>Feature sequence01 77 436 gene locus_tag LOCUS_00010 77 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1216 608 gene locus_tag LOCUS_00020 1216 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2475 1213 gene locus_tag LOCUS_00030 2475 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3328 4608 gene locus_tag LOCUS_00040 3328 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4890 4684 gene locus_tag LOCUS_00050 4890 4684 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010707259.1 protein_id gnl|my_center|LOCUS_00050 5145 5642 gene locus_tag LOCUS_00060 5145 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5646 6257 gene locus_tag LOCUS_00070 5646 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7031 6585 gene locus_tag LOCUS_00080 7031 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8158 7178 gene locus_tag LOCUS_00090 8158 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8601 9977 gene locus_tag LOCUS_00100 8601 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10109 12508 gene locus_tag LOCUS_00110 10109 12508 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_00110 12758 14563 gene locus_tag LOCUS_00120 gene pepF 12758 14563 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_00120 15112 14681 gene locus_tag LOCUS_00130 15112 14681 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007485423.1 protein_id gnl|my_center|LOCUS_00130 15239 15490 gene locus_tag LOCUS_00140 15239 15490 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249503.1 protein_id gnl|my_center|LOCUS_00140 15621 15923 gene locus_tag LOCUS_00150 15621 15923 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_00150 15934 16314 gene locus_tag LOCUS_00160 15934 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16337 18835 gene locus_tag LOCUS_00170 16337 18835 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_00170 19672 19052 gene locus_tag LOCUS_00180 gene plsY 19672 19052 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_00180 20459 19695 gene locus_tag LOCUS_00190 20459 19695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24302 20697 gene locus_tag LOCUS_00200 24302 20697 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_00200 26150 24444 gene locus_tag LOCUS_00210 26150 24444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27057 26170 gene locus_tag LOCUS_00220 gene whiA 27057 26170 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243775.1 protein_id gnl|my_center|LOCUS_00220 27988 27101 gene locus_tag LOCUS_00230 gene murB 27988 27101 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546624.1 protein_id gnl|my_center|LOCUS_00230 28153 28833 gene locus_tag LOCUS_00240 28153 28833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 28872 29852 gene locus_tag LOCUS_00250 28872 29852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_00250 29842 30624 gene locus_tag LOCUS_00260 29842 30624 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_00260 30602 31189 gene locus_tag LOCUS_00270 30602 31189 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984457.1 protein_id gnl|my_center|LOCUS_00270 31918 31232 gene locus_tag LOCUS_00280 31918 31232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 32230 33432 gene locus_tag LOCUS_00290 32230 33432 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965535.1 protein_id gnl|my_center|LOCUS_00290 33447 34583 gene locus_tag LOCUS_00300 gene glgD 33447 34583 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903377.1 protein_id gnl|my_center|LOCUS_00300 34880 36319 gene locus_tag LOCUS_00310 gene glgA 34880 36319 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_00310 36438 38882 gene locus_tag LOCUS_00320 36438 38882 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_00320 38966 40900 gene locus_tag LOCUS_00330 38966 40900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40897 41217 gene locus_tag LOCUS_00340 40897 41217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41239 43464 gene locus_tag LOCUS_00350 41239 43464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43486 44121 gene locus_tag LOCUS_00360 43486 44121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_00360 44199 45512 gene locus_tag LOCUS_00370 44199 45512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 45502 46686 gene locus_tag LOCUS_00380 45502 46686 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_00380 48316 46844 gene locus_tag LOCUS_00390 48316 46844 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_00390 49021 48335 gene locus_tag LOCUS_00400 gene tsaA 49021 48335 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_00400 49234 49158 gene locus_tag LOCUS_t00010 49234 49158 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 49532 49278 gene locus_tag LOCUS_00410 49532 49278 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_00410 50076 50387 gene locus_tag LOCUS_00420 gene rpsJ 50076 50387 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040596.1 protein_id gnl|my_center|LOCUS_00420 50533 51162 gene locus_tag LOCUS_00430 gene rplC 50533 51162 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_00430 51178 51801 gene locus_tag LOCUS_00440 gene rplD 51178 51801 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_00440 51801 52094 gene locus_tag LOCUS_00450 gene rplW 51801 52094 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_00450 52113 52943 gene locus_tag LOCUS_00460 gene rplB 52113 52943 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_00460 52959 53240 gene locus_tag LOCUS_00470 gene rpsS 52959 53240 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_00470 53272 53607 gene locus_tag LOCUS_00480 gene rplV 53272 53607 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_00480 53623 54420 gene locus_tag LOCUS_00490 gene rpsC 53623 54420 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_00490 54398 54820 gene locus_tag LOCUS_00500 gene rplP 54398 54820 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_00500 54825 55016 gene locus_tag LOCUS_00510 gene rpmC 54825 55016 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943478.1 protein_id gnl|my_center|LOCUS_00510 55040 55306 gene locus_tag LOCUS_00520 gene rpsQ 55040 55306 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_00520 55378 55746 gene locus_tag LOCUS_00530 gene rplN 55378 55746 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_00530 55762 56076 gene locus_tag LOCUS_00540 gene rplX 55762 56076 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_00540 56094 56633 gene locus_tag LOCUS_00550 gene rplE 56094 56633 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_00550 56651 56836 gene locus_tag LOCUS_00560 56651 56836 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_00560 57028 57426 gene locus_tag LOCUS_00570 gene rpsH 57028 57426 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_00570 57443 57982 gene locus_tag LOCUS_00580 gene rplF 57443 57982 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_00580 58001 58360 gene locus_tag LOCUS_00590 gene rplR 58001 58360 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_00590 58375 58875 gene locus_tag LOCUS_00600 gene rpsE 58375 58875 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_00600 58890 59069 gene locus_tag LOCUS_00610 gene rpmD 58890 59069 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129921.1 protein_id gnl|my_center|LOCUS_00610 59137 59577 gene locus_tag LOCUS_00620 gene rplO 59137 59577 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_00620 59578 60939 gene locus_tag LOCUS_00630 gene secY 59578 60939 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_00630 61020 61661 gene locus_tag LOCUS_00640 61020 61661 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_00640 61668 62420 gene locus_tag LOCUS_00650 gene map 61668 62420 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_00650 62429 62761 gene locus_tag LOCUS_00660 62429 62761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 62789 63013 gene locus_tag LOCUS_00670 gene infA 62789 63013 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_00670 63210 63578 gene locus_tag LOCUS_00680 gene rpsM 63210 63578 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_00680 63600 63998 gene locus_tag LOCUS_00690 gene rpsK 63600 63998 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_00690 64015 64644 gene locus_tag LOCUS_00700 gene rpsD 64015 64644 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_00700 64769 65767 gene locus_tag LOCUS_00710 gene rpoA 64769 65767 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_00710 65850 66191 gene locus_tag LOCUS_00720 gene rplQ 65850 66191 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_00720 68174 66411 gene locus_tag LOCUS_00730 68174 66411 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_00730 68980 68312 gene locus_tag LOCUS_00740 68980 68312 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_00740 69716 68973 gene locus_tag LOCUS_00750 69716 68973 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_00750 69888 70571 gene locus_tag LOCUS_00760 69888 70571 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_00760 70565 71806 gene locus_tag LOCUS_00770 70565 71806 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_00770 73557 71863 gene locus_tag LOCUS_00780 73557 71863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 75600 73597 gene locus_tag LOCUS_00790 75600 73597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 76297 75617 gene locus_tag LOCUS_00800 76297 75617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 76832 76284 gene locus_tag LOCUS_00810 76832 76284 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_00810 79006 77102 gene locus_tag LOCUS_00820 79006 77102 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861512.1 protein_id gnl|my_center|LOCUS_00820 79717 79028 gene locus_tag LOCUS_00830 79717 79028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_00830 80030 81157 gene locus_tag LOCUS_00840 80030 81157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 81141 81779 gene locus_tag LOCUS_00850 gene hisG 81141 81779 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244473.1 protein_id gnl|my_center|LOCUS_00850 81797 83074 gene locus_tag LOCUS_00860 gene hisD 81797 83074 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_00860 83105 84172 gene locus_tag LOCUS_00870 gene hisC 83105 84172 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_00870 84188 84778 gene locus_tag LOCUS_00880 gene hisB 84188 84778 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083477.1 protein_id gnl|my_center|LOCUS_00880 84795 85403 gene locus_tag LOCUS_00890 gene hisH 84795 85403 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_00890 85422 85883 gene locus_tag LOCUS_00900 85422 85883 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837587.1 protein_id gnl|my_center|LOCUS_00900 86028 86744 gene locus_tag LOCUS_00910 gene hisA 86028 86744 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_00910 86834 87592 gene locus_tag LOCUS_00920 gene hisF 86834 87592 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_00920 87617 88276 gene locus_tag LOCUS_00930 gene hisIE 87617 88276 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_00930 88273 89097 gene locus_tag LOCUS_00940 88273 89097 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_00940 90902 89397 gene locus_tag LOCUS_00950 gene galT 90902 89397 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_00950 92073 90922 gene locus_tag LOCUS_00960 92073 90922 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_00960 92298 93095 gene locus_tag LOCUS_00970 92298 93095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 93418 93083 gene locus_tag LOCUS_00980 93418 93083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 93822 93439 gene locus_tag LOCUS_00990 93822 93439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 94109 93819 gene locus_tag LOCUS_01000 94109 93819 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_01000 97117 94448 gene locus_tag LOCUS_01010 97117 94448 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_01010 99431 97464 gene locus_tag LOCUS_01020 99431 97464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 99972 99538 gene locus_tag LOCUS_01030 gene rpiB 99972 99538 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_01030 100924 100211 gene locus_tag LOCUS_01040 gene tsaB 100924 100211 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_01040 101375 100947 gene locus_tag LOCUS_01050 gene tsaE 101375 100947 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_01050 102578 101385 gene locus_tag LOCUS_01060 102578 101385 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_01060 103163 102621 gene locus_tag LOCUS_01070 103163 102621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 104079 103339 gene locus_tag LOCUS_01080 104079 103339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 104442 104621 gene locus_tag LOCUS_01090 104442 104621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 104578 106248 gene locus_tag LOCUS_01100 104578 106248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 106296 106640 gene locus_tag LOCUS_01110 106296 106640 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_01110 106658 107257 gene locus_tag LOCUS_01120 gene recR 106658 107257 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_01120 107489 107749 gene locus_tag LOCUS_01130 107489 107749 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_01130 108147 107836 gene locus_tag LOCUS_01140 108147 107836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 109450 108302 gene locus_tag LOCUS_01150 109450 108302 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_01150 109596 110666 gene locus_tag LOCUS_01160 109596 110666 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_01160 110979 113750 gene locus_tag LOCUS_01170 110979 113750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 114392 113847 gene locus_tag LOCUS_01180 114392 113847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 114707 114504 gene locus_tag LOCUS_01190 114707 114504 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_01190 115712 114711 gene locus_tag LOCUS_01200 115712 114711 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_01200 115883 116416 gene locus_tag LOCUS_01210 115883 116416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 116419 116967 gene locus_tag LOCUS_01220 116419 116967 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678780.1 protein_id gnl|my_center|LOCUS_01220 117183 117551 gene locus_tag LOCUS_01230 117183 117551 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987070.1 protein_id gnl|my_center|LOCUS_01230 117575 118474 gene locus_tag LOCUS_01240 117575 118474 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_01240 118489 120606 gene locus_tag LOCUS_01250 118489 120606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 120729 122126 gene locus_tag LOCUS_01260 120729 122126 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_01260 122317 123393 gene locus_tag LOCUS_01270 122317 123393 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_01270 123407 124165 gene locus_tag LOCUS_01280 123407 124165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 125895 124291 gene locus_tag LOCUS_01290 125895 124291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 126059 126622 gene locus_tag LOCUS_01300 126059 126622 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_01300 126619 127335 gene locus_tag LOCUS_01310 126619 127335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 127353 128654 gene locus_tag LOCUS_01320 127353 128654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 129456 128692 gene locus_tag LOCUS_01330 gene fecE 129456 128692 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_01330 130472 129456 gene locus_tag LOCUS_01340 130472 129456 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 protein_id gnl|my_center|LOCUS_01340 131364 130438 gene locus_tag LOCUS_01350 131364 130438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 132275 131361 gene locus_tag LOCUS_01360 132275 131361 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_01360 132473 133216 gene locus_tag LOCUS_01370 132473 133216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 133333 135525 gene locus_tag LOCUS_01380 133333 135525 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202054.1 protein_id gnl|my_center|LOCUS_01380 135522 136316 gene locus_tag LOCUS_01390 135522 136316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 136334 136798 gene locus_tag LOCUS_01400 136334 136798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 138011 137160 gene locus_tag LOCUS_01410 138011 137160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 138292 138681 gene locus_tag LOCUS_01420 138292 138681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 138695 139432 gene locus_tag LOCUS_01430 138695 139432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891149.1 protein_id gnl|my_center|LOCUS_01430 140405 139485 gene locus_tag LOCUS_01440 140405 139485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_01440 140930 140442 gene locus_tag LOCUS_01450 gene nrdR 140930 140442 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_01450 141148 141393 gene locus_tag LOCUS_01460 141148 141393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 141450 142508 gene locus_tag LOCUS_01470 141450 142508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 143615 142620 gene locus_tag LOCUS_01480 gene dusB 143615 142620 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_01480 143815 144792 gene locus_tag LOCUS_01490 143815 144792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 144810 145331 gene locus_tag LOCUS_01500 gene ruvC 144810 145331 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_01500 