCUS_13150 21696 20731 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202571.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence046 268 1278 gene locus_tag LOCUS_13160 268 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1266 2036 gene locus_tag LOCUS_13170 1266 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2144 2591 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtataccgccggataggcggcttagaat 2732 2866 gene locus_tag LOCUS_13180 2732 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3436 3017 gene locus_tag LOCUS_13190 3436 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4231 3437 gene locus_tag LOCUS_13200 4231 3437 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_13200 6225 5575 gene locus_tag LOCUS_13210 6225 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6699 6247 gene locus_tag LOCUS_13220 6699 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 6921 6757 gene locus_tag LOCUS_13230 6921 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 7881 6925 gene locus_tag LOCUS_13240 7881 6925 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_13240 8807 7974 gene locus_tag LOCUS_13250 8807 7974 CDS product ArdC-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785691.1 protein_id gnl|my_center|LOCUS_13250 10709 8895 gene locus_tag LOCUS_13260 10709 8895 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245380.1 protein_id gnl|my_center|LOCUS_13260 10978 11196 gene locus_tag LOCUS_13270 10978 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 11193 11402 gene locus_tag LOCUS_13280 11193 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 11399 11656 gene locus_tag LOCUS_13290 11399 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 12046 13278 gene locus_tag LOCUS_13300 12046 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 13603 14061 gene locus_tag LOCUS_13310 13603 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 14058 14510 gene locus_tag LOCUS_13320 14058 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 14661 15161 gene locus_tag LOCUS_13330 14661 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15332 15913 gene locus_tag LOCUS_13340 15332 15913 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426023.1 protein_id gnl|my_center|LOCUS_13340 15999 17213 gene locus_tag LOCUS_13350 15999 17213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_13350 17312 17755 gene locus_tag LOCUS_13360 17312 17755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 17974 18336 gene locus_tag LOCUS_13370 17974 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 18622 20010 gene locus_tag LOCUS_13380 18622 20010 CDS product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 protein_id gnl|my_center|LOCUS_13380 20176 20496 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaaccatcgtataggtggcttagaat 20622 21608 gene locus_tag LOCUS_13390 gene csy3 20622 21608 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence047 1682 186 gene locus_tag LOCUS_13400 1682 186 CDS product subtype B tannase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898589.1 protein_id gnl|my_center|LOCUS_13400 2358 1816 gene locus_tag LOCUS_13410 2358 1816 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818015.1 protein_id gnl|my_center|LOCUS_13410 2553 2479 gene locus_tag LOCUS_t00300 2553 2479 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2655 3263 gene locus_tag LOCUS_13420 gene hisH 2655 3263 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_13420 3260 3991 gene locus_tag LOCUS_13430 gene hisA 3260 3991 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_13430 4004 4759 gene locus_tag LOCUS_13440 gene hisF 4004 4759 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_13440 4820 5428 gene locus_tag LOCUS_13450 gene hisIE 4820 5428 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_13450 5460 6128 gene locus_tag LOCUS_13460 5460 6128 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_13460 6157 7476 gene locus_tag LOCUS_13470 6157 7476 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788816.1 protein_id gnl|my_center|LOCUS_13470 7527 8687 gene locus_tag LOCUS_13480 gene lysA 7527 8687 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_13480 9933 8746 gene locus_tag LOCUS_13490 gene kbl 9933 8746 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_13490 10117 11019 gene locus_tag LOCUS_13500 10117 11019 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_13500 11121 11876 gene locus_tag LOCUS_13510 11121 11876 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769737.1 protein_id gnl|my_center|LOCUS_13510 11873 12868 gene locus_tag LOCUS_13520 gene murB 11873 12868 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_13520 12876 13637 gene locus_tag LOCUS_13530 12876 13637 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_13530 13706 14413 gene locus_tag LOCUS_13540 13706 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 14862 14473 gene locus_tag LOCUS_13550 14862 14473 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_13550 15422 14994 gene locus_tag LOCUS_13560 gene rplS 15422 14994 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_13560 15573 16319 gene locus_tag LOCUS_13570 15573 16319 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_13570 16344 17207 gene locus_tag LOCUS_13580 16344 17207 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_13580 17204 20248 gene locus_tag LOCUS_13590 17204 20248 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_13590 20779 20273 gene locus_tag LOCUS_13600 20779 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence048 1499 426 gene locus_tag LOCUS_13610 1499 426 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_13610 2966 1509 gene locus_tag LOCUS_13620 2966 1509 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107325.1 protein_id gnl|my_center|LOCUS_13620 3859 2969 gene locus_tag LOCUS_13630 3859 2969 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_13630 5106 3865 gene locus_tag LOCUS_13640 5106 3865 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_13640 5301 6197 gene locus_tag LOCUS_13650 5301 6197 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_13650 6998 6225 gene locus_tag LOCUS_13660 gene proC 6998 6225 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_13660 8149 7025 gene locus_tag LOCUS_13670 8149 7025 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_13670 9119 8151 gene locus_tag LOCUS_13680 gene argC 9119 8151 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_13680 9318 9121 gene locus_tag LOCUS_13690 9318 9121 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_13690 10560 9331 gene locus_tag LOCUS_13700 10560 9331 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_13700 11160 10588 gene locus_tag LOCUS_13710 11160 10588 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_13710 11645 11157 gene locus_tag LOCUS_13720 gene argR 11645 11157 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_13720 11796 11554 gene locus_tag LOCUS_13730 11796 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11795 14554 gene locus_tag LOCUS_13740 11795 14554 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202068.1 protein_id gnl|my_center|LOCUS_13740 14740 16206 gene locus_tag LOCUS_13750 gene rhaB 14740 16206 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_13750 16233 17663 gene locus_tag LOCUS_13760 16233 17663 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_13760 17665 18702 gene locus_tag LOCUS_13770 gene rhaT 17665 18702 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_13770 18736 19548 gene locus_tag LOCUS_13780 gene rhaD 18736 19548 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_13780 20146 19562 gene locus_tag LOCUS_13790 20146 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 20478 20684 gene locus_tag LOCUS_13800 20478 20684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence049 2121 319 gene locus_tag LOCUS_13810 2121 319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944619.1 protein_id gnl|my_center|LOCUS_13810 2294 3361 gene locus_tag LOCUS_13820 2294 3361 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_13820 3434 6826 gene locus_tag LOCUS_13830 gene mfd 3434 6826 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_13830 8653 6851 gene locus_tag LOCUS_13840 8653 6851 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_13840 8970 8650 gene locus_tag LOCUS_13850 8970 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_13850 10190 9027 gene locus_tag LOCUS_13860 10190 9027 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109125.1 protein_id gnl|my_center|LOCUS_13860 10360 11028 gene locus_tag LOCUS_13870 10360 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 11025 11894 gene locus_tag LOCUS_13880 11025 11894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 11891 12796 gene locus_tag LOCUS_13890 11891 12796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 12793 13809 gene locus_tag LOCUS_13900 12793 13809 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_13900 13787 14500 gene locus_tag LOCUS_13910 13787 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 16013 14898 gene locus_tag LOCUS_13920 16013 14898 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_13920 16722 16306 gene locus_tag LOCUS_13930 16722 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 16972 16727 gene locus_tag LOCUS_13940 16972 16727 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259539.1 protein_id gnl|my_center|LOCUS_13940 19723 17384 gene locus_tag LOCUS_13950 19723 17384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence050 1064 369 gene locus_tag LOCUS_13960 1064 