>Feature sequence01 <1 573 gene locus_tag LOCUS_00010 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958343.1:ATP-binding protein 882 2948 gene locus_tag LOCUS_00020 882 2948 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107987.1 protein_id gnl|my_center|LOCUS_00020 3625 2945 gene locus_tag LOCUS_00030 3625 2945 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_00030 3780 4424 gene locus_tag LOCUS_00040 3780 4424 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767685.1 protein_id gnl|my_center|LOCUS_00040 6013 4421 gene locus_tag LOCUS_00050 6013 4421 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_00050 6955 6053 gene locus_tag LOCUS_00060 6955 6053 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_00060 8628 6952 gene locus_tag LOCUS_00070 8628 6952 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_00070 8680 9507 gene locus_tag LOCUS_00080 8680 9507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9523 11736 gene locus_tag LOCUS_00090 gene bglX 9523 11736 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658134.1 protein_id gnl|my_center|LOCUS_00090 12759 11749 gene locus_tag LOCUS_00100 12759 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14373 12856 gene locus_tag LOCUS_00110 14373 12856 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084146450.1 protein_id gnl|my_center|LOCUS_00110 14647 15255 gene locus_tag LOCUS_00120 14647 15255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15265 16848 gene locus_tag LOCUS_00130 15265 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16869 18236 gene locus_tag LOCUS_00140 16869 18236 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201962.1 protein_id gnl|my_center|LOCUS_00140 18263 19087 gene locus_tag LOCUS_00150 18263 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19107 19745 gene locus_tag LOCUS_00160 19107 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19749 20225 gene locus_tag LOCUS_00170 19749 20225 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_00170 20247 21854 gene locus_tag LOCUS_00180 20247 21854 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002431748.1 protein_id gnl|my_center|LOCUS_00180 21870 22484 gene locus_tag LOCUS_00190 21870 22484 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723672.1 protein_id gnl|my_center|LOCUS_00190 22481 22957 gene locus_tag LOCUS_00200 gene ybaK 22481 22957 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_00200 23318 22959 gene locus_tag LOCUS_00210 23318 22959 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_00210 23433 24173 gene locus_tag LOCUS_00220 gene phoN2 23433 24173 CDS product PAP2 family phosphatase PhoN2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850660.1 protein_id gnl|my_center|LOCUS_00220 24176 25645 gene locus_tag LOCUS_00230 24176 25645 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195154.1 protein_id gnl|my_center|LOCUS_00230 25670 26074 gene locus_tag LOCUS_00240 25670 26074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 26091 26492 gene locus_tag LOCUS_00250 gene mutT 26091 26492 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_00250 26489 27799 gene locus_tag LOCUS_00260 26489 27799 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_00260 29465 27807 gene locus_tag LOCUS_00270 29465 27807 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793588.1 protein_id gnl|my_center|LOCUS_00270 31027 29465 gene locus_tag LOCUS_00280 31027 29465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31101 32159 gene locus_tag LOCUS_00290 31101 32159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32156 32611 gene locus_tag LOCUS_00300 32156 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32611 33327 gene locus_tag LOCUS_00310 32611 33327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 34049 33324 gene locus_tag LOCUS_00320 34049 33324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 34836 34042 gene locus_tag LOCUS_00330 34836 34042 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_00330 35263 34844 gene locus_tag LOCUS_00340 gene fabZ 35263 34844 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 protein_id gnl|my_center|LOCUS_00340 36903 35260 gene locus_tag LOCUS_00350 36903 35260 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798215.1 protein_id gnl|my_center|LOCUS_00350 37023 37724 gene locus_tag LOCUS_00360 37023 37724 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786205.1 protein_id gnl|my_center|LOCUS_00360 37726 38187 gene locus_tag LOCUS_00370 gene queF 37726 38187 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_00370 38200 39453 gene locus_tag LOCUS_00380 38200 39453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39500 40915 gene locus_tag LOCUS_00390 gene hydG 39500 40915 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108015.1 protein_id gnl|my_center|LOCUS_00390 40917 41999 gene locus_tag LOCUS_00400 gene hydF 40917 41999 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798360.1 protein_id gnl|my_center|LOCUS_00400 43091 42006 gene locus_tag LOCUS_00410 gene hydE 43091 42006 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_00410 43627 43094 gene locus_tag LOCUS_00420 43627 43094 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_00420 44363 43629 gene locus_tag LOCUS_00430 44363 43629 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_00430 44699 44370 gene locus_tag LOCUS_00440 44699 44370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_00440 46062 44701 gene locus_tag LOCUS_00450 46062 44701 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_00450 46479 46066 gene locus_tag LOCUS_00460 46479 46066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 46826 46482 gene locus_tag LOCUS_00470 46826 46482 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_00470 47396 46911 gene locus_tag LOCUS_00480 gene nuoE 47396 46911 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_00480 49185 47404 gene locus_tag LOCUS_00490 49185 47404 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766747.1 protein_id gnl|my_center|LOCUS_00490 50986 49193 gene locus_tag LOCUS_00500 gene nuoF 50986 49193 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_00500 51406 51017 gene locus_tag LOCUS_00510 51406 51017 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_00510 51516 53072 gene locus_tag LOCUS_00520 51516 53072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 53084 54151 gene locus_tag LOCUS_00530 53084 54151 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_00530 56159 54141 gene locus_tag LOCUS_00540 56159 54141 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_00540 56912 56169 gene locus_tag LOCUS_00550 56912 56169 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_00550 57668 56922 gene locus_tag LOCUS_00560 57668 56922 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_00560 57714 58391 gene locus_tag LOCUS_00570 57714 58391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58410 58844 gene locus_tag LOCUS_00580 58410 58844 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398241.1 protein_id gnl|my_center|LOCUS_00580 58885 60006 gene locus_tag LOCUS_00590 gene dnaN 58885 60006 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_00590 60014 60859 gene locus_tag LOCUS_00600 60014 60859 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_00600 60859 61425 gene locus_tag LOCUS_00610 60859 61425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 61429 62811 gene locus_tag LOCUS_00620 gene nhaA 61429 62811 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_00620 62840 62913 gene locus_tag LOCUS_t00010 62840 62913 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 64216 62921 gene locus_tag LOCUS_00630 gene purB 64216 62921 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233955.1 protein_id gnl|my_center|LOCUS_00630 65162 64224 gene locus_tag LOCUS_00640 65162 64224 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_00640 66453 65179 gene locus_tag LOCUS_00650 66453 65179 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_00650 67427 66471 gene locus_tag LOCUS_00660 67427 66471 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_00660 68638 67442 gene locus_tag LOCUS_00670 68638 67442 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760990.1 protein_id gnl|my_center|LOCUS_00670 70119 68647 gene locus_tag LOCUS_00680 70119 68647 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_00680 71140 70130 gene locus_tag LOCUS_00690 gene asnA 71140 70130 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_00690 72164 71142 gene locus_tag LOCUS_00700 72164 71142 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_00700 73449 72166 gene locus_tag LOCUS_00710 73449 72166 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_00710 74762 73446 gene locus_tag LOCUS_00720 74762 73446 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_00720 75532 74765 gene locus_tag LOCUS_00730 75532 74765 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_00730 76573 75539 gene locus_tag LOCUS_00740 76573 75539 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_00740 77657 76587 gene locus_tag LOCUS_00750 gene leuB 77657 76587 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_00750 79183 77654 gene locus_tag LOCUS_00760 79183 77654 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763199.1 protein_id gnl|my_center|LOCUS_00760 79773 79180 gene locus_tag LOCUS_00770 gene leuD 79773 79180 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_00770 81137 79770 gene locus_tag LOCUS_00780 gene leuC 81137 79770 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_00780 82643 81138 gene locus_tag LOCUS_00790 82643 81138 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_00790 83694 82648 gene locus_tag LOCUS_00800 gene ilvC 83694 82648 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_00800 84025 83708 gene locus_tag LOCUS_00810 84025 83708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 85739 84015 gene locus_tag LOCUS_00820 gene ilvB 85739 84015 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_00820 87526 85739 gene locus_tag LOCUS_00830 gene ilvD 87526 85739 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_00830 88995 87640 gene locus_tag LOCUS_00840 88995 87640 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_00840 90131 88992 gene locus_tag LOCUS_00850 gene icd 90131 88992 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108123.1 protein_id gnl|my_center|LOCUS_00850 92326 90128 gene locus_tag LOCUS_00860 92326 90128 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_00860 92421 94847 gene locus_tag LOCUS_00870 gene thrA 92421 94847 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_00870 94852 95775 gene locus_tag LOCUS_00880 94852 95775 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_00880 95772 97073 gene locus_tag LOCUS_00890 gene thrC 95772 97073 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_00890 97086 98084 gene locus_tag LOCUS_00900 97086 98084 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_00900 98119 99291 gene locus_tag LOCUS_00910 98119 99291 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_00910 99974 100825 gene locus_tag LOCUS_00920 gene hisG 99974 100825 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_00920 100829 102097 gene locus_tag LOCUS_00930 gene hisD 100829 102097 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_00930 102084 103133 gene locus_tag LOCUS_00940 gene hisC 102084 103133 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789125.1 protein_id gnl|my_center|LOCUS_00940 103108 104166 gene locus_tag LOCUS_00950 gene hisB 103108 104166 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_00950 104163 104750 gene locus_tag LOCUS_00960 gene hisH 104163 104750 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_00960 104747 105475 gene locus_tag LOCUS_00970 gene hisA 104747 105475 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_00970 105457 106212 gene locus_tag LOCUS_00980 gene hisF 105457 106212 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_00980 106209 106808 gene locus_tag LOCUS_00990 gene hisIE 106209 106808 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788819.1 protein_id gnl|my_center|LOCUS_00990 106857 107426 gene locus_tag LOCUS_01000 106857 107426 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_01000 107432 108640 gene locus_tag LOCUS_01010 107432 108640 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_01010 108633 109577 gene locus_tag LOCUS_01020 gene argC 108633 109577 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_01020 109581 110705 gene locus_tag LOCUS_01030 109581 110705 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_01030 110702 111658 gene locus_tag LOCUS_01040 110702 111658 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_01040 111655 112431 gene locus_tag LOCUS_01050 gene argB 111655 112431 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_01050 112428 113516 gene locus_tag LOCUS_01060 112428 113516 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_01060 113497 114816 gene locus_tag LOCUS_01070 gene argH 113497 114816 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_01070 114819 118031 gene locus_tag LOCUS_01080 gene carB 114819 118031 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_01080 118028 119482 gene locus_tag LOCUS_01090 118028 119482 CDS product glycosyl hydrolase family 79 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526730.1 protein_id gnl|my_center|LOCUS_01090 119504 123472 gene locus_tag LOCUS_01100 119504 123472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 123480 124133 gene locus_tag LOCUS_01110 123480 124133 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930809.1 protein_id gnl|my_center|LOCUS_01110 126624 124138 gene locus_tag LOCUS_01120 126624 124138 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_01120 126706 127452 gene locus_tag LOCUS_01130 gene nadE 126706 127452 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_01130 129312 127447 gene locus_tag LOCUS_01140 129312 127447 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_01140 129743 129321 gene locus_tag LOCUS_01150 129743 129321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 130745 129756 gene locus_tag LOCUS_01160 130745 129756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 132719 130761 gene locus_tag LOCUS_01170 132719 130761 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_01170 134672 132804 gene locus_tag LOCUS_01180 gene gyrB 134672 132804 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_01180 136445 134814 gene locus_tag LOCUS_01190 136445 134814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 139387 136445 gene locus_tag LOCUS_01200 139387 136445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 139493 140197 gene locus_tag LOCUS_01210 139493 140197 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_01210 140194 140832 gene locus_tag LOCUS_01220 gene nth 140194 140832 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_01220 142480 140822 gene locus_tag LOCUS_01230 142480 140822 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786230.1 protein_id gnl|my_center|LOCUS_01230 142581 144251 gene locus_tag LOCUS_01240 142581 144251 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_01240 145072 144248 gene locus_tag LOCUS_01250 145072 144248 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_01250 145184 146446 gene locus_tag LOCUS_01260 145184 146446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 146448 147392 gene locus_tag LOCUS_01270 146448 147392 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_01270 147393 148664 gene locus_tag LOCUS_01280 147393 148664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 149826 148645 gene locus_tag LOCUS_01290 149826 148645 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_01290 150704 149826 gene locus_tag LOCUS_01300 150704 149826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 150759 152846 gene locus_tag LOCUS_01310 150759 152846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 153297 152836 gene locus_tag LOCUS_01320 153297 152836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 155497 153311 gene locus_tag LOCUS_01330 gene nrdD 155497 153311 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083208.1 protein_id gnl|my_center|LOCUS_01330 156745 155624 gene locus_tag LOCUS_01340 156745 155624 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_01340 158034 156793 gene locus_tag LOCUS_01350 158034 156793 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_01350 158097 158942 gene locus_tag LOCUS_01360 158097 158942 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_01360 158939 160138 gene locus_tag LOCUS_01370 158939 160138 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_01370 160175 161602 gene locus_tag LOCUS_01380 160175 161602 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202731.1 protein_id gnl|my_center|LOCUS_01380 161639 163240 gene locus_tag LOCUS_01390 161639 163240 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 protein_id gnl|my_center|LOCUS_01390 163240 164463 gene locus_tag LOCUS_01400 163240 164463 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_01400 164460 165128 gene locus_tag LOCUS_01410 gene tsaA 164460 165128 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_01410 165143 166300 gene locus_tag LOCUS_01420 165143 166300 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109296.1 protein_id gnl|my_center|LOCUS_01420 167744 166341 gene locus_tag LOCUS_01430 gene gcvPB 167744 166341 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_01430 169042 167741 gene locus_tag LOCUS_01440 169042 167741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 169423 169049 gene locus_tag LOCUS_01450 gene gcvH 169423 169049 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_01450 170530 169430 gene locus_tag LOCUS_01460 170530 169430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 171264 170560 gene locus_tag LOCUS_01470 171264 170560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 171731 171261 gene locus_tag LOCUS_01480 171731 171261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 171798 172469 gene locus_tag LOCUS_01490 171798 172469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 175452 172420 gene locus_tag LOCUS_01500 175452 172420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 176192 175452 gene locus_tag LOCUS_01510 176192 175452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 177236 176196 gene locus_tag LOCUS_01520 177236 176196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 179178 177223 gene locus_tag LOCUS_01530 179178 177223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 179528 179181 gene locus_tag LOCUS_01540 179528 179181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 179859 180257 gene locus_tag LOCUS_01550 179859 180257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 180626 180231 gene locus_tag LOCUS_01560 180626 180231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 183989 180645 gene locus_tag LOCUS_01570 gene secA 183989 180645 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_01570 184161 185186 gene locus_tag LOCUS_01580 gene pseB 184161 185186 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_01580 185183 186343 gene locus_tag LOCUS_01590 gene pseC 185183 186343 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_01590 186345 187187 gene locus_tag LOCUS_01600 186345 187187 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015758.1 protein_id gnl|my_center|LOCUS_01600 187189 187959 gene locus_tag LOCUS_01610 187189 187959 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_01610 187964 189271 gene locus_tag LOCUS_01620 187964 189271 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_01620 189275 189835 gene locus_tag LOCUS_01630 189275 189835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 189828 190286 gene locus_tag LOCUS_01640 189828 190286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 190283 191293 gene locus_tag LOCUS_01650 gene pseI 190283 191293 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_01650 191302 192828 gene locus_tag LOCUS_01660 191302 192828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 192833 194386 gene locus_tag LOCUS_01670 192833 194386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 195382 194378 gene locus_tag LOCUS_01680 195382 194378 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_01680 196913 195372 gene locus_tag LOCUS_01690 196913 195372 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_01690 197876 196929 gene locus_tag LOCUS_01700 197876 196929 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787404.1 protein_id gnl|my_center|LOCUS_01700 200350 197873 gene locus_tag LOCUS_01710 200350 197873 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_01710 201352 200363 gene locus_tag LOCUS_01720 201352 200363 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_01720 201408 201479 gene locus_tag LOCUS_t00020 201408 201479 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 202769 201513 gene locus_tag LOCUS_01730 202769 201513 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_01730 204171 202858 gene locus_tag LOCUS_01740 gene xylA 204171 202858 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_01740 205656 204178 gene locus_tag LOCUS_01750 205656 204178 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_01750 206391 205810 gene locus_tag LOCUS_01760 206391 205810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 209285 206475 gene locus_tag LOCUS_01770 209285 206475 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_01770 209472 210335 gene locus_tag LOCUS_01780 209472 210335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 210450 211511 gene locus_tag LOCUS_01790 210450 211511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 211583 212575 gene locus_tag LOCUS_01800 211583 212575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 212580 213503 gene locus_tag LOCUS_01810 212580 213503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 214448 213510 gene locus_tag LOCUS_01820 214448 213510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 214488 217301 gene locus_tag LOCUS_01830 214488 217301 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_01830 217308 218153 gene locus_tag LOCUS_01840 217308 218153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 219642 218413 gene locus_tag LOCUS_01850 219642 218413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 219796 221013 gene locus_tag LOCUS_01860 219796 221013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 221023 221748 gene locus_tag LOCUS_01870 221023 221748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 221772 222305 gene locus_tag LOCUS_01880 221772 222305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 222452 222380 gene locus_tag LOCUS_t00030 222452 222380 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 222511 223401 gene locus_tag LOCUS_01890 gene fabD 222511 223401 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_01890 223977 223411 gene locus_tag LOCUS_01900 gene pnuC 223977 223411 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_01900 226358 223977 gene locus_tag LOCUS_01910 226358 223977 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 protein_id gnl|my_center|LOCUS_01910 226601 228685 gene locus_tag LOCUS_01920 226601 228685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 228694 229947 gene locus_tag LOCUS_01930 228694 229947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 229952 231484 gene locus_tag LOCUS_01940 229952 231484 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_01940 233490 231550 gene locus_tag LOCUS_01950 233490 231550 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_01950 236571 233503 gene locus_tag LOCUS_01960 236571 233503 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_01960 236760 240755 gene locus_tag LOCUS_01970 236760 240755 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_01970 240848 243337 gene locus_tag LOCUS_01980 240848 243337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 243344 244675 gene locus_tag LOCUS_01990 243344 244675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 244682 246109 gene locus_tag LOCUS_02000 244682 246109 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966721.1 protein_id gnl|my_center|LOCUS_02000 246122 247117 gene locus_tag LOCUS_02010 246122 247117 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_02010 247110 248795 gene locus_tag LOCUS_02020 247110 248795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 248792 251236 gene locus_tag LOCUS_02030 248792 251236 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203451.1 protein_id gnl|my_center|LOCUS_02030 252387 251233 gene locus_tag LOCUS_02040 252387 251233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 253623 252478 gene locus_tag LOCUS_02050 253623 252478 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_02050 255100 253643 gene locus_tag LOCUS_02060 gene gnd 255100 253643 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675469.1 protein_id gnl|my_center|LOCUS_02060 256252 255116 gene locus_tag LOCUS_02070 gene pdxB 256252 255116 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_02070 257531 256254 gene locus_tag LOCUS_02080 257531 256254 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_02080 258615 257536 gene locus_tag LOCUS_02090 258615 257536 