145356 145967 gene locus_tag LOCUS_01510 gene ruvA 145356 145967 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142878.1 protein_id gnl|my_center|LOCUS_01510 146196 147206 gene locus_tag LOCUS_01520 gene ruvB 146196 147206 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_01520 147219 148109 gene locus_tag LOCUS_01530 147219 148109 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_01530 148280 149158 gene locus_tag LOCUS_01540 148280 149158 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_01540 149162 150016 gene locus_tag LOCUS_01550 149162 150016 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_01550 150049 150870 gene locus_tag LOCUS_01560 150049 150870 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_01560 150898 151665 gene locus_tag LOCUS_01570 gene truA 150898 151665 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_01570 151662 152852 gene locus_tag LOCUS_01580 151662 152852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 152891 153562 gene locus_tag LOCUS_01590 152891 153562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 153601 156000 gene locus_tag LOCUS_01600 153601 156000 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_01600 156099 156677 gene locus_tag LOCUS_01610 156099 156677 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_01610 156679 157560 gene locus_tag LOCUS_01620 156679 157560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 157649 157723 gene locus_tag LOCUS_t00020 157649 157723 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 1408 191 gene locus_tag LOCUS_01630 gene trpB 1408 191 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_01630 5182 1484 gene locus_tag LOCUS_01640 5182 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 6674 5493 gene locus_tag LOCUS_01650 gene rpoD 6674 5493 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_01650 8437 6698 gene locus_tag LOCUS_01660 gene dnaG 8437 6698 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_01660 9265 8648 gene locus_tag LOCUS_01670 9265 8648 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_01670 10561 9284 gene locus_tag LOCUS_01680 gene hflX 10561 9284 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857415.1 protein_id gnl|my_center|LOCUS_01680 10896 10693 gene locus_tag LOCUS_01690 gene rpmE 10896 10693 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_01690 11714 11004 gene locus_tag LOCUS_01700 gene sigE 11714 11004 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_01700 12595 11732 gene locus_tag LOCUS_01710 gene spoIIGA 12595 11732 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_01710 13166 12930 gene locus_tag LOCUS_01720 13166 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 13280 13471 gene locus_tag LOCUS_01730 13280 13471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 14758 13508 gene locus_tag LOCUS_01740 14758 13508 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245218.1 protein_id gnl|my_center|LOCUS_01740 15942 14944 gene locus_tag LOCUS_01750 15942 14944 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_01750 17010 15967 gene locus_tag LOCUS_01760 17010 15967 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_01760 18058 17012 gene locus_tag LOCUS_01770 18058 17012 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_01770 19503 18103 gene locus_tag LOCUS_01780 gene murD 19503 18103 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_01780 20378 19521 gene locus_tag LOCUS_01790 gene rsmA 20378 19521 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651548.1 protein_id gnl|my_center|LOCUS_01790 20468 20543 gene locus_tag LOCUS_t00030 20468 20543 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22796 20724 gene locus_tag LOCUS_01800 22796 20724 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_01800 23173 22793 gene locus_tag LOCUS_01810 23173 22793 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_01810 24521 23157 gene locus_tag LOCUS_01820 24521 23157 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965302.1 protein_id gnl|my_center|LOCUS_01820 26477 24603 gene locus_tag LOCUS_01830 26477 24603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 26652 28097 gene locus_tag LOCUS_01840 26652 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 28121 29026 gene locus_tag LOCUS_01850 28121 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 30282 29176 gene locus_tag LOCUS_01860 30282 29176 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051462.1 protein_id gnl|my_center|LOCUS_01860 30455 31648 gene locus_tag LOCUS_01870 30455 31648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 31704 32162 gene locus_tag LOCUS_01880 31704 32162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 32172 32936 gene locus_tag LOCUS_01890 32172 32936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 32936 33550 gene locus_tag LOCUS_01900 32936 33550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 34422 33616 gene locus_tag LOCUS_01910 34422 33616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 34802 34527 gene locus_tag LOCUS_01920 34802 34527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 36687 34933 gene locus_tag LOCUS_01930 36687 34933 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_01930 38612 37011 gene locus_tag LOCUS_01940 38612 37011 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_01940 41876 38736 gene locus_tag LOCUS_01950 41876 38736 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262372.1 protein_id gnl|my_center|LOCUS_01950 42091 42423 gene locus_tag LOCUS_01960 42091 42423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 42454 43296 gene locus_tag LOCUS_01970 42454 43296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 43299 44279 gene locus_tag LOCUS_01980 43299 44279 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994644.1 protein_id gnl|my_center|LOCUS_01980 44834 44517 gene locus_tag LOCUS_01990 44834 44517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 46486 45188 gene locus_tag LOCUS_02000 46486 45188 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 protein_id gnl|my_center|LOCUS_02000 47310 46594 gene locus_tag LOCUS_02010 gene deoD 47310 46594 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_02010 47993 47328 gene locus_tag LOCUS_02020 gene deoC 47993 47328 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_02020 48209 48297 gene locus_tag LOCUS_t00040 48209 48297 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48302 48379 gene locus_tag LOCUS_t00050 48302 48379 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 50135 48996 gene locus_tag LOCUS_02030 50135 48996 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_02030 50395 50201 gene locus_tag LOCUS_02040 50395 50201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 52121 50388 gene locus_tag LOCUS_02050 52121 50388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 52436 52777 gene locus_tag LOCUS_02060 52436 52777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 52777 53361 gene locus_tag LOCUS_02070 52777 53361 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001631032.1 protein_id gnl|my_center|LOCUS_02070 53600 53445 gene locus_tag LOCUS_02080 53600 53445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 54160 53627 gene locus_tag LOCUS_02090 54160 53627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 54658 54173 gene locus_tag LOCUS_02100 54658 54173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 54958 54698 gene locus_tag LOCUS_02110 54958 54698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 55700 56023 gene locus_tag LOCUS_02120 55700 56023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 56139 56603 gene locus_tag LOCUS_02130 56139 56603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 56735 57976 gene locus_tag LOCUS_02140 56735 57976 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769287.1 protein_id gnl|my_center|LOCUS_02140 58000 58896 gene locus_tag LOCUS_02150 58000 58896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 58911 59333 gene locus_tag LOCUS_02160 gene pth2 58911 59333 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_02160 59416 60138 gene locus_tag LOCUS_02170 59416 60138 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_02170 60243 60929 gene locus_tag LOCUS_02180 60243 60929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 61219 61875 gene locus_tag LOCUS_02190 61219 61875 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02190 61922 63853 gene locus_tag LOCUS_02200 61922 63853 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964289.1 protein_id gnl|my_center|LOCUS_02200 63917 65275 gene locus_tag LOCUS_02210 63917 65275 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_02210 65769 65563 gene locus_tag LOCUS_02220 65769 65563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 66745 65963 gene locus_tag LOCUS_02230 66745 65963 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975956.1 protein_id gnl|my_center|LOCUS_02230 66910 67338 gene locus_tag LOCUS_02240 66910 67338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 68337 67435 gene locus_tag LOCUS_02250 68337 67435 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133938067.1 protein_id gnl|my_center|LOCUS_02250 70378 68363 gene locus_tag LOCUS_02260 70378 68363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 70530 71300 gene locus_tag LOCUS_02270 70530 71300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 71324 72475 gene locus_tag LOCUS_02280 71324 72475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 72638 72931 gene locus_tag LOCUS_02290 72638 72931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 74640 73072 gene locus_tag LOCUS_02300 74640 73072 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_02300 75675 74641 gene locus_tag LOCUS_02310 75675 74641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 76014 75682 gene locus_tag LOCUS_02320 76014 75682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 76460 76011 gene locus_tag LOCUS_02330 76460 76011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 77243 76638 gene locus_tag LOCUS_02340 gene lexA 77243 76638 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383895.1 protein_id gnl|my_center|LOCUS_02340 78374 77418 gene locus_tag LOCUS_02350 78374 77418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 81153 78742 gene locus_tag LOCUS_02360 81153 78742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 82296 81367 gene locus_tag LOCUS_02370 82296 81367 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_02370 82979 82701 gene locus_tag LOCUS_02380 82979 82701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 83332 82976 gene locus_tag LOCUS_02390 83332 82976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 83587 83506 gene locus_tag LOCUS_t00060 83587 83506 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 84973 83684 gene locus_tag LOCUS_02400 84973 83684 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_02400 85048 85167 gene locus_tag LOCUS_02410 85048 85167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 85148 85414 gene locus_tag LOCUS_02420 85148 85414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 85522 86697 gene locus_tag LOCUS_02430 85522 86697 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_02430 87169 86759 gene locus_tag LOCUS_02440 87169 86759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 88072 87257 gene locus_tag LOCUS_02450 gene proC 88072 87257 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836906.1 protein_id gnl|my_center|LOCUS_02450 89339 88083 gene locus_tag LOCUS_02460 89339 88083 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922104.1 protein_id gnl|my_center|LOCUS_02460 89671 89336 gene locus_tag LOCUS_02470 89671 89336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 90595 89822 gene locus_tag LOCUS_02480 gene proB 90595 89822 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_02480 91351 90647 gene locus_tag LOCUS_02490 91351 90647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 91850 91485 gene locus_tag LOCUS_02500 91850 91485 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399582.1 protein_id gnl|my_center|LOCUS_02500 93116 91851 gene locus_tag LOCUS_02510 93116 91851 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_02510 94559 93126 gene locus_tag LOCUS_02520 94559 93126 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_02520 95579 94815 gene locus_tag LOCUS_02530 95579 94815 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_02530 96864 95806 gene locus_tag LOCUS_02540 96864 95806 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582826.1 protein_id gnl|my_center|LOCUS_02540 97907 96885 gene locus_tag LOCUS_02550 97907 96885 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_02550 101441 97926 gene locus_tag LOCUS_02560 101441 97926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 103608 101458 gene locus_tag LOCUS_02570 103608 101458 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_02570 104502 103627 gene locus_tag LOCUS_02580 104502 103627 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_02580 105466 104504 gene locus_tag LOCUS_02590 105466 104504 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_02590 108508 105491 gene locus_tag LOCUS_02600 108508 105491 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_02600 110145 109108 gene locus_tag LOCUS_02610 gene mnmA 110145 109108 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_02610 110599 110162 gene locus_tag LOCUS_02620 gene rnhA 110599 110162 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_02620 111631 110624 gene locus_tag LOCUS_02630 111631 110624 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083301.1 protein_id gnl|my_center|LOCUS_02630 111808 111653 gene locus_tag LOCUS_02640 111808 111653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 113304 112051 gene locus_tag LOCUS_02650 113304 112051 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_02650 114143 113508 gene locus_tag LOCUS_02660 114143 113508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 114792 114160 gene locus_tag LOCUS_02670 114792 114160 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_02670 115390 114797 gene locus_tag LOCUS_02680 115390 114797 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965573.1 protein_id gnl|my_center|LOCUS_02680 117469 115412 gene locus_tag LOCUS_02690 117469 115412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 117710 118888 gene locus_tag LOCUS_02700 gene thiI 117710 118888 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_02700 119266 120054 gene locus_tag LOCUS_02710 gene minD 119266 120054 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880533.1 protein_id gnl|my_center|LOCUS_02710 120144 120530 gene locus_tag LOCUS_02720 gene mgsA 120144 120530 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230640.1 protein_id gnl|my_center|LOCUS_02720 120892 122169 gene locus_tag LOCUS_02730 120892 122169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 123494 122358 gene locus_tag LOCUS_02740 123494 122358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 124907 123507 gene locus_tag LOCUS_02750 124907 123507 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_02750 125708 124962 gene locus_tag LOCUS_02760 125708 124962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 126343 125756 gene locus_tag LOCUS_02770 126343 125756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 126836 126336 gene locus_tag LOCUS_02780 126836 126336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 128786 127041 gene locus_tag LOCUS_02790 128786 127041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 129390 128797 gene locus_tag LOCUS_02800 129390 128797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 130369 129473 gene locus_tag LOCUS_02810 130369 129473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 130795 130409 gene locus_tag LOCUS_02820 130795 130409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 132389 130788 gene locus_tag LOCUS_02830 132389 130788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 133742 132435 gene locus_tag LOCUS_02840 133742 132435 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_02840 134163 133732 gene locus_tag LOCUS_02850 134163 133732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 134371 134165 gene locus_tag LOCUS_02860 134371 134165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 135022 134765 gene locus_tag LOCUS_02870 135022 134765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 136717 135287 gene locus_tag LOCUS_02880 136717 135287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 137739 136852 gene locus_tag LOCUS_02890 137739 136852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 138185 137766 gene locus_tag LOCUS_02900 138185 137766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 138356 138273 gene locus_tag LOCUS_t00070 138356 138273 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 138540 138615 gene locus_tag LOCUS_t00080 138540 138615 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 140422 138716 gene locus_tag LOCUS_02910 gene tndX 140422 138716 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_02910 140636 140397 gene locus_tag LOCUS_02920 140636 140397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 141523 140633 gene locus_tag LOCUS_02930 141523 140633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 141900 141520 gene locus_tag LOCUS_02940 141900 141520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 144715 142943 gene locus_tag LOCUS_02950 144715 142943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 146008 144719 gene locus_tag LOCUS_02960 146008 144719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 148096 146087 