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1352 2185 gene locus_tag LOCUS_13970 1352 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 2286 2687 gene locus_tag LOCUS_13980 2286 2687 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_13980 3327 2761 gene locus_tag LOCUS_13990 3327 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4302 3349 gene locus_tag LOCUS_14000 4302 3349 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_14000 5192 4404 gene locus_tag LOCUS_14010 5192 4404 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_14010 6056 5217 gene locus_tag LOCUS_14020 gene lipA 6056 5217 CDS product tyrosine/lipid phosphatase LipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989815.1 protein_id gnl|my_center|LOCUS_14020 6937 6083 gene locus_tag LOCUS_14030 6937 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9520 6950 gene locus_tag LOCUS_14040 9520 6950 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_14040 11020 9677 gene locus_tag LOCUS_14050 11020 9677 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_14050 12110 11010 gene locus_tag LOCUS_14060 12110 11010 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_14060 13374 12145 gene locus_tag LOCUS_14070 13374 12145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_14070 14624 13371 gene locus_tag LOCUS_14080 14624 13371 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_14080 15343 14627 gene locus_tag LOCUS_14090 15343 14627 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_14090 15464 16567 gene locus_tag LOCUS_14100 15464 16567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 16706 18358 gene locus_tag LOCUS_14110 16706 18358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 18362 19567 gene locus_tag LOCUS_14120 18362 19567 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence051 958 326 gene locus_tag LOCUS_14130 958 326 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_14130 1641 958 gene locus_tag LOCUS_14140 1641 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 3151 1646 gene locus_tag LOCUS_14150 gene lepB 3151 1646 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_14150 3891 3163 gene locus_tag LOCUS_14160 gene dapB 3891 3163 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_14160 3987 5258 gene locus_tag LOCUS_14170 3987 5258 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_14170 5345 5710 gene locus_tag LOCUS_14180 5345 5710 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_14180 5723 6490 gene locus_tag LOCUS_14190 5723 6490 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_14190 6499 6933 gene locus_tag LOCUS_14200 6499 6933 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_14200 7151 6936 gene locus_tag LOCUS_14210 7151 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 7783 7148 gene locus_tag LOCUS_14220 gene pssA 7783 7148 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759605.1 protein_id gnl|my_center|LOCUS_14220 8545 7868 gene locus_tag LOCUS_14230 8545 7868 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_14230 8741 12445 gene locus_tag LOCUS_14240 gene dnaE 8741 12445 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_14240 12503 12820 gene locus_tag LOCUS_14250 gene trxA 12503 12820 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_14250 12823 13146 gene locus_tag LOCUS_14260 12823 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784743.1 protein_id gnl|my_center|LOCUS_14260 13864 13385 gene locus_tag LOCUS_14270 13864 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 14738 15043 gene locus_tag LOCUS_14280 14738 15043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 15286 17397 gene locus_tag LOCUS_14290 15286 17397 CDS product BT4734/BF3469 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764484.1 protein_id gnl|my_center|LOCUS_14290 17666 17451 gene locus_tag LOCUS_14300 17666 17451 CDS product immunity 17 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796270.1 protein_id gnl|my_center|LOCUS_14300 18101 17673 gene locus_tag LOCUS_14310 gene tsaE 18101 17673 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_14310 18551 18114 gene locus_tag LOCUS_14320 18551 18114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763987.1 protein_id gnl|my_center|LOCUS_14320 18654 18839 gene locus_tag LOCUS_14330 18654 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 18852 19760 gene locus_tag LOCUS_14340 18852 19760 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence052 932 15 gene locus_tag LOCUS_14350 932 15 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769011.1 protein_id gnl|my_center|LOCUS_14350 3402 955 gene locus_tag LOCUS_14360 3402 955 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789772.1 protein_id gnl|my_center|LOCUS_14360 3500 4306 gene locus_tag LOCUS_14370 3500 4306 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_14370 4319 5623 gene locus_tag LOCUS_14380 4319 5623 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_14380 5731 6288 gene locus_tag LOCUS_14390 5731 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 6430 7521 gene locus_tag LOCUS_14400 6430 7521 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_14400 7531 8727 gene locus_tag LOCUS_14410 7531 8727 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001346611.1 protein_id gnl|my_center|LOCUS_14410 8751 9497 gene locus_tag LOCUS_14420 8751 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 9521 10465 gene locus_tag LOCUS_14430 9521 10465 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_14430 11086 10538 gene locus_tag LOCUS_14440 11086 10538 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_14440 11679 11101 gene locus_tag LOCUS_14450 11679 11101 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_14450 11862 12116 gene locus_tag LOCUS_14460 11862 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 12121 14709 gene locus_tag LOCUS_14470 gene clpB 12121 14709 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_14470 16763 14718 gene locus_tag LOCUS_14480 16763 14718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 17106 16786 gene locus_tag LOCUS_14490 17106 16786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 17721 17197 gene locus_tag LOCUS_14500 17721 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 17870 17718 gene locus_tag LOCUS_14510 17870 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence053 67 1071 gene locus_tag LOCUS_14520 67 1071 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_14520 1246 1683 gene locus_tag LOCUS_14530 1246 1683 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_14530 1826 2914 gene locus_tag LOCUS_14540 gene gmd 1826 2914 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_14540 2911 4083 gene locus_tag LOCUS_14550 2911 4083 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_14550 5352 4102 gene locus_tag LOCUS_14560 5352 4102 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062984.1 protein_id gnl|my_center|LOCUS_14560 5479 6261 gene locus_tag LOCUS_14570 5479 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 6341 8374 gene locus_tag LOCUS_14580 6341 8374 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_14580 8385 9650 gene locus_tag LOCUS_14590 8385 9650 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_14590 9769 12426 gene locus_tag LOCUS_14600 9769 12426 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202547.1 protein_id gnl|my_center|LOCUS_14600 12531 14060 gene locus_tag LOCUS_14610 12531 14060 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107292.1 protein_id gnl|my_center|LOCUS_14610 14490 14245 gene locus_tag LOCUS_14620 14490 14245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 14580 15497 gene locus_tag LOCUS_14630 gene metA 14580 15497 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_14630 15475 17391 gene locus_tag LOCUS_14640 15475 17391 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence054 280 59 gene locus_tag LOCUS_14650 280 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2539 293 gene locus_tag LOCUS_14660 2539 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 3762 2716 gene locus_tag LOCUS_14670 3762 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4006 3788 gene locus_tag LOCUS_14680 4006 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 4210 4013 gene locus_tag LOCUS_14690 4210 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6650 4224 gene locus_tag LOCUS_14700 6650 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7237 6656 gene locus_tag LOCUS_14710 7237 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7757 7230 gene locus_tag LOCUS_14720 7757 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 8595 7741 gene locus_tag LOCUS_14730 8595 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 8957 8604 gene locus_tag LOCUS_14740 8957 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 9385 8876 gene locus_tag LOCUS_14750 9385 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 9828 9388 gene locus_tag LOCUS_14760 9828 9388 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765882.1 protein_id gnl|my_center|LOCUS_14760 10049 9837 gene locus_tag LOCUS_14770 10049 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 10354 10055 gene locus_tag LOCUS_14780 10354 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 10835 10356 gene locus_tag LOCUS_14790 10835 10356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 11795 10842 gene locus_tag LOCUS_14800 11795 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 12406 11801 gene locus_tag LOCUS_14810 12406 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 14202 12448 gene locus_tag LOCUS_14820 14202 