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_02090 260064 258652 gene locus_tag LOCUS_02100 260064 258652 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_02100 260068 261039 gene locus_tag LOCUS_02110 260068 261039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 262455 261043 gene locus_tag LOCUS_02120 gene pelB 262455 261043 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_02120 264618 262471 gene locus_tag LOCUS_02130 264618 262471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 266135 264639 gene locus_tag LOCUS_02140 266135 264639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 267785 266241 gene locus_tag LOCUS_02150 267785 266241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 270028 267872 gene locus_tag LOCUS_02160 270028 267872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 273150 270052 gene locus_tag LOCUS_02170 273150 270052 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_02170 275524 273401 gene locus_tag LOCUS_02180 275524 273401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 278680 275576 gene locus_tag LOCUS_02190 278680 275576 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 protein_id gnl|my_center|LOCUS_02190 278915 281776 gene locus_tag LOCUS_02200 278915 281776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 283334 281745 gene locus_tag LOCUS_02210 283334 281745 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640391.1 protein_id gnl|my_center|LOCUS_02210 285028 283376 gene locus_tag LOCUS_02220 285028 283376 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640391.1 protein_id gnl|my_center|LOCUS_02220 285189 285533 gene locus_tag LOCUS_02230 285189 285533 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_02230 288006 285535 gene locus_tag LOCUS_02240 288006 285535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 288103 289446 gene locus_tag LOCUS_02250 288103 289446 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_02250 289461 292223 gene locus_tag LOCUS_02260 289461 292223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 292227 293390 gene locus_tag LOCUS_02270 292227 293390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 293402 295765 gene locus_tag LOCUS_02280 293402 295765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 295767 297188 gene locus_tag LOCUS_02290 gene rhaB 295767 297188 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108961.1 protein_id gnl|my_center|LOCUS_02290 297192 298490 gene locus_tag LOCUS_02300 297192 298490 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536410.1 protein_id gnl|my_center|LOCUS_02300 298500 299537 gene locus_tag LOCUS_02310 gene rhaT 298500 299537 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_02310 299539 300102 gene locus_tag LOCUS_02320 299539 300102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 300155 302359 gene locus_tag LOCUS_02330 300155 302359 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682106.1 protein_id gnl|my_center|LOCUS_02330 302370 303380 gene locus_tag LOCUS_02340 302370 303380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 303834 303394 gene locus_tag LOCUS_02350 gene umuD 303834 303394 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_02350 304694 303831 gene locus_tag LOCUS_02360 304694 303831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 304767 306728 gene locus_tag LOCUS_02370 304767 306728 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_02370 306721 307560 gene locus_tag LOCUS_02380 306721 307560 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761509.1 protein_id gnl|my_center|LOCUS_02380 307586 307753 gene locus_tag LOCUS_02390 307586 307753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence02 772 260 gene locus_tag LOCUS_02400 772 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 875 2707 gene locus_tag LOCUS_02410 875 2707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_02410 2736 3107 gene locus_tag LOCUS_02420 2736 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3104 6055 gene locus_tag LOCUS_02430 3104 6055 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769700.1 protein_id gnl|my_center|LOCUS_02430 9369 6052 gene locus_tag LOCUS_02440 9369 6052 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107573.1 protein_id gnl|my_center|LOCUS_02440 10804 9371 gene locus_tag LOCUS_02450 10804 9371 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_02450 10860 11939 gene locus_tag LOCUS_02460 10860 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 11951 12655 gene locus_tag LOCUS_02470 11951 12655 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_02470 13249 12659 gene locus_tag LOCUS_02480 13249 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 14392 13253 gene locus_tag LOCUS_02490 gene rfbB 14392 13253 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_02490 14963 14385 gene locus_tag LOCUS_02500 gene rfbC 14963 14385 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_02500 15832 14960 gene locus_tag LOCUS_02510 gene rfbD 15832 14960 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_02510 15902 16360 gene locus_tag LOCUS_02520 gene rnhA 15902 16360 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_02520 16365 17462 gene locus_tag LOCUS_02530 gene pdxA 16365 17462 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_02530 17467 17937 gene locus_tag LOCUS_02540 17467 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 18370 17903 gene locus_tag LOCUS_02550 18370 17903 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784379.1 protein_id gnl|my_center|LOCUS_02550 20711 18372 gene locus_tag LOCUS_02560 20711 18372 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766160.1 protein_id gnl|my_center|LOCUS_02560 21748 20720 gene locus_tag LOCUS_02570 gene rlmN 21748 20720 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_02570 21819 22844 gene locus_tag LOCUS_02580 gene recA 21819 22844 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_02580 23773 22841 gene locus_tag LOCUS_02590 23773 22841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 24503 23742 gene locus_tag LOCUS_02600 gene rsmI 24503 23742 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_02600 24605 25120 gene locus_tag LOCUS_02610 24605 25120 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763837.1 protein_id gnl|my_center|LOCUS_02610 25981 25124 gene locus_tag LOCUS_02620 gene xerD 25981 25124 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_02620 26043 27302 gene locus_tag LOCUS_02630 26043 27302 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202581.1 protein_id gnl|my_center|LOCUS_02630 27405 27986 gene locus_tag LOCUS_02640 27405 27986 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_02640 28001 28582 gene locus_tag LOCUS_02650 gene pth 28001 28582 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_02650 28688 28861 gene locus_tag LOCUS_02660 28688 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 29068 30759 gene locus_tag LOCUS_02670 29068 30759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 30756 31160 gene locus_tag LOCUS_02680 30756 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 31912 31157 gene locus_tag LOCUS_02690 gene tpiA 31912 31157 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_02690 32021 33274 gene locus_tag LOCUS_02700 gene tyrS 32021 33274 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762838.1 protein_id gnl|my_center|LOCUS_02700 33274 33621 gene locus_tag LOCUS_02710 gene rbfA 33274 33621 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_02710 33618 34814 gene locus_tag LOCUS_02720 33618 34814 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_02720 35715 34777 gene locus_tag LOCUS_02730 35715 34777 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_02730 35759 36337 gene locus_tag LOCUS_02740 35759 36337 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_02740 36337 36723 gene locus_tag LOCUS_02750 36337 36723 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760336.1 protein_id gnl|my_center|LOCUS_02750 37251 36724 gene locus_tag LOCUS_02760 37251 36724 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_02760 38940 37324 gene locus_tag LOCUS_02770 38940 37324 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_02770 40515 38953 gene locus_tag LOCUS_02780 40515 38953 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_02780 40978 40697 gene locus_tag LOCUS_02790 40978 40697 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_02790 41142 43541 gene locus_tag LOCUS_02800 gene lon 41142 43541 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_02800 43541 44209 gene locus_tag LOCUS_02810 gene ung 43541 44209 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067035.1 protein_id gnl|my_center|LOCUS_02810 44197 44676 gene locus_tag LOCUS_02820 gene coaD 44197 44676 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_02820 44676 45566 gene locus_tag LOCUS_02830 44676 45566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 45570 45800 gene locus_tag LOCUS_02840 45570 45800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 47361 45763 gene locus_tag LOCUS_02850 gene lnt 47361 45763 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_02850 48410 47358 gene locus_tag LOCUS_02860 48410 47358 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_02860 49198 48407 gene locus_tag LOCUS_02870 49198 48407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 49828 49205 gene locus_tag LOCUS_02880 49828 49205 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_02880 52834 49883 gene locus_tag LOCUS_02890 52834 49883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_02890 53416 52859 gene locus_tag LOCUS_02900 gene ruvC 53416 52859 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_02900 54691 53420 gene locus_tag LOCUS_02910 gene serS 54691 53420 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759982.1 protein_id gnl|my_center|LOCUS_02910 55031 54771 gene locus_tag LOCUS_02920 gene rpmA 55031 54771 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759983.1 protein_id gnl|my_center|LOCUS_02920 55354 55043 gene locus_tag LOCUS_02930 gene rplU 55354 55043 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775748.1 protein_id gnl|my_center|LOCUS_02930 55517 56668 gene locus_tag LOCUS_02940 55517 56668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 56665 57375 gene locus_tag LOCUS_02950 56665 57375 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108550.1 protein_id gnl|my_center|LOCUS_02950 57422 57616 gene locus_tag LOCUS_02960 gene rpsU 57422 57616 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_02960 57661 57743 gene locus_tag LOCUS_t00040 57661 57743 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 60274 57743 gene locus_tag LOCUS_02970 60274 57743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 60307 61251 gene locus_tag LOCUS_02980 60307 61251 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330721.1 protein_id gnl|my_center|LOCUS_02980 61254 61865 gene locus_tag LOCUS_02990 61254 61865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 61858 63339 gene locus_tag LOCUS_03000 61858 63339 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119386.1 protein_id gnl|my_center|LOCUS_03000 63343 64317 gene locus_tag LOCUS_03010 63343 64317 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330724.1 protein_id gnl|my_center|LOCUS_03010 64345 65742 gene locus_tag LOCUS_03020 64345 65742 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189567636.1 protein_id gnl|my_center|LOCUS_03020 66277 65750 gene locus_tag LOCUS_03030 66277 65750 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_03030 66400 69315 gene locus_tag LOCUS_03040 66400 69315 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108444.1 protein_id gnl|my_center|LOCUS_03040 70684 69302 gene locus_tag LOCUS_03050 70684 69302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 70739 72220 gene locus_tag LOCUS_03060 gene glpK 70739 72220 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080610.1 protein_id gnl|my_center|LOCUS_03060 72233 73657 gene locus_tag LOCUS_03070 72233 73657 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_03070 73670 75007 gene locus_tag LOCUS_03080 73670 75007 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102238.1 protein_id gnl|my_center|LOCUS_03080 74991 77048 gene locus_tag LOCUS_03090 74991 77048 CDS product alpha-L-rhamnosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695108.1 protein_id gnl|my_center|LOCUS_03090 79497 77029 gene locus_tag LOCUS_03100 79497 77029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 81114 79498 gene locus_tag LOCUS_03110 81114 79498 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_03110 82177 81119 gene locus_tag LOCUS_03120 gene prfB 82177 81119 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_03120 82956 82207 gene locus_tag LOCUS_03130 gene murI 82956 82207 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_03130 84368 82974 gene locus_tag LOCUS_03140 84368 82974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 84274 84585 gene locus_tag LOCUS_03150 84274 84585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 85943 84675 gene locus_tag LOCUS_03160 85943 84675 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_03160 87222 85930 gene locus_tag LOCUS_03170 87222 85930 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_03170 89317 87224 gene locus_tag LOCUS_03180 89317 87224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 89886 89317 gene locus_tag LOCUS_03190 89886 89317 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_03190 90836 89883 gene locus_tag LOCUS_03200 90836 89883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 90945 91019 gene locus_tag LOCUS_t00050 90945 91019 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 91106 91333 gene locus_tag LOCUS_03210 91106 91333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 91500 91351 gene locus_tag LOCUS_03220 91500 91351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 93696 91810 gene locus_tag LOCUS_03230 93696 91810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 94058 93699 gene locus_tag LOCUS_03240 94058 93699 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769502.1 protein_id gnl|my_center|LOCUS_03240 94161 94991 gene locus_tag LOCUS_03250 94161 94991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 94984 96546 gene locus_tag LOCUS_03260 94984 96546 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107578.1 protein_id gnl|my_center|LOCUS_03260 97520 96549 gene locus_tag LOCUS_03270 97520 96549 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_03270 97605 98522 gene locus_tag LOCUS_03280 97605 98522 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_03280 98539 99678 gene locus_tag LOCUS_03290 gene zinU 98539 99678 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_03290 99837 100112 gene locus_tag LOCUS_03300 99837 100112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 100117 101193 gene locus_tag LOCUS_03310 100117 101193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 101216 102292 gene locus_tag LOCUS_03320 101216 102292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 103323 102283 gene locus_tag LOCUS_03330 103323 102283 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_03330 104509 103361 gene locus_tag LOCUS_03340 104509 103361 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_03340 104574 106610 gene locus_tag LOCUS_03350 104574 106610 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_03350 107197 106607 gene locus_tag LOCUS_03360 107197 106607 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186915.1 protein_id gnl|my_center|LOCUS_03360 108225 107194 gene locus_tag LOCUS_03370 108225 107194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 109592 108225 gene locus_tag LOCUS_03380 109592 108225 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_03380 110148 109594 gene locus_tag LOCUS_03390 gene def 110148 109594 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_03390 110558 110145 gene locus_tag LOCUS_03400 gene ruvX 110558 110145 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_03400 110585 111436 gene locus_tag LOCUS_03410 110585 111436 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_03410 111436 112584 gene locus_tag LOCUS_03420 111436 112584 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_03420 112588 113889 gene locus_tag LOCUS_03430 gene rseP 112588 113889 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_03430 113902 114882 gene locus_tag LOCUS_03440 113902 114882 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_03440 114953 115027 gene locus_tag LOCUS_t00060 114953 115027 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 115049 115303 gene locus_tag LOCUS_03450 gene rpsT 115049 115303 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_03450 115319 115393 gene locus_tag LOCUS_t00070 115319 115393 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 115534 116898 gene locus_tag LOCUS_03460 115534 116898 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762675.1 protein_id gnl|my_center|LOCUS_03460 116911 117945 gene locus_tag LOCUS_03470 116911 117945 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107936.1 protein_id gnl|my_center|LOCUS_03470 119635 118292 gene locus_tag LOCUS_03480 gene gdhA 119635 118292 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_03480 120685 119666 gene locus_tag LOCUS_03490 120685 119666 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_03490 122467 120689 gene locus_tag LOCUS_03500 122467 120689 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_03500 123113 122556 gene locus_tag LOCUS_03510 123113 122556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 125726 123141 gene locus_tag LOCUS_03520 125726 123141 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_03520 126432 125752 gene locus_tag LOCUS_03530 126432 125752 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839293.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03530 127256 126429 gene locus_tag LOCUS_03540 127256 126429 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_03540 127302 128039 gene locus_tag LOCUS_03550 127302 128039 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_03550 128086 128712 gene locus_tag LOCUS_03560 128086 128712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 128709 129971 gene locus_tag LOCUS_03570 128709 129971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 129978 130898 gene locus_tag LOCUS_03580 gene trxB 129978 130898 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_03580 130895 131689 gene locus_tag LOCUS_03590 130895 131689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 131726 132046 gene locus_tag LOCUS_03600 131726 132046 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_03600 132062 133723 gene locus_tag LOCUS_03610 gene recN 132062 133723 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_03610 133781 134434 gene locus_tag LOCUS_03620 gene upp 133781 134434 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_03620 135835 134429 gene locus_tag LOCUS_03630 gene rpoN 135835 134429 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_03630 136393 135836 gene locus_tag LOCUS_03640 136393 135836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 136859 136395 gene locus_tag LOCUS_03650 136859 136395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 136881 138206 gene locus_tag LOCUS_03660 gene miaB 136881 138206 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_03660 138265 138340 gene locus_tag LOCUS_t00080 138265 138340 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 139568 138630 gene locus_tag LOCUS_03670 139568 138630 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223913.1 protein_id gnl|my_center|LOCUS_03670 139654 140340 gene locus_tag LOCUS_03680 gene radC 139654 140340 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_03680 142131 140347 gene locus_tag LOCUS_03690 142131 140347 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794777.1 protein_id gnl|my_center|LOCUS_03690 142276 142728 gene locus_tag LOCUS_03700 gene mraZ 142276 142728 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_03700 142740 143645 gene locus_tag LOCUS_03710 gene rsmH 142740 143645 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172605046.1 protein_id gnl|my_center|LOCUS_03710 143649 144011 gene locus_tag LOCUS_03720 143649 144011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 144013 145854 gene locus_tag LOCUS_03730 144013 145854 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_03730 145851 147251 gene locus_tag LOCUS_03740 145851 147251 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_03740 147265 148419 gene locus_tag LOCUS_03750 gene mraY 147265 148419 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_03750 148434 149780 gene locus_tag LOCUS_03760 gene murD 148434 149780 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_03760 149782 151131 gene locus_tag LOCUS_03770 149782 151131 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_03770 151136 152260 gene locus_tag LOCUS_03780 gene murG 151136 152260 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_03780 152257 153615 gene locus_tag LOCUS_03790 gene murC 152257 153615 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763710.1 protein_id gnl|my_center|LOCUS_03790 153615 154349 gene locus_tag LOCUS_03800 153615 154349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 154331 155779 gene locus_tag LOCUS_03810 154331 155779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 155789 157024 gene locus_tag LOCUS_03820 155789 157024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 157021 158646 gene locus_tag LOCUS_03830 gene gltX 157021 158646 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_03830 159459 158638 gene locus_tag LOCUS_03840 gene truB 159459 158638 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_03840 159891 159460 gene locus_tag LOCUS_03850 gene rpiB 159891 159460 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_03850 159989 161503 gene locus_tag LOCUS_03860 159989 161503 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_03860 161508 162692 gene locus_tag LOCUS_03870 161508 162692 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760990.1 protein_id gnl|my_center|LOCUS_03870 162721 163527 gene locus_tag LOCUS_03880 162721 163527 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762840.1 protein_id gnl|my_center|LOCUS_03880 163540 164385 gene locus_tag LOCUS_03890 gene kduI 163540 164385 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201855.1 protein_id gnl|my_center|LOCUS_03890 164385 165254 gene locus_tag LOCUS_03900 164385 165254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 165254 167341 gene locus_tag LOCUS_03910 165254 167341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 168597 167338 gene locus_tag LOCUS_03920 168597 167338 CDS product phage integrase SAM-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108551.