gene locus_tag LOCUS_02970 148096 146087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 <149299 148111 gene locus_tag LOCUS_02980 <149299 148111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003690162.1:DNA adenine methylase >Feature sequence03 1512 226 gene locus_tag LOCUS_02990 1512 226 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_02990 2249 4876 gene locus_tag LOCUS_03000 2249 4876 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_03000 5125 6372 gene locus_tag LOCUS_03010 5125 6372 CDS product YidE/YbjL duplication inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280515.1 protein_id gnl|my_center|LOCUS_03010 8277 6445 gene locus_tag LOCUS_03020 8277 6445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_03020 9994 8270 gene locus_tag LOCUS_03030 9994 8270 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_03030 10422 9991 gene locus_tag LOCUS_03040 10422 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 12012 10675 gene locus_tag LOCUS_03050 12012 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 13296 12025 gene locus_tag LOCUS_03060 13296 12025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 13609 13361 gene locus_tag LOCUS_03070 13609 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 15253 13946 gene locus_tag LOCUS_03080 15253 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 15729 15271 gene locus_tag LOCUS_03090 15729 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 16586 15660 gene locus_tag LOCUS_03100 16586 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 16988 16737 gene locus_tag LOCUS_03110 16988 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 17367 17002 gene locus_tag LOCUS_03120 17367 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 18326 17565 gene locus_tag LOCUS_03130 18326 17565 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937650.1 protein_id gnl|my_center|LOCUS_03130 18630 18878 gene locus_tag LOCUS_03140 18630 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 19151 20236 gene locus_tag LOCUS_03150 gene uxuA 19151 20236 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244855.1 protein_id gnl|my_center|LOCUS_03150 20252 20812 gene locus_tag LOCUS_03160 20252 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 21032 21721 gene locus_tag LOCUS_03170 21032 21721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_03170 21797 23266 gene locus_tag LOCUS_03180 21797 23266 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_03180 23557 24228 gene locus_tag LOCUS_03190 gene rpe 23557 24228 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992061.1 protein_id gnl|my_center|LOCUS_03190 24241 25185 gene locus_tag LOCUS_03200 24241 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 26580 25273 gene locus_tag LOCUS_03210 26580 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 28050 26611 gene locus_tag LOCUS_03220 28050 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 28198 28710 gene locus_tag LOCUS_03230 28198 28710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 28707 29222 gene locus_tag LOCUS_03240 28707 29222 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547510.1 protein_id gnl|my_center|LOCUS_03240 29303 29929 gene locus_tag LOCUS_03250 29303 29929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 31762 30008 gene locus_tag LOCUS_03260 31762 30008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_03260 33492 31759 gene locus_tag LOCUS_03270 33492 31759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_03270 34204 33485 gene locus_tag LOCUS_03280 34204 33485 CDS product 4Fe-4S double cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860330.1 protein_id gnl|my_center|LOCUS_03280 35527 34232 gene locus_tag LOCUS_03290 35527 34232 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_03290 35516 35695 gene locus_tag LOCUS_03300 35516 35695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 35983 36972 gene locus_tag LOCUS_03310 35983 36972 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_03310 37092 38912 gene locus_tag LOCUS_03320 37092 38912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 39010 41643 gene locus_tag LOCUS_03330 39010 41643 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_03330 41739 42632 gene locus_tag LOCUS_03340 41739 42632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 42775 43689 gene locus_tag LOCUS_03350 42775 43689 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_03350 43709 44359 gene locus_tag LOCUS_03360 43709 44359 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_03360 44475 45200 gene locus_tag LOCUS_03370 gene pyrH 44475 45200 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_03370 45197 45751 gene locus_tag LOCUS_03380 gene frr 45197 45751 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_03380 45826 46521 gene locus_tag LOCUS_03390 45826 46521 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_03390 46523 47398 gene locus_tag LOCUS_03400 46523 47398 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732813.1 protein_id gnl|my_center|LOCUS_03400 47414 48565 gene locus_tag LOCUS_03410 47414 48565 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_03410 48585 49646 gene locus_tag LOCUS_03420 gene rseP 48585 49646 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_03420 49670 50749 gene locus_tag LOCUS_03430 gene ispG 49670 50749 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_03430 50833 55197 gene locus_tag LOCUS_03440 50833 55197 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_03440 55334 55609 gene locus_tag LOCUS_03450 55334 55609 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359333.1 protein_id gnl|my_center|LOCUS_03450 55687 55929 gene locus_tag LOCUS_03460 55687 55929 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_03460 55994 56269 gene locus_tag LOCUS_03470 55994 56269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 56804 57073 gene locus_tag LOCUS_03480 56804 57073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 57162 57458 gene locus_tag LOCUS_03490 57162 57458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 57528 59354 gene locus_tag LOCUS_03500 57528 59354 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_03500 59595 60158 gene locus_tag LOCUS_03510 59595 60158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 62046 60511 gene locus_tag LOCUS_03520 62046 60511 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_03520 63504 62215 gene locus_tag LOCUS_03530 63504 62215 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_03530 64417 63521 gene locus_tag LOCUS_03540 64417 63521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 65913 64432 gene locus_tag LOCUS_03550 65913 64432 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_03550 66380 65919 gene locus_tag LOCUS_03560 gene dtd 66380 65919 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965571.1 protein_id gnl|my_center|LOCUS_03560 68595 66397 gene locus_tag LOCUS_03570 68595 66397 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_03570 70744 68636 gene locus_tag LOCUS_03580 70744 68636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 72376 70778 gene locus_tag LOCUS_03590 72376 70778 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_03590 72885 72382 gene locus_tag LOCUS_03600 72885 72382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 73708 72911 gene locus_tag LOCUS_03610 gene cdaA 73708 72911 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_03610 73947 74720 gene locus_tag LOCUS_03620 gene ispD 73947 74720 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_03620 74751 75230 gene locus_tag LOCUS_03630 gene ispF 74751 75230 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459082.1 protein_id gnl|my_center|LOCUS_03630 75466 76260 gene locus_tag LOCUS_03640 gene spo0A 75466 76260 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_03640 76972 76310 gene locus_tag LOCUS_03650 76972 76310 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_03650 77557 77078 gene locus_tag LOCUS_03660 77557 77078 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576872.1 protein_id gnl|my_center|LOCUS_03660 79610 77631 gene locus_tag LOCUS_03670 79610 77631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 82680 79714 gene locus_tag LOCUS_03680 gene infB 82680 79714 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541506.1 protein_id gnl|my_center|LOCUS_03680 83017 82697 gene locus_tag LOCUS_03690 83017 82697 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286523.1 protein_id gnl|my_center|LOCUS_03690 83292 83014 gene locus_tag LOCUS_03700 83292 83014 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_03700 84592 83309 gene locus_tag LOCUS_03710 84592 83309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 85108 84617 gene locus_tag LOCUS_03720 gene rimP 85108 84617 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_03720 86305 85496 gene locus_tag LOCUS_03730 86305 85496 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_03730 87049 86333 gene locus_tag LOCUS_03740 87049 86333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522364.1 protein_id gnl|my_center|LOCUS_03740 88059 87046 gene locus_tag LOCUS_03750 88059 87046 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_03750 89296 88367 gene locus_tag LOCUS_03760 89296 88367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 90102 89446 gene locus_tag LOCUS_03770 90102 89446 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420189.1 protein_id gnl|my_center|LOCUS_03770 90805 90080 gene locus_tag LOCUS_03780 90805 90080 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_03780 90978 94064 gene locus_tag LOCUS_03790 90978 94064 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_03790 94615 94106 gene locus_tag LOCUS_03800 94615 94106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 95396 94608 gene locus_tag LOCUS_03810 95396 94608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 95627 97531 gene locus_tag LOCUS_03820 95627 97531 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_03820 98323 97571 gene locus_tag LOCUS_03830 98323 97571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 99579 98458 gene locus_tag LOCUS_03840 99579 98458 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_03840 99791 101038 gene locus_tag LOCUS_03850 99791 101038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 101147 102046 gene locus_tag LOCUS_03860 gene rbsK 101147 102046 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212251.1 protein_id gnl|my_center|LOCUS_03860 102162 104576 gene locus_tag LOCUS_03870 102162 104576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 105397 104606 gene locus_tag LOCUS_03880 105397 104606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 105737 105411 gene locus_tag LOCUS_03890 105737 105411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 107453 105819 gene locus_tag LOCUS_03900 107453 105819 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_03900 108255 107470 gene locus_tag LOCUS_03910 108255 107470 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_03910 108781 108260 gene locus_tag LOCUS_03920 108781 108260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 110325 109126 gene locus_tag LOCUS_03930 110325 109126 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_03930 110529 110329 gene locus_tag LOCUS_03940 110529 110329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 110902 110600 gene locus_tag LOCUS_03950 110902 110600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 111039 110848 gene locus_tag LOCUS_03960 111039 110848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 111592 111050 gene locus_tag LOCUS_03970 111592 111050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 111804 111598 gene locus_tag LOCUS_03980 111804 111598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 112032 111808 gene locus_tag LOCUS_03990 gene acpP 112032 111808 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753030.1 protein_id gnl|my_center|LOCUS_03990 113729 112347 gene locus_tag LOCUS_04000 113729 112347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 114315 116129 gene locus_tag LOCUS_04010 114315 116129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 116126 116344 gene locus_tag LOCUS_04020 116126 116344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 116997 116419 gene locus_tag LOCUS_04030 116997 116419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 118409 117141 gene locus_tag LOCUS_04040 118409 117141 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence04 368 694 gene locus_tag LOCUS_04050 368 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 688 1044 gene locus_tag LOCUS_04060 gene tnpB 688 1044 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748777.1 protein_id gnl|my_center|LOCUS_04060 1135 2706 gene locus_tag LOCUS_04070 1135 2706 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_04070 2953 3519 gene locus_tag LOCUS_04080 2953 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3509 4240 gene locus_tag LOCUS_04090 3509 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 4309 4566 gene locus_tag LOCUS_04100 4309 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4496 4852 gene locus_tag LOCUS_04110 4496 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 4858 5811 gene locus_tag LOCUS_04120 4858 5811 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_04120 5918 6229 gene locus_tag LOCUS_04130 5918 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 6273 7595 gene locus_tag LOCUS_04140 6273 7595 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_04140 7570 8370 gene locus_tag LOCUS_04150 7570 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 8386 8907 gene locus_tag LOCUS_04160 8386 8907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 8897 10411 gene locus_tag LOCUS_04170 8897 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 10395 10730 gene locus_tag LOCUS_04180 10395 10730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 10742 11578 gene locus_tag LOCUS_04190 10742 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 11644 11991 gene locus_tag LOCUS_04200 11644 11991 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513548.1 protein_id gnl|my_center|LOCUS_04200 12005 12316 gene locus_tag LOCUS_04210 12005 12316 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526806.1 protein_id gnl|my_center|LOCUS_04210 12382 12711 gene locus_tag LOCUS_04220 12382 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 12708 15026 gene locus_tag LOCUS_04230 12708 15026 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_04230 15077 16123 gene locus_tag LOCUS_04240 15077 16123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 16256 17332 gene locus_tag LOCUS_04250 16256 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 17779 17459 gene locus_tag LOCUS_04260 17779 17459 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_04260 17933 18319 gene locus_tag LOCUS_04270 17933 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 18397 19014 gene locus_tag LOCUS_04280 18397 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 18992 19705 gene locus_tag LOCUS_04290 18992 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 19803 20213 gene locus_tag LOCUS_04300 19803 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 20449 21591 gene locus_tag LOCUS_04310 20449 21591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 21612 23015 gene locus_tag LOCUS_04320 21612 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 23033 24067 gene locus_tag LOCUS_04330 23033 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 24093 24239 gene locus_tag LOCUS_04340 24093 24239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 24374 24532 gene locus_tag LOCUS_04350 24374 24532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 24904 25065 gene locus_tag LOCUS_04360 24904 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 25965 27092 gene locus_tag LOCUS_04370 25965 27092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 27105 28871 gene locus_tag LOCUS_04380 27105 28871 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_04380 29068 30492 gene locus_tag LOCUS_04390 29068 30492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 30826 31092 gene locus_tag LOCUS_04400 30826 31092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 31930 33471 gene locus_tag LOCUS_04410 31930 33471 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_04410 33729 34664 gene locus_tag LOCUS_04420 33729 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 35026 36063 gene locus_tag LOCUS_04430 35026 36063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 36775 36966 gene locus_tag LOCUS_04440 36775 36966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 37002 37388 gene locus_tag LOCUS_04450 37002 37388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 38055 38348 gene locus_tag LOCUS_04460 38055 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 38820 39257 gene locus_tag LOCUS_04470 38820 39257 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_04470 39556 40215 gene locus_tag LOCUS_04480 39556 40215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 40365 40517 gene locus_tag LOCUS_04490 40365 40517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 40582 40947 gene locus_tag LOCUS_04500 40582 40947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 40955 41146 gene locus_tag LOCUS_04510 40955 41146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 41165 42790 gene locus_tag LOCUS_04520 41165 42790 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272719.1 protein_id gnl|my_center|LOCUS_04520 44217 42940 gene locus_tag LOCUS_04530 44217 42940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 45355 44960 gene locus_tag LOCUS_04540 