12448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 14652 14368 gene locus_tag LOCUS_14830 14652 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 15128 14721 gene locus_tag LOCUS_14840 15128 14721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 16331 15141 gene locus_tag LOCUS_14850 16331 15141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 17253 16351 gene locus_tag LOCUS_14860 17253 16351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence055 392 51 gene locus_tag LOCUS_14870 gene rpsF 392 51 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_14870 514 993 gene locus_tag LOCUS_14880 514 993 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759738.1 protein_id gnl|my_center|LOCUS_14880 1121 1297 gene locus_tag LOCUS_14890 1121 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2091 1372 gene locus_tag LOCUS_14900 2091 1372 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_14900 3626 2094 gene locus_tag LOCUS_14910 3626 2094 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_14910 5958 3799 gene locus_tag LOCUS_14920 5958 3799 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_14920 9181 6077 gene locus_tag LOCUS_14930 9181 6077 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_14930 9290 10417 gene locus_tag LOCUS_14940 gene hemW 9290 10417 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_14940 11244 12869 gene locus_tag LOCUS_14950 11244 12869 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086777.1 protein_id gnl|my_center|LOCUS_14950 13793 12972 gene locus_tag LOCUS_14960 13793 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 14145 14930 gene locus_tag LOCUS_14970 14145 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 14985 15974 gene locus_tag LOCUS_14980 14985 15974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14980 >Feature sequence056 <1 3450 gene locus_tag LOCUS_14990 <1 3450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303084.1:discoidin domain-containing protein 5192 3681 gene locus_tag LOCUS_15000 5192 3681 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803715.1 protein_id gnl|my_center|LOCUS_15000 5543 5208 gene locus_tag LOCUS_15010 5543 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815012.1 protein_id gnl|my_center|LOCUS_15010 5845 5540 gene locus_tag LOCUS_15020 5845 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5978 7786 gene locus_tag LOCUS_15030 5978 7786 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_15030 7934 8107 gene locus_tag LOCUS_15040 7934 8107 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_15040 9516 8377 gene locus_tag LOCUS_15050 9516 8377 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_15050 10820 9612 gene locus_tag LOCUS_15060 10820 9612 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_15060 12646 10832 gene locus_tag LOCUS_15070 12646 10832 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_15070 12888 12962 gene locus_tag LOCUS_t00310 12888 12962 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14115 16499 gene locus_tag LOCUS_15080 14115 16499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence057 598 3867 gene locus_tag LOCUS_15090 598 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 3867 6356 gene locus_tag LOCUS_15100 gene galB 3867 6356 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_15100 7058 6396 gene locus_tag LOCUS_15110 7058 6396 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943161.1 protein_id gnl|my_center|LOCUS_15110 7147 7878 gene locus_tag LOCUS_15120 7147 7878 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_15120 8021 9874 gene locus_tag LOCUS_15130 8021 9874 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_15130 9887 11248 gene locus_tag LOCUS_15140 9887 11248 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769569.1 protein_id gnl|my_center|LOCUS_15140 11223 11969 gene locus_tag LOCUS_15150 11223 11969 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_15150 12045 14378 gene locus_tag LOCUS_15160 12045 14378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence058 2857 644 gene locus_tag LOCUS_15170 2857 644 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784085.1 protein_id gnl|my_center|LOCUS_15170 4129 2948 gene locus_tag LOCUS_15180 4129 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 5268 4192 gene locus_tag LOCUS_15190 5268 4192 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_15190 6485 5340 gene locus_tag LOCUS_15200 6485 5340 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_15200 7288 6560 gene locus_tag LOCUS_15210 7288 6560 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_15210 7413 8411 gene locus_tag LOCUS_15220 7413 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 8430 8870 gene locus_tag LOCUS_15230 8430 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 9104 8958 gene locus_tag LOCUS_15240 9104 8958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 9725 9207 gene locus_tag LOCUS_15250 9725 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 10356 9835 gene locus_tag LOCUS_15260 10356 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 11249 10470 gene locus_tag LOCUS_15270 11249 10470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 12248 11400 gene locus_tag LOCUS_15280 12248 11400 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_15280 13095 12472 gene locus_tag LOCUS_15290 13095 12472 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_15290 13944 13135 gene locus_tag LOCUS_15300 13944 13135 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025876514.1 protein_id gnl|my_center|LOCUS_15300 14052 14573 gene locus_tag LOCUS_15310 14052 14573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence059 2832 1576 gene locus_tag LOCUS_15320 2832 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3078 4076 gene locus_tag LOCUS_15330 3078 4076 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_15330 4196 7906 gene locus_tag LOCUS_15340 4196 7906 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227523.1 protein_id gnl|my_center|LOCUS_15340 7927 9411 gene locus_tag LOCUS_15350 7927 9411 CDS product glycoside hydrolase family 30 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948839.1 protein_id gnl|my_center|LOCUS_15350 9408 10043 gene locus_tag LOCUS_15360 9408 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 10036 10392 gene locus_tag LOCUS_15370 10036 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 10434 11294 gene locus_tag LOCUS_15380 10434 11294 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_15380 13547 11346 gene locus_tag LOCUS_15390 13547 11346 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_15390 15022 13985 gene locus_tag LOCUS_15400 15022 13985 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence060 <1 870 gene locus_tag LOCUS_15410 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286021.1:glycoside hydrolase family 28 protein 988 2103 gene locus_tag LOCUS_15420 988 2103 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108035.1 protein_id gnl|my_center|LOCUS_15420 3830 2166 gene locus_tag LOCUS_15430 gene asnB 3830 2166 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_15430 5548 3851 gene locus_tag LOCUS_15440 5548 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6657 5545 gene locus_tag LOCUS_15450 gene carA 6657 5545 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_15450 8398 6659 gene locus_tag LOCUS_15460 8398 6659 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_15460 10022 8379 gene locus_tag LOCUS_15470 10022 8379 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence061 981 2471 gene locus_tag LOCUS_15480 981 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 2490 5207 gene locus_tag LOCUS_15490 2490 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6708 5272 gene locus_tag LOCUS_15500 6708 5272 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_15500 6822 7634 gene locus_tag LOCUS_15510 6822 7634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790485.1 protein_id gnl|my_center|LOCUS_15510 9541 7727 gene locus_tag LOCUS_15520 9541 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 12912 9625 gene locus_tag LOCUS_15530 12912 9625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106133626.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence062 1230 463 gene locus_tag LOCUS_15540 1230 463 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_15540 3052 1385 gene locus_tag LOCUS_15550 3052 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 3522 6125 gene locus_tag LOCUS_15560 3522 6125 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_15560 6150 6596 gene locus_tag LOCUS_15570 6150 6596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 7871 6624 gene locus_tag LOCUS_15580 gene aroA 7871 6624 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_15580 9245 7884 gene locus_tag LOCUS_15590 9245 7884 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_15590 11603 9246 gene locus_tag LOCUS_15600 11603 9246 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_15600 12797 11646 gene locus_tag LOCUS_15610 12797 11646 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_15610 13321 12803 gene locus_tag LOCUS_15620 gene rimM 13321 12803 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_15620 <14046 13318 gene locus_tag LOCUS_15630 <14046 13318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790583.