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence03 381 722 gene locus_tag LOCUS_03930 381 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 722 1051 gene locus_tag LOCUS_03940 722 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 1090 1596 gene locus_tag LOCUS_03950 1090 1596 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_03950 1634 2872 gene locus_tag LOCUS_03960 1634 2872 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_03960 3759 2869 gene locus_tag LOCUS_03970 3759 2869 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769713.1 protein_id gnl|my_center|LOCUS_03970 3843 5252 gene locus_tag LOCUS_03980 3843 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5327 6106 gene locus_tag LOCUS_03990 5327 6106 CDS product YhfC family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674858.1 protein_id gnl|my_center|LOCUS_03990 6501 6082 gene locus_tag LOCUS_04000 6501 6082 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_04000 7823 6516 gene locus_tag LOCUS_04010 7823 6516 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786583.1 protein_id gnl|my_center|LOCUS_04010 8163 7834 gene locus_tag LOCUS_04020 8163 7834 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809294.1 protein_id gnl|my_center|LOCUS_04020 8530 8165 gene locus_tag LOCUS_04030 8530 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10108 8534 gene locus_tag LOCUS_04040 10108 8534 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_04040 10174 10881 gene locus_tag LOCUS_04050 gene deoD 10174 10881 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_04050 10905 11906 gene locus_tag LOCUS_04060 gene trpS 10905 11906 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_04060 11903 12682 gene locus_tag LOCUS_04070 11903 12682 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_04070 14529 12679 gene locus_tag LOCUS_04080 14529 12679 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555875.1 protein_id gnl|my_center|LOCUS_04080 14631 15458 gene locus_tag LOCUS_04090 14631 15458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 15506 16468 gene locus_tag LOCUS_04100 15506 16468 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_04100 17133 16465 gene locus_tag LOCUS_04110 gene folP 17133 16465 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_04110 18443 17160 gene locus_tag LOCUS_04120 gene tilS 18443 17160 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_04120 19450 18440 gene locus_tag LOCUS_04130 19450 18440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 20941 19463 gene locus_tag LOCUS_04140 gene proS 20941 19463 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_04140 21073 22242 gene locus_tag LOCUS_04150 21073 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 22288 23961 gene locus_tag LOCUS_04160 22288 23961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 23964 24950 gene locus_tag LOCUS_04170 gene lpxD 23964 24950 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_04170 24994 25890 gene locus_tag LOCUS_04180 24994 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 25897 26709 gene locus_tag LOCUS_04190 gene lpxA 25897 26709 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_04190 26709 27311 gene locus_tag LOCUS_04200 26709 27311 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_04200 27381 27659 gene locus_tag LOCUS_04210 27381 27659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 27661 28926 gene locus_tag LOCUS_04220 gene nusA 27661 28926 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_04220 28946 31702 gene locus_tag LOCUS_04230 28946 31702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 32110 31712 gene locus_tag LOCUS_04240 gene rnhA 32110 31712 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_04240 32144 32216 gene locus_tag LOCUS_t00090 32144 32216 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 33446 32262 gene locus_tag LOCUS_04250 33446 32262 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_04250 34872 33448 gene locus_tag LOCUS_04260 34872 33448 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_04260 35343 35870 gene locus_tag LOCUS_04270 35343 35870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 35860 36093 gene locus_tag LOCUS_04280 35860 36093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 36349 37458 gene locus_tag LOCUS_04290 36349 37458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 39544 39110 gene locus_tag LOCUS_04300 39544 39110 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784733.1 protein_id gnl|my_center|LOCUS_04300 39603 42203 gene locus_tag LOCUS_04310 gene polA 39603 42203 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_04310 42175 42765 gene locus_tag LOCUS_04320 42175 42765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 42755 43369 gene locus_tag LOCUS_04330 gene rsmG 42755 43369 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_04330 43382 43534 gene locus_tag LOCUS_04340 gene rpmH 43382 43534 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_04340 44980 43583 gene locus_tag LOCUS_04350 44980 43583 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_04350 46245 45202 gene locus_tag LOCUS_04360 46245 45202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 47787 46669 gene locus_tag LOCUS_04370 47787 46669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 50591 47814 gene locus_tag LOCUS_04380 50591 47814 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_04380 53422 50588 gene locus_tag LOCUS_04390 53422 50588 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_04390 53879 53427 gene locus_tag LOCUS_04400 53879 53427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 56233 53876 gene locus_tag LOCUS_04410 56233 53876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 56898 56230 gene locus_tag LOCUS_04420 56898 56230 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761105.1 protein_id gnl|my_center|LOCUS_04420 56964 57845 gene locus_tag LOCUS_04430 56964 57845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 57842 58291 gene locus_tag LOCUS_04440 57842 58291 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_04440 58288 58554 gene locus_tag LOCUS_04450 58288 58554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 58595 60196 gene locus_tag LOCUS_04460 58595 60196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_04460 60697 60164 gene locus_tag LOCUS_04470 60697 60164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 61712 60702 gene locus_tag LOCUS_04480 61712 60702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 61790 62740 gene locus_tag LOCUS_04490 61790 62740 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_04490 63791 62724 gene locus_tag LOCUS_04500 63791 62724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 63853 65067 gene locus_tag LOCUS_04510 63853 65067 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_04510 66335 65064 gene locus_tag LOCUS_04520 66335 65064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 66931 66314 gene locus_tag LOCUS_04530 66931 66314 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_04530 68333 66936 gene locus_tag LOCUS_04540 68333 66936 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_04540 69329 68337 gene locus_tag LOCUS_04550 69329 68337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 70418 69387 gene locus_tag LOCUS_04560 70418 69387 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760868.1 protein_id gnl|my_center|LOCUS_04560 70533 71201 gene locus_tag LOCUS_04570 70533 71201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_04570 71207 71731 gene locus_tag LOCUS_04580 71207 71731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 71733 72275 gene locus_tag LOCUS_04590 71733 72275 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_04590 73063 72272 gene locus_tag LOCUS_04600 gene mazG 73063 72272 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109215.1 protein_id gnl|my_center|LOCUS_04600 73112 74413 gene locus_tag LOCUS_04610 73112 74413 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_04610 74410 75138 gene locus_tag LOCUS_04620 74410 75138 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_04620 75144 76292 gene locus_tag LOCUS_04630 75144 76292 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_04630 76285 77373 gene locus_tag LOCUS_04640 gene prfA 76285 77373 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_04640 78606 77374 gene locus_tag LOCUS_04650 gene fabF 78606 77374 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_04650 78695 79582 gene locus_tag LOCUS_04660 78695 79582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 79608 80000 gene locus_tag LOCUS_04670 79608 80000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 79997 80878 gene locus_tag LOCUS_04680 79997 80878 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_04680 81834 80881 gene locus_tag LOCUS_04690 81834 80881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 82366 81836 gene locus_tag LOCUS_04700 82366 81836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 82479 85007 gene locus_tag LOCUS_04710 gene gyrA 82479 85007 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_04710 85034 86338 gene locus_tag LOCUS_04720 85034 86338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 87423 86332 gene locus_tag LOCUS_04730 87423 86332 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_04730 87537 88094 gene locus_tag LOCUS_04740 87537 88094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 88094 89413 gene locus_tag LOCUS_04750 88094 89413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 89415 92150 gene locus_tag LOCUS_04760 gene leuS 89415 92150 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_04760 92147 93073 gene locus_tag LOCUS_04770 92147 93073 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108649.1 protein_id gnl|my_center|LOCUS_04770 93057 94013 gene locus_tag LOCUS_04780 93057 94013 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_04780 94120 95055 gene locus_tag LOCUS_04790 94120 95055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 95752 95039 gene locus_tag LOCUS_04800 95752 95039 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_04800 95899 97821 gene locus_tag LOCUS_04810 gene dnaK 95899 97821 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_04810 97834 98385 gene locus_tag LOCUS_04820 97834 98385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 98487 99569 gene locus_tag LOCUS_04830 98487 99569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 100646 99645 gene locus_tag LOCUS_04840 100646 99645 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_04840 100722 101288 gene locus_tag LOCUS_04850 gene gmk 100722 101288 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_04850 101285 101842 gene locus_tag LOCUS_04860 gene nadD 101285 101842 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_04860 104733 101848 gene locus_tag LOCUS_04870 104733 101848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 105912 104959 gene locus_tag LOCUS_04880 gene corA 105912 104959 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943935.1 protein_id gnl|my_center|LOCUS_04880 106652 106029 gene locus_tag LOCUS_04890 gene recR 106652 106029 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_04890 106716 109004 gene locus_tag LOCUS_04900 106716 109004 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_04900 109008 109556 gene locus_tag LOCUS_04910 109008 109556 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_04910 109553 110599 gene locus_tag LOCUS_04920 109553 110599 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_04920 110606 113566 gene locus_tag LOCUS_04930 110606 113566 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108778.1 protein_id gnl|my_center|LOCUS_04930 113690 115906 gene locus_tag LOCUS_04940 gene rpsA 113690 115906 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_04940 115910 116704 gene locus_tag LOCUS_04950 115910 116704 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_04950 116718 117638 gene locus_tag LOCUS_04960 116718 117638 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_04960 117638 118669 gene locus_tag LOCUS_04970 gene mltG 117638 118669 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_04970 120488 118611 gene locus_tag LOCUS_04980 120488 118611 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_04980 121362 120592 gene locus_tag LOCUS_04990 121362 120592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 122389 121841 gene locus_tag LOCUS_05000 122389 121841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 123110 122544 gene locus_tag LOCUS_05010 123110 122544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 123603 123142 gene locus_tag LOCUS_05020 123603 123142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 125854 124358 gene locus_tag LOCUS_05030 125854 124358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 128195 126051 gene locus_tag LOCUS_05040 gene uvrB 128195 126051 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_05040 128230 129342 gene locus_tag LOCUS_05050 128230 129342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 129345 130775 gene locus_tag LOCUS_05060 129345 130775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 131738 130779 gene locus_tag LOCUS_05070 131738 130779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 133218 131740 gene locus_tag LOCUS_05080 gene guaB 133218 131740 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_05080 135343 133238 gene locus_tag LOCUS_05090 135343 133238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 136874 135345 gene locus_tag LOCUS_05100 gene purH 136874 135345 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548356.1 protein_id gnl|my_center|LOCUS_05100 137440 136871 gene locus_tag LOCUS_05110 gene purN 137440 136871 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088592.1 protein_id gnl|my_center|LOCUS_05110 138462 137437 gene locus_tag LOCUS_05120 gene purM 138462 137437 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_05120 139827 138469 gene locus_tag LOCUS_05130 gene purF 139827 138469 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989807.1 protein_id gnl|my_center|LOCUS_05130 140550 139828 gene locus_tag LOCUS_05140 140550 139828 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_05140 144276 140551 gene locus_tag LOCUS_05150 144276 140551 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836287.1 protein_id gnl|my_center|LOCUS_05150 144745 144278 gene locus_tag LOCUS_05160 gene purE 144745 144278 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303771.1 protein_id gnl|my_center|LOCUS_05160 145446 144751 gene locus_tag LOCUS_05170 145446 144751 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426355.1 protein_id gnl|my_center|LOCUS_05170 145533 146825 gene locus_tag LOCUS_05180 gene pyrC 145533 146825 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_05180 146822 147568 gene locus_tag LOCUS_05190 146822 147568 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_05190 147562 148467 gene locus_tag LOCUS_05200 147562 148467 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_05200 148464 149165 gene locus_tag LOCUS_05210 gene pyrF 148464 149165 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263220.1 protein_id gnl|my_center|LOCUS_05210 149174 149794 gene locus_tag LOCUS_05220 gene pyrE 149174 149794 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711440.1 protein_id gnl|my_center|LOCUS_05220 149808 150887 gene locus_tag LOCUS_05230 gene pyrB 149808 150887 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_05230 150910 152235 gene locus_tag LOCUS_05240 150910 152235 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618921.1 protein_id gnl|my_center|LOCUS_05240 152232 152774 gene locus_tag LOCUS_05250 152232 152774 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201864.1 protein_id gnl|my_center|LOCUS_05250 152790 153488 gene locus_tag LOCUS_05260 152790 153488 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_05260 153500 154825 gene locus_tag LOCUS_05270 153500 154825 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_05270 156696 154837 gene locus_tag LOCUS_05280 gene htpG 156696 154837 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_05280 156797 158164 gene locus_tag LOCUS_05290 156797 158164 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_05290 158166 159011 gene locus_tag LOCUS_05300 158166 159011 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_05300 160245 158986 gene locus_tag LOCUS_05310 160245 158986 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615837.1 protein_id gnl|my_center|LOCUS_05310 160890 160252 gene locus_tag LOCUS_05320 160890 160252 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085692.1 protein_id gnl|my_center|LOCUS_05320 161521 160940 gene locus_tag LOCUS_05330 161521 160940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 162133 161534 gene locus_tag LOCUS_05340 162133 161534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 163857 162211 gene locus_tag LOCUS_05350 163857 162211 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_05350 163985 164809 gene locus_tag LOCUS_05360 163985 164809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 165424 164813 gene locus_tag LOCUS_05370 gene folE 165424 164813 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062927.1 protein_id gnl|my_center|LOCUS_05370 165489 165710 gene locus_tag LOCUS_05380 165489 165710 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence04 1781 624 gene locus_tag LOCUS_05390 1781 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3211 1874 gene locus_tag LOCUS_05400 3211 1874 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_05400 3346 3876 gene locus_tag LOCUS_05410 gene yihA 3346 3876 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_05410 3896 4864 gene locus_tag LOCUS_05420 3896 4864 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_05420 4869 5099 gene locus_tag LOCUS_05430 4869 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 5096 6403 gene locus_tag LOCUS_05440 gene der 5096 6403 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_05440 6428 7108 gene locus_tag LOCUS_05450 gene cmk 6428 7108 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_05450 7105 8037 gene locus_tag LOCUS_05460 7105 8037 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_05460 8055 8621 gene locus_tag LOCUS_05470 gene efp 8055 8621 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_05470 9025 8624 gene locus_tag LOCUS_05480 9025 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 9076 9549 gene locus_tag LOCUS_05490 gene rlmH 9076 9549 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_05490 9576 13061 gene locus_tag LOCUS_05500 9576 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 13084 14235 gene locus_tag LOCUS_05510 13084 14235 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_05510 14989 14177 gene locus_tag LOCUS_05520 gene lptB 14989 14177 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_05520 16760 14997 gene locus_tag LOCUS_05530 16760 14997 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_05530 16820 17425 gene locus_tag LOCUS_05540 16820 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 17406 18047 gene locus_tag LOCUS_05550 17406 18047 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_05550 20813 18051 gene locus_tag LOCUS_05560 20813 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 23552 20835 gene locus_tag LOCUS_05570 23552 20835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 26938 23612 gene locus_tag LOCUS_05580 26938 23612 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765809.1 protein_id gnl|my_center|LOCUS_05580 29108 26949 gene locus_tag LOCUS_05590 gene metG 29108 26949 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_05590 31105 29105 gene locus_tag LOCUS_05600 gene dnaG 31105 29105 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_05600 33312 31102 gene locus_tag LOCUS_05610 gene recQ 33312 31102 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_05610 34563 33322 gene locus_tag LOCUS_05620 34563 33322 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_05620 35484 34567 gene locus_tag LOCUS_05630 35484 34567 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_05630 36554 35481 gene locus_tag LOCUS_05640 gene serC 36554 35481 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_05640 37182 36559 gene locus_tag LOCUS_05650 37182 36559 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002255036.1 protein_id gnl|my_center|LOCUS_05650 37332 37769 gene locus_tag LOCUS_05660 37332 37769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 38756 37992 gene locus_tag LOCUS_05670 38756 37992 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212827.1 protein_id gnl|my_center|LOCUS_05670 39752 38787 gene locus_tag LOCUS_05680 39752 38787 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_05680 41667 39754 gene locus_tag LOCUS_05690 41667 39754 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_05690 42304 41669 gene locus_tag LOCUS_05700 42304 41669 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_05700 42972 42337 gene locus_tag LOCUS_05710 42972 42337 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_05710 43022 43693 gene locus_tag LOCUS_05720 43022 43693 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048078.1 protein_id gnl|my_center|LOCUS_05720 43686 46589 gene locus_tag LOCUS_05730 gene uvrA 43686 46589 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405104.1 protein_id gnl|my_center|LOCUS_05730 46586 47584 gene locus_tag LOCUS_05740 46586 47584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 47597 48448 gene locus_tag LOCUS_05750 47597 48448 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_05750 49087 48437 gene locus_tag LOCUS_05760 gene recO 49087 48437 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783992.1 protein_id gnl|my_center|LOCUS_05760 49680 49084 gene locus_tag LOCUS_05770 49680 49084 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_05770 51263 49677 gene locus_tag LOCUS_05780 51263 49677 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_05780 52513 51275 gene locus_tag LOCUS_05790 52513 51275 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_05790 53507 52527 gene locus_tag LOCUS_05800 53507 52527 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203421.1 protein_id gnl|my_center|LOCUS_05800 54468 53527 gene locus_tag LOCUS_05810 gene rsgA 54468 53527 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_05810 54517 55866 gene locus_tag LOCUS_05820 54517 55866 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_05820 55874 57937 gene locus_tag LOCUS_05830 gene rnr 55874 57937 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_05830 57937 58998 gene locus_tag LOCUS_05840 57937 58998 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_05840 59320 59120 gene locus_tag LOCUS_05850 59320 59120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 60570 60217 gene locus_tag LOCUS_05860 60570 60217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 60715 63582 gene locus_tag LOCUS_05870 60715 63582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 63961 63566 gene locus_tag LOCUS_05880 63961 63566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 66194 64695 gene locus_tag LOCUS_05890 gene gpmI 66194 64695 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_05890 68224 66248 gene locus_tag LOCUS_05900 68224 66248 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_05900 69334 68228 gene locus_tag LOCUS_05910 69334 68228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 72185 69339 gene locus_tag LOCUS_05920 72185 69339 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_05920 73292 72192 gene locus_tag LOCUS_05930 73292 72192 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_05930 74578 73274 gene locus_tag LOCUS_05940 74578 73274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 76915 74582 gene locus_tag LOCUS_05950 76915 74582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 82595 77085 gene locus_tag LOCUS_05960 82595 77085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 85883 82608 gene locus_tag LOCUS_05970 85883 82608 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_05970 89451 86167 gene locus_tag LOCUS_05980 89451 86167 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_05980 90971 89634 gene locus_tag LOCUS_05990 90971 89634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 91131 90985 gene locus_tag LOCUS_06000 91131 90985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 91362 92591 gene locus_tag LOCUS_06010 gene metK 91362 92591 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_06010 93378 92581 gene locus_tag LOCUS_06020 gene miaA 93378 92581 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_06020 93445 93891 gene locus_tag LOCUS_06030 gene smpB 93445 93891 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760495.1 protein_id gnl|my_center|LOCUS_06030 94578 93886 gene locus_tag LOCUS_06040 gene trmB 94578 93886 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_06040 94996 94556 gene locus_tag LOCUS_06050 94996 94556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 96168 94993 gene locus_tag LOCUS_06060 96168 94993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 97172 96171 gene locus_tag LOCUS_06070 97172 96171 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_06070 98137 97169 gene locus_tag LOCUS_06080 98137 97169 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_06080 98670 98137 gene locus_tag LOCUS_06090 98670 98137 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_06090 99286 98675 gene locus_tag LOCUS_06100 99286 98675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 99612 99298 gene locus_tag LOCUS_06110 gene trxA 99612 99298 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_06110 99922 99629 gene locus_tag LOCUS_06120 99922 99629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762066.1 protein_id gnl|my_center|LOCUS_06120 103026 99919 gene locus_tag LOCUS_06130 103026 99919 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_06130 104045 103026 gene locus_tag LOCUS_06140 104045 103026 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_06140 105469 104054 gene locus_tag LOCUS_06150 105469 104054 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791600.1 protein_id gnl|my_center|LOCUS_06150 105583 106464 gene locus_tag LOCUS_06160 gene lgt 105583 106464 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_06160 107724 106471 gene locus_tag LOCUS_06170 107724 106471 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence05 851 408 gene locus_tag LOCUS_06180 851 408 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_06180 2257 1055 gene locus_tag LOCUS_06190 2257 1055 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_06190 2335 3156 gene locus_tag LOCUS_06200 2335 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3153 4607 gene locus_tag LOCUS_06210 3153 4607 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_06210 4604 6040 gene locus_tag LOCUS_06220 4604 6040 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_06220 6037 7830 gene locus_tag LOCUS_06230 6037 7830 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_06230 7952 8578 gene locus_tag LOCUS_06240 7952 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 9077 8910 gene locus_tag LOCUS_06250 9077 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 9250 10899 gene locus_tag LOCUS_06260 9250 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12082 11252 gene locus_tag LOCUS_06270 12082 11252 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 protein_id gnl|my_center|LOCUS_06270 12755 12084 gene locus_tag LOCUS_06280 12755 12084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 13528 12941 gene locus_tag LOCUS_06290 13528 12941 