45355 44960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 45900 46676 gene locus_tag LOCUS_04550 45900 46676 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_04550 47323 46778 gene locus_tag LOCUS_04560 47323 46778 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209000318.1 protein_id gnl|my_center|LOCUS_04560 48147 47392 gene locus_tag LOCUS_04570 48147 47392 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970686.1 protein_id gnl|my_center|LOCUS_04570 48963 48358 gene locus_tag LOCUS_04580 48963 48358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 49745 49125 gene locus_tag LOCUS_04590 49745 49125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 50501 49977 gene locus_tag LOCUS_04600 50501 49977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 50813 52378 gene locus_tag LOCUS_04610 50813 52378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 52539 52793 gene locus_tag LOCUS_04620 52539 52793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 53230 54078 gene locus_tag LOCUS_04630 53230 54078 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_04630 54101 54670 gene locus_tag LOCUS_04640 54101 54670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 54862 55617 gene locus_tag LOCUS_04650 54862 55617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 55735 56385 gene locus_tag LOCUS_04660 55735 56385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 56407 57150 gene locus_tag LOCUS_04670 56407 57150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 57271 57344 gene locus_tag LOCUS_t00090 57271 57344 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 57353 57429 gene locus_tag LOCUS_t00100 57353 57429 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57445 57521 gene locus_tag LOCUS_t00110 57445 57521 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 58503 57700 gene locus_tag LOCUS_04680 58503 57700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 58664 59680 gene locus_tag LOCUS_04690 58664 59680 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_04690 59702 60493 gene locus_tag LOCUS_04700 59702 60493 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989419.1 protein_id gnl|my_center|LOCUS_04700 60528 61319 gene locus_tag LOCUS_04710 60528 61319 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989419.1 protein_id gnl|my_center|LOCUS_04710 61395 61961 gene locus_tag LOCUS_04720 61395 61961 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365240.1 protein_id gnl|my_center|LOCUS_04720 62047 63111 gene locus_tag LOCUS_04730 62047 63111 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_04730 63222 64208 gene locus_tag LOCUS_04740 63222 64208 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_04740 64440 64853 gene locus_tag LOCUS_04750 64440 64853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 64930 66249 gene locus_tag LOCUS_04760 gene melA 64930 66249 CDS product alpha-galactosidase MelA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246000.1 protein_id gnl|my_center|LOCUS_04760 66923 66462 gene locus_tag LOCUS_04770 66923 66462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 67083 67304 gene locus_tag LOCUS_04780 67083 67304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 67464 67595 gene locus_tag LOCUS_04790 67464 67595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 68274 67570 gene locus_tag LOCUS_04800 68274 67570 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_04800 71915 68358 gene locus_tag LOCUS_04810 gene nifJ 71915 68358 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_04810 72133 72672 gene locus_tag LOCUS_04820 72133 72672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 73840 72653 gene locus_tag LOCUS_04830 73840 72653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 74697 74002 gene locus_tag LOCUS_04840 gene rplA 74697 74002 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_04840 75146 74721 gene locus_tag LOCUS_04850 gene rplK 75146 74721 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_04850 75795 75250 gene locus_tag LOCUS_04860 gene nusG 75795 75250 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_04860 76057 75815 gene locus_tag LOCUS_04870 76057 75815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 76241 76092 gene locus_tag LOCUS_04880 gene rpmG 76241 76092 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_04880 77300 76581 gene locus_tag LOCUS_04890 77300 76581 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_04890 78939 77323 gene locus_tag LOCUS_04900 78939 77323 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_04900 79225 80127 gene locus_tag LOCUS_04910 79225 80127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 81560 80277 gene locus_tag LOCUS_04920 gene obgE 81560 80277 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_04920 83734 81743 gene locus_tag LOCUS_04930 gene ligA 83734 81743 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_04930 83896 84129 gene locus_tag LOCUS_04940 83896 84129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 84279 84560 gene locus_tag LOCUS_04950 84279 84560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 84600 86348 gene locus_tag LOCUS_04960 84600 86348 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_04960 87693 86512 gene locus_tag LOCUS_04970 87693 86512 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338522.1 protein_id gnl|my_center|LOCUS_04970 87838 88536 gene locus_tag LOCUS_04980 87838 88536 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_04980 88680 89402 gene locus_tag LOCUS_04990 88680 89402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_04990 89386 90960 gene locus_tag LOCUS_05000 89386 90960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036818.1 protein_id gnl|my_center|LOCUS_05000 90978 91709 gene locus_tag LOCUS_05010 90978 91709 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355974.1 protein_id gnl|my_center|LOCUS_05010 91706 92521 gene locus_tag LOCUS_05020 91706 92521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 95900 92751 gene locus_tag LOCUS_05030 gene ileS 95900 92751 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_05030 97516 96413 gene locus_tag LOCUS_05040 97516 96413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 98390 97542 gene locus_tag LOCUS_05050 98390 97542 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_05050 98796 100595 gene locus_tag LOCUS_05060 gene thrS 98796 100595 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_05060 100592 101071 gene locus_tag LOCUS_05070 100592 101071 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001861299.1 protein_id gnl|my_center|LOCUS_05070 101087 101518 gene locus_tag LOCUS_05080 101087 101518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 101551 102507 gene locus_tag LOCUS_05090 101551 102507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 102719 102794 gene locus_tag LOCUS_t00120 102719 102794 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 103993 102926 gene locus_tag LOCUS_05100 103993 102926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 104683 104174 gene locus_tag LOCUS_05110 104683 104174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 106466 104751 gene locus_tag LOCUS_05120 gene argS 106466 104751 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020254.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence05 232 939 gene locus_tag LOCUS_05130 232 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 936 1802 gene locus_tag LOCUS_05140 936 1802 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860782.1 protein_id gnl|my_center|LOCUS_05140 1803 2009 gene locus_tag LOCUS_05150 1803 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2139 2702 gene locus_tag LOCUS_05160 2139 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2748 3323 gene locus_tag LOCUS_05170 2748 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3434 4528 gene locus_tag LOCUS_05180 gene ychF 3434 4528 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_05180 4583 5677 gene locus_tag LOCUS_05190 4583 5677 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_05190 5950 5708 gene locus_tag LOCUS_05200 5950 5708 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109531.1 protein_id gnl|my_center|LOCUS_05200 6059 6997 gene locus_tag LOCUS_05210 6059 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 9201 7069 gene locus_tag LOCUS_05220 9201 7069 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949064.1 protein_id gnl|my_center|LOCUS_05220 10682 9261 gene locus_tag LOCUS_05230 10682 9261 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_05230 12113 10701 gene locus_tag LOCUS_05240 12113 10701 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_05240 12740 13729 gene locus_tag LOCUS_05250 12740 13729 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_05250 13746 14711 gene locus_tag LOCUS_05260 13746 14711 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371274.1 protein_id gnl|my_center|LOCUS_05260 14704 15477 gene locus_tag LOCUS_05270 14704 15477 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_05270 16576 15623 gene locus_tag LOCUS_05280 gene pyrF 16576 15623 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138240.1 protein_id gnl|my_center|LOCUS_05280 17407 16580 gene locus_tag LOCUS_05290 17407 16580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 18106 17552 gene locus_tag LOCUS_05300 18106 17552 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047752.1 protein_id gnl|my_center|LOCUS_05300 18276 19472 gene locus_tag LOCUS_05310 18276 19472 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_05310 19494 20588 gene locus_tag LOCUS_05320 gene pheA 19494 20588 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_05320 20604 21617 gene locus_tag LOCUS_05330 gene aroB 20604 21617 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289143.1 protein_id gnl|my_center|LOCUS_05330 21614 22717 gene locus_tag LOCUS_05340 gene aroC 21614 22717 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_05340 22714 23973 gene locus_tag LOCUS_05350 22714 23973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 23970 24404 gene locus_tag LOCUS_05360 gene aroQ 23970 24404 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903558.1 protein_id gnl|my_center|LOCUS_05360 24411 25631 gene locus_tag LOCUS_05370 gene aroA 24411 25631 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_05370 25635 26495 gene locus_tag LOCUS_05380 25635 26495 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_05380 26723 27754 gene locus_tag LOCUS_05390 26723 27754 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_05390 28100 30643 gene locus_tag LOCUS_05400 28100 30643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 30734 31195 gene locus_tag LOCUS_05410 30734 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 31620 31264 gene locus_tag LOCUS_05420 31620 31264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 33669 31657 gene locus_tag LOCUS_05430 33669 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 35276 33858 gene locus_tag LOCUS_05440 35276 33858 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_05440 35734 36387 gene locus_tag LOCUS_05450 35734 36387 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_05450 36377 37474 gene locus_tag LOCUS_05460 36377 37474 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_05460 37624 38103 gene locus_tag LOCUS_05470 37624 38103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 38350 38066 gene locus_tag LOCUS_05480 38350 38066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 38607 38326 gene locus_tag LOCUS_05490 38607 38326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 38789 39925 gene locus_tag LOCUS_05500 38789 39925 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948545.1 protein_id gnl|my_center|LOCUS_05500 40575 39922 gene locus_tag LOCUS_05510 40575 39922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 41827 41402 gene locus_tag LOCUS_05520 41827 41402 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_05520 42762 41830 gene locus_tag LOCUS_05530 gene manA 42762 41830 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232833.1 protein_id gnl|my_center|LOCUS_05530 42884 44077 gene locus_tag LOCUS_05540 42884 44077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 44510 44058 gene locus_tag LOCUS_05550 44510 44058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 45094 44561 gene locus_tag LOCUS_05560 45094 44561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 45698 45096 gene locus_tag LOCUS_05570 45698 45096 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_05570 46560 45688 gene locus_tag LOCUS_05580 46560 45688 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_05580 47781 46570 gene locus_tag LOCUS_05590 47781 46570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 51382 47867 gene locus_tag LOCUS_05600 gene mfd 51382 47867 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_05600 51870 51397 gene locus_tag LOCUS_05610 51870 51397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 52501 51875 gene locus_tag LOCUS_05620 gene pth 52501 51875 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_05620 52767 55400 gene locus_tag LOCUS_05630 gene ppdK 52767 55400 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_05630 56023 55589 gene locus_tag LOCUS_05640 gene nifU 56023 55589 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_05640 57225 56035 gene locus_tag LOCUS_05650 gene nifS 57225 56035 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_05650 57532 57389 gene locus_tag LOCUS_05660 57532 57389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 58079 57942 gene locus_tag LOCUS_05670 58079 57942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 58350 58198 gene locus_tag LOCUS_05680 58350 58198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 60432 58567 gene locus_tag LOCUS_05690 60432 58567 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_05690 62240 60429 gene locus_tag LOCUS_05700 62240 60429 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_05700 63085 62405 gene locus_tag LOCUS_05710 63085 62405 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_05710 63798 63085 gene locus_tag LOCUS_05720 63798 63085 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_05720 64092 64343 gene locus_tag LOCUS_05730 64092 64343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 64461 65099 gene locus_tag LOCUS_05740 64461 65099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 65096 65521 gene locus_tag LOCUS_05750 65096 65521 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921433.1 protein_id gnl|my_center|LOCUS_05750 66577 65513 gene locus_tag LOCUS_05760 gene mutY 66577 65513 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 protein_id gnl|my_center|LOCUS_05760 67362 66574 gene locus_tag LOCUS_05770 67362 66574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 67499 68137 gene locus_tag LOCUS_05780 67499 68137 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_05780 68147 69265 gene locus_tag LOCUS_05790 68147 69265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 69964 69383 gene locus_tag LOCUS_05800 69964 69383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 71924 69981 gene locus_tag LOCUS_05810 71924 69981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 73219 71921 gene locus_tag LOCUS_05820 73219 71921 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_05820 73870 73286 gene locus_tag LOCUS_05830 73870 73286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 74975 73857 gene locus_tag LOCUS_05840 74975 73857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 75934 74975 gene locus_tag LOCUS_05850 75934 74975 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_05850 78357 76051 gene locus_tag LOCUS_05860 78357 76051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 79486 78527 gene locus_tag LOCUS_05870 79486 78527 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_05870 79906 80169 gene locus_tag LOCUS_05880 gene rpsO 79906 80169 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_05880 80366 82462 gene locus_tag LOCUS_05890 gene pnp 80366 82462 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_05890 82637 82563 gene locus_tag LOCUS_t00130 82637 82563 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 85149 82762 gene locus_tag LOCUS_05900 85149 82762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 86479 85166 gene locus_tag LOCUS_05910 86479 85166 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948726.1 protein_id gnl|my_center|LOCUS_05910 87384 86512 gene locus_tag LOCUS_05920 87384 86512 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081106.1 protein_id gnl|my_center|LOCUS_05920 88099 87386 gene locus_tag LOCUS_05930 88099 87386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 88530 88123 gene locus_tag LOCUS_05940 88530 88123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 88881 88693 gene locus_tag LOCUS_05950 88881 88693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 89499 89005 gene locus_tag LOCUS_05960 89499 89005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 93110 89523 gene locus_tag LOCUS_05970 gene addA 93110 89523 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 protein_id gnl|my_center|LOCUS_05970 94701 93112 gene locus_tag LOCUS_05980 94701 93112 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583098.1 protein_id gnl|my_center|LOCUS_05980 95650 94850 gene locus_tag LOCUS_05990 95650 94850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 97580 95790 gene locus_tag LOCUS_06000 97580 95790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 98407 97577 gene locus_tag LOCUS_06010 98407 97577 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872006.1 protein_id gnl|my_center|LOCUS_06010 100840 98420 gene locus_tag LOCUS_06020 100840 98420 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107276.