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence063 608 2602 gene locus_tag LOCUS_15640 608 2602 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_15640 5232 2650 gene locus_tag LOCUS_15650 gene mutS 5232 2650 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_15650 5697 6413 gene locus_tag LOCUS_15660 5697 6413 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_15660 6417 7355 gene locus_tag LOCUS_15670 6417 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 7352 9322 gene locus_tag LOCUS_15680 7352 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11196 9400 gene locus_tag LOCUS_15690 11196 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12295 11297 gene locus_tag LOCUS_15700 12295 11297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 12379 12957 gene locus_tag LOCUS_15710 12379 12957 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_15710 12954 13700 gene locus_tag LOCUS_15720 12954 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence064 757 832 gene locus_tag LOCUS_t00320 757 832 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 877 952 gene locus_tag LOCUS_t00330 877 952 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1016 1945 gene locus_tag LOCUS_15730 1016 1945 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704391.1 protein_id gnl|my_center|LOCUS_15730 1945 2502 gene locus_tag LOCUS_15740 1945 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2572 3816 gene locus_tag LOCUS_15750 2572 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3813 4811 gene locus_tag LOCUS_15760 gene siaP 3813 4811 CDS product sialic acid TRAP transporter substrate-binding protein SiaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694430.1 protein_id gnl|my_center|LOCUS_15760 6140 4842 gene locus_tag LOCUS_15770 6140 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 6411 8072 gene locus_tag LOCUS_15780 6411 8072 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_15780 9067 8105 gene locus_tag LOCUS_15790 9067 8105 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077130071.1 protein_id gnl|my_center|LOCUS_15790 9684 9070 gene locus_tag LOCUS_15800 9684 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 10747 9710 gene locus_tag LOCUS_15810 10747 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 11005 10757 gene locus_tag LOCUS_15820 11005 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 12017 11148 gene locus_tag LOCUS_15830 12017 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_15830 12738 11983 gene locus_tag LOCUS_15840 12738 11983 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_15840 13446 12739 gene locus_tag LOCUS_15850 13446 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence065 1150 62 gene locus_tag LOCUS_15860 1150 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2276 1842 gene locus_tag LOCUS_15870 2276 1842 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_15870 2954 2319 gene locus_tag LOCUS_15880 gene coaE 2954 2319 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_15880 3981 2941 gene locus_tag LOCUS_15890 3981 2941 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109340.1 protein_id gnl|my_center|LOCUS_15890 4270 3959 gene locus_tag LOCUS_15900 gene yajC 4270 3959 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_15900 5228 4302 gene locus_tag LOCUS_15910 gene nusB 5228 4302 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_15910 5412 5798 gene locus_tag LOCUS_15920 5412 5798 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_15920 5939 6520 gene locus_tag LOCUS_15930 5939 6520 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_15930 6662 7231 gene locus_tag LOCUS_15940 gene pth 6662 7231 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_15940 7234 7656 gene locus_tag LOCUS_15950 7234 7656 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_15950 7704 8681 gene locus_tag LOCUS_15960 7704 8681 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_15960 10950 8686 gene locus_tag LOCUS_15970 10950 8686 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786012.1 protein_id gnl|my_center|LOCUS_15970 11108 11527 gene locus_tag LOCUS_15980 gene mce 11108 11527 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_15980 11547 13100 gene locus_tag LOCUS_15990 11547 13100 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence066 68 1846 gene locus_tag LOCUS_16000 68 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1862 4006 gene locus_tag LOCUS_16010 gene rnr 1862 4006 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_16010 5027 4080 gene locus_tag LOCUS_16020 gene cysK 5027 4080 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_16020 5135 6061 gene locus_tag LOCUS_16030 5135 6061 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_16030 6051 7634 gene locus_tag LOCUS_16040 6051 7634 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_16040 7778 9898 gene locus_tag LOCUS_16050 7778 9898 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_16050 9911 11194 gene locus_tag LOCUS_16060 gene purD 9911 11194 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_16060 11334 12176 gene locus_tag LOCUS_16070 11334 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_16070 12173 12628 gene locus_tag LOCUS_16080 12173 12628 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_16080 13079 13231 gene locus_tag LOCUS_16090 13079 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 13197 13496 gene locus_tag LOCUS_16100 13197 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence067 941 1444 gene locus_tag LOCUS_16110 941 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1495 3954 gene locus_tag LOCUS_16120 1495 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 4126 5322 gene locus_tag LOCUS_16130 4126 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5407 7566 gene locus_tag LOCUS_16140 5407 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 7815 8096 gene locus_tag LOCUS_16150 7815 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 8363 9499 gene locus_tag LOCUS_16160 8363 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 9583 11994 gene locus_tag LOCUS_16170 9583 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 12850 13347 gene locus_tag LOCUS_16180 12850 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence068 876 2099 gene locus_tag LOCUS_16190 876 2099 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_16190 2154 3206 gene locus_tag LOCUS_16200 gene recA 2154 3206 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_16200 3785 3237 gene locus_tag LOCUS_16210 3785 3237 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_16210 4409 3867 gene locus_tag LOCUS_16220 4409 3867 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_16220 8138 4431 gene locus_tag LOCUS_16230 gene purL 8138 4431 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_16230 9641 8169 gene locus_tag LOCUS_16240 9641 8169 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_16240 9756 12533 gene locus_tag LOCUS_16250 gene uvrA 9756 12533 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence069 406 1071 gene locus_tag LOCUS_16260 406 1071 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366897.1 protein_id gnl|my_center|LOCUS_16260 1207 2286 gene locus_tag LOCUS_16270 1207 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 3503 2340 gene locus_tag LOCUS_16280 3503 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 4531 3521 gene locus_tag LOCUS_16290 4531 3521 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201948.1 protein_id gnl|my_center|LOCUS_16290 4739 5710 gene locus_tag LOCUS_16300 4739 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 5682 6200 gene locus_tag LOCUS_16310 5682 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 6205 7584 gene locus_tag LOCUS_16320 6205 7584 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_16320 7605 9989 gene locus_tag LOCUS_16330 7605 9989 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_16330 9986 10489 gene locus_tag LOCUS_16340 9986 10489 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_16340 10517 11104 gene locus_tag LOCUS_16350 10517 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 11260 11850 gene locus_tag LOCUS_16360 11260 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 12346 12101 gene locus_tag LOCUS_16370 12346 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence070 284 2689 gene locus_tag LOCUS_16380 284 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 2731 4230 gene locus_tag LOCUS_16390 2731 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4429 5517 gene locus_tag LOCUS_16400 4429 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5645 5902 gene locus_tag LOCUS_16410 5645 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5899 6177 gene locus_tag LOCUS_16420 5899 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6624 9866 gene locus_tag LOCUS_16430 6624 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 10208 10426 gene locus_tag LOCUS_16440 10208 10426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 11321 11548 gene locus_tag LOCUS_16450 11321 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 11565 12011 gene locus_tag LOCUS_16460 11565 12011 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_16460 12204 12701 gene locus_tag LOCUS_16470 12204 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence071 2901 247 gene locus_tag LOCUS_16480 2901 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5971 2936 gene locus_tag LOCUS_16490 5971 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 6982 5981 gene locus_tag LOCUS_16500 6982 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 8488 7037 gene locus_tag LOCUS_16510 8488 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 9689 8535 gene locus_tag LOCUS_16520 9689 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 11035 9686 gene locus_tag LOCUS_16530 11035 9686 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108610.1 protein_id gnl|my_center|LOCUS_16530 <13029 11296 gene locus_tag LOCUS_16540 <13029 11296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767789.