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_06290 14055 13528 gene locus_tag LOCUS_06300 14055 13528 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_06300 14350 14039 gene locus_tag LOCUS_06310 14350 14039 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_06310 14422 16074 gene locus_tag LOCUS_06320 14422 16074 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_06320 16078 18717 gene locus_tag LOCUS_06330 16078 18717 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801208.1 protein_id gnl|my_center|LOCUS_06330 18719 19120 gene locus_tag LOCUS_06340 18719 19120 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_06340 19107 21023 gene locus_tag LOCUS_06350 19107 21023 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_06350 22404 21133 gene locus_tag LOCUS_06360 22404 21133 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_06360 23204 22401 gene locus_tag LOCUS_06370 23204 22401 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202764.1 protein_id gnl|my_center|LOCUS_06370 23678 23205 gene locus_tag LOCUS_06380 23678 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 24151 25371 gene locus_tag LOCUS_06390 24151 25371 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203495.1 protein_id gnl|my_center|LOCUS_06390 25368 26519 gene locus_tag LOCUS_06400 25368 26519 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_06400 27865 26516 gene locus_tag LOCUS_06410 27865 26516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 29491 27878 gene locus_tag LOCUS_06420 29491 27878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 30534 29503 gene locus_tag LOCUS_06430 30534 29503 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_06430 30662 30988 gene locus_tag LOCUS_06440 30662 30988 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815797.1 protein_id gnl|my_center|LOCUS_06440 32102 31860 gene locus_tag LOCUS_06450 32102 31860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 33782 32718 gene locus_tag LOCUS_06460 33782 32718 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_06460 34212 33892 gene locus_tag LOCUS_06470 34212 33892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 34319 35857 gene locus_tag LOCUS_06480 34319 35857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 35854 37110 gene locus_tag LOCUS_06490 35854 37110 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_06490 37176 38579 gene locus_tag LOCUS_06500 gene rlmD 37176 38579 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_06500 38576 39535 gene locus_tag LOCUS_06510 38576 39535 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_06510 40152 39550 gene locus_tag LOCUS_06520 40152 39550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 40232 41746 gene locus_tag LOCUS_06530 40232 41746 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787423.1 protein_id gnl|my_center|LOCUS_06530 42351 41743 gene locus_tag LOCUS_06540 42351 41743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 42923 42348 gene locus_tag LOCUS_06550 42923 42348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 43102 44361 gene locus_tag LOCUS_06560 43102 44361 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_06560 46578 44362 gene locus_tag LOCUS_06570 46578 44362 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107463.1 protein_id gnl|my_center|LOCUS_06570 46625 47335 gene locus_tag LOCUS_06580 46625 47335 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_06580 47337 48599 gene locus_tag LOCUS_06590 47337 48599 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_06590 48690 50327 gene locus_tag LOCUS_06600 48690 50327 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_06600 50331 52400 gene locus_tag LOCUS_06610 gene ligA 50331 52400 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_06610 52405 53361 gene locus_tag LOCUS_06620 52405 53361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 53358 55547 gene locus_tag LOCUS_06630 53358 55547 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_06630 55547 57343 gene locus_tag LOCUS_06640 55547 57343 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_06640 57347 58195 gene locus_tag LOCUS_06650 57347 58195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 58167 59402 gene locus_tag LOCUS_06660 58167 59402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 60587 59403 gene locus_tag LOCUS_06670 60587 59403 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_06670 61215 60580 gene locus_tag LOCUS_06680 61215 60580 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_06680 62373 61216 gene locus_tag LOCUS_06690 62373 61216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 62444 63643 gene locus_tag LOCUS_06700 62444 63643 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_06700 63644 64366 gene locus_tag LOCUS_06710 gene pssA 63644 64366 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_06710 65737 64370 gene locus_tag LOCUS_06720 65737 64370 CDS product putative oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_06720 65866 65941 gene locus_tag LOCUS_t00100 65866 65941 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 68028 67312 gene locus_tag LOCUS_06730 68028 67312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 68286 69551 gene locus_tag LOCUS_06740 68286 69551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 69838 69548 gene locus_tag LOCUS_06750 69838 69548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 69971 70666 gene locus_tag LOCUS_06760 69971 70666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 70701 71357 gene locus_tag LOCUS_06770 70701 71357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 71317 72732 gene locus_tag LOCUS_06780 71317 72732 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203207.1 protein_id gnl|my_center|LOCUS_06780 72757 73500 gene locus_tag LOCUS_06790 72757 73500 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_06790 73984 73508 gene locus_tag LOCUS_06800 73984 73508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 74608 74138 gene locus_tag LOCUS_06810 gene cdd 74608 74138 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_06810 74661 75926 gene locus_tag LOCUS_06820 gene mnmA 74661 75926 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_06820 75923 77470 gene locus_tag LOCUS_06830 75923 77470 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_06830 78840 77452 gene locus_tag LOCUS_06840 78840 77452 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_06840 80285 78837 gene locus_tag LOCUS_06850 80285 78837 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_06850 81333 80311 gene locus_tag LOCUS_06860 gene tsaD 81333 80311 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_06860 81636 81355 gene locus_tag LOCUS_06870 81636 81355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 81559 81948 gene locus_tag LOCUS_06880 81559 81948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence06 1536 127 gene locus_tag LOCUS_06890 gene mnmE 1536 127 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_06890 2733 1546 gene locus_tag LOCUS_06900 gene pncB 2733 1546 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766265.1 protein_id gnl|my_center|LOCUS_06900 4558 2747 gene locus_tag LOCUS_06910 4558 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 7269 4639 gene locus_tag LOCUS_06920 7269 4639 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_06920 7375 8538 gene locus_tag LOCUS_06930 7375 8538 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_06930 8819 10246 gene locus_tag LOCUS_06940 gene dnaA 8819 10246 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_06940 10259 10909 gene locus_tag LOCUS_06950 gene rpe 10259 10909 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_06950 11507 10896 gene locus_tag LOCUS_06960 11507 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 11560 13476 gene locus_tag LOCUS_06970 gene ftsH 11560 13476 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695721.1 protein_id gnl|my_center|LOCUS_06970 13469 14302 gene locus_tag LOCUS_06980 13469 14302 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764240.1 protein_id gnl|my_center|LOCUS_06980 14303 14956 gene locus_tag LOCUS_06990 14303 14956 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_06990 14953 15474 gene locus_tag LOCUS_07000 14953 15474 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765257.1 protein_id gnl|my_center|LOCUS_07000 15520 17340 gene locus_tag LOCUS_07010 gene fucI 15520 17340 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_07010 17347 18006 gene locus_tag LOCUS_07020 17347 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18031 19161 gene locus_tag LOCUS_07030 gene tgt 18031 19161 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_07030 19165 20256 gene locus_tag LOCUS_07040 19165 20256 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_07040 20264 20695 gene locus_tag LOCUS_07050 gene dut 20264 20695 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964537.1 protein_id gnl|my_center|LOCUS_07050 20692 21993 gene locus_tag LOCUS_07060 20692 21993 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_07060 22593 21988 gene locus_tag LOCUS_07070 22593 21988 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_07070 23564 22572 gene locus_tag LOCUS_07080 gene obgE 23564 22572 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_07080 23867 23712 gene locus_tag LOCUS_07090 23867 23712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 26561 25158 gene locus_tag LOCUS_07100 gene aspA 26561 25158 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_07100 26659 26817 gene locus_tag LOCUS_07110 26659 26817 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_07110 26890 28173 gene locus_tag LOCUS_07120 26890 28173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_07120 28204 29421 gene locus_tag LOCUS_07130 28204 29421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 29449 31248 gene locus_tag LOCUS_07140 29449 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 31308 32801 gene locus_tag LOCUS_07150 31308 32801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 33404 32826 gene locus_tag LOCUS_07160 33404 32826 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_07160 33943 33401 gene locus_tag LOCUS_07170 gene hpt 33943 33401 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 protein_id gnl|my_center|LOCUS_07170 34058 35659 gene locus_tag LOCUS_07180 34058 35659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 36581 35628 gene locus_tag LOCUS_07190 36581 35628 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_07190 36637 37419 gene locus_tag LOCUS_07200 36637 37419 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_07200 37444 38346 gene locus_tag LOCUS_07210 37444 38346 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_07210 38348 39271 gene locus_tag LOCUS_07220 38348 39271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 39274 40944 gene locus_tag LOCUS_07230 39274 40944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 41370 40948 gene locus_tag LOCUS_07240 41370 40948 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_07240 43127 41394 gene locus_tag LOCUS_07250 43127 41394 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_07250 43735 43124 gene locus_tag LOCUS_07260 43735 43124 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_07260 45059 43740 gene locus_tag LOCUS_07270 45059 43740 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_07270 46803 45049 gene locus_tag LOCUS_07280 46803 45049 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788434.1 protein_id gnl|my_center|LOCUS_07280 47382 46807 gene locus_tag LOCUS_07290 47382 46807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 47999 47394 gene locus_tag LOCUS_07300 47999 47394 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678965.1 protein_id gnl|my_center|LOCUS_07300 48129 49295 gene locus_tag LOCUS_07310 48129 49295 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014759708.1 protein_id gnl|my_center|LOCUS_07310 50460 49300 gene locus_tag LOCUS_07320 50460 49300 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_07320 50905 50471 gene locus_tag LOCUS_07330 50905 50471 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_07330 51315 50902 gene locus_tag LOCUS_07340 51315 50902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 52847 51312 gene locus_tag LOCUS_07350 52847 51312 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_07350 54411 52921 gene locus_tag LOCUS_07360 54411 52921 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_07360 55474 54440 gene locus_tag LOCUS_07370 gene pdxB 55474 54440 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201894.1 protein_id gnl|my_center|LOCUS_07370 55803 55471 gene locus_tag LOCUS_07380 55803 55471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 56908 55805 gene locus_tag LOCUS_07390 gene recF 56908 55805 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_07390 56997 57677 gene locus_tag LOCUS_07400 56997 57677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 57681 58430 gene locus_tag LOCUS_07410 57681 58430 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_07410 59034 58528 gene locus_tag LOCUS_07420 59034 58528 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202632.1 protein_id gnl|my_center|LOCUS_07420 59817 59056 gene locus_tag LOCUS_07430 59817 59056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 62957 61719 gene locus_tag LOCUS_07440 62957 61719 CDS product winged helix DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763966.1 protein_id gnl|my_center|LOCUS_07440 63551 62964 gene locus_tag LOCUS_07450 63551 62964 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_07450 63609 64916 gene locus_tag LOCUS_07460 63609 64916 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_07460 65992 64913 gene locus_tag LOCUS_07470 65992 64913 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_07470 66865 65999 gene locus_tag LOCUS_07480 66865 65999 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_07480 66993 67187 gene locus_tag LOCUS_07490 66993 67187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 67272 68003 gene locus_tag LOCUS_07500 67272 68003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 68275 69186 gene locus_tag LOCUS_07510 68275 69186 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence07 685 476 gene locus_tag LOCUS_07520 685 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1596 694 gene locus_tag LOCUS_07530 1596 694 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_07530 2067 1609 gene locus_tag LOCUS_07540 2067 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3245 2079 gene locus_tag LOCUS_07550 3245 2079 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066524.1 protein_id gnl|my_center|LOCUS_07550 3296 5023 gene locus_tag LOCUS_07560 3296 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 5571 4972 gene locus_tag LOCUS_07570 5571 4972 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810571.1 protein_id gnl|my_center|LOCUS_07570 6515 5568 gene locus_tag LOCUS_07580 6515 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 8968 6707 gene locus_tag LOCUS_07590 gene feoB 8968 6707 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_07590 9148 10515 gene locus_tag LOCUS_07600 gene radA 9148 10515 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_07600 11539 10517 gene locus_tag LOCUS_07610 gene galE 11539 10517 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_07610 11695 11612 gene locus_tag LOCUS_t00110 11695 11612 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13091 11754 gene locus_tag LOCUS_07620 13091 11754 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_07620 13248 13796 gene locus_tag LOCUS_07630 13248 13796 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962515.1 protein_id gnl|my_center|LOCUS_07630 13796 14275 gene locus_tag LOCUS_07640 13796 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 14943 14281 gene locus_tag LOCUS_07650 14943 14281 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_07650 15695 14946 gene locus_tag LOCUS_07660 gene ispE 15695 14946 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_07660 16285 15692 gene locus_tag LOCUS_07670 16285 15692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 17027 16278 gene locus_tag LOCUS_07680 gene sufC 17027 16278 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_07680 18486 17038 gene locus_tag LOCUS_07690 gene sufB 18486 17038 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_07690 18633 21443 gene locus_tag LOCUS_07700 18633 21443 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_07700 21589 21503 gene locus_tag LOCUS_t00120 21589 21503 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21683 22654 gene locus_tag LOCUS_07710 gene aroB 21683 22654 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_07710 22651 24621 gene locus_tag LOCUS_07720 22651 24621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 25052 24606 gene locus_tag LOCUS_07730 25052 24606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 26120 25113 gene locus_tag LOCUS_07740 26120 25113 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_07740 26748 26146 gene locus_tag LOCUS_07750 gene rpsD 26748 26146 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_07750 27155 26769 gene locus_tag LOCUS_07760 gene rpsK 27155 26769 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963447.1 protein_id gnl|my_center|LOCUS_07760 27546 27169 gene locus_tag LOCUS_07770 gene rpsM 27546 27169 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_07770 27924 27706 gene locus_tag LOCUS_07780 gene infA 27924 27706 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_07780 28716 27937 gene locus_tag LOCUS_07790 gene map 28716 27937 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_07790 30078 28741 gene locus_tag LOCUS_07800 gene secY 30078 28741 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_07800 30532 30083 gene locus_tag LOCUS_07810 gene rplO 30532 30083 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_07810 30729 30547 gene locus_tag LOCUS_07820 gene rpmD 30729 30547 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_07820 31259 30741 gene locus_tag LOCUS_07830 gene rpsE 31259 30741 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_07830 31633 31271 gene locus_tag LOCUS_07840 gene rplR 31633 31271 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963454.1 protein_id gnl|my_center|LOCUS_07840 32190 31648 gene locus_tag LOCUS_07850 gene rplF 32190 31648 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791561.1 protein_id gnl|my_center|LOCUS_07850 32625 32230 gene locus_tag LOCUS_07860 gene rpsH 32625 32230 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782213.1 protein_id gnl|my_center|LOCUS_07860 32914 32645 gene locus_tag LOCUS_07870 gene rpsN 32914 32645 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_07870 33517 32921 gene locus_tag LOCUS_07880 gene rplE 33517 32921 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_07880 33834 33520 gene locus_tag LOCUS_07890 gene rplX 33834 33520 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_07890 34212 33847 gene locus_tag LOCUS_07900 gene rplN 34212 33847 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_07900 34468 34214 gene locus_tag LOCUS_07910 gene rpsQ 34468 34214 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_07910 34677 34483 gene locus_tag LOCUS_07920 gene rpmC 34677 34483 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_07920 35115 34696 gene locus_tag LOCUS_07930 gene rplP 35115 34696 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_07930 35712 36317 gene locus_tag LOCUS_07940 35712 36317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 37038 36295 gene locus_tag LOCUS_07950 37038 36295 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_07950 37863 37039 gene locus_tag LOCUS_07960 37863 37039 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767449.1 protein_id gnl|my_center|LOCUS_07960 38085 37867 gene locus_tag LOCUS_07970 38085 37867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 38950 38096 gene locus_tag LOCUS_07980 38950 38096 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964449.1 protein_id gnl|my_center|LOCUS_07980 39042 39860 gene locus_tag LOCUS_07990 39042 39860 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_07990 39868 41490 gene locus_tag LOCUS_08000 39868 41490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 41811 41563 gene locus_tag LOCUS_08010 41811 41563 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779510.1 protein_id gnl|my_center|LOCUS_08010 42622 41897 gene locus_tag LOCUS_08020 gene pnuC 42622 41897 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020439.1 protein_id gnl|my_center|LOCUS_08020 44408 42600 gene locus_tag LOCUS_08030 gene uvrC 44408 42600 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_08030 45653 44412 gene locus_tag LOCUS_08040 45653 44412 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120385.1 protein_id gnl|my_center|LOCUS_08040 46517 45717 gene locus_tag LOCUS_08050 46517 45717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 47001 46750 gene locus_tag LOCUS_08060 47001 46750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 47863 47099 gene locus_tag LOCUS_08070 gene rpsC 47863 47099 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762038.1 protein_id gnl|my_center|LOCUS_08070 48260 47865 gene locus_tag LOCUS_08080 gene rplV 48260 47865 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_08080 48565 48296 gene locus_tag LOCUS_08090 gene rpsS 48565 48296 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_08090 49412 48588 gene locus_tag LOCUS_08100 gene rplB 49412 48588 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_08100 49716 49426 gene locus_tag LOCUS_08110 gene rplW 49716 49426 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791542.1 protein_id gnl|my_center|LOCUS_08110 50361 49735 gene locus_tag LOCUS_08120 gene rplD 50361 49735 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_08120 50960 50364 gene locus_tag LOCUS_08130 gene rplC 50960 50364 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_08130 51120 51905 gene locus_tag LOCUS_08140 gene cdaA 51120 51905 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762592.1 protein_id gnl|my_center|LOCUS_08140 51902 54364 gene locus_tag LOCUS_08150 51902 54364 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_08150 54372 54752 gene locus_tag LOCUS_08160 54372 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 54745 55836 gene locus_tag LOCUS_08170 54745 55836 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_08170 56742 55843 gene locus_tag LOCUS_08180 56742 55843 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761129.1 protein_id gnl|my_center|LOCUS_08180 57569 56760 gene locus_tag LOCUS_08190 gene dapF 57569 56760 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135464474.1 protein_id gnl|my_center|LOCUS_08190 58450 57563 gene locus_tag LOCUS_08200 gene dapA 58450 57563 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_08200 59109 58447 gene locus_tag LOCUS_08210 gene dapB 59109 58447 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_08210 61213 59111 gene locus_tag LOCUS_08220 61213 59111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 62533 61226 gene locus_tag LOCUS_08230 gene murA 62533 61226 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_08230 62657 63781 gene locus_tag LOCUS_08240 62657 63781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence08 396 323 gene locus_tag LOCUS_t00130 396 323 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 512 763 gene locus_tag LOCUS_08250 512 763 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_08250 2657 822 gene locus_tag LOCUS_08260 2657 822 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_08260 5058 2662 gene locus_tag LOCUS_08270 5058 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5129 8539 gene locus_tag LOCUS_08280 5129 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 9666 8491 gene locus_tag LOCUS_08290 9666 8491 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_08290 9793 10668 gene locus_tag LOCUS_08300 9793 10668 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775503.1 protein_id gnl|my_center|LOCUS_08300 10795 13938 gene locus_tag LOCUS_08310 10795 13938 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108498.1 protein_id gnl|my_center|LOCUS_08310 13952 15970 gene locus_tag LOCUS_08320 13952 15970 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761944.1 protein_id gnl|my_center|LOCUS_08320 16025 18790 gene locus_tag LOCUS_08330 16025 18790 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108499.1 protein_id gnl|my_center|LOCUS_08330 18804 20483 gene locus_tag LOCUS_08340 18804 20483 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761942.1 protein_id gnl|my_center|LOCUS_08340 20513 22387 gene locus_tag LOCUS_08350 20513 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 22517 24862 gene locus_tag LOCUS_08360 22517 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 24869 26425 gene locus_tag LOCUS_08370 24869 26425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 26425 27498 gene locus_tag LOCUS_08380 26425 27498 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_08380 27581 28669 gene locus_tag LOCUS_08390 27581 28669 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_08390 28672 30015 gene locus_tag