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence06 289 576 gene locus_tag LOCUS_06030 289 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2571 967 gene locus_tag LOCUS_06040 2571 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4308 2731 gene locus_tag LOCUS_06050 4308 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6168 4555 gene locus_tag LOCUS_06060 6168 4555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7230 6268 gene locus_tag LOCUS_06070 7230 6268 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055164393.1 protein_id gnl|my_center|LOCUS_06070 8559 7393 gene locus_tag LOCUS_06080 8559 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 9623 8934 gene locus_tag LOCUS_06090 9623 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 10363 9722 gene locus_tag LOCUS_06100 10363 9722 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761359.1 protein_id gnl|my_center|LOCUS_06100 12669 10459 gene locus_tag LOCUS_06110 gene gyrA 12669 10459 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656784.1 protein_id gnl|my_center|LOCUS_06110 14876 12882 gene locus_tag LOCUS_06120 gene gyrB 14876 12882 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874360.1 protein_id gnl|my_center|LOCUS_06120 15188 16006 gene locus_tag LOCUS_06130 gene queG 15188 16006 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438992.1 protein_id gnl|my_center|LOCUS_06130 16781 20029 gene locus_tag LOCUS_06140 gene addB 16781 20029 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_06140 20251 22098 gene locus_tag LOCUS_06150 20251 22098 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_06150 22074 22745 gene locus_tag LOCUS_06160 22074 22745 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_06160 22934 23239 gene locus_tag LOCUS_06170 22934 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 23307 24140 gene locus_tag LOCUS_06180 23307 24140 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_06180 24221 26167 gene locus_tag LOCUS_06190 24221 26167 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_06190 26207 26944 gene locus_tag LOCUS_06200 26207 26944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 27294 27118 gene locus_tag LOCUS_06210 27294 27118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 27849 27319 gene locus_tag LOCUS_06220 gene sigX 27849 27319 CDS product RNA polymerase sigma factor SigX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230521.1 protein_id gnl|my_center|LOCUS_06220 28017 28697 gene locus_tag LOCUS_06230 28017 28697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 28752 29693 gene locus_tag LOCUS_06240 28752 29693 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392568.1 protein_id gnl|my_center|LOCUS_06240 29690 31015 gene locus_tag LOCUS_06250 29690 31015 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048018.1 protein_id gnl|my_center|LOCUS_06250 31038 31319 gene locus_tag LOCUS_06260 31038 31319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 31465 32778 gene locus_tag LOCUS_06270 gene xylA 31465 32778 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898127.1 protein_id gnl|my_center|LOCUS_06270 33166 34683 gene locus_tag LOCUS_06280 gene xylB 33166 34683 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_06280 34811 35551 gene locus_tag LOCUS_06290 34811 35551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 36649 35876 gene locus_tag LOCUS_06300 gene sigG 36649 35876 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_06300 37012 37794 gene locus_tag LOCUS_06310 37012 37794 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_06310 37856 38062 gene locus_tag LOCUS_06320 37856 38062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 38111 39526 gene locus_tag LOCUS_06330 38111 39526 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_06330 40633 39770 gene locus_tag LOCUS_06340 40633 39770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 42253 40655 gene locus_tag LOCUS_06350 42253 40655 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_06350 44002 42383 gene locus_tag LOCUS_06360 44002 42383 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251368.1 protein_id gnl|my_center|LOCUS_06360 46318 44066 gene locus_tag LOCUS_06370 46318 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 48016 46409 gene locus_tag LOCUS_06380 48016 46409 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775379.1 protein_id gnl|my_center|LOCUS_06380 49679 48069 gene locus_tag LOCUS_06390 49679 48069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 50399 49722 gene locus_tag LOCUS_06400 50399 49722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 52781 50583 gene locus_tag LOCUS_06410 52781 50583 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 protein_id gnl|my_center|LOCUS_06410 54025 52844 gene locus_tag LOCUS_06420 54025 52844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 54531 56732 gene locus_tag LOCUS_06430 54531 56732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 56964 59381 gene locus_tag LOCUS_06440 gene pcrA 56964 59381 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_06440 60708 59422 gene locus_tag LOCUS_06450 60708 59422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 60878 61432 gene locus_tag LOCUS_06460 gene spoVT 60878 61432 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_06460 61918 61499 gene locus_tag LOCUS_06470 61918 61499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 62132 63043 gene locus_tag LOCUS_06480 62132 63043 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_06480 63981 63307 gene locus_tag LOCUS_06490 63981 63307 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_06490 64081 64773 gene locus_tag LOCUS_06500 64081 64773 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_06500 67569 64918 gene locus_tag LOCUS_06510 67569 64918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 71504 67701 gene locus_tag LOCUS_06520 71504 67701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 72729 71638 gene locus_tag LOCUS_06530 72729 71638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 73247 72726 gene locus_tag LOCUS_06540 73247 72726 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_06540 73941 73267 gene locus_tag LOCUS_06550 73941 73267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 74700 73957 gene locus_tag LOCUS_06560 gene aph(3')-IIIa 74700 73957 CDS product aminoglycoside O-phosphotransferase APH(3')-IIIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096887.1 protein_id gnl|my_center|LOCUS_06560 75392 74697 gene locus_tag LOCUS_06570 75392 74697 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_06570 76027 75497 gene locus_tag LOCUS_06580 gene raiA 76027 75497 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_06580 78488 76188 gene locus_tag LOCUS_06590 78488 76188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 79021 78521 gene locus_tag LOCUS_06600 79021 78521 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524903.1 protein_id gnl|my_center|LOCUS_06600 79224 79766 gene locus_tag LOCUS_06610 79224 79766 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_06610 79790 81151 gene locus_tag LOCUS_06620 gene rlmD 79790 81151 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_06620 81217 82203 gene locus_tag LOCUS_06630 81217 82203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 82441 82788 gene locus_tag LOCUS_06640 82441 82788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 82801 83175 gene locus_tag LOCUS_06650 82801 83175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 83177 83575 gene locus_tag LOCUS_06660 83177 83575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 83586 84119 gene locus_tag LOCUS_06670 83586 84119 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480501.1 protein_id gnl|my_center|LOCUS_06670 84141 84911 gene locus_tag LOCUS_06680 84141 84911 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784150.1 protein_id gnl|my_center|LOCUS_06680 84974 85897 gene locus_tag LOCUS_06690 84974 85897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 85979 86752 gene locus_tag LOCUS_06700 85979 86752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 86906 87577 gene locus_tag LOCUS_06710 86906 87577 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_06710 87693 88670 gene locus_tag LOCUS_06720 gene ansA 87693 88670 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_06720 88872 89645 gene locus_tag LOCUS_06730 88872 89645 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_06730 89759 90535 gene locus_tag LOCUS_06740 89759 90535 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_06740 90550 90675 gene locus_tag LOCUS_06750 90550 90675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 90685 90921 gene locus_tag LOCUS_06760 90685 90921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence07 311 1339 gene locus_tag LOCUS_06770 311 1339 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035844551.1 protein_id gnl|my_center|LOCUS_06770 1469 2068 gene locus_tag LOCUS_06780 1469 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2894 2070 gene locus_tag LOCUS_06790 2894 2070 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965896.1 protein_id gnl|my_center|LOCUS_06790 3066 4436 gene locus_tag LOCUS_06800 3066 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6421 4490 gene locus_tag LOCUS_06810 6421 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6626 7648 gene locus_tag LOCUS_06820 gene gapA 6626 7648 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153505.1 protein_id gnl|my_center|LOCUS_06820 7652 8701 gene locus_tag LOCUS_06830 7652 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9532 8762 gene locus_tag LOCUS_06840 9532 8762 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963877.1 protein_id gnl|my_center|LOCUS_06840 13879 9629 gene locus_tag LOCUS_06850 13879 9629 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484061.1 protein_id gnl|my_center|LOCUS_06850 14307 14110 gene locus_tag LOCUS_06860 14307 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 15077 14310 gene locus_tag LOCUS_06870 15077 14310 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723335.1 protein_id gnl|my_center|LOCUS_06870 15817 15095 gene locus_tag LOCUS_06880 gene nagB 15817 15095 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_06880 16760 15831 gene locus_tag LOCUS_06890 16760 15831 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920615.1 protein_id gnl|my_center|LOCUS_06890 17677 16757 gene locus_tag LOCUS_06900 17677 16757 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_06900 18426 17692 gene locus_tag LOCUS_06910 18426 17692 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_06910 19119 18475 gene locus_tag LOCUS_06920 19119 18475 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_06920 20780 19116 gene locus_tag LOCUS_06930 gene glnS 20780 19116 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418271.1 protein_id gnl|my_center|LOCUS_06930 22499 20811 gene locus_tag LOCUS_06940 22499 20811 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_06940 23274 22684 gene locus_tag LOCUS_06950 23274 22684 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_06950 23460 24194 gene locus_tag LOCUS_06960 23460 24194 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_06960 24212 25942 gene locus_tag LOCUS_06970 24212 25942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 27362 25977 gene locus_tag LOCUS_06980 27362 25977 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_06980 27985 27359 gene locus_tag LOCUS_06990 27985 27359 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_06990 28218 28142 gene locus_tag LOCUS_t00140 28218 28142 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29550 28411 gene locus_tag LOCUS_07000 29550 28411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 30384 30309 gene locus_tag LOCUS_t00150 30384 30309 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30528 30752 gene locus_tag LOCUS_07010 30528 30752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 30849 32075 gene locus_tag LOCUS_07020 30849 32075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 32219 32773 gene locus_tag LOCUS_07030 gene sigH 32219 32773 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_07030 32973 33248 gene locus_tag LOCUS_07040 32973 33248 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_07040 33467 33793 gene locus_tag LOCUS_07050 33467 33793 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888516.1 protein_id gnl|my_center|LOCUS_07050 34754 33828 gene locus_tag LOCUS_07060 34754 33828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 35338 34775 gene locus_tag LOCUS_07070 35338 34775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 35672 35331 gene locus_tag LOCUS_07080 35672 35331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 35828 36112 gene locus_tag LOCUS_07090 35828 36112 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232153.1 protein_id gnl|my_center|LOCUS_07090 36307 37032 gene locus_tag LOCUS_07100 gene rpsB 36307 37032 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_07100 37076 38002 gene locus_tag LOCUS_07110 gene tsf 37076 38002 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_07110 38208 38726 gene locus_tag LOCUS_07120 38208 38726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 39063 39275 gene locus_tag LOCUS_07130 39063 39275 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023878.1 protein_id gnl|my_center|LOCUS_07130 39272 40300 gene locus_tag LOCUS_07140 39272 40300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 40290 40826 gene locus_tag LOCUS_07150 40290 40826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 41177 40866 gene locus_tag LOCUS_07160 41177 40866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 41874 41158 gene locus_tag LOCUS_07170 41874 41158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 42245 43954 gene locus_tag LOCUS_07180 gene ilvB 42245 43954 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_07180 43968 44519 gene locus_tag LOCUS_07190 gene ilvN 43968 44519 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_07190 44500 45519 gene locus_tag LOCUS_07200 gene ilvC 44500 45519 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151741.1 protein_id gnl|my_center|LOCUS_07200 45672 47333 gene locus_tag LOCUS_07210 gene ilvD 45672 47333 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_07210 47359 48660 gene locus_tag LOCUS_07220 47359 48660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_07220 48647 49843 gene locus_tag LOCUS_07230 gene ilvA 48647 49843 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_07230 51127 49901 gene locus_tag LOCUS_07240 51127 49901 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_07240 52151 51231 gene locus_tag LOCUS_07250 gene metA 52151 51231 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_07250 53457 52174 gene locus_tag LOCUS_07260 53457 52174 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_07260 55038 53590 gene locus_tag LOCUS_07270 55038 53590 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888725.1 protein_id gnl|my_center|LOCUS_07270 56262 55090 gene locus_tag LOCUS_07280 56262 55090 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_07280 57928 56255 gene locus_tag LOCUS_07290 57928 56255 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_07290 58192 57941 gene locus_tag LOCUS_07300 58192 57941 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_07300 58482 58237 gene locus_tag LOCUS_07310 58482 58237 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_07310 59282 58533 gene locus_tag LOCUS_07320 59282 58533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 59572 60696 gene locus_tag LOCUS_07330 59572 60696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 61866 60889 gene locus_tag LOCUS_07340 61866 60889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 62794 62000 gene locus_tag LOCUS_07350 62794 62000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_07350 63769 62798 gene locus_tag LOCUS_07360 63769 62798 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_07360 64844 63852 gene locus_tag LOCUS_07370 64844 63852 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_07370 66149 65325 gene locus_tag LOCUS_07380 gene pfkB 66149 65325 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_07380 67730 66321 gene locus_tag LOCUS_07390 gene pyk 67730 66321 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_07390 68437 67865 gene locus_tag LOCUS_07400 68437 67865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 69264 68458 gene locus_tag LOCUS_07410 69264 68458 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_07410 70132 69296 gene locus_tag LOCUS_07420 70132 69296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 71520 70273 gene locus_tag LOCUS_07430 71520 70273 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_07430 72076 71504 gene locus_tag LOCUS_07440 72076 71504 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646218.1 protein_id gnl|my_center|LOCUS_07440 72431 72994 gene locus_tag LOCUS_07450 72431 72994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 72991 73674 gene locus_tag LOCUS_07460 72991 73674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 73671 74639 gene locus_tag LOCUS_07470 73671 74639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 74626 75513 gene locus_tag LOCUS_07480 74626 75513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 76079 75579 gene locus_tag LOCUS_07490 76079 75579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 78820 76310 gene locus_tag LOCUS_07500 gene polA 78820 