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence072 165 965 gene locus_tag LOCUS_16550 165 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2560 1022 gene locus_tag LOCUS_16560 2560 1022 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_16560 3663 2596 gene locus_tag LOCUS_16570 3663 2596 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765298.1 protein_id gnl|my_center|LOCUS_16570 5399 3777 gene locus_tag LOCUS_16580 5399 3777 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_16580 6504 5545 gene locus_tag LOCUS_16590 gene xerD 6504 5545 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761920.1 protein_id gnl|my_center|LOCUS_16590 6566 6991 gene locus_tag LOCUS_16600 gene aroQ 6566 6991 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_16600 7002 7673 gene locus_tag LOCUS_16610 7002 7673 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_16610 7695 9020 gene locus_tag LOCUS_16620 7695 9020 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108151.1 protein_id gnl|my_center|LOCUS_16620 9017 10999 gene locus_tag LOCUS_16630 9017 10999 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_16630 11009 11419 gene locus_tag LOCUS_16640 11009 11419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 11492 11668 gene locus_tag LOCUS_16650 11492 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 11723 11989 gene locus_tag LOCUS_16660 11723 11989 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139109819.1 protein_id gnl|my_center|LOCUS_16660 12336 12797 gene locus_tag LOCUS_16670 12336 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 >Feature sequence073 511 1629 gene locus_tag LOCUS_16680 511 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1770 2918 gene locus_tag LOCUS_16690 1770 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 2966 4054 gene locus_tag LOCUS_16700 2966 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4388 5281 gene locus_tag LOCUS_16710 4388 5281 CDS product DUF5119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927908.1 protein_id gnl|my_center|LOCUS_16710 5402 6685 gene locus_tag LOCUS_16720 5402 6685 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303108.1 protein_id gnl|my_center|LOCUS_16720 6791 8125 gene locus_tag LOCUS_16730 6791 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 8177 9238 gene locus_tag LOCUS_16740 8177 9238 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203477.1 protein_id gnl|my_center|LOCUS_16740 9266 10303 gene locus_tag LOCUS_16750 9266 10303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 10340 11320 gene locus_tag LOCUS_16760 10340 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence074 <1 1112 gene locus_tag LOCUS_16770 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962448.1:TlpA disulfide reductase family protein 1344 2420 gene locus_tag LOCUS_16780 1344 2420 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203162.1 protein_id gnl|my_center|LOCUS_16780 2549 5575 gene locus_tag LOCUS_16790 2549 5575 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_16790 5785 7221 gene locus_tag LOCUS_16800 5785 7221 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_16800 7416 10451 gene locus_tag LOCUS_16810 7416 10451 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789008.1 protein_id gnl|my_center|LOCUS_16810 12260 11325 gene locus_tag LOCUS_16820 12260 11325 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence075 2216 801 gene locus_tag LOCUS_16830 2216 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2627 4585 gene locus_tag LOCUS_16840 2627 4585 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_16840 4633 5286 gene locus_tag LOCUS_16850 4633 5286 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_16850 5394 5909 gene locus_tag LOCUS_16860 5394 5909 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_16860 6266 7162 gene locus_tag LOCUS_16870 gene rfbD 6266 7162 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_16870 7192 8628 gene locus_tag LOCUS_16880 7192 8628 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_16880 8844 8674 gene locus_tag LOCUS_16890 8844 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 11145 8890 gene locus_tag LOCUS_16900 11145 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 11787 11173 gene locus_tag LOCUS_16910 11787 11173 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence076 1461 175 gene locus_tag LOCUS_16920 1461 175 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_16920 2293 1475 gene locus_tag LOCUS_16930 2293 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3035 2286 gene locus_tag LOCUS_16940 gene sufC 3035 2286 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_16940 4602 3142 gene locus_tag LOCUS_16950 gene sufB 4602 3142 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_16950 5113 4577 gene locus_tag LOCUS_16960 5113 4577 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796780.1 protein_id gnl|my_center|LOCUS_16960 8172 5110 gene locus_tag LOCUS_16970 gene infB 8172 5110 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108813.1 protein_id gnl|my_center|LOCUS_16970 9506 8247 gene locus_tag LOCUS_16980 gene nusA 9506 8247 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_16980 9979 9512 gene locus_tag LOCUS_16990 gene rimP 9979 9512 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence077 2 424 gene locus_tag LOCUS_17000 2 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 454 1683 gene locus_tag LOCUS_17010 454 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1744 3033 gene locus_tag LOCUS_17020 1744 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 3059 4309 gene locus_tag LOCUS_17030 3059 4309 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_17030 4433 6001 gene locus_tag LOCUS_17040 4433 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 6148 7764 gene locus_tag LOCUS_17050 6148 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 7826 9046 gene locus_tag LOCUS_17060 7826 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 9065 11185 gene locus_tag LOCUS_17070 9065 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence078 1705 824 gene locus_tag LOCUS_17080 1705 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3079 2150 gene locus_tag LOCUS_17090 3079 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4547 3138 gene locus_tag LOCUS_17100 4547 3138 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_17100 5507 4692 gene locus_tag LOCUS_17110 5507 4692 CDS product alpha/beta hydrolase fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_17110 5720 5647 gene locus_tag LOCUS_t00340 5720 5647 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5818 6327 gene locus_tag LOCUS_17120 gene cobU 5818 6327 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202889.1 protein_id gnl|my_center|LOCUS_17120 6333 7370 gene locus_tag LOCUS_17130 gene cobT 6333 7370 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202890.1 protein_id gnl|my_center|LOCUS_17130 7488 8219 gene locus_tag LOCUS_17140 7488 8219 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292396.1 protein_id gnl|my_center|LOCUS_17140 9114 8437 gene locus_tag LOCUS_17150 9114 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 10022 9111 gene locus_tag LOCUS_17160 10022 9111 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_17160 <10742 10010 gene locus_tag LOCUS_17170 <10742 10010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765719.1:dihydroorotate dehydrogenase electron transfer subunit >Feature sequence079 2098 29 gene locus_tag LOCUS_17180 gene uvrB 2098 29 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_17180 2255 3103 gene locus_tag LOCUS_17190 gene bamD 2255 3103 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_17190 3132 3476 gene locus_tag LOCUS_17200 3132 3476 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_17200 3473 3928 gene locus_tag LOCUS_17210 3473 3928 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_17210 4657 3974 gene locus_tag LOCUS_17220 4657 3974 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786956.1 protein_id gnl|my_center|LOCUS_17220 4828 5694 gene locus_tag LOCUS_17230 4828 5694 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_17230 9064 5816 gene locus_tag LOCUS_17240 9064 5816 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_17240 10165 9305 gene locus_tag LOCUS_17250 10165 9305 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence080 133 732 gene locus_tag LOCUS_17260 133 732 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_17260 811 1929 gene locus_tag LOCUS_17270 811 1929 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_17270 1954 3141 gene locus_tag LOCUS_17280 1954 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3141 4511 gene locus_tag LOCUS_17290 3141 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4704 5711 gene locus_tag LOCUS_17300 4704 5711 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784257.1 protein_id gnl|my_center|LOCUS_17300 5792 7207 gene locus_tag LOCUS_17310 5792 7207 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_17310 7219 7962 gene locus_tag LOCUS_17320 7219 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 8489 8223 gene locus_tag LOCUS_17330 8489 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17330 9353 9009 gene locus_tag LOCUS_17340 9353 9009 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_17340 9623 9366 gene locus_tag LOCUS_17350 9623 