LOCUS_08400 28672 30015 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_08400 30022 31059 gene locus_tag LOCUS_08410 30022 31059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 31056 33467 gene locus_tag LOCUS_08420 31056 33467 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583019.1 protein_id gnl|my_center|LOCUS_08420 33464 35617 gene locus_tag LOCUS_08430 33464 35617 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_08430 37883 35622 gene locus_tag LOCUS_08440 37883 35622 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_08440 37950 39227 gene locus_tag LOCUS_08450 37950 39227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 40253 39294 gene locus_tag LOCUS_08460 40253 39294 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_08460 40339 41934 gene locus_tag LOCUS_08470 gene glpA 40339 41934 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694610.1 protein_id gnl|my_center|LOCUS_08470 41931 43070 gene locus_tag LOCUS_08480 gene glpB 41931 43070 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098020.1 protein_id gnl|my_center|LOCUS_08480 43067 44296 gene locus_tag LOCUS_08490 gene glpC 43067 44296 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000377.1 protein_id gnl|my_center|LOCUS_08490 44311 45189 gene locus_tag LOCUS_08500 44311 45189 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_08500 45189 46562 gene locus_tag LOCUS_08510 gene glpT 45189 46562 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_08510 47723 46986 gene locus_tag LOCUS_08520 47723 46986 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987068.1 protein_id gnl|my_center|LOCUS_08520 49214 47733 gene locus_tag LOCUS_08530 gene glpK 49214 47733 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_08530 51426 49243 gene locus_tag LOCUS_08540 51426 49243 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_08540 52605 51478 gene locus_tag LOCUS_08550 52605 51478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 53903 52611 gene locus_tag LOCUS_08560 53903 52611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 54163 53948 gene locus_tag LOCUS_08570 54163 53948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 54293 55504 gene locus_tag LOCUS_08580 54293 55504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 56570 55461 gene locus_tag LOCUS_08590 56570 55461 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_08590 56776 56567 gene locus_tag LOCUS_08600 56776 56567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 57204 57119 gene locus_tag LOCUS_t00140 57204 57119 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58679 57255 gene locus_tag LOCUS_08610 58679 57255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 58812 58973 gene locus_tag LOCUS_08620 58812 58973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 58973 60790 gene locus_tag LOCUS_08630 58973 60790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 61107 60883 gene locus_tag LOCUS_08640 61107 60883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 61397 61155 gene locus_tag LOCUS_08650 61397 61155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence09 557 324 gene locus_tag LOCUS_08660 557 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 1488 535 gene locus_tag LOCUS_08670 1488 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1621 1893 gene locus_tag LOCUS_08680 1621 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1914 2282 gene locus_tag LOCUS_08690 1914 2282 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764760.1 protein_id gnl|my_center|LOCUS_08690 3039 2302 gene locus_tag LOCUS_08700 3039 2302 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_08700 3679 3041 gene locus_tag LOCUS_08710 3679 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4831 3692 gene locus_tag LOCUS_08720 4831 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 4960 6366 gene locus_tag LOCUS_08730 4960 6366 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_08730 7126 6449 gene locus_tag LOCUS_08740 7126 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7231 8253 gene locus_tag LOCUS_08750 7231 8253 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217731.1 protein_id gnl|my_center|LOCUS_08750 8923 8231 gene locus_tag LOCUS_08760 8923 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 10147 8930 gene locus_tag LOCUS_08770 gene cls 10147 8930 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_08770 10701 10150 gene locus_tag LOCUS_08780 10701 10150 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053025875.1 protein_id gnl|my_center|LOCUS_08780 10826 11641 gene locus_tag LOCUS_08790 10826 11641 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_08790 11634 12437 gene locus_tag LOCUS_08800 11634 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 12448 12792 gene locus_tag LOCUS_08810 12448 12792 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538531.1 protein_id gnl|my_center|LOCUS_08810 12816 13553 gene locus_tag LOCUS_08820 12816 13553 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107567.1 protein_id gnl|my_center|LOCUS_08820 14426 13554 gene locus_tag LOCUS_08830 14426 13554 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_08830 14498 15607 gene locus_tag LOCUS_08840 14498 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 15609 17342 gene locus_tag LOCUS_08850 15609 17342 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202604.1 protein_id gnl|my_center|LOCUS_08850 18664 17339 gene locus_tag LOCUS_08860 gene ffh 18664 17339 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_08860 18703 19431 gene locus_tag LOCUS_08870 18703 19431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 19471 19740 gene locus_tag LOCUS_08880 19471 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 19743 20027 gene locus_tag LOCUS_08890 19743 20027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 20258 21790 gene locus_tag LOCUS_08900 gene rny 20258 21790 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_08900 22619 21792 gene locus_tag LOCUS_08910 22619 21792 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_08910 23898 22621 gene locus_tag LOCUS_08920 23898 22621 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880349.1 protein_id gnl|my_center|LOCUS_08920 24255 23902 gene locus_tag LOCUS_08930 24255 23902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 24344 25255 gene locus_tag LOCUS_08940 gene nusB 24344 25255 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_08940 25260 25592 gene locus_tag LOCUS_08950 gene yajC 25260 25592 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_08950 25603 26532 gene locus_tag LOCUS_08960 25603 26532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 26529 27053 gene locus_tag LOCUS_08970 gene coaE 26529 27053 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_08970 27050 27475 gene locus_tag LOCUS_08980 27050 27475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 27462 28772 gene locus_tag LOCUS_08990 gene rimO 27462 28772 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_08990 29854 28976 gene locus_tag LOCUS_09000 29854 28976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 29982 29907 gene locus_tag LOCUS_t00150 29982 29907 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30073 30468 gene locus_tag LOCUS_tm00010 30073 30468 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 30486 32405 gene locus_tag LOCUS_09010 30486 32405 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_09010 32455 33594 gene locus_tag LOCUS_09020 32455 33594 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_09020 33606 35555 gene locus_tag LOCUS_09030 33606 35555 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_09030 35557 36282 gene locus_tag LOCUS_09040 35557 36282 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_09040 36292 37824 gene locus_tag LOCUS_09050 gene araA 36292 37824 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_09050 37824 39410 gene locus_tag LOCUS_09060 37824 39410 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_09060 39416 39814 gene locus_tag LOCUS_09070 39416 39814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 39802 41292 gene locus_tag LOCUS_09080 39802 41292 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_09080 41294 42334 gene locus_tag LOCUS_09090 gene holA 41294 42334 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_09090 44577 42331 gene locus_tag LOCUS_09100 44577 42331 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203339.1 protein_id gnl|my_center|LOCUS_09100 44867 44577 gene locus_tag LOCUS_09110 44867 44577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 45774 44857 gene locus_tag LOCUS_09120 gene xerC 45774 44857 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_09120 45846 46709 gene locus_tag LOCUS_09130 45846 46709 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_09130 46706 48058 gene locus_tag LOCUS_09140 46706 48058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_09140 48040 48870 gene locus_tag LOCUS_09150 48040 48870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 48884 49696 gene locus_tag LOCUS_09160 48884 49696 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_09160 50586 49693 gene locus_tag LOCUS_09170 50586 49693 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_09170 50671 52323 gene locus_tag LOCUS_09180 50671 52323 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_09180 53313 52342 gene locus_tag LOCUS_09190 gene pfkA 53313 52342 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_09190 53384 53842 gene locus_tag LOCUS_09200 53384 53842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 53847 55289 gene locus_tag LOCUS_09210 53847 55289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 56999 55290 gene locus_tag LOCUS_09220 56999 55290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 57135 57208 gene locus_tag LOCUS_t00160 57135 57208 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 436 669 gene locus_tag LOCUS_09230 436 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 925 2043 gene locus_tag LOCUS_09240 925 2043 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050532079.1 protein_id gnl|my_center|LOCUS_09240 5991 2128 gene locus_tag LOCUS_09250 5991 2128 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_09250 6334 7719 gene locus_tag LOCUS_09260 6334 7719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7845 9323 gene locus_tag LOCUS_09270 7845 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 9351 11483 gene locus_tag LOCUS_09280 9351 11483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 11577 11903 gene locus_tag LOCUS_09290 11577 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 11900 17887 gene locus_tag LOCUS_09300 11900 17887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 17884 21138 gene locus_tag LOCUS_09310 17884 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 21642 21133 gene locus_tag LOCUS_09320 21642 21133 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203239.1 protein_id gnl|my_center|LOCUS_09320 21706 22824 gene locus_tag LOCUS_09330 21706 22824 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_09330 25690 22799 gene locus_tag LOCUS_09340 25690 22799 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_09340 25762 27861 gene locus_tag LOCUS_09350 gene recG 25762 27861 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172726565.1 protein_id gnl|my_center|LOCUS_09350 27882 28430 gene locus_tag LOCUS_09360 27882 28430 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_09360 28432 30108 gene locus_tag LOCUS_09370 28432 30108 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_09370 30121 32385 gene locus_tag LOCUS_09380 30121 32385 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_09380 32932 32393 gene locus_tag LOCUS_09390 32932 32393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 33042 34946 gene locus_tag LOCUS_09400 33042 34946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 36001 35003 gene locus_tag LOCUS_09410 gene gap 36001 35003 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_09410 36101 37225 gene locus_tag LOCUS_09420 gene lpxB 36101 37225 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_09420 37238 37399 gene locus_tag LOCUS_09430 37238 37399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 37386 38600 gene locus_tag LOCUS_09440 37386 38600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 38602 40413 gene locus_tag LOCUS_09450 38602 40413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 41060 40410 gene locus_tag LOCUS_09460 41060 40410 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_09460 42949 41057 gene locus_tag LOCUS_09470 gene yidC 42949 41057 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_09470 44664 42949 gene locus_tag LOCUS_09480 44664 42949 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_09480 44745 45422 gene locus_tag LOCUS_09490 gene trmD 44745 45422 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_09490 45779 46540 gene locus_tag LOCUS_09500 45779 46540 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_09500 49863 46534 gene locus_tag LOCUS_09510 49863 46534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence11 1576 479 gene locus_tag LOCUS_09520 1576 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1812 2066 gene locus_tag LOCUS_09530 1812 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2498 2151 gene locus_tag LOCUS_09540 2498 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2554 2937 gene locus_tag LOCUS_09550 2554 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 3132 4337 gene locus_tag LOCUS_09560 3132 4337 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_09560 7291 4406 gene locus_tag LOCUS_09570 7291 4406 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_09570 9020 7293 gene locus_tag LOCUS_09580 9020 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 9382 9017 gene locus_tag LOCUS_09590 9382 9017 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759873.1 protein_id gnl|my_center|LOCUS_09590 9604 9515 gene locus_tag LOCUS_t00170 9604 9515 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10858 9716 gene locus_tag LOCUS_09600 10858 9716 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048172603.1 protein_id gnl|my_center|LOCUS_09600 12305 10851 gene locus_tag LOCUS_09610 12305 10851 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789261.1 protein_id gnl|my_center|LOCUS_09610 14015 12315 gene locus_tag LOCUS_09620 14015 12315 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_09620 14068 14478 gene locus_tag LOCUS_09630 14068 14478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 14484 15518 gene locus_tag LOCUS_09640 gene pheS 14484 15518 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_09640 15572 15647 gene locus_tag LOCUS_t00180 15572 15647 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15935 18814 gene locus_tag LOCUS_09650 15935 18814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 18867 20024 gene locus_tag LOCUS_09660 gene lysA 18867 20024 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_09660 20042 21031 gene locus_tag LOCUS_09670 20042 21031 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083685838.1 protein_id gnl|my_center|LOCUS_09670 21767 21021 gene locus_tag LOCUS_09680 gene tatC 21767 21021 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_09680 21970 21767 gene locus_tag LOCUS_09690 21970 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 22758 22009 gene locus_tag LOCUS_09700 22758 22009 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_09700 23497 22760 gene locus_tag LOCUS_09710 gene fabG 23497 22760 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_09710 24877 23501 gene locus_tag LOCUS_09720 24877 23501 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_09720 25366 24881 gene locus_tag LOCUS_09730 25366 24881 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_09730 26419 25370 gene locus_tag LOCUS_09740 26419 25370 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_09740 27822 26425 gene locus_tag LOCUS_09750 gene pelB 27822 26425 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_09750 29016 27871 gene locus_tag LOCUS_09760 29016 27871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 29087 30109 gene locus_tag LOCUS_09770 29087 30109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 30758 30099 gene locus_tag LOCUS_09780 30758 30099 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140258.1 protein_id gnl|my_center|LOCUS_09780 30861 34127 gene locus_tag LOCUS_09790 30861 34127 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130858180.1 protein_id gnl|my_center|LOCUS_09790 34133 36013 gene locus_tag LOCUS_09800 34133 36013 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_09800 36520 36092 gene locus_tag LOCUS_09810 36520 36092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 37830 36517 gene locus_tag LOCUS_09820 37830 36517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 38264 37842 gene locus_tag LOCUS_09830 38264 37842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 40223 38268 gene locus_tag LOCUS_09840 40223 38268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767054.1 protein_id gnl|my_center|LOCUS_09840 41169 40228 gene locus_tag LOCUS_09850 41169 40228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 42368 41280 gene locus_tag LOCUS_09860 42368 41280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 42622 43197 gene locus_tag LOCUS_09870 42622 43197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_09870 43201 43491 gene locus_tag LOCUS_09880 43201 43491 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_09880 43970 43650 gene locus_tag LOCUS_09890 43970 43650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence12 622 549 gene locus_tag LOCUS_t00190 622 549 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2068 668 gene locus_tag LOCUS_09900 gene hisS 2068 668 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_09900 4625 2070 gene locus_tag LOCUS_09910 4625 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 4752 6560 gene locus_tag LOCUS_09920 gene sppA 4752 6560 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_09920 7599 6553 gene locus_tag LOCUS_09930 7599 6553 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_09930 8263 7586 gene locus_tag LOCUS_09940 8263 7586 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_09940 9158 8268 gene locus_tag LOCUS_09950 9158 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 10062 9166 gene locus_tag LOCUS_09960 10062 9166 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09960 10133 10438 gene locus_tag LOCUS_09970 10133 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 11145 10396 gene locus_tag LOCUS_09980 11145 10396 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_09980 12155 11154 gene locus_tag LOCUS_09990 12155 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 12254 14803 gene locus_tag LOCUS_10000 12254 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 14800 15843 gene locus_tag LOCUS_10010 14800 15843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 16774 15797 gene locus_tag LOCUS_10020 16774 15797 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_10020 16836 17999 gene locus_tag LOCUS_10030 16836 17999 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_10030 18926 18003 gene locus_tag LOCUS_10040 18926 18003 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670643.1 protein_id gnl|my_center|LOCUS_10040 20056 18923 gene locus_tag LOCUS_10050 20056 18923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 20487 20056 gene locus_tag LOCUS_10060 20487 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 20534 21145 gene locus_tag LOCUS_10070 20534 21145 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_10070 21210 22259 gene locus_tag LOCUS_10080 gene queA 21210 22259 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_10080 22357 23517 gene locus_tag LOCUS_10090 22357 23517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 23520 24296 gene locus_tag LOCUS_10100 23520 24296 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_10100 24293 25333 gene locus_tag LOCUS_10110 24293 25333 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_10110 25418 26212 gene locus_tag LOCUS_10120 25418 26212 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_10120 26228 26668 gene locus_tag LOCUS_10130 26228 26668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 26677 27258 gene locus_tag LOCUS_10140 26677 27258 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_10140 27273 27743 gene locus_tag LOCUS_10150 27273 27743 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_10150 27831 29237 gene locus_tag LOCUS_10160 gene asnS 27831 29237 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760798.1 protein_id gnl|my_center|LOCUS_10160 29239 29859 gene locus_tag LOCUS_10170 gene udk 29239 29859 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107155.1 protein_id gnl|my_center|LOCUS_10170 29856 30578 gene locus_tag LOCUS_10180 29856 30578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 32100 30565 gene locus_tag LOCUS_10190 32100 30565 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_10190 32506 32102 gene locus_tag LOCUS_10200 32506 32102 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_10200 34208 32511 gene locus_tag LOCUS_10210 34208 32511 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_10210 37093 34262 gene locus_tag LOCUS_10220 37093 34262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 37437 38624 gene locus_tag LOCUS_10230 37437 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 39571 38711 gene locus_tag LOCUS_10240 39571 38711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 40321 39584 gene locus_tag LOCUS_10250 40321 39584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 41046 40327 gene locus_tag LOCUS_10260 41046 40327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 42085 41057 gene locus_tag LOCUS_10270 42085 41057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 42322 42107 gene locus_tag LOCUS_10280 42322 42107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 42632 43708 gene locus_tag LOCUS_10290 42632 43708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence13 847 1818 gene locus_tag LOCUS_10300 847 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2029 3000 gene locus_tag LOCUS_10310 2029 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3316 3495 gene locus_tag LOCUS_10320 3316 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3613 4611 gene locus_tag LOCUS_10330 3613 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5318 4626 gene locus_tag LOCUS_10340 gene tsaB 5318 4626 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_10340 5808 5311 gene locus_tag LOCUS_10350 5808 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 5880 9227 gene locus_tag LOCUS_10360 gene ileS 5880 9227 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_10360 9241 9642 gene locus_tag LOCUS_10370 9241 9642 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_10370 9644 10204 gene locus_tag LOCUS_10380 9644 10204 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_10380 10201 11859 gene locus_tag LOCUS_10390 10201 11859 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_10390 11853 12722 gene locus_tag LOCUS_10400 11853 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 12830 13849 gene locus_tag LOCUS_10410 12830 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_10410 13849 14868 gene locus_tag LOCUS_10420 gene plsX 13849 14868 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_10420 14858 15097 gene locus_tag LOCUS_10430 gene acpP 14858 15097 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_10430 17892 15100 gene locus_tag LOCUS_10440 17892 15100 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_10440 17955 20219 gene locus_tag LOCUS_10450 17955 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 22056 20194 gene locus_tag LOCUS_10460 22056 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 25433 22047 gene locus_tag LOCUS_10470 25433 22047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 27405 25438 gene locus_tag LOCUS_10480 27405 25438 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_10480 28536 27409 gene locus_tag LOCUS_10490 28536 27409 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038708.1 protein_id gnl|my_center|LOCUS_10490 30552 28540 gene locus_tag LOCUS_10500 30552 28540 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108937.1 protein_id gnl|my_center|LOCUS_10500 33657 30616 gene locus_tag LOCUS_10510 33657 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 35255 33666 gene locus_tag LOCUS_10520 35255 33666 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789572.1 protein_id gnl|my_center|LOCUS_10520 38303 35310 gene locus_tag LOCUS_10530 38303 35310 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_10530 39659 38328 gene locus_tag LOCUS_10540 39659 38328 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_10540 39791 40933 gene locus_tag LOCUS_10550 39791 40933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 40930 41676 gene locus_tag LOCUS_10560 40930 41676 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_10560 41714 41787 gene locus_tag LOCUS_t00200 41714 41787 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 41962 42357 gene locus_tag LOCUS_10570 41962 