76310 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038317.1 protein_id gnl|my_center|LOCUS_07500 78978 79053 gene locus_tag LOCUS_t00160 78978 79053 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 79112 79951 gene locus_tag LOCUS_07510 79112 79951 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_07510 79969 81126 gene locus_tag LOCUS_07520 79969 81126 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_07520 82242 81406 gene locus_tag LOCUS_07530 82242 81406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence08 1887 259 gene locus_tag LOCUS_07540 1887 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3138 2188 gene locus_tag LOCUS_07550 3138 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4234 3248 gene locus_tag LOCUS_07560 gene argF 4234 3248 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_07560 5517 4357 gene locus_tag LOCUS_07570 5517 4357 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_07570 6311 5514 gene locus_tag LOCUS_07580 gene argB 6311 5514 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_07580 7883 6672 gene locus_tag LOCUS_07590 gene argJ 7883 6672 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_07590 8974 8048 gene locus_tag LOCUS_07600 gene argC 8974 8048 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_07600 10499 9105 gene locus_tag LOCUS_07610 gene argH 10499 9105 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_07610 11929 10691 gene locus_tag LOCUS_07620 11929 10691 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_07620 12191 11952 gene locus_tag LOCUS_07630 12191 11952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 12610 13503 gene locus_tag LOCUS_07640 gene dapA 12610 13503 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_07640 13594 14340 gene locus_tag LOCUS_07650 gene dapB 13594 14340 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_07650 14493 15800 gene locus_tag LOCUS_07660 gene lysA 14493 15800 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_07660 15883 17193 gene locus_tag LOCUS_07670 15883 17193 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286872.1 protein_id gnl|my_center|LOCUS_07670 17223 18224 gene locus_tag LOCUS_07680 17223 18224 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_07680 18403 19440 gene locus_tag LOCUS_07690 18403 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 20697 19522 gene locus_tag LOCUS_07700 gene hemW 20697 19522 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_07700 22666 20858 gene locus_tag LOCUS_07710 gene lepA 22666 20858 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_07710 23012 24253 gene locus_tag LOCUS_07720 23012 24253 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_07720 24340 24732 gene locus_tag LOCUS_07730 24340 24732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 24932 25636 gene locus_tag LOCUS_07740 24932 25636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 25672 26787 gene locus_tag LOCUS_07750 gene holA 25672 26787 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700067.1 protein_id gnl|my_center|LOCUS_07750 26792 27364 gene locus_tag LOCUS_07760 gene rnmV 26792 27364 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356126.1 protein_id gnl|my_center|LOCUS_07760 27417 27938 gene locus_tag LOCUS_07770 27417 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 27949 28344 gene locus_tag LOCUS_07780 27949 28344 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567927.1 protein_id gnl|my_center|LOCUS_07780 28483 28824 gene locus_tag LOCUS_07790 28483 28824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 29085 28879 gene locus_tag LOCUS_07800 29085 28879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 29214 30944 gene locus_tag LOCUS_07810 29214 30944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 31205 32809 gene locus_tag LOCUS_07820 31205 32809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 33809 32892 gene locus_tag LOCUS_07830 33809 32892 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234236.1 protein_id gnl|my_center|LOCUS_07830 37742 34050 gene locus_tag LOCUS_07840 37742 34050 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_07840 39197 37929 gene locus_tag LOCUS_07850 gene purD 39197 37929 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_07850 40512 39328 gene locus_tag LOCUS_07860 40512 39328 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_07860 41264 40536 gene locus_tag LOCUS_07870 41264 40536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 42044 41433 gene locus_tag LOCUS_07880 gene purN 42044 41433 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_07880 43416 42373 gene locus_tag LOCUS_07890 gene purM 43416 42373 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_07890 44082 43588 gene locus_tag LOCUS_07900 gene purE 44082 43588 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_07900 45886 44360 gene locus_tag LOCUS_07910 gene malQ 45886 44360 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_07910 47593 46445 gene locus_tag LOCUS_07920 47593 46445 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_07920 47819 49288 gene locus_tag LOCUS_07930 gene thrC 47819 49288 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_07930 49285 50172 gene locus_tag LOCUS_07940 gene thrB 49285 50172 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986279.1 protein_id gnl|my_center|LOCUS_07940 51009 50317 gene locus_tag LOCUS_07950 51009 50317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048138.1 protein_id gnl|my_center|LOCUS_07950 51266 51081 gene locus_tag LOCUS_07960 gene rpmB 51266 51081 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_07960 52084 51428 gene locus_tag LOCUS_07970 gene trmB 52084 51428 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266024.1 protein_id gnl|my_center|LOCUS_07970 52258 52476 gene locus_tag LOCUS_07980 52258 52476 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105789.1 protein_id gnl|my_center|LOCUS_07980 53402 52686 gene locus_tag LOCUS_07990 53402 52686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 53587 54858 gene locus_tag LOCUS_08000 53587 54858 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_08000 55343 55038 gene locus_tag LOCUS_08010 55343 55038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 55488 55330 gene locus_tag LOCUS_08020 55488 55330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 56241 55663 gene locus_tag LOCUS_08030 56241 55663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 56504 56280 gene locus_tag LOCUS_08040 56504 56280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 57420 56752 gene locus_tag LOCUS_08050 57420 56752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 58123 57755 gene locus_tag LOCUS_08060 58123 57755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08060 58276 58133 gene locus_tag LOCUS_08070 58276 58133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 60066 58273 gene locus_tag LOCUS_08080 60066 58273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 61538 60063 gene locus_tag LOCUS_08090 61538 60063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 62008 61505 gene locus_tag LOCUS_08100 62008 61505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 62641 62024 gene locus_tag LOCUS_08110 62641 62024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 63303 62929 gene locus_tag LOCUS_08120 63303 62929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 63742 63602 gene locus_tag LOCUS_08130 63742 63602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 64094 64020 gene locus_tag LOCUS_t00170 64094 64020 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 64177 64102 gene locus_tag LOCUS_t00180 64177 64102 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64259 64184 gene locus_tag LOCUS_t00190 64259 64184 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 64356 64280 gene locus_tag LOCUS_t00200 64356 64280 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 64439 64364 gene locus_tag LOCUS_t00210 64439 64364 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65641 64580 gene locus_tag LOCUS_08140 65641 64580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 66449 65646 gene locus_tag LOCUS_08150 66449 65646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 67887 66475 gene locus_tag LOCUS_08160 67887 66475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 68231 69829 gene locus_tag LOCUS_08170 68231 69829 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 protein_id gnl|my_center|LOCUS_08170 70487 70173 gene locus_tag LOCUS_08180 70487 70173 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_08180 70818 70531 gene locus_tag LOCUS_08190 70818 70531 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906388.1 protein_id gnl|my_center|LOCUS_08190 71162 71638 gene locus_tag LOCUS_08200 71162 71638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 71769 72362 gene locus_tag LOCUS_08210 gene infC 71769 72362 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808206.1 protein_id gnl|my_center|LOCUS_08210 72402 72599 gene locus_tag LOCUS_08220 72402 72599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 72634 72987 gene locus_tag LOCUS_08230 gene rplT 72634 72987 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_08230 73105 73881 gene locus_tag LOCUS_08240 73105 73881 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_08240 73896 75170 gene locus_tag LOCUS_08250 73896 75170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence09 969 217 gene locus_tag LOCUS_08260 gene sigF 969 217 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_08260 1509 1057 gene locus_tag LOCUS_08270 gene spoIIAB 1509 1057 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_08270 2071 1754 gene locus_tag LOCUS_08280 gene spoIIAA 2071 1754 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_08280 3379 2525 gene locus_tag LOCUS_08290 gene folD 3379 2525 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_08290 4370 3363 gene locus_tag LOCUS_08300 4370 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5672 4392 gene locus_tag LOCUS_08310 5672 4392 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_08310 6958 5672 gene locus_tag LOCUS_08320 6958 5672 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_08320 7181 7627 gene locus_tag LOCUS_08330 7181 7627 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437174.1 protein_id gnl|my_center|LOCUS_08330 7783 8724 gene locus_tag LOCUS_08340 7783 8724 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_08340 8887 9099 gene locus_tag LOCUS_08350 8887 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9764 9225 gene locus_tag LOCUS_08360 9764 9225 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_08360 11504 9813 gene locus_tag LOCUS_08370 11504 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12058 11648 gene locus_tag LOCUS_08380 12058 11648 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_08380 13603 12362 gene locus_tag LOCUS_08390 gene eno 13603 12362 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_08390 13898 14509 gene locus_tag LOCUS_08400 13898 14509 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868563.1 protein_id gnl|my_center|LOCUS_08400 14534 15271 gene locus_tag LOCUS_08410 14534 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15852 15322 gene locus_tag LOCUS_08420 15852 15322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 17274 15874 gene locus_tag LOCUS_08430 17274 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18044 17625 gene locus_tag LOCUS_08440 18044 17625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 18265 18444 gene locus_tag LOCUS_08450 18265 18444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 18572 19090 gene locus_tag LOCUS_08460 gene rimM 18572 19090 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_08460 19099 19821 gene locus_tag LOCUS_08470 gene trmD 19099 19821 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_08470 19829 21409 gene locus_tag LOCUS_08480 gene murJ 19829 21409 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010896072.1 protein_id gnl|my_center|LOCUS_08480 21437 23341 gene locus_tag LOCUS_08490 21437 23341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 23449 23958 gene locus_tag LOCUS_08500 23449 23958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 23986 24465 gene locus_tag LOCUS_08510 23986 24465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 24644 24901 gene locus_tag LOCUS_08520 24644 24901 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362134.1 protein_id gnl|my_center|LOCUS_08520 25112 26938 gene locus_tag LOCUS_08530 gene uvrC 25112 26938 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_08530 26964 27575 gene locus_tag LOCUS_08540 gene rsmD 26964 27575 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009910569.1 protein_id gnl|my_center|LOCUS_08540 27572 28024 gene locus_tag LOCUS_08550 gene coaD 27572 28024 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414998.1 protein_id gnl|my_center|LOCUS_08550 28374 29102 gene locus_tag LOCUS_08560 28374 29102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 29320 31284 gene locus_tag LOCUS_08570 gene uvrB 29320 31284 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_08570 31441 34257 gene locus_tag LOCUS_08580 gene uvrA 31441 34257 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_08580 34554 36614 gene locus_tag LOCUS_08590 34554 36614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 36891 38150 gene locus_tag LOCUS_08600 36891 38150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 38270 38830 gene locus_tag LOCUS_08610 gene hpt 38270 38830 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416006.1 protein_id gnl|my_center|LOCUS_08610 38837 40207 gene locus_tag LOCUS_08620 38837 40207 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_08620 41605 40253 gene locus_tag LOCUS_08630 41605 40253 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272228.1 protein_id gnl|my_center|LOCUS_08630 44187 41863 gene locus_tag LOCUS_08640 44187 41863 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_08640 45790 44171 gene locus_tag LOCUS_08650 45790 44171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 45986 47029 gene locus_tag LOCUS_08660 45986 47029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 47076 47528 gene locus_tag LOCUS_08670 47076 47528 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974670.1 protein_id gnl|my_center|LOCUS_08670 50323 47843 gene locus_tag LOCUS_08680 50323 47843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 51251 50532 gene locus_tag LOCUS_08690 51251 50532 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_08690 52425 51274 gene locus_tag LOCUS_08700 52425 51274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 53618 52566 gene locus_tag LOCUS_08710 53618 52566 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_08710 53797 55161 gene locus_tag LOCUS_08720 53797 55161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 57565 55274 gene locus_tag LOCUS_08730 57565 55274 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_08730 59451 57976 gene locus_tag LOCUS_08740 59451 57976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 59641 59438 gene locus_tag LOCUS_08750 59641 59438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 60456 59770 gene locus_tag LOCUS_08760 60456 59770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 62077 60458 gene locus_tag LOCUS_08770 62077 60458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 62928 62050 gene locus_tag LOCUS_08780 62928 62050 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_08780 64510 62930 gene locus_tag LOCUS_08790 64510 62930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 65303 64497 gene locus_tag LOCUS_08800 65303 64497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 65644 65348 gene locus_tag LOCUS_08810 65644 65348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 66445 66011 gene locus_tag LOCUS_08820 66445 66011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 68228 66639 gene locus_tag LOCUS_08830 68228 66639 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_08830 69181 68432 gene locus_tag LOCUS_08840 69181 68432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 69341 71539 gene locus_tag LOCUS_08850 69341 71539 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence10 2547 223 gene locus_tag LOCUS_08860 2547 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2668 2462 gene locus_tag LOCUS_08870 2668 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4208 2676 gene locus_tag LOCUS_08880 4208 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 5323 4235 gene locus_tag LOCUS_08890 5323 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6775 5348 gene locus_tag LOCUS_08900 6775 5348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 7668 6874 gene locus_tag LOCUS_08910 7668 6874 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900020.1 protein_id gnl|my_center|LOCUS_08910 9474 7681 gene locus_tag LOCUS_08920 9474 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 9639 10091 gene locus_tag LOCUS_08930 9639 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10117 12189 gene locus_tag LOCUS_08940 10117 12189 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_08940 12416 13690 gene locus_tag LOCUS_08950 12416 13690 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_08950 13690 14139 gene locus_tag LOCUS_08960 13690 14139 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_08960 14142 14366 gene locus_tag LOCUS_08970 14142 14366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 14647 14423 gene locus_tag LOCUS_08980 14647 14423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14763 14975 gene locus_tag LOCUS_08990 14763 