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence081 537 449 gene locus_tag LOCUS_t00350 537 449 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1480 692 gene locus_tag LOCUS_17360 1480 692 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_17360 2458 1484 gene locus_tag LOCUS_17370 2458 1484 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_17370 3242 2541 gene locus_tag LOCUS_17380 3242 2541 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_17380 3450 4085 gene locus_tag LOCUS_17390 gene cmk 3450 4085 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_17390 4103 4966 gene locus_tag LOCUS_17400 4103 4966 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_17400 5044 6024 gene locus_tag LOCUS_17410 gene pfkA 5044 6024 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_17410 6026 7897 gene locus_tag LOCUS_17420 6026 7897 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_17420 9534 7945 gene locus_tag LOCUS_17430 9534 7945 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence082 532 83 gene locus_tag LOCUS_17440 532 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 1371 529 gene locus_tag LOCUS_17450 1371 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2075 1377 gene locus_tag LOCUS_17460 2075 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2263 2676 gene locus_tag LOCUS_17470 2263 2676 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_17470 2923 2765 gene locus_tag LOCUS_17480 2923 2765 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_17480 3059 3736 gene locus_tag LOCUS_17490 3059 3736 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_17490 3733 5004 gene locus_tag LOCUS_17500 3733 5004 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_17500 5184 5588 gene locus_tag LOCUS_17510 5184 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5585 7273 gene locus_tag LOCUS_17520 5585 7273 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791319.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence083 1194 295 gene locus_tag LOCUS_17530 1194 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3138 1327 gene locus_tag LOCUS_17540 3138 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6203 3153 gene locus_tag LOCUS_17550 6203 3153 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_17550 <9304 6477 gene locus_tag LOCUS_17560 <9304 6477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767197.1:glycosyl hydrolase >Feature sequence084 458 1795 gene locus_tag LOCUS_17570 458 1795 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015371.1 protein_id gnl|my_center|LOCUS_17570 2676 1792 gene locus_tag LOCUS_17580 2676 1792 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_17580 3989 2673 gene locus_tag LOCUS_17590 gene xylA 3989 2673 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_17590 5504 4020 gene locus_tag LOCUS_17600 5504 4020 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_17600 5835 5620 gene locus_tag LOCUS_17610 5835 5620 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_17610 7012 5957 gene locus_tag LOCUS_17620 gene iolU 7012 5957 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_17620 7660 7016 gene locus_tag LOCUS_17630 7660 7016 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_17630 7760 8647 gene locus_tag LOCUS_17640 7760 8647 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence085 382 1041 gene locus_tag LOCUS_17650 382 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2035 1388 gene locus_tag LOCUS_17660 2035 1388 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_17660 2164 3849 gene locus_tag LOCUS_17670 2164 3849 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_17670 4143 6377 gene locus_tag LOCUS_17680 4143 6377 CDS product alpha-L-rhamnosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695108.1 protein_id gnl|my_center|LOCUS_17680 6494 6766 gene locus_tag LOCUS_17690 6494 6766 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_17690 6825 8462 gene locus_tag LOCUS_17700 gene groL 6825 8462 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_17700 8842 9015 gene locus_tag LOCUS_17710 8842 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence086 135 332 gene locus_tag LOCUS_17720 135 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 970 329 gene locus_tag LOCUS_17730 970 329 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_17730 2878 974 gene locus_tag LOCUS_17740 2878 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3070 4362 gene locus_tag LOCUS_17750 3070 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 4453 4662 gene locus_tag LOCUS_17760 4453 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 5979 4849 gene locus_tag LOCUS_17770 5979 4849 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583039.1 protein_id gnl|my_center|LOCUS_17770 6110 6640 gene locus_tag LOCUS_17780 6110 6640 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005806119.1 protein_id gnl|my_center|LOCUS_17780 6622 6894 gene locus_tag LOCUS_17790 6622 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 <8654 6962 gene locus_tag LOCUS_17800 <8654 6962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107663.1:AMP-binding protein >Feature sequence087 86 3256 gene locus_tag LOCUS_17810 86 3256 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_17810 3289 4953 gene locus_tag LOCUS_17820 3289 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 4984 5802 gene locus_tag LOCUS_17830 4984 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 5962 6918 gene locus_tag LOCUS_17840 5962 6918 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_17840 6974 8113 gene locus_tag LOCUS_17850 6974 8113 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence088 830 1249 gene locus_tag LOCUS_17860 830 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 2697 1333 gene locus_tag LOCUS_17870 gene thrC 2697 1333 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_17870 3944 2694 gene locus_tag LOCUS_17880 3944 2694 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202073.1 protein_id gnl|my_center|LOCUS_17880 6380 3948 gene locus_tag LOCUS_17890 gene thrA 6380 3948 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_17890 6484 7530 gene locus_tag LOCUS_17900 6484 7530 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074859600.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence089 3 332 gene locus_tag LOCUS_17910 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 537 1952 gene locus_tag LOCUS_17920 537 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2063 3220 gene locus_tag LOCUS_17930 2063 3220 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801462.1 protein_id gnl|my_center|LOCUS_17930 3339 3701 gene locus_tag LOCUS_17940 3339 3701 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_17940 3714 5381 gene locus_tag LOCUS_17950 3714 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 5408 7000 gene locus_tag LOCUS_17960 5408 7000 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797424.1 protein_id gnl|my_center|LOCUS_17960 7006 8319 gene locus_tag LOCUS_17970 7006 8319 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797433.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence090 2467 824 gene locus_tag LOCUS_17980 2467 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2641 4263 gene locus_tag LOCUS_17990 2641 4263 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_17990 4657 4415 gene locus_tag LOCUS_18000 4657 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4804 5589 gene locus_tag LOCUS_18010 4804 5589 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254593.1 protein_id gnl|my_center|LOCUS_18010 5599 6942 gene locus_tag LOCUS_18020 gene arcA 5599 6942 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904161.1 protein_id gnl|my_center|LOCUS_18020 7008 7481 gene locus_tag LOCUS_18030 7008 7481 CDS product DUF3237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084993485.1 protein_id gnl|my_center|LOCUS_18030 7916 7665 gene locus_tag LOCUS_18040 7916 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence091 163 966 gene locus_tag LOCUS_18050 163 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1147 2067 gene locus_tag LOCUS_18060 gene rfbA 1147 2067 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_18060 2100 3287 gene locus_tag LOCUS_18070 2100 3287 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_18070 3353 3559 gene locus_tag LOCUS_18080 3353 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3567 3854 gene locus_tag LOCUS_18090 3567 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3998 5215 gene locus_tag LOCUS_18100 3998 5215 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_18100 5222 6160 gene locus_tag LOCUS_18110 5222 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6185 7465 gene locus_tag LOCUS_18120 6185 7465 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_18120 >Feature sequence092 454 215 gene locus_tag LOCUS_18130 454 215 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_18130 612 2018 gene locus_tag LOCUS_18140 612 2018 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786913.1 protein_id gnl|my_center|LOCUS_18140 2069 3232 gene locus_tag LOCUS_18150 2069 3232 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_18150 3366 4112 gene locus_tag LOCUS_18160 3366 4112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_18160 4125 5345 gene locus_tag LOCUS_18170 4125 5345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786907.1 protein_id gnl|my_center|LOCUS_18170 5368 6450 gene locus_tag LOCUS_18180 5368 6450 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_18180 6454 7179 gene locus_tag LOCUS_18190 6454 7179 