42357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 42361 42852 gene locus_tag LOCUS_10580 42361 42852 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827403.1 protein_id gnl|my_center|LOCUS_10580 42839 43075 gene locus_tag LOCUS_10590 42839 43075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence14 850 2169 gene locus_tag LOCUS_10600 850 2169 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10600 2269 4851 gene locus_tag LOCUS_10610 gene mutS 2269 4851 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_10610 6164 4848 gene locus_tag LOCUS_10620 6164 4848 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_10620 7536 6169 gene locus_tag LOCUS_10630 7536 6169 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762587.1 protein_id gnl|my_center|LOCUS_10630 8057 7569 gene locus_tag LOCUS_10640 8057 7569 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008593045.1 protein_id gnl|my_center|LOCUS_10640 8867 8073 gene locus_tag LOCUS_10650 8867 8073 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_10650 9886 8864 gene locus_tag LOCUS_10660 9886 8864 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_10660 10820 9891 gene locus_tag LOCUS_10670 10820 9891 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793053.1 protein_id gnl|my_center|LOCUS_10670 10898 13792 gene locus_tag LOCUS_10680 10898 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_10680 13795 14418 gene locus_tag LOCUS_10690 13795 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 15508 14408 gene locus_tag LOCUS_10700 gene ychF 15508 14408 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_10700 15599 16477 gene locus_tag LOCUS_10710 15599 16477 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_10710 16502 17644 gene locus_tag LOCUS_10720 gene galK 16502 17644 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_10720 19728 17641 gene locus_tag LOCUS_10730 19728 17641 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_10730 20397 19798 gene locus_tag LOCUS_10740 20397 19798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 21717 20428 gene locus_tag LOCUS_10750 21717 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 23101 21776 gene locus_tag LOCUS_10760 23101 21776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203253.1 protein_id gnl|my_center|LOCUS_10760 23807 23079 gene locus_tag LOCUS_10770 23807 23079 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964522.1 protein_id gnl|my_center|LOCUS_10770 27027 23842 gene locus_tag LOCUS_10780 gene mfd 27027 23842 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_10780 27288 28328 gene locus_tag LOCUS_10790 gene ruvB 27288 28328 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_10790 28361 30307 gene locus_tag LOCUS_10800 28361 30307 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_10800 30313 31092 gene locus_tag LOCUS_10810 30313 31092 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_10810 32281 31097 gene locus_tag LOCUS_10820 gene hflX 32281 31097 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_10820 33030 32341 gene locus_tag LOCUS_10830 33030 32341 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_10830 33116 33559 gene locus_tag LOCUS_10840 gene ybeY 33116 33559 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_10840 33561 35447 gene locus_tag LOCUS_10850 gene mnmG 33561 35447 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_10850 36057 35464 gene locus_tag LOCUS_10860 gene ruvA 36057 35464 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_10860 36123 37364 gene locus_tag LOCUS_10870 36123 37364 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_10870 37376 37792 gene locus_tag LOCUS_10880 37376 37792 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_10880 37789 38151 gene locus_tag LOCUS_10890 37789 38151 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_10890 38151 38579 gene locus_tag LOCUS_10900 gene folK 38151 38579 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_10900 38590 40128 gene locus_tag LOCUS_10910 38590 40128 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence15 195 1112 gene locus_tag LOCUS_10920 195 1112 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_10920 4203 1114 gene locus_tag LOCUS_10930 4203 1114 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_10930 4259 4606 gene locus_tag LOCUS_10940 4259 4606 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_10940 4606 5316 gene locus_tag LOCUS_10950 4606 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5349 6047 gene locus_tag LOCUS_10960 5349 6047 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_10960 6047 6427 gene locus_tag LOCUS_10970 gene rnpA 6047 6427 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_10970 6424 6657 gene locus_tag LOCUS_10980 gene yidD 6424 6657 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_10980 8444 6654 gene locus_tag LOCUS_10990 gene lepA 8444 6654 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_10990 10488 8449 gene locus_tag LOCUS_11000 10488 8449 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_11000 11268 10546 gene locus_tag LOCUS_11010 11268 10546 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202815.1 protein_id gnl|my_center|LOCUS_11010 11931 11272 gene locus_tag LOCUS_11020 11931 11272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_11020 13234 12161 gene locus_tag LOCUS_11030 13234 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 13546 15150 gene locus_tag LOCUS_11040 13546 15150 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_11040 15332 15405 gene locus_tag LOCUS_t00210 15332 15405 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17885 15411 gene locus_tag LOCUS_11050 17885 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 18395 17937 gene locus_tag LOCUS_11060 18395 17937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 21367 19625 gene locus_tag LOCUS_11070 21367 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 21398 21823 gene locus_tag LOCUS_11080 gene tsaE 21398 21823 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_11080 22966 21914 gene locus_tag LOCUS_11090 22966 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 24202 23063 gene locus_tag LOCUS_11100 24202 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 24761 24204 gene locus_tag LOCUS_11110 24761 24204 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_11110 24830 26068 gene locus_tag LOCUS_11120 24830 26068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 26065 27270 gene locus_tag LOCUS_11130 26065 27270 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_11130 28252 27260 gene locus_tag LOCUS_11140 28252 27260 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_11140 28339 28980 gene locus_tag LOCUS_11150 28339 28980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 30306 28984 gene locus_tag LOCUS_11160 30306 28984 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_11160 30437 30868 gene locus_tag LOCUS_11170 30437 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 30877 31761 gene locus_tag LOCUS_11180 30877 31761 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107584.1 protein_id gnl|my_center|LOCUS_11180 31878 31803 gene locus_tag LOCUS_t00220 31878 31803 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 32562 31912 gene locus_tag LOCUS_11190 32562 31912 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_11190 32610 34196 gene locus_tag LOCUS_11200 32610 34196 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918680.1 protein_id gnl|my_center|LOCUS_11200 37478 34209 gene locus_tag LOCUS_11210 37478 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920041.1 protein_id gnl|my_center|LOCUS_11210 37624 37550 gene locus_tag LOCUS_t00230 37624 37550 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 102 3239 gene locus_tag LOCUS_11220 102 3239 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_11220 3252 4841 gene locus_tag LOCUS_11230 3252 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6222 4912 gene locus_tag LOCUS_11240 6222 4912 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293026.1 protein_id gnl|my_center|LOCUS_11240 7729 6224 gene locus_tag LOCUS_11250 7729 6224 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_11250 7806 10421 gene locus_tag LOCUS_11260 gene alaS 7806 10421 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109057.1 protein_id gnl|my_center|LOCUS_11260 10421 12868 gene locus_tag LOCUS_11270 10421 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 12872 13513 gene locus_tag LOCUS_11280 12872 13513 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_11280 13554 14594 gene locus_tag LOCUS_11290 13554 14594 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_11290 14596 15555 gene locus_tag LOCUS_11300 14596 15555 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_11300 15565 15882 gene locus_tag LOCUS_11310 15565 15882 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_11310 15879 16679 gene locus_tag LOCUS_11320 15879 16679 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475994.1 protein_id gnl|my_center|LOCUS_11320 16686 17495 gene locus_tag LOCUS_11330 16686 17495 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_11330 17501 18985 gene locus_tag LOCUS_11340 gene dnaB 17501 18985 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_11340 18989 19408 gene locus_tag LOCUS_11350 18989 19408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 19405 20358 gene locus_tag LOCUS_11360 19405 20358 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_11360 20351 21703 gene locus_tag LOCUS_11370 gene rsxC 20351 21703 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_11370 21710 22678 gene locus_tag LOCUS_11380 21710 22678 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_11380 22682 23257 gene locus_tag LOCUS_11390 22682 23257 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_11390 23261 23845 gene locus_tag LOCUS_11400 23261 23845 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_11400 23852 24457 gene locus_tag LOCUS_11410 gene rsxA 23852 24457 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761247.1 protein_id gnl|my_center|LOCUS_11410 25632 24553 gene locus_tag LOCUS_11420 25632 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 27179 25788 gene locus_tag LOCUS_11430 gene gltA 27179 25788 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_11430 28039 27179 gene locus_tag LOCUS_11440 28039 27179 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048249.1 protein_id gnl|my_center|LOCUS_11440 29167 28067 gene locus_tag LOCUS_11450 29167 28067 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_11450 29405 30769 gene locus_tag LOCUS_11460 29405 30769 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785877.1 protein_id gnl|my_center|LOCUS_11460 30776 32086 gene locus_tag LOCUS_11470 30776 32086 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107332.1 protein_id gnl|my_center|LOCUS_11470 32088 32486 gene locus_tag LOCUS_11480 32088 32486 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_11480 32647 34824 gene locus_tag LOCUS_11490 32647 34824 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_11490 34831 36150 gene locus_tag LOCUS_11500 34831 36150 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence17 734 1594 gene locus_tag LOCUS_11510 734 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1619 2692 gene locus_tag LOCUS_11520 1619 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3487 2684 gene locus_tag LOCUS_11530 3487 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4508 3531 gene locus_tag LOCUS_11540 gene aroB 4508 3531 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920845.1 protein_id gnl|my_center|LOCUS_11540 5539 4505 gene locus_tag LOCUS_11550 5539 4505 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_11550 6405 5545 gene locus_tag LOCUS_11560 6405 5545 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_11560 7570 6470 gene locus_tag LOCUS_11570 gene aroC 7570 6470 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_11570 8665 7577 gene locus_tag LOCUS_11580 8665 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9739 8666 gene locus_tag LOCUS_11590 9739 8666 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_11590 11096 9816 gene locus_tag LOCUS_11600 11096 9816 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_11600 11154 11753 gene locus_tag LOCUS_11610 11154 11753 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805103.1 protein_id gnl|my_center|LOCUS_11610 11750 12589 gene locus_tag LOCUS_11620 11750 12589 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_11620 12586 13518 gene locus_tag LOCUS_11630 12586 13518 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080609.1 protein_id gnl|my_center|LOCUS_11630 13524 14891 gene locus_tag LOCUS_11640 13524 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 14888 16024 gene locus_tag LOCUS_11650 14888 16024 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_11650 16021 16308 gene locus_tag LOCUS_11660 16021 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 16305 18515 gene locus_tag LOCUS_11670 16305 18515 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107207.1 protein_id gnl|my_center|LOCUS_11670 18515 20086 gene locus_tag LOCUS_11680 18515 20086 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766132.1 protein_id gnl|my_center|LOCUS_11680 22172 20073 gene locus_tag LOCUS_11690 22172 20073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 24005 22242 gene locus_tag LOCUS_11700 24005 22242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 27035 24024 gene locus_tag LOCUS_11710 27035 24024 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_11710 27252 29873 gene locus_tag LOCUS_11720 27252 29873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 30109 29789 gene locus_tag LOCUS_11730 30109 29789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 31071 30106 gene locus_tag LOCUS_11740 31071 30106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 31530 31234 gene locus_tag LOCUS_11750 31530 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 31607 31870 gene locus_tag LOCUS_11760 31607 31870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 32129 31938 gene locus_tag LOCUS_11770 32129 31938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 32248 32484 gene locus_tag LOCUS_11780 32248 32484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 32662 32943 gene locus_tag LOCUS_11790 32662 32943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 33027 33296 gene locus_tag LOCUS_11800 33027 33296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 33411 33665 gene locus_tag LOCUS_11810 33411 33665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 33652 34350 gene locus_tag LOCUS_11820 33652 34350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence18 2 289 gene locus_tag LOCUS_11830 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1326 1766 gene locus_tag LOCUS_11840 1326 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1756 2340 gene locus_tag LOCUS_11850 1756 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3602 2337 gene locus_tag LOCUS_11860 3602 2337 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582809.1 protein_id gnl|my_center|LOCUS_11860 5580 3622 gene locus_tag LOCUS_11870 5580 3622 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_11870 6689 5586 gene locus_tag LOCUS_11880 6689 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 9176 6693 gene locus_tag LOCUS_11890 9176 6693 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_11890 10561 9179 gene locus_tag LOCUS_11900 gene lpdA 10561 9179 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766155.1 protein_id gnl|my_center|LOCUS_11900 11980 10571 gene locus_tag LOCUS_11910 11980 10571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 15399 12022 gene locus_tag LOCUS_11920 15399 12022 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227589.1 protein_id gnl|my_center|LOCUS_11920 15458 18886 gene locus_tag LOCUS_11930 15458 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 18925 22437 gene locus_tag LOCUS_11940 18925 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 22507 26034 gene locus_tag LOCUS_11950 gene nifJ 22507 26034 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_11950 26882 27064 gene locus_tag LOCUS_11960 26882 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 27529 31650 gene locus_tag LOCUS_11970 gene cas9 27529 31650 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963637.1 protein_id gnl|my_center|LOCUS_11970 32560 32895 gene locus_tag LOCUS_11980 gene cas2 32560 32895 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_11980 32991 33188 gene locus_tag LOCUS_11990 32991 33188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence19 230 1543 gene locus_tag LOCUS_12000 230 1543 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_12000 2880 1540 gene locus_tag LOCUS_12010 2880 1540 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107715.1 protein_id gnl|my_center|LOCUS_12010 4018 2888 gene locus_tag LOCUS_12020 4018 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 6627 4015 gene locus_tag LOCUS_12030 6627 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7376 6621 gene locus_tag LOCUS_12040 7376 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 8374 7373 gene locus_tag LOCUS_12050 8374 7373 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_12050 9357 8374 gene locus_tag LOCUS_12060 9357 8374 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_12060 10292 9354 gene locus_tag LOCUS_12070 10292 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 11170 10289 gene locus_tag LOCUS_12080 11170 10289 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_12080 12169 11177 gene locus_tag LOCUS_12090 12169 11177 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_12090 12194 13120 gene locus_tag LOCUS_12100 12194 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 13245 13937 gene locus_tag LOCUS_12110 13245 13937 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_12110 13939 14349 gene locus_tag LOCUS_12120 13939 14349 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_12120 14379 15137 gene locus_tag LOCUS_12130 14379 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 15158 16552 gene locus_tag LOCUS_12140 15158 16552 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791757.1 protein_id gnl|my_center|LOCUS_12140 16552 17433 gene locus_tag LOCUS_12150 gene era 16552 17433 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203581.1 protein_id gnl|my_center|LOCUS_12150 17438 20146 gene locus_tag LOCUS_12160 17438 20146 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_12160 20159 22576 gene locus_tag LOCUS_12170 gene galB 20159 22576 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_12170 24311 22569 gene locus_tag LOCUS_12180 gene recJ 24311 22569 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_12180 24380 25915 gene locus_tag LOCUS_12190 gene lysS 24380 25915 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_12190 25912 26691 gene locus_tag LOCUS_12200 25912 26691 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_12200 26684 27424 gene locus_tag LOCUS_12210 gene aroE 26684 27424 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879816.1 protein_id gnl|my_center|LOCUS_12210 27437 27976 gene locus_tag LOCUS_12220 27437 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 28042 30093 gene locus_tag LOCUS_12230 28042 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence20 1767 610 gene locus_tag LOCUS_12240 1767 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1951 3243 gene locus_tag LOCUS_12250 1951 3243 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119397.1 protein_id gnl|my_center|LOCUS_12250 4137 3250 gene locus_tag LOCUS_12260 4137 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 5416 4142 gene locus_tag LOCUS_12270 gene nqrF 5416 4142 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787210.1 protein_id gnl|my_center|LOCUS_12270 6046 5432 gene locus_tag LOCUS_12280 gene nqrE 6046 5432 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_12280 6670 6059 gene locus_tag LOCUS_12290 6670 6059 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_12290 7420 6674 gene locus_tag LOCUS_12300 7420 6674 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765873.1 protein_id gnl|my_center|LOCUS_12300 8542 7424 gene locus_tag LOCUS_12310 8542 7424 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787201.1 protein_id gnl|my_center|LOCUS_12310 9899 8547 gene locus_tag LOCUS_12320 9899 8547 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_12320 10001 12589 gene locus_tag LOCUS_12330 10001 12589 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_12330 14130 13243 gene locus_tag LOCUS_12340 14130 13243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 15774 14146 gene locus_tag LOCUS_12350 15774 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 15846 16142 gene locus_tag LOCUS_12360 15846 16142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 16828 16214 gene locus_tag LOCUS_12370 16828 16214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17718 16972 gene locus_tag LOCUS_12380 17718 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 17771 18541 gene locus_tag LOCUS_12390 17771 18541 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113172.1 protein_id gnl|my_center|LOCUS_12390 18543 20612 gene locus_tag LOCUS_12400 18543 20612 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_12400 20671 22161 gene locus_tag LOCUS_12410 20671 22161 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086603.1 protein_id gnl|my_center|LOCUS_12410 22170 22412 gene locus_tag LOCUS_12420 22170 22412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 23804 22419 gene locus_tag LOCUS_12430 23804 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 23872 24909 gene locus_tag LOCUS_12440 23872 24909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 24929 25540 gene locus_tag LOCUS_12450 24929 25540 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_12450 25548 26489 gene locus_tag LOCUS_12460 25548 26489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 26477 27004 gene locus_tag LOCUS_12470 26477 27004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 27001 27339 gene locus_tag LOCUS_12480 27001 27339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 27641 27327 gene locus_tag LOCUS_12490 27641 27327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 27828 27755 gene locus_tag LOCUS_t00240 27828 27755 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28572 28898 gene locus_tag LOCUS_12500 28572 28898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence21 380 922 gene locus_tag LOCUS_12510 380 922 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_12510 919 1515 gene locus_tag LOCUS_12520 919 1515 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_12520 2668 1478 gene locus_tag LOCUS_12530 2668 1478 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200876.1 protein_id gnl|my_center|LOCUS_12530 2937 2665 gene locus_tag LOCUS_12540 2937 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 3685 2939 gene locus_tag LOCUS_12550 3685 2939 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_12550 4391 3687 gene locus_tag LOCUS_12560 4391 3687 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191776298.1 protein_id gnl|my_center|LOCUS_12560 5847 4393 gene locus_tag LOCUS_12570 5847 4393 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286021.1 protein_id gnl|my_center|LOCUS_12570 6684 5992 gene locus_tag LOCUS_12580 6684 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 8129 6681 gene locus_tag LOCUS_12590 8129 6681 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_12590 9203 8208 gene locus_tag LOCUS_12600 gene tsf 9203 8208 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_12600 9962 9234 gene locus_tag LOCUS_12610 gene rpsB 9962 9234 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_12610 10601 10212 gene locus_tag LOCUS_12620 gene rpsI 10601 10212 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390000.1 protein_id gnl|my_center|LOCUS_12620 11063 10611 gene locus_tag LOCUS_12630 gene rplM 11063 10611 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_12630 11755 11186 gene locus_tag LOCUS_12640 gene frr 11755 11186 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_12640 12473 11769 gene locus_tag LOCUS_12650 gene pyrH 12473 11769 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_12650 12570 13298 gene locus_tag LOCUS_12660 12570 13298 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_12660 14428 13301 gene locus_tag LOCUS_12670 gene lpxK 14428 13301 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_12670 15416 14421 gene locus_tag LOCUS_12680 gene dusB 15416 14421 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_12680 15463 17226 gene locus_tag LOCUS_12690 15463 17226 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765424.1 protein_id gnl|my_center|LOCUS_12690 20465 17223 gene locus_tag LOCUS_12700 20465 17223 CDS product DUF4906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764428.1 protein_id gnl|my_center|LOCUS_12700 22198 20465 gene locus_tag LOCUS_12710 22198 20465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 23256 22201 gene locus_tag LOCUS_12720 23256 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 24249 23257 gene locus_tag LOCUS_12730 24249 23257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 25603 24341 gene locus_tag LOCUS_12740 25603 24341 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203742.