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 14906 15400 gene locus_tag LOCUS_09000 14906 15400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 15491 15922 gene locus_tag LOCUS_09010 15491 15922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 16233 16030 gene locus_tag LOCUS_09020 16233 16030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 17765 16308 gene locus_tag LOCUS_09030 17765 16308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_09030 19964 18093 gene locus_tag LOCUS_09040 19964 18093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_09040 20123 20821 gene locus_tag LOCUS_09050 20123 20821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 20826 22289 gene locus_tag LOCUS_09060 20826 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 22282 23766 gene locus_tag LOCUS_09070 22282 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 26603 24018 gene locus_tag LOCUS_09080 26603 24018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 26952 27833 gene locus_tag LOCUS_09090 gene nanA 26952 27833 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224706.1 protein_id gnl|my_center|LOCUS_09090 27850 28548 gene locus_tag LOCUS_09100 27850 28548 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_09100 28625 29299 gene locus_tag LOCUS_09110 28625 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 29997 29416 gene locus_tag LOCUS_09120 29997 29416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 30560 30009 gene locus_tag LOCUS_09130 30560 30009 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911193.1 protein_id gnl|my_center|LOCUS_09130 31357 30923 gene locus_tag LOCUS_09140 31357 30923 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840640.1 protein_id gnl|my_center|LOCUS_09140 32828 31461 gene locus_tag LOCUS_09150 32828 31461 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_09150 33186 33656 gene locus_tag LOCUS_09160 33186 33656 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_09160 33887 35509 gene locus_tag LOCUS_09170 33887 35509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 35542 37113 gene locus_tag LOCUS_09180 35542 37113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 37511 37293 gene locus_tag LOCUS_09190 37511 37293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 38674 37556 gene locus_tag LOCUS_09200 38674 37556 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_09200 39675 38869 gene locus_tag LOCUS_09210 39675 38869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 40045 39839 gene locus_tag LOCUS_09220 40045 39839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 40138 41190 gene locus_tag LOCUS_09230 40138 41190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 41971 41234 gene locus_tag LOCUS_09240 41971 41234 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_09240 43341 42046 gene locus_tag LOCUS_09250 43341 42046 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783481.1 protein_id gnl|my_center|LOCUS_09250 43557 44324 gene locus_tag LOCUS_09260 43557 44324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 44353 45762 gene locus_tag LOCUS_09270 44353 45762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 45779 46024 gene locus_tag LOCUS_09280 45779 46024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 46322 46068 gene locus_tag LOCUS_09290 46322 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 46479 47108 gene locus_tag LOCUS_09300 46479 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 47582 47172 gene locus_tag LOCUS_09310 47582 47172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 48002 47721 gene locus_tag LOCUS_09320 48002 47721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 48144 48302 gene locus_tag LOCUS_09330 48144 48302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 48366 50384 gene locus_tag LOCUS_09340 48366 50384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 50999 50454 gene locus_tag LOCUS_09350 50999 50454 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_09350 51419 51033 gene locus_tag LOCUS_09360 51419 51033 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_09360 51639 51729 gene locus_tag LOCUS_t00220 51639 51729 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 52997 51855 gene locus_tag LOCUS_09370 52997 51855 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_09370 53674 53042 gene locus_tag LOCUS_09380 53674 53042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 54569 53742 gene locus_tag LOCUS_09390 gene dinD 54569 53742 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460715.1 protein_id gnl|my_center|LOCUS_09390 55480 54635 gene locus_tag LOCUS_09400 55480 54635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 57295 55601 gene locus_tag LOCUS_09410 57295 55601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 58074 57397 gene locus_tag LOCUS_09420 58074 57397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 58242 58442 gene locus_tag LOCUS_09430 58242 58442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 58516 58770 gene locus_tag LOCUS_09440 58516 58770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 58774 59007 gene locus_tag LOCUS_09450 58774 59007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 59183 59004 gene locus_tag LOCUS_09460 59183 59004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 59281 59538 gene locus_tag LOCUS_09470 59281 59538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 59468 59677 gene locus_tag LOCUS_09480 59468 59677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 59640 59858 gene locus_tag LOCUS_09490 59640 59858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 59851 60759 gene locus_tag LOCUS_09500 59851 60759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 60785 60991 gene locus_tag LOCUS_09510 60785 60991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 61368 60973 gene locus_tag LOCUS_09520 61368 60973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 61411 61797 gene locus_tag LOCUS_09530 61411 61797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 61736 62179 gene locus_tag LOCUS_09540 61736 62179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 62204 62560 gene locus_tag LOCUS_09550 62204 62560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 62765 62562 gene locus_tag LOCUS_09560 62765 62562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 62919 63242 gene locus_tag LOCUS_09570 62919 63242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 63372 64292 gene locus_tag LOCUS_09580 63372 64292 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024691572.1 protein_id gnl|my_center|LOCUS_09580 64314 64556 gene locus_tag LOCUS_09590 64314 64556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 64546 64899 gene locus_tag LOCUS_09600 64546 64899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 64900 65829 gene locus_tag LOCUS_09610 64900 65829 CDS product DUF4373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108097.1 protein_id gnl|my_center|LOCUS_09610 65854 66273 gene locus_tag LOCUS_09620 65854 66273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 66270 66482 gene locus_tag LOCUS_09630 66270 66482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 66532 66984 gene locus_tag LOCUS_09640 66532 66984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 66998 67792 gene locus_tag LOCUS_09650 66998 67792 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_09650 67789 68691 gene locus_tag LOCUS_09660 67789 68691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040412236.1 protein_id gnl|my_center|LOCUS_09660 68688 69032 gene locus_tag LOCUS_09670 68688 69032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 69056 69493 gene locus_tag LOCUS_09680 69056 69493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 69516 69683 gene locus_tag LOCUS_09690 69516 69683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 69687 69878 gene locus_tag LOCUS_09700 69687 69878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 69892 70209 gene locus_tag LOCUS_09710 69892 70209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 70202 70603 gene locus_tag LOCUS_09720 70202 70603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence11 1615 389 gene locus_tag LOCUS_09730 1615 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2589 1627 gene locus_tag LOCUS_09740 gene miaA 2589 1627 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_09740 3098 2823 gene locus_tag LOCUS_09750 3098 2823 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665928.1 protein_id gnl|my_center|LOCUS_09750 3369 3088 gene locus_tag LOCUS_09760 3369 3088 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812262.1 protein_id gnl|my_center|LOCUS_09760 4445 3453 gene locus_tag LOCUS_09770 4445 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 5595 4516 gene locus_tag LOCUS_09780 gene queA 5595 4516 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_09780 6312 5773 gene locus_tag LOCUS_09790 6312 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 6480 6737 gene locus_tag LOCUS_09800 6480 6737 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_09800 7072 7677 gene locus_tag LOCUS_09810 gene lexA 7072 7677 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_09810 7681 8493 gene locus_tag LOCUS_09820 7681 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8654 10048 gene locus_tag LOCUS_09830 8654 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 10396 12744 gene locus_tag LOCUS_09840 gene lon 10396 12744 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097310.1 protein_id gnl|my_center|LOCUS_09840 12748 13347 gene locus_tag LOCUS_09850 12748 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13368 14057 gene locus_tag LOCUS_09860 13368 14057 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_09860 14071 14829 gene locus_tag LOCUS_09870 14071 14829 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382313.1 protein_id gnl|my_center|LOCUS_09870 14884 15435 gene locus_tag LOCUS_09880 gene scpB 14884 15435 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402814.1 protein_id gnl|my_center|LOCUS_09880 15432 16256 gene locus_tag LOCUS_09890 15432 16256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 16277 16774 gene locus_tag LOCUS_09900 gene ytfJ 16277 16774 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_09900 17056 18144 gene locus_tag LOCUS_09910 17056 18144 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541694.1 protein_id gnl|my_center|LOCUS_09910 18165 18875 gene locus_tag LOCUS_09920 18165 18875 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_09920 18898 19287 gene locus_tag LOCUS_09930 18898 19287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 19529 20632 gene locus_tag LOCUS_09940 gene prfB 19529 20632 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226186.1 protein_id gnl|my_center|LOCUS_09940 20680 20988 gene locus_tag LOCUS_09950 20680 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 22198 21089 gene locus_tag LOCUS_09960 gene ftsZ 22198 21089 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_09960 23158 22358 gene locus_tag LOCUS_09970 23158 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 24261 23155 gene locus_tag LOCUS_09980 gene murG 24261 23155 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181833.1 protein_id gnl|my_center|LOCUS_09980 25841 24579 gene locus_tag LOCUS_09990 gene spoVE 25841 24579 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_09990 26864 25878 gene locus_tag LOCUS_10000 gene mraY 26864 25878 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_10000 28314 26911 gene locus_tag LOCUS_10010 28314 26911 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_10010 29774 28332 gene locus_tag LOCUS_10020 29774 28332 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_10020 32333 30024 gene locus_tag LOCUS_10030 32333 30024 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_10030 32898 32461 gene locus_tag LOCUS_10040 32898 32461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 33854 32904 gene locus_tag LOCUS_10050 gene rsmH 33854 32904 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_10050 34231 36357 gene locus_tag LOCUS_10060 34231 36357 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_10060 37186 36503 gene locus_tag LOCUS_10070 37186 36503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 39220 37211 gene locus_tag LOCUS_10080 39220 37211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 41429 39450 gene locus_tag LOCUS_10090 41429 39450 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_10090 42040 41429 gene locus_tag LOCUS_10100 42040 41429 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_10100 42720 42055 gene locus_tag LOCUS_10110 gene cmk 42720 42055 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_10110 44051 42798 gene locus_tag LOCUS_10120 44051 42798 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_10120 46362 44431 gene locus_tag LOCUS_10130 46362 44431 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_10130 46632 47795 gene locus_tag LOCUS_10140 46632 47795 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_10140 47795 48187 gene locus_tag LOCUS_10150 gene cdd 47795 48187 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_10150 48233 48556 gene locus_tag LOCUS_10160 48233 48556 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723189.1 protein_id gnl|my_center|LOCUS_10160 50523 48817 gene locus_tag LOCUS_10170 50523 48817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 51700 50948 gene locus_tag LOCUS_10180 51700 50948 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 protein_id gnl|my_center|LOCUS_10180 53392 51713 gene locus_tag LOCUS_10190 gene cdr 53392 51713 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087552.1 protein_id gnl|my_center|LOCUS_10190 53944 53570 gene locus_tag LOCUS_10200 53944 53570 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_10200 55272 53971 gene locus_tag LOCUS_10210 55272 53971 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_10210 55498 58074 gene locus_tag LOCUS_10220 55498 58074 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_10220 58945 58487 gene locus_tag LOCUS_10230 58945 58487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 59664 58942 gene locus_tag LOCUS_10240 gene tepA 59664 58942 CDS product translocation-enhancing protein TepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245712.1 protein_id gnl|my_center|LOCUS_10240 59845 60414 gene locus_tag LOCUS_10250 59845 60414 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_10250 60599 61300 gene locus_tag LOCUS_10260 60599 61300 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_10260 61315 62313 gene locus_tag LOCUS_10270 61315 62313 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_10270 62655 62443 gene locus_tag LOCUS_10280 62655 62443 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_10280 62848 63630 gene locus_tag LOCUS_10290 62848 63630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 64088 64399 gene locus_tag LOCUS_10300 64088 64399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 65982 64675 gene locus_tag LOCUS_10310 65982 64675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 66436 65999 gene locus_tag LOCUS_10320 66436 65999 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_10320 67475 66648 gene locus_tag LOCUS_10330 67475 66648 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_10330 67625 68641 gene locus_tag LOCUS_10340 gene galE 67625 68641 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775237.