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence093 1200 133 gene locus_tag LOCUS_18200 1200 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 3885 1267 gene locus_tag LOCUS_18210 3885 1267 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_18210 4395 3958 gene locus_tag LOCUS_18220 4395 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 5222 4392 gene locus_tag LOCUS_18230 5222 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 5602 5252 gene locus_tag LOCUS_18240 5602 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence094 254 1285 gene locus_tag LOCUS_18250 gene cobD 254 1285 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768909.1 protein_id gnl|my_center|LOCUS_18250 1337 2278 gene locus_tag LOCUS_18260 gene cbiB 1337 2278 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803605.1 protein_id gnl|my_center|LOCUS_18260 2847 2275 gene locus_tag LOCUS_18270 2847 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3941 2853 gene locus_tag LOCUS_18280 3941 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 4048 4896 gene locus_tag LOCUS_18290 4048 4896 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_18290 4897 6687 gene locus_tag LOCUS_18300 4897 6687 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_18300 <7277 6749 gene locus_tag LOCUS_18310 <7277 6749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765597.1:helix-turn-helix domain-containing protein >Feature sequence095 <1 777 gene locus_tag LOCUS_18320 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791373.1:polyribonucleotide nucleotidyltransferase 899 1822 gene locus_tag LOCUS_18330 899 1822 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_18330 1819 2814 gene locus_tag LOCUS_18340 1819 2814 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_18340 2874 3302 gene locus_tag LOCUS_18350 2874 3302 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_18350 3417 4730 gene locus_tag LOCUS_18360 3417 4730 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_18360 5466 4735 gene locus_tag LOCUS_18370 5466 4735 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_18370 6401 5493 gene locus_tag LOCUS_18380 6401 5493 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_18380 <6895 6394 gene locus_tag LOCUS_18390 <6895 6394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203665.1:calcium-translocating P-type ATPase, PMCA-type >Feature sequence096 275 2374 gene locus_tag LOCUS_18400 275 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2376 3818 gene locus_tag LOCUS_18410 2376 3818 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761349.1 protein_id gnl|my_center|LOCUS_18410 3946 4686 gene locus_tag LOCUS_18420 3946 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 5784 5269 gene locus_tag LOCUS_18430 5784 5269 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_18430 5968 6618 gene locus_tag LOCUS_18440 5968 6618 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence097 <1 1093 gene locus_tag LOCUS_18450 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106133626.1:TonB-dependent receptor 1182 3044 gene locus_tag LOCUS_18460 1182 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 3755 3303 gene locus_tag LOCUS_18470 3755 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 4661 3840 gene locus_tag LOCUS_18480 4661 3840 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193211.1 protein_id gnl|my_center|LOCUS_18480 4870 6438 gene locus_tag LOCUS_18490 4870 6438 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence098 1636 530 gene locus_tag LOCUS_18500 1636 530 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_18500 2978 2523 gene locus_tag LOCUS_18510 gene queF 2978 2523 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_18510 3051 3890 gene locus_tag LOCUS_18520 3051 3890 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202722.1 protein_id gnl|my_center|LOCUS_18520 3967 4410 gene locus_tag LOCUS_18530 3967 4410 CDS product DUF1893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761597.1 protein_id gnl|my_center|LOCUS_18530 4438 6318 gene locus_tag LOCUS_18540 4438 6318 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence099 567 857 gene locus_tag LOCUS_18550 567 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 980 1315 gene locus_tag LOCUS_18560 980 1315 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_18560 1332 3884 gene locus_tag LOCUS_18570 1332 3884 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_18570 3929 4423 gene locus_tag LOCUS_18580 gene msrA 3929 4423 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831153.1 protein_id gnl|my_center|LOCUS_18580 4461 5120 gene locus_tag LOCUS_18590 4461 5120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_18590 5155 5496 gene locus_tag LOCUS_18600 5155 5496 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_18600 5571 6341 gene locus_tag LOCUS_18610 gene suhB 5571 6341 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460178.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence100 1899 193 gene locus_tag LOCUS_18620 1899 193 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_18620 2924 1902 gene locus_tag LOCUS_18630 2924 1902 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_18630 3823 2930 gene locus_tag LOCUS_18640 3823 2930 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_18640 5184 3985 gene locus_tag LOCUS_18650 5184 3985 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_18650 5967 5254 gene locus_tag LOCUS_18660 5967 5254 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555511.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence101 <1 1491 gene locus_tag LOCUS_18670 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203639.1:4Fe-4S binding protein 1516 2946 gene locus_tag LOCUS_18680 1516 2946 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_18680 3484 3017 gene locus_tag LOCUS_18690 3484 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_18690 3920 3561 gene locus_tag LOCUS_18700 3920 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109213.1 protein_id gnl|my_center|LOCUS_18700 4528 3971 gene locus_tag LOCUS_18710 4528 3971 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_18710 5506 4586 gene locus_tag LOCUS_18720 5506 4586 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_18720 <6451 5602 gene locus_tag LOCUS_18730 <6451 5602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775782.1:30S ribosomal protein S1 >Feature sequence102 1037 1735 gene locus_tag LOCUS_18740 gene upp 1037 1735 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_18740 2839 1769 gene locus_tag LOCUS_18750 2839 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2963 3436 gene locus_tag LOCUS_18760 2963 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3443 4036 gene locus_tag LOCUS_18770 3443 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 4042 4443 gene locus_tag LOCUS_18780 4042 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4467 5246 gene locus_tag LOCUS_18790 4467 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 5940 5272 gene locus_tag LOCUS_18800 5940 5272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence103 480 1733 gene locus_tag LOCUS_18810 480 1733 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_18810 2943 1711 gene locus_tag LOCUS_18820 2943 1711 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_18820 3067 3672 gene locus_tag LOCUS_18830 3067 3672 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_18830 3660 4577 gene locus_tag LOCUS_18840 3660 4577 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_18840 4592 5242 gene locus_tag LOCUS_18850 gene mtnN 4592 5242 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689868.1 protein_id gnl|my_center|LOCUS_18850 5755 5261 gene locus_tag LOCUS_18860 5755 5261 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence104 2308 1058 gene locus_tag LOCUS_18870 2308 1058 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_18870 2624 4003 gene locus_tag LOCUS_18880 2624 4003 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_18880 3993 5297 gene locus_tag LOCUS_18890 3993 5297 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence105 <1 1623 gene locus_tag LOCUS_18900 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203679.1:beta-glucosidase BglX 2523 2254 gene locus_tag LOCUS_18910 2523 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 <5652 3316 gene locus_tag LOCUS_18920 <5652 3316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048696927.1:bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence106 2773 557 gene locus_tag LOCUS_18930 2773 557 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_18930 4016 2778 gene locus_tag LOCUS_18940 4016 2778 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765060.1 protein_id gnl|my_center|LOCUS_18940 4860 4039 gene locus_tag LOCUS_18950 gene dapF 4860 4039 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence107 3969 2401 gene locus_tag LOCUS_18960 3969 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 5105 4020 gene locus_tag LOCUS_18970 5105 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence108 789 1355 gene locus_tag LOCUS_18980 789 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3895 1358 gene locus_tag LOCUS_18990 3895 1358 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_18990 4030 3945 gene locus_tag LOCUS_t00360 4030 3945 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 1212 577 gene locus_tag LOCUS_19000 1212 577 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404247.1 protein_id gnl|my_center|LOCUS_19000 2511 1315 gene locus_tag LOCUS_19010 gene galK 2511 1315 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_19010 3853 2528 gene locus_tag LOCUS_19020 3853 2528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_19020 <4626 3897 gene locus_tag LOCUS_19030 <4626 3897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766110.1:galactose mutarotase >Feature sequence110 647 1747 gene locus_tag LOCUS_19040 647 1747 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703911.1 protein_id gnl|my_center|LOCUS_19040 1841 4267 gene locus_tag LOCUS_19050 1841 4267 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157437265.