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence22 11 277 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gggtgttgtgattgtttcaaagatagaaaaaat 990 1307 gene locus_tag LOCUS_12750 990 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1867 1331 gene locus_tag LOCUS_12760 1867 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2250 1888 gene locus_tag LOCUS_12770 2250 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2431 2258 gene locus_tag LOCUS_12780 2431 2258 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_12780 2534 2917 gene locus_tag LOCUS_12790 2534 2917 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_12790 2919 4802 gene locus_tag LOCUS_12800 2919 4802 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_12800 6613 4799 gene locus_tag LOCUS_12810 6613 4799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426617.1 protein_id gnl|my_center|LOCUS_12810 6681 7208 gene locus_tag LOCUS_12820 6681 7208 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_12820 7298 7696 gene locus_tag LOCUS_12830 gene rpsF 7298 7696 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_12830 7700 7972 gene locus_tag LOCUS_12840 gene rpsR 7700 7972 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_12840 7984 8424 gene locus_tag LOCUS_12850 gene rplI 7984 8424 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963954.1 protein_id gnl|my_center|LOCUS_12850 9442 10818 gene locus_tag LOCUS_12860 9442 10818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 12292 10838 gene locus_tag LOCUS_12870 12292 10838 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 protein_id gnl|my_center|LOCUS_12870 13246 12317 gene locus_tag LOCUS_12880 13246 12317 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_12880 13319 15025 gene locus_tag LOCUS_12890 13319 15025 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_12890 15026 15712 gene locus_tag LOCUS_12900 15026 15712 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793718.1 protein_id gnl|my_center|LOCUS_12900 15712 16302 gene locus_tag LOCUS_12910 15712 16302 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_12910 16299 17720 gene locus_tag LOCUS_12920 16299 17720 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_12920 17717 19057 gene locus_tag LOCUS_12930 17717 19057 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_12930 19061 19711 gene locus_tag LOCUS_12940 19061 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 19715 20752 gene locus_tag LOCUS_12950 19715 20752 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_12950 20736 22097 gene locus_tag LOCUS_12960 gene trkA 20736 22097 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_12960 22158 22709 gene locus_tag LOCUS_12970 22158 22709 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_12970 22722 23912 gene locus_tag LOCUS_12980 gene dnaJ 22722 23912 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_12980 24018 24395 gene locus_tag LOCUS_12990 gene rplS 24018 24395 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_12990 24426 24500 gene locus_tag LOCUS_t00250 24426 24500 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 1735 359 gene locus_tag LOCUS_13000 1735 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1793 2713 gene locus_tag LOCUS_13010 1793 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2717 3052 gene locus_tag LOCUS_13020 2717 3052 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788139.1 protein_id gnl|my_center|LOCUS_13020 4957 3053 gene locus_tag LOCUS_13030 4957 3053 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107228.1 protein_id gnl|my_center|LOCUS_13030 5831 5019 gene locus_tag LOCUS_13040 5831 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6787 5852 gene locus_tag LOCUS_13050 6787 5852 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_13050 7193 6780 gene locus_tag LOCUS_13060 7193 6780 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025075578.1 protein_id gnl|my_center|LOCUS_13060 7593 7180 gene locus_tag LOCUS_13070 7593 7180 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_13070 7933 7595 gene locus_tag LOCUS_13080 7933 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 8274 7930 gene locus_tag LOCUS_13090 8274 7930 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805125.1 protein_id gnl|my_center|LOCUS_13090 8336 9799 gene locus_tag LOCUS_13100 8336 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 9799 12123 gene locus_tag LOCUS_13110 9799 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 12135 13142 gene locus_tag LOCUS_13120 gene pta 12135 13142 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_13120 14622 13111 gene locus_tag LOCUS_13130 14622 13111 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108495.1 protein_id gnl|my_center|LOCUS_13130 15533 14622 gene locus_tag LOCUS_13140 15533 14622 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_13140 16968 15601 gene locus_tag LOCUS_13150 16968 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 17823 17146 gene locus_tag LOCUS_13160 17823 17146 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_13160 18784 17807 gene locus_tag LOCUS_13170 18784 17807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 21199 20414 gene locus_tag LOCUS_13180 21199 20414 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_13180 21965 21225 gene locus_tag LOCUS_13190 21965 21225 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_13190 22888 21977 gene locus_tag LOCUS_13200 22888 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 23774 22890 gene locus_tag LOCUS_13210 23774 22890 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_13210 24090 23812 gene locus_tag LOCUS_13220 24090 23812 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788894.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence24 1871 3328 gene locus_tag LOCUS_13230 1871 3328 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_13230 3399 4286 gene locus_tag LOCUS_13240 3399 4286 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 protein_id gnl|my_center|LOCUS_13240 4290 6029 gene locus_tag LOCUS_13250 gene argS 4290 6029 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_13250 6062 6460 gene locus_tag LOCUS_13260 6062 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 8628 6466 gene locus_tag LOCUS_13270 8628 6466 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_13270 8683 11979 gene locus_tag LOCUS_13280 8683 11979 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_13280 13718 11976 gene locus_tag LOCUS_13290 13718 11976 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_13290 14434 13715 gene locus_tag LOCUS_13300 14434 13715 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_13300 14483 15808 gene locus_tag LOCUS_13310 14483 15808 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_13310 19217 15822 gene locus_tag LOCUS_13320 19217 15822 CDS product PA14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108640.1 protein_id gnl|my_center|LOCUS_13320 19307 20644 gene locus_tag LOCUS_13330 19307 20644 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_13330 20735 23602 gene locus_tag LOCUS_13340 20735 23602 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107553.1 protein_id gnl|my_center|LOCUS_13340 23656 23748 gene locus_tag LOCUS_t00260 23656 23748 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence25 1755 457 gene locus_tag LOCUS_13350 gene rodA 1755 457 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_13350 3578 1755 gene locus_tag LOCUS_13360 gene mrdA 3578 1755 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_13360 4090 3578 gene locus_tag LOCUS_13370 4090 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4827 4087 gene locus_tag LOCUS_13380 4827 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5925 4909 gene locus_tag LOCUS_13390 5925 4909 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_13390 6002 6673 gene locus_tag LOCUS_13400 6002 6673 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_13400 7156 6662 gene locus_tag LOCUS_13410 7156 6662 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_13410 9492 7177 gene locus_tag LOCUS_13420 gene topA 9492 7177 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_13420 9590 11971 gene locus_tag LOCUS_13430 9590 11971 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_13430 11973 12989 gene locus_tag LOCUS_13440 11973 12989 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_13440 12989 13831 gene locus_tag LOCUS_13450 gene prmC 12989 13831 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_13450 13933 15093 gene locus_tag LOCUS_13460 13933 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 16852 15074 gene locus_tag LOCUS_13470 16852 15074 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_13470 17671 16853 gene locus_tag LOCUS_13480 17671 16853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 17875 20346 gene locus_tag LOCUS_13490 17875 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 20343 20954 gene locus_tag LOCUS_13500 20343 20954 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_13500 21402 20932 gene locus_tag LOCUS_13510 21402 20932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 21488 22411 gene locus_tag LOCUS_13520 21488 22411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 22655 23776 gene locus_tag LOCUS_13530 22655 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence26 529 457 gene locus_tag LOCUS_t00270 529 457 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 728 546 gene locus_tag LOCUS_13540 gene rpmF 728 546 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_13540 1085 747 gene locus_tag LOCUS_13550 1085 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2944 1139 gene locus_tag LOCUS_13560 gene typA 2944 1139 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791956.1 protein_id gnl|my_center|LOCUS_13560 3068 2985 gene locus_tag LOCUS_t00280 3068 2985 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3646 3095 gene locus_tag LOCUS_13570 3646 3095 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202750.1 protein_id gnl|my_center|LOCUS_13570 5230 3650 gene locus_tag LOCUS_13580 5230 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6268 5378 gene locus_tag LOCUS_13590 gene deoC 6268 5378 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762870.1 protein_id gnl|my_center|LOCUS_13590 6670 6284 gene locus_tag LOCUS_13600 6670 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 9108 6667 gene locus_tag LOCUS_13610 gene pheT 9108 6667 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_13610 9996 9115 gene locus_tag LOCUS_13620 gene ftsY 9996 9115 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963551.1 protein_id gnl|my_center|LOCUS_13620 11339 10053 gene locus_tag LOCUS_13630 11339 10053 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_13630 12440 11343 gene locus_tag LOCUS_13640 12440 11343 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_13640 13688 12456 gene locus_tag LOCUS_13650 13688 12456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_13650 14958 13690 gene locus_tag LOCUS_13660 14958 13690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_13660 15617 14955 gene locus_tag LOCUS_13670 15617 14955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_13670 15902 15744 gene locus_tag LOCUS_13680 15902 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 16103 15915 gene locus_tag LOCUS_13690 gene rpmG 16103 15915 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_13690 16321 16115 gene locus_tag LOCUS_13700 gene rpmB 16321 16115 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186391.1 protein_id gnl|my_center|LOCUS_13700 17730 16432 gene locus_tag LOCUS_13710 17730 16432 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783769.1 protein_id gnl|my_center|LOCUS_13710 18081 17737 gene locus_tag LOCUS_13720 gene rplT 18081 17737 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_13720 18288 18094 gene locus_tag LOCUS_13730 gene rpmI 18288 18094 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_13730 18935 18342 gene locus_tag LOCUS_13740 gene infC 18935 18342 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_13740 20632 18935 gene locus_tag LOCUS_13750 gene thrS 20632 18935 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_13750 20803 21339 gene locus_tag LOCUS_13760 20803 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 21341 22291 gene locus_tag LOCUS_13770 21341 22291 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_13770 22945 22295 gene locus_tag LOCUS_13780 22945 22295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 23642 22971 gene locus_tag LOCUS_13790 23642 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 23841 23736 gene locus_tag LOCUS_r00010 23841 23736 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence27 1576 437 gene locus_tag LOCUS_13800 1576 437 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_13800 3193 1697 gene locus_tag LOCUS_13810 3193 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5843 3393 gene locus_tag LOCUS_13820 5843 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 6182 6472 gene locus_tag LOCUS_13830 6182 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6578 7408 gene locus_tag LOCUS_13840 6578 7408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 7410 8801 gene locus_tag LOCUS_13850 7410 8801 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_13850 8774 11386 gene locus_tag LOCUS_13860 8774 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 11370 12593 gene locus_tag LOCUS_13870 gene pepT 11370 12593 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_13870 12590 13711 gene locus_tag LOCUS_13880 12590 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 13836 16235 gene locus_tag LOCUS_13890 13836 16235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 16259 16402 gene locus_tag LOCUS_13900 16259 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 16427 18781 gene locus_tag LOCUS_13910 16427 18781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 20399 18795 gene locus_tag LOCUS_13920 20399 18795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 22403 20412 gene locus_tag LOCUS_13930 22403 20412 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence28 1804 359 gene locus_tag LOCUS_13940 1804 359 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_13940 1886 2809 gene locus_tag LOCUS_13950 gene oxyR 1886 2809 CDS product LysR family transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224776.1 protein_id gnl|my_center|LOCUS_13950 2853 4010 gene locus_tag LOCUS_13960 2853 4010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201247873.1 protein_id gnl|my_center|LOCUS_13960 4007 4900 gene locus_tag LOCUS_13970 4007 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5376 4897 gene locus_tag LOCUS_13980 5376 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 5457 6458 gene locus_tag LOCUS_13990 5457 6458 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_13990 6439 7290 gene locus_tag LOCUS_14000 6439 7290 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972784.1 protein_id gnl|my_center|LOCUS_14000 7287 8009 gene locus_tag LOCUS_14010 7287 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 8266 8181 gene locus_tag LOCUS_t00290 8266 8181 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8370 10577 gene locus_tag LOCUS_14020 8370 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_14020 10749 11792 gene locus_tag LOCUS_14030 10749 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12343 11798 gene locus_tag LOCUS_14040 12343 11798 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_14040 12470 12745 gene locus_tag LOCUS_14050 gene rpsO 12470 12745 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_14050 12825 15251 gene locus_tag LOCUS_14060 gene pnp 12825 15251 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_14060 16171 15248 gene locus_tag LOCUS_14070 16171 15248 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_14070 16739 16164 gene locus_tag LOCUS_14080 16739 16164 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_14080 18298 16736 gene locus_tag LOCUS_14090 18298 16736 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_14090 20341 18368 gene locus_tag LOCUS_14100 20341 18368 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_14100 21792 20341 gene locus_tag LOCUS_14110 21792 20341 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_14110 22475 21810 gene locus_tag LOCUS_14120 22475 21810 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_14120 23505 22480 gene locus_tag LOCUS_14130 23505 22480 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence29 707 781 gene locus_tag LOCUS_t00300 707 781 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 874 2235 gene locus_tag LOCUS_14140 874 2235 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766999.1 protein_id gnl|my_center|LOCUS_14140 2329 2895 gene locus_tag LOCUS_14150 2329 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3021 3230 gene locus_tag LOCUS_14160 3021 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3237 3797 gene locus_tag LOCUS_14170 3237 3797 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962711.1 protein_id gnl|my_center|LOCUS_14170 4510 4815 gene locus_tag LOCUS_14180 4510 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6705 4873 gene locus_tag LOCUS_14190 6705 4873 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108254.1 protein_id gnl|my_center|LOCUS_14190 9696 6718 gene locus_tag LOCUS_14200 9696 6718 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108253.1 protein_id gnl|my_center|LOCUS_14200 11402 9726 gene locus_tag LOCUS_14210 11402 9726 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_14210 11463 12983 gene locus_tag LOCUS_14220 gene guaA 11463 12983 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_14220 14915 12984 gene locus_tag LOCUS_14230 14915 12984 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14230 15139 14912 gene locus_tag LOCUS_14240 15139 14912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14240 15212 17116 gene locus_tag LOCUS_14250 15212 17116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 18022 17117 gene locus_tag LOCUS_14260 18022 17117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 20586 18022 gene locus_tag LOCUS_14270 20586 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 21802 20696 gene locus_tag LOCUS_14280 21802 20696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 22128 21799 gene locus_tag LOCUS_14290 22128 21799 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_14290 22730 22131 gene locus_tag LOCUS_14300 22730 22131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence30 1128 1583 gene locus_tag LOCUS_14310 1128 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1585 2025 gene locus_tag LOCUS_14320 gene ohrR 1585 2025 CDS product hydroperoxide stress response transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090940.1 protein_id gnl|my_center|LOCUS_14320 2704 2018 gene locus_tag LOCUS_14330 2704 2018 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943875.1 protein_id gnl|my_center|LOCUS_14330 4277 2718 gene locus_tag LOCUS_14340 4277 2718 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_14340 4375 5388 gene locus_tag LOCUS_14350 4375 5388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 5392 6786 gene locus_tag LOCUS_14360 gene potA 5392 6786 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762997.1 protein_id gnl|my_center|LOCUS_14360 6779 7552 gene locus_tag LOCUS_14370 6779 7552 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107691.1 protein_id gnl|my_center|LOCUS_14370 7552 8355 gene locus_tag LOCUS_14380 7552 8355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993119.1 protein_id gnl|my_center|LOCUS_14380 8352 9653 gene locus_tag LOCUS_14390 8352 9653 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_14390 11591 9639 gene locus_tag LOCUS_14400 11591 9639 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_14400 12632 11598 gene locus_tag LOCUS_14410 12632 11598 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_14410 12677 14278 gene locus_tag LOCUS_14420 12677 14278 CDS product DUF5605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080612.1 protein_id gnl|my_center|LOCUS_14420 14278 16128 gene locus_tag LOCUS_14430 14278 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 16131 16676 gene locus_tag LOCUS_14440 16131 16676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 17691 16660 gene locus_tag LOCUS_14450 17691 16660 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_14450 18471 17707 gene locus_tag LOCUS_14460 18471 17707 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_14460 18546 21395 gene locus_tag LOCUS_14470 gene uvrA 18546 21395 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence31 172 1206 gene locus_tag LOCUS_14480 172 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1226 2227 gene locus_tag LOCUS_14490 1226 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 2231 3691 gene locus_tag LOCUS_14500 2231 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3688 5970 gene locus_tag LOCUS_14510 3688 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 5983 9207 gene locus_tag LOCUS_14520 5983 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 9920 9276 gene locus_tag LOCUS_14530 9920 9276 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_14530 10033 10872 gene locus_tag LOCUS_14540 10033 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 14958 12193 gene locus_tag LOCUS_14550 14958 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303161.1 protein_id gnl|my_center|LOCUS_14550 15038 17482 gene locus_tag LOCUS_14560 15038 17482 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_14560 17498 19135 gene locus_tag LOCUS_14570 17498 19135 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918673.1 protein_id gnl|my_center|LOCUS_14570 19138 20265 gene locus_tag LOCUS_14580 19138 20265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 20771 20346 gene locus_tag LOCUS_14590 20771 20346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 21084 20845 gene locus_tag LOCUS_14600 21084 20845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence32 <1 944 gene locus_tag LOCUS_14610 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762559.1:glycine--tRNA ligase 951 1943 gene locus_tag LOCUS_14620 gene thiL 951 1943 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_14620 5599 1940 gene locus_tag LOCUS_14630 gene dnaE 5599 1940 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992125.1 protein_id gnl|my_center|LOCUS_14630 8721 5665 gene locus_tag LOCUS_14640 gene secDF 8721 5665 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_14640 8845 9309 gene locus_tag LOCUS_14650 8845 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 9313 10260 gene locus_tag LOCUS_14660 gene floA 9313 10260 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_14660 11058 10264 gene locus_tag LOCUS_14670 11058 10264 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_14670 11101 11934 gene locus_tag LOCUS_14680 11101 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 12473 11940 gene locus_tag LOCUS_14690 12473 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 14535 12499 gene locus_tag LOCUS_14700 14535 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 15192 14680 gene locus_tag LOCUS_14710 15192 14680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 16535 15351 gene locus_tag LOCUS_14720 16535 15351 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_14720 16689 16615 gene locus_tag LOCUS_t00310 16689 16615 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17021 16716 gene locus_tag LOCUS_14730 gene rpsJ 17021 16716 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_14730 19167 17047 gene locus_tag LOCUS_14740 gene fusA 19167 17047 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence33 416 186 gene locus_tag LOCUS_14750 416 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2307 658 gene locus_tag LOCUS_14760 2307 658 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_14760 2379 3590 gene locus_tag LOCUS_14770 2379 3590 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_14770 3587 4087 gene locus_tag LOCUS_14780 3587 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4081 4674 gene locus_tag LOCUS_14790 4081 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4681 5031 gene locus_tag LOCUS_14800 4681 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5114 7192 gene locus_tag LOCUS_14810 gene clpB 5114 7192 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_14810 7222 7875 gene locus_tag LOCUS_14820 7222 7875 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_14820 7880 9112 gene locus_tag LOCUS_14830 7880 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 9374 9084 gene locus_tag LOCUS_14840 9374 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 10732 9374 gene locus_tag LOCUS_14850 10732 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 12031 10745 gene locus_tag LOCUS_14860 12031 10745 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_14860 13859 12033 gene locus_tag LOCUS_14870 13859 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 14169 13849 gene locus_tag LOCUS_14880 14169 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 15179 14166 gene locus_tag LOCUS_14890 15179 14166 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_14890 16254 15184 gene locus_tag LOCUS_14900 16254 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 16946 16251 gene locus_tag LOCUS_14910 16946 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 17736 16954 gene locus_tag LOCUS_14920 17736 16954 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_14920 19005 17740 gene locus_tag LOCUS_14930 19005 17740 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence34 2410 779 gene locus_tag LOCUS_14940 2410 779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_14940 3789 2440 gene locus_tag LOCUS_14950 3789 2440 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440000.1 protein_id gnl|my_center|LOCUS_14950 3870 5738 gene locus_tag LOCUS_14960 gene dxs 3870 5738 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_14960 5812 5888 gene locus_tag LOCUS_t00320 5812 5888 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5921 6003 gene locus_tag LOCUS_t00330 5921 6003 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6022 6094 gene locus_tag LOCUS_t00340 6022 6094 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6106 6178 gene locus_tag LOCUS_t00350 6106 6178 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6232 7419 gene locus_tag LOCUS_14970 gene tuf 6232 7419 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_14970 7472 7545 gene locus_tag LOCUS_t00360 7472 7545 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7628 7816 gene locus_tag LOCUS_14980 7628 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 7834 8400 gene locus_tag LOCUS_14990 gene nusG 7834 8400 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963317.1 protein_id gnl|my_center|LOCUS_14990 8407 8850 gene locus_tag LOCUS_15000 gene rplK 8407 8850 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_15000 8863 9567 gene locus_tag LOCUS_15010 gene rplA 8863 9567 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_15010 9580 10110 gene locus_tag LOCUS_15020 gene rplJ 9580 10110 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762028.1 protein_id gnl|my_center|LOCUS_15020 10143 10514 gene locus_tag LOCUS_15030 gene rplL 10143 10514 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_15030 10622 14446 gene locus_tag LOCUS_15040 gene rpoB 10622 14446 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762029.1 protein_id gnl|my_center|LOCUS_15040 14468 18718 gene locus_tag LOCUS_15050 gene rpoC 14468 18718 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_15050 18828 18902 gene locus_tag LOCUS_t00370 18828 18902 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 2085 1459 gene locus_tag LOCUS_15060 2085 1459 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765906.1 protein_id gnl|my_center|LOCUS_15060 3276 2179 gene locus_tag LOCUS_15070 3276 2179 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_15070 3645 3292 gene locus_tag LOCUS_15080 3645 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3989 3648 gene locus_tag LOCUS_15090 3989 3648 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_15090 6814 3989 gene locus_tag LOCUS_15100 6814 3989 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_15100 7501 6827 gene locus_tag LOCUS_15110 gene hypB 7501 6827 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_15110 7636 8232 gene locus_tag LOCUS_15120 7636 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8246 9154 gene locus_tag LOCUS_15130 8246 9154 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_15130 9151 10134 gene locus_tag LOCUS_15140 9151 10134 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972287.1 protein_id gnl|my_center|LOCUS_15140 10131 12032 gene locus_tag LOCUS_15150 10131 12032 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053568.1 protein_id gnl|my_center|LOCUS_15150 12034 12438 gene locus_tag LOCUS_15160 12034 12438 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_15160 12440 12742 gene locus_tag LOCUS_15170 12440 12742 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256949.1 protein_id gnl|my_center|LOCUS_15170 12759 14951 gene locus_tag LOCUS_15180 12759 14951 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_15180 14964 16202 gene locus_tag LOCUS_15190 14964 16202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 16243 17829 gene locus_tag LOCUS_15200 gene uxuB 16243 17829 CDS product D-mannonate dehydrogenase UxuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082564.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence36 922 215 gene locus_tag LOCUS_15210 922 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1308 1048 gene locus_tag LOCUS_15220 1308 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3359 1743 gene locus_tag LOCUS_15230 3359 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4613 3507 gene locus_tag LOCUS_15240 4613 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 5004 4600 gene locus_tag LOCUS_15250 5004 4600 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_15250 5476 5006 gene locus_tag LOCUS_15260 gene greA 5476 5006 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_15260 5951 5550 gene locus_tag LOCUS_15270 5951 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 6811 5939 gene locus_tag LOCUS_15280 6811 5939 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931936.1 protein_id gnl|my_center|LOCUS_15280 9366 6802 gene locus_tag LOCUS_15290 9366 6802 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107692.1 protein_id gnl|my_center|LOCUS_15290 10569 9373 gene locus_tag LOCUS_15300 10569 9373 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_15300 11840 10566 gene locus_tag LOCUS_15310 11840 10566 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_15310 13793 11856 gene locus_tag LOCUS_15320 13793 11856 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_15320 15804 13795 gene locus_tag LOCUS_15330 15804 13795 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107440.1 protein_id gnl|my_center|LOCUS_15330 15999 15814 gene locus_tag LOCUS_15340 15999 15814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 17153 16005 gene locus_tag LOCUS_15350 gene xseA 17153 16005 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_15350 18205 17213 gene locus_tag LOCUS_15360 18205 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence37 1681 3192 gene locus_tag LOCUS_15370 1681 3192 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640391.1 protein_id gnl|my_center|LOCUS_15370 3205 5490 gene locus_tag LOCUS_15380 3205 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 5906 5487 gene locus_tag LOCUS_15390 5906 5487 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_15390 7325 5910 gene locus_tag LOCUS_15400 gene uxaC 7325 5910 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_15400 10815 7366 gene locus_tag LOCUS_15410 10815 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 13829 10815 gene locus_tag LOCUS_15420 13829 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 16625 13842 gene locus_tag LOCUS_15430 16625 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence38 334 732 gene locus_tag LOCUS_15440 334 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 729 929 gene locus_tag LOCUS_15450 729 929 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_15450 1759 935 gene locus_tag LOCUS_15460 1759 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1895 2584 gene locus_tag LOCUS_15470 1895 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3743 2547 gene locus_tag LOCUS_15480 3743 2547 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_15480 4364 3744 gene locus_tag LOCUS_15490 4364 3744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5393 4371 gene locus_tag LOCUS_15500 5393 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6749 5400 gene locus_tag LOCUS_15510 6749 5400 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_15510 6842 7252 gene locus_tag LOCUS_15520 6842 7252 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017296.1 protein_id gnl|my_center|LOCUS_15520 7259 8818 gene locus_tag LOCUS_15530 7259 8818 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_15530 8805 10445 gene locus_tag LOCUS_15540 8805 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 12751 10448 gene locus_tag LOCUS_15550 12751 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 14639 12753 gene locus_tag LOCUS_15560 14639 12753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 14783 16189 gene locus_tag LOCUS_15570 14783 16189 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_15570 16196 16942 gene locus_tag LOCUS_15580 16196 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 17160 17609 gene locus_tag LOCUS_15590 gene dtd 17160 17609 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence39 251 850 gene locus_tag LOCUS_15600 251 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1037 2065 gene locus_tag LOCUS_15610 gene murB 1037 2065 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_15610 3707 2103 gene locus_tag LOCUS_15620 3707 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 4333 3707 gene locus_tag LOCUS_15630 4333 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 5525 4680 gene locus_tag LOCUS_15640 5525 4680 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222866.1 protein_id gnl|my_center|LOCUS_15640 7281 5539 gene locus_tag LOCUS_15650 gene aspS 7281 5539 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_15650 7654 8535 gene locus_tag LOCUS_15660 7654 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 9619 8561 gene locus_tag LOCUS_15670 9619 8561 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_15670 11586 9622 gene locus_tag LOCUS_15680 11586 9622 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_15680 12202 11591 gene locus_tag LOCUS_15690 12202 11591 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_15690 12620 12219 gene locus_tag LOCUS_15700 12620 12219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 12816 13025 gene locus_tag LOCUS_15710 12816 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 13092 15200 gene locus_tag LOCUS_15720 13092 15200 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_15720 15206 16393 gene locus_tag LOCUS_15730 gene uxuA 15206 16393 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_15730 17259 16426 gene locus_tag LOCUS_15740 gene rsmA 17259 16426 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_15740 17550 17287 gene locus_tag LOCUS_15750 17550 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence40 1276 158 gene locus_tag LOCUS_15760 1276 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2378 1311 gene locus_tag LOCUS_15770 2378 1311 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767329.1 protein_id gnl|my_center|LOCUS_15770 3505 2423 gene locus_tag LOCUS_15780 3505 2423 CDS product fimbrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303108.1 protein_id gnl|my_center|LOCUS_15780 4079 3558 gene locus_tag LOCUS_15790 4079 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4631 4272 gene locus_tag LOCUS_15800 4631 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 6344 4632 gene locus_tag LOCUS_15810 6344 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 7044 8099 gene locus_tag LOCUS_15820 gene ftcD 7044 8099 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080786.1 protein_id gnl|my_center|LOCUS_15820 8977 8111 gene locus_tag LOCUS_15830 8977 8111 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_15830 10249 8990 gene locus_tag LOCUS_15840 10249 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 11391 10246 gene locus_tag LOCUS_15850 11391 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818879.1 protein_id gnl|my_center|LOCUS_15850 11479 11934 gene locus_tag LOCUS_15860 11479 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 11950 14460 gene locus_tag LOCUS_15870 11950 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 14473 15909 gene locus_tag LOCUS_15880 14473 15909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 16092 15925 gene locus_tag LOCUS_15890 16092 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence41 1020 103 gene locus_tag LOCUS_15900 gene cysK 1020 103 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_15900 1112 3511 gene locus_tag LOCUS_15910 1112 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3594 3520 gene locus_tag LOCUS_t00380 3594 3520 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4618 3623 gene locus_tag LOCUS_15920 4618 3623 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_15920 4666 5664 gene locus_tag LOCUS_15930 4666 5664 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_15930 5664 6134 gene locus_tag LOCUS_15940 5664 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 6131 6604 gene locus_tag LOCUS_15950 6131 6604 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_15950 7616 6588 gene locus_tag LOCUS_15960 7616 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8600 7851 gene locus_tag LOCUS_15970 8600 7851 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_15970 10126 8597 gene locus_tag LOCUS_15980 gene cysS 10126 8597 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_15980 11258 10182 gene locus_tag LOCUS_15990 11258 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 11930 11466 gene locus_tag LOCUS_16000 11930 11466 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_16000 12114 13406 gene locus_tag LOCUS_16010 12114 13406 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_16010 <15529 13438 gene locus_tag LOCUS_16020 <15529 13438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804126.1:DNA-directed RNA polymerase subunit beta' >Feature sequence42 2575 1085 gene locus_tag LOCUS_16030 2575 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3431 2580 gene locus_tag LOCUS_16040 3431 2580 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_16040 5029 3437 gene locus_tag LOCUS_16050 gene atpA 5029 3437 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107412.1 protein_id gnl|my_center|LOCUS_16050 5505 5029 gene locus_tag LOCUS_16060 5505 5029 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761392.1 protein_id gnl|my_center|LOCUS_16060 6014 5511 gene locus_tag LOCUS_16070 gene atpF 6014 5511 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_16070 6272 6018 gene locus_tag LOCUS_16080 gene atpE 6272 6018 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_16080 7332 6286 gene locus_tag LOCUS_16090 gene atpB 7332 6286 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_16090 7556 7329 gene locus_tag LOCUS_16100 7556 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 9085 7562 gene locus_tag LOCUS_16110 gene atpD 9085 7562 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_16110 10487 9177 gene locus_tag LOCUS_16120 gene eno 10487 9177 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_16120 15145 10553 gene locus_tag LOCUS_16130 15145 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 15374 15269 gene locus_tag LOCUS_r00020 15374 15269 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence43 468 1673 gene locus_tag LOCUS_16140 468 1673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_16140 4702 1838 gene locus_tag LOCUS_16150 4702 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 7275 4699 gene locus_tag LOCUS_16160 7275 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 8987 7272 gene locus_tag LOCUS_16170 8987 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 10603 8987 gene locus_tag LOCUS_16180 10603 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 12838 10679 gene locus_tag LOCUS_16190 12838 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 13910 12867 gene locus_tag LOCUS_16200 13910 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 14485 13910 gene locus_tag LOCUS_16210 14485 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence44 335 4054 gene locus_tag LOCUS_16220 335 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 4075 7722 gene locus_tag LOCUS_16230 4075 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 9349 7727 gene locus_tag LOCUS_16240 gene groL 9349 7727 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_16240 9618 9352 gene locus_tag LOCUS_16250 9618 9352 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_16250 11067 9718 gene locus_tag LOCUS_16260 11067 9718 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_16260 11123 11653 gene locus_tag LOCUS_16270 11123 11653 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_16270 14363 11631 gene locus_tag LOCUS_16280 gene ppdK 14363 11631 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765523.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence45 471 1106 gene locus_tag LOCUS_16290 471 1106 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_16290 1683 3146 gene locus_tag LOCUS_16300 1683 3146 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015055963.1 protein_id gnl|my_center|LOCUS_16300 4185 3163 gene locus_tag LOCUS_16310 4185 3163 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763724.1 protein_id gnl|my_center|LOCUS_16310 4904 4182 gene locus_tag LOCUS_16320 4904 4182 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_16320 5058 5957 gene locus_tag LOCUS_16330 5058 5957 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767091.1 protein_id gnl|my_center|LOCUS_16330 5954 6958 gene locus_tag LOCUS_16340 5954 6958 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108909.1 protein_id gnl|my_center|LOCUS_16340 6940 7872 gene locus_tag LOCUS_16350 6940 7872 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762562.1 protein_id gnl|my_center|LOCUS_16350 7887 9104 gene locus_tag LOCUS_16360 gene fucP 7887 9104 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921904.1 protein_id gnl|my_center|LOCUS_16360 9109 12321 gene locus_tag LOCUS_16370 9109 12321 CDS product DUF6298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149839243.1 protein_id gnl|my_center|LOCUS_16370 12334 13191 gene locus_tag LOCUS_16380 12334 13191 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_16380 13247 13320 gene locus_tag LOCUS_t00390 13247 13320 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 13335 13408 gene locus_tag LOCUS_t00400 13335 13408 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence46 443 243 gene locus_tag LOCUS_16390 443 243 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761125.1 protein_id gnl|my_center|LOCUS_16390 865 449 gene locus_tag LOCUS_16400 865 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2880 1192 gene locus_tag LOCUS_16410 gene ettA 2880 1192 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_16410 2949 9647 gene locus_tag LOCUS_16420 2949 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence47 711 217 gene locus_tag LOCUS_16430 711 217 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 protein_id gnl|my_center|LOCUS_16430 1432 713 gene locus_tag LOCUS_16440 1432 713 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_16440 1998 1432 gene locus_tag LOCUS_16450 1998 1432 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_16450 2612 1998 gene locus_tag LOCUS_16460 2612 1998 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_16460 4404 2614 gene locus_tag LOCUS_16470 gene mutL 4404 2614 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_16470 4706 4404 gene locus_tag LOCUS_16480 4706 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4796 6982 gene locus_tag LOCUS_16490 4796 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 6994 8115 gene locus_tag LOCUS_16500 6994 8115 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336377.1 protein_id gnl|my_center|LOCUS_16500 8119 8595 gene locus_tag LOCUS_16510 gene ispF 8119 8595 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_16510 8651 8722 gene locus_tag LOCUS_t00410 8651 8722 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8766 8840 gene locus_tag LOCUS_t00420 8766 8840 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence48 1760 1293 gene locus_tag LOCUS_16520 1760 1293 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_16520 2069 3358 gene locus_tag LOCUS_16530 2069 3358 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_16530 3355 4368 gene locus_tag LOCUS_16540 gene metX 3355 4368 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_16540 4373 6859 gene locus_tag LOCUS_16550 gene thrA 4373 6859 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_16550 8273 7515 gene locus_tag LOCUS_16560 8273 7515 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence49 871 799 gene locus_tag LOCUS_t00430 871 799 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 980 2398 gene locus_tag LOCUS_16570 gene glmM 980 2398 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_16570 2402 3466 gene locus_tag LOCUS_16580 2402 3466 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128545.1 protein_id gnl|my_center|LOCUS_16580 3493 4668 gene locus_tag LOCUS_16590 3493 4668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_16590 4839 4663 gene locus_tag LOCUS_16600 4839 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 6170 4860 gene locus_tag LOCUS_16610 6170 4860 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_16610 6226 7428 gene locus_tag LOCUS_16620 6226 7428 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_16620 7579 7788 gene locus_tag LOCUS_16630 7579 7788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence50 153 1508 gene locus_tag LOCUS_16640 gene gdhA 153 1508 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_16640 1515 4454 gene locus_tag LOCUS_16650 1515 4454 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_16650 4464 6317 gene locus_tag LOCUS_16660 gene glmS 4464 6317 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_16660 7049 6330 gene locus_tag LOCUS_16670 7049 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence51 459 2444 gene locus_tag LOCUS_16680 459 2444 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337464.1 protein_id gnl|my_center|LOCUS_16680 3639 2434 gene locus_tag LOCUS_16690 3639 2434 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_16690 3726 5492 gene locus_tag LOCUS_16700 3726 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence52 103 3294 gene locus_tag LOCUS_16710 103 3294 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202496.1 protein_id gnl|my_center|LOCUS_16710 3361 4929 gene locus_tag LOCUS_16720 3361 4929 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_16720 5023 5223 gene locus_tag LOCUS_16730 5023 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence53 2521 692 gene locus_tag LOCUS_16740 2521 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 3907 2537 gene locus_tag LOCUS_16750 3907 2537 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705383.1 protein_id gnl|my_center|LOCUS_16750 4552 4112 gene locus_tag LOCUS_16760 4552 4112 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence54 1538 1392 gene locus_tag LOCUS_16770 1538 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1603 2292 gene locus_tag LOCUS_16780 1603 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 2298 2822 gene locus_tag LOCUS_16790 2298 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2865 2941 gene locus_tag LOCUS_t00440 2865 2941 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2943 4727 gene locus_tag LOCUS_16800 2943 4727 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence55 210 1670 gene locus_tag LOCUS_16810 210 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1699 1863 gene locus_tag LOCUS_16820 1699 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence56 <1 1986 gene locus_tag LOCUS_16830 <1 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775478.1:M13 family metallopeptidase 2044 2724 gene locus_tag LOCUS_16840 2044 2724 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence57 76 516 gene locus_tag LOCUS_16850 76 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 489 1463 gene locus_tag LOCUS_16860 489 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16860 >Feature sequence58 344 1417 gene locus_tag LOCUS_16870 344 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 <2149 1615 gene locus_tag LOCUS_16880 <2149 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020424.1:DUF362 domain-containing protein >Feature sequence59 710 372 gene locus_tag LOCUS_16890 710 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1044 712 gene locus_tag LOCUS_16900 1044 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1757 1062 gene locus_tag LOCUS_16910 1757 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence60 >Feature sequence61 691 290 gene locus_tag LOCUS_16920 691 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1369 758 gene locus_tag LOCUS_16930 1369 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence62 502 720 gene locus_tag LOCUS_16940 502 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 <1546 778 gene locus_tag LOCUS_16950 <1546 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989918.1:class B sortase >Feature sequence63 <1 829 gene locus_tag LOCUS_16960 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275545.1:alpha-glucuronidase family glycosyl hydrolase 1251 955 gene locus_tag LOCUS_16970 1251 955 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence64 <1531 384 gene locus_tag LOCUS_16980 <1531 384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336918.1:terminase large subunit