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence111 2298 2065 gene locus_tag LOCUS_19060 2298 2065 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_19060 2462 3112 gene locus_tag LOCUS_19070 2462 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19070 3221 3868 gene locus_tag LOCUS_19080 3221 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19080 >Feature sequence112 1415 108 gene locus_tag LOCUS_19090 gene ricT 1415 108 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_19090 2603 1497 gene locus_tag LOCUS_19100 2603 1497 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_19100 3584 2631 gene locus_tag LOCUS_19110 gene metF 3584 2631 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence113 287 1567 gene locus_tag LOCUS_19120 287 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 1599 2645 gene locus_tag LOCUS_19130 1599 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 2664 3926 gene locus_tag LOCUS_19140 2664 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence114 609 112 gene locus_tag LOCUS_19150 609 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1822 698 gene locus_tag LOCUS_19160 1822 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2743 1835 gene locus_tag LOCUS_19170 2743 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038184.1 protein_id gnl|my_center|LOCUS_19170 <4102 2819 gene locus_tag LOCUS_19180 <4102 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459352.1:heavy metal translocating P-type ATPase >Feature sequence115 914 1687 gene locus_tag LOCUS_19190 914 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence116 3014 1371 gene locus_tag LOCUS_19200 3014 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 3385 3011 gene locus_tag LOCUS_19210 3385 3011 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence117 309 1250 gene locus_tag LOCUS_19220 gene trxB 309 1250 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_19220 1243 1953 gene locus_tag LOCUS_19230 1243 1953 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_19230 <3405 2119 gene locus_tag LOCUS_19240 <3405 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785391.1:glutamine synthetase III >Feature sequence118 1847 651 gene locus_tag LOCUS_19250 1847 651 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_19250 3139 1928 gene locus_tag LOCUS_19260 3139 1928 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence119 1 498 gene locus_tag LOCUS_19270 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 718 434 gene locus_tag LOCUS_19280 718 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1439 873 gene locus_tag LOCUS_19290 1439 873 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938435.1 protein_id gnl|my_center|LOCUS_19290 1931 1509 gene locus_tag LOCUS_19300 1931 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 2146 1916 gene locus_tag LOCUS_19310 2146 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 2358 2143 gene locus_tag LOCUS_19320 2358 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2710 2429 gene locus_tag LOCUS_19330 2710 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 >Feature sequence120 2907 334 gene locus_tag LOCUS_19340 2907 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence121 242 2383 gene locus_tag LOCUS_19350 242 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence122 1696 494 gene locus_tag LOCUS_19360 1696 494 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_19360 2383 1763 gene locus_tag LOCUS_19370 2383 1763 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_19370 2971 2501 gene locus_tag LOCUS_19380 gene argR 2971 2501 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence123 1407 283 gene locus_tag LOCUS_19390 1407 283 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_19390 2279 1413 gene locus_tag LOCUS_19400 2279 1413 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202924.1 protein_id gnl|my_center|LOCUS_19400 3046 2297 gene locus_tag LOCUS_19410 3046 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence124 <1 1006 gene locus_tag LOCUS_19420 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764412.1:M56 family metallopeptidase >Feature sequence125 414 1526 gene locus_tag LOCUS_19430 414 1526 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202923.1 protein_id gnl|my_center|LOCUS_19430 1523 2419 gene locus_tag LOCUS_19440 1523 2419 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202922.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence126 385 170 gene locus_tag LOCUS_19450 385 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1323 529 gene locus_tag LOCUS_19460 1323 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2022 1339 gene locus_tag LOCUS_19470 2022 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence127 1558 446 gene locus_tag LOCUS_19480 gene ald 1558 446 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence128 559 1374 gene locus_tag LOCUS_19490 559 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1380 2105 gene locus_tag LOCUS_19500 1380 2105 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence129 84 1433 gene locus_tag LOCUS_19510 84 1433 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_19510 <2383 1642 gene locus_tag LOCUS_19520 <2383 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460649.1:radical SAM protein >Feature sequence130 920 426 gene locus_tag LOCUS_19530 920 426 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_19530 1320 943 gene locus_tag LOCUS_19540 1320 943 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811644.1 protein_id gnl|my_center|LOCUS_19540 2072 1896 gene locus_tag LOCUS_19550 2072 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence131 1282 191 gene locus_tag LOCUS_19560 1282 191 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_19560 2171 1377 gene locus_tag LOCUS_19570 gene nagB 2171 1377 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence132 <2230 1579 gene locus_tag LOCUS_19580 <2230 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202911.1:pyruvate, phosphate dikinase >Feature sequence133 <1 655 gene locus_tag LOCUS_19590 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762736.1:peptidylprolyl isomerase 657 1157 gene locus_tag LOCUS_19600 657 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence134 <1 566 gene locus_tag LOCUS_19610 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007850909.1:ATP-binding protein 563 1885 gene locus_tag LOCUS_19620 563 1885 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065539461.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence135 1589 6 gene locus_tag LOCUS_19630 1589 6 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767836.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence136 156 521 gene locus_tag LOCUS_19640 gene crcB 156 521 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_19640 518 1060 gene locus_tag LOCUS_19650 518 1060 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895565.1 protein_id gnl|my_center|LOCUS_19650 1434 1090 gene locus_tag LOCUS_19660 1434 1090 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_19660 1562 1434 gene locus_tag LOCUS_19670 1562 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence137 <1 881 gene locus_tag LOCUS_19680 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765263.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence138 2 511 gene locus_tag LOCUS_19690 2 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence139 809 1447 gene locus_tag LOCUS_19700 809 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence140 1808 168 gene locus_tag LOCUS_19710 1808 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484911.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence141 1535 444 gene locus_tag LOCUS_19720 1535 444 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202260.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence142 263 39 gene locus_tag LOCUS_19730 gene rpmB 263 39 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_19730 1427 405 gene locus_tag LOCUS_19740 gene tsaD 1427 405 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787941.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence143 <1 970 gene locus_tag LOCUS_19750 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258810.1:serine/threonine-protein kinase >Feature sequence144 <1 683 gene locus_tag LOCUS_19760 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013363706.1:DNA methylase 680 1084 gene locus_tag LOCUS_19770 680 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1419 1249 gene locus_tag LOCUS_19780 1419 1249 CDS product FaeA/PapI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813931.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence145 335 51 gene locus_tag LOCUS_19790 335 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1055 489 gene locus_tag LOCUS_19800 1055 489 CDS product host-nuclease inhibitor Gam family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938435.1 protein_id gnl|my_center|LOCUS_19800 1508 1089 gene locus_tag LOCUS_19810 1508 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810