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence12 1424 2464 gene locus_tag LOCUS_10350 1424 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2490 2702 gene locus_tag LOCUS_10360 2490 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3297 3809 gene locus_tag LOCUS_10370 3297 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3821 4192 gene locus_tag LOCUS_10380 3821 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 4196 4462 gene locus_tag LOCUS_10390 4196 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4480 4818 gene locus_tag LOCUS_10400 4480 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 5475 4915 gene locus_tag LOCUS_10410 5475 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5692 7464 gene locus_tag LOCUS_10420 5692 7464 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862474.1 protein_id gnl|my_center|LOCUS_10420 7468 9363 gene locus_tag LOCUS_10430 7468 9363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583043.1 protein_id gnl|my_center|LOCUS_10430 9599 12232 gene locus_tag LOCUS_10440 9599 12232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 13427 12306 gene locus_tag LOCUS_10450 13427 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016019.1 protein_id gnl|my_center|LOCUS_10450 13911 13420 gene locus_tag LOCUS_10460 13911 13420 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902608.1 protein_id gnl|my_center|LOCUS_10460 16419 14212 gene locus_tag LOCUS_10470 16419 14212 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178933861.1 protein_id gnl|my_center|LOCUS_10470 17162 16443 gene locus_tag LOCUS_10480 17162 16443 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263776.1 protein_id gnl|my_center|LOCUS_10480 17689 17279 gene locus_tag LOCUS_10490 17689 17279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 18457 17774 gene locus_tag LOCUS_10500 18457 17774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 18988 18581 gene locus_tag LOCUS_10510 18988 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 20192 19002 gene locus_tag LOCUS_10520 20192 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 22363 20189 gene locus_tag LOCUS_10530 22363 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 23915 22356 gene locus_tag LOCUS_10540 23915 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 24889 23936 gene locus_tag LOCUS_10550 24889 23936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470381.1 protein_id gnl|my_center|LOCUS_10550 27601 25061 gene locus_tag LOCUS_10560 27601 25061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 29059 27947 gene locus_tag LOCUS_10570 29059 27947 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_10570 31152 29227 gene locus_tag LOCUS_10580 31152 29227 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_10580 31371 31730 gene locus_tag LOCUS_10590 31371 31730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 31796 32236 gene locus_tag LOCUS_10600 31796 32236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 32464 32300 gene locus_tag LOCUS_10610 32464 32300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 33559 32618 gene locus_tag LOCUS_10620 33559 32618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 34618 33950 gene locus_tag LOCUS_10630 34618 33950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 34776 35723 gene locus_tag LOCUS_10640 34776 35723 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_10640 35736 36815 gene locus_tag LOCUS_10650 35736 36815 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123159.1 protein_id gnl|my_center|LOCUS_10650 36951 37838 gene locus_tag LOCUS_10660 36951 37838 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_10660 37918 38685 gene locus_tag LOCUS_10670 37918 38685 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_10670 39272 38811 gene locus_tag LOCUS_10680 39272 38811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 39993 39346 gene locus_tag LOCUS_10690 39993 39346 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107285.1 protein_id gnl|my_center|LOCUS_10690 40926 40006 gene locus_tag LOCUS_10700 40926 40006 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_10700 42225 40939 gene locus_tag LOCUS_10710 42225 40939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 42880 42260 gene locus_tag LOCUS_10720 42880 42260 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642400.1 protein_id gnl|my_center|LOCUS_10720 43577 43026 gene locus_tag LOCUS_10730 43577 43026 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_10730 44730 43663 gene locus_tag LOCUS_10740 gene leuB 44730 43663 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_10740 45444 44950 gene locus_tag LOCUS_10750 gene leuD 45444 44950 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583553.1 protein_id gnl|my_center|LOCUS_10750 46729 45464 gene locus_tag LOCUS_10760 gene leuC 46729 45464 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_10760 48588 46930 gene locus_tag LOCUS_10770 48588 46930 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_10770 52161 49093 gene locus_tag LOCUS_10780 52161 49093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 52428 53267 gene locus_tag LOCUS_10790 52428 53267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 53516 53295 gene locus_tag LOCUS_10800 53516 53295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 53629 54252 gene locus_tag LOCUS_10810 53629 54252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 54446 55270 gene locus_tag LOCUS_10820 54446 55270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 56981 55398 gene locus_tag LOCUS_10830 56981 55398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 57154 59343 gene locus_tag LOCUS_10840 57154 59343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 59369 60067 gene locus_tag LOCUS_10850 59369 60067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 60625 60218 gene locus_tag LOCUS_10860 60625 60218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 61016 60798 gene locus_tag LOCUS_10870 61016 60798 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966985.1 protein_id gnl|my_center|LOCUS_10870 62754 61036 gene locus_tag LOCUS_10880 62754 61036 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_10880 63746 62877 gene locus_tag LOCUS_10890 63746 62877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 64038 63790 gene locus_tag LOCUS_10900 64038 63790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 64464 64754 gene locus_tag LOCUS_10910 64464 64754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 64751 65008 gene locus_tag LOCUS_10920 64751 65008 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396019.1 protein_id gnl|my_center|LOCUS_10920 64984 65118 gene locus_tag LOCUS_10930 64984 65118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 65565 65155 gene locus_tag LOCUS_10940 65565 65155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 66312 65632 gene locus_tag LOCUS_10950 66312 65632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 66865 66305 gene locus_tag LOCUS_10960 66865 66305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 67222 66998 gene locus_tag LOCUS_10970 67222 66998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 67466 67212 gene locus_tag LOCUS_10980 67466 67212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence13 383 1300 gene locus_tag LOCUS_10990 gene spoIIIAA 383 1300 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_10990 1297 1800 gene locus_tag LOCUS_11000 gene spoIIIAB 1297 1800 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965392.1 protein_id gnl|my_center|LOCUS_11000 1815 2009 gene locus_tag LOCUS_11010 gene spoIIIAC 1815 2009 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_11010 2054 2389 gene locus_tag LOCUS_11020 gene spoIIIAD 2054 2389 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810912.1 protein_id gnl|my_center|LOCUS_11020 2494 3492 gene locus_tag LOCUS_11030 2494 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 3504 3995 gene locus_tag LOCUS_11040 3504 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4013 4510 gene locus_tag LOCUS_11050 4013 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4549 5226 gene locus_tag LOCUS_11060 4549 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 6167 5358 gene locus_tag LOCUS_11070 6167 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 6664 6185 gene locus_tag LOCUS_11080 6664 6185 CDS product LURP-one-related/scramblase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242923.1 protein_id gnl|my_center|LOCUS_11080 7906 6734 gene locus_tag LOCUS_11090 gene ugpC 7906 6734 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_11090 10300 8147 gene locus_tag LOCUS_11100 10300 8147 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_11100 11023 10322 gene locus_tag LOCUS_11110 11023 10322 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_11110 11792 11133 gene locus_tag LOCUS_11120 11792 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 12162 14354 gene locus_tag LOCUS_11130 12162 14354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 16167 14659 gene locus_tag LOCUS_11140 gene ypwA 16167 14659 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_11140 16341 16886 gene locus_tag LOCUS_11150 16341 16886 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287063.1 protein_id gnl|my_center|LOCUS_11150 17608 16883 gene locus_tag LOCUS_11160 17608 16883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 17820 19910 gene locus_tag LOCUS_11170 17820 19910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 19927 20757 gene locus_tag LOCUS_11180 19927 20757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 20934 21473 gene locus_tag LOCUS_11190 20934 21473 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_11190 21556 21990 gene locus_tag LOCUS_11200 gene ohrR 21556 21990 CDS product organic hydroperoxide resistance transcriptional regulator OhrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245653.1 protein_id gnl|my_center|LOCUS_11200 22976 22143 gene locus_tag LOCUS_11210 22976 22143 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_11210 24844 23060 gene locus_tag LOCUS_11220 gene aspS 24844 23060 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_11220 26178 24850 gene locus_tag LOCUS_11230 gene hisS 26178 24850 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_11230 26472 28634 gene locus_tag LOCUS_11240 gene recG 26472 28634 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_11240 28872 30392 gene locus_tag LOCUS_11250 28872 30392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 30424 33240 gene locus_tag LOCUS_11260 30424 33240 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_11260 33745 34440 gene locus_tag LOCUS_11270 33745 34440 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_11270 34466 35143 gene locus_tag LOCUS_11280 34466 35143 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654037.1 protein_id gnl|my_center|LOCUS_11280 35150 36598 gene locus_tag LOCUS_11290 35150 36598 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_11290 36615 38768 gene locus_tag LOCUS_11300 36615 38768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760433.1 protein_id gnl|my_center|LOCUS_11300 38780 39964 gene locus_tag LOCUS_11310 38780 39964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 39961 41376 gene locus_tag LOCUS_11320 39961 41376 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274807.1 protein_id gnl|my_center|LOCUS_11320 41443 43743 gene locus_tag LOCUS_11330 41443 43743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 45905 43803 gene locus_tag LOCUS_11340 gene pdcB 45905 43803 CDS product phosphodiesterase PdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437448.1 protein_id gnl|my_center|LOCUS_11340 47253 46105 gene locus_tag LOCUS_11350 47253 46105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 49136 47688 gene locus_tag LOCUS_11360 49136 47688 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_11360 49262 50152 gene locus_tag LOCUS_11370 49262 50152 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948703.1 protein_id gnl|my_center|LOCUS_11370 50254 50634 gene locus_tag LOCUS_11380 50254 50634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 50631 52361 gene locus_tag LOCUS_11390 50631 52361 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_11390 52358 54046 gene locus_tag LOCUS_11400 gene cydC 52358 54046 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_11400 54237 55022 gene locus_tag LOCUS_11410 54237 55022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 55054 55740 gene locus_tag LOCUS_11420 55054 55740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 55740 57650 gene locus_tag LOCUS_11430 55740 57650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 57699 58805 gene locus_tag LOCUS_11440 57699 58805 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939731.1 protein_id gnl|my_center|LOCUS_11440 58806 59813 gene locus_tag LOCUS_11450 58806 59813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966458.1 protein_id gnl|my_center|LOCUS_11450 59810 60805 gene locus_tag LOCUS_11460 59810 60805 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_11460 60793 61773 gene locus_tag LOCUS_11470 60793 61773 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519085.1 protein_id gnl|my_center|LOCUS_11470 61775 62458 gene locus_tag LOCUS_11480 61775 62458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 62480 63652 gene locus_tag LOCUS_11490 62480 63652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence14 177 58 gene locus_tag LOCUS_11500 177 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 293 1855 gene locus_tag LOCUS_11510 gene cls 293 1855 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837633.1 protein_id gnl|my_center|LOCUS_11510 1959 2333 gene locus_tag LOCUS_11520 1959 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2361 3263 gene locus_tag LOCUS_11530 2361 3263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_11530 3265 4101 gene locus_tag LOCUS_11540 3265 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4116 5015 gene locus_tag LOCUS_11550 4116 5015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948486.1 protein_id gnl|my_center|LOCUS_11550 5017 5823 gene locus_tag LOCUS_11560 5017 5823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6333 7175 gene locus_tag LOCUS_11570 gene xerD 6333 7175 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_11570 7561 8052 gene locus_tag LOCUS_11580 7561 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 8067 8837 gene locus_tag LOCUS_11590 8067 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 8834 9022 gene locus_tag LOCUS_11600 8834 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 9082 9744 gene locus_tag LOCUS_11610 9082 9744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9783 10433 gene locus_tag LOCUS_11620 9783 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 10465 11055 gene locus_tag LOCUS_11630 10465 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 11063 11785 gene locus_tag LOCUS_11640 11063 11785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 11860 13659 gene locus_tag LOCUS_11650 11860 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 13886 14401 gene locus_tag LOCUS_11660 13886 14401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 14591 14376 gene locus_tag LOCUS_11670 14591 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 15469 14696 gene locus_tag LOCUS_11680 15469 14696 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_11680 17456 15471 gene locus_tag LOCUS_11690 gene metG 17456 15471 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_11690 18828 17689 gene locus_tag LOCUS_11700 gene nagA 18828 17689 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861065.1 protein_id gnl|my_center|LOCUS_11700 19815 18919 gene locus_tag LOCUS_11710 gene rsmI 19815 18919 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_11710 20545 19793 gene locus_tag LOCUS_11720 20545 19793 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_11720 21332 20547 gene locus_tag LOCUS_11730 gene rlmB 21332 20547 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387444.1 protein_id gnl|my_center|LOCUS_11730 22152 21469 gene locus_tag LOCUS_11740 22152 21469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 22963 22244 gene locus_tag LOCUS_11750 22963 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 23157 24323 gene locus_tag LOCUS_11760 23157 24323 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_11760 24575 25525 gene locus_tag LOCUS_11770 24575 25525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 25552 26094 gene locus_tag LOCUS_11780 25552 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 26144 26329 gene locus_tag LOCUS_11790 26144 26329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 26286 27692 gene locus_tag LOCUS_11800 26286 27692 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_11800 27692 28405 gene locus_tag LOCUS_11810 27692 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 28402 28911 gene locus_tag LOCUS_11820 28402 28911 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_11820 29079 29717 gene locus_tag LOCUS_11830 29079 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 29922 32513 gene locus_tag LOCUS_11840 gene clpB 29922 32513 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_11840 32730 34127 gene locus_tag LOCUS_11850 32730 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 34187 35779 gene locus_tag LOCUS_11860 34187 35779 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_11860 36033 36467 gene locus_tag LOCUS_11870 gene dut 36033 36467 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121799.1 protein_id gnl|my_center|LOCUS_11870 36633 37781 gene locus_tag LOCUS_11880 36633 37781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 37796 38224 gene locus_tag LOCUS_11890 gene ruvX 37796 38224 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_11890 38404 39795 gene locus_tag LOCUS_11900 38404 39795 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_11900 40048 40896 gene locus_tag LOCUS_11910 40048 40896 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_11910 41047 41433 gene locus_tag LOCUS_11920 41047 41433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 41595 42806 gene locus_tag LOCUS_11930 41595 42806 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_11930 45870 42949 gene locus_tag LOCUS_11940 gene ebgA 45870 42949 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674096.1 protein_id gnl|my_center|LOCUS_11940 46078 46911 gene locus_tag LOCUS_11950 46078 46911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 46921 47751 gene locus_tag LOCUS_11960 46921 47751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 48707 47784 gene locus_tag LOCUS_11970 48707 47784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 49546 50154 gene locus_tag LOCUS_11980 49546 50154 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_11980 50194 50994 gene locus_tag LOCUS_11990 50194 50994 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_11990 51184 52608 gene locus_tag LOCUS_12000 gene glnA 51184 52608 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_12000 52984 53436 gene locus_tag LOCUS_12010 52984 53436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 54531 53509 gene locus_tag LOCUS_12020 54531 53509 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_12020 54709 55980 gene locus_tag LOCUS_12030 54709 55980 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804912.1 protein_id gnl|my_center|LOCUS_12030 55994 56350 gene locus_tag LOCUS_12040 55994 56350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 57054 56392 gene locus_tag LOCUS_12050 57054 56392 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202621584.1 protein_id gnl|my_center|LOCUS_12050 57855 57073 gene locus_tag LOCUS_12060 57855 57073 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379384.1 protein_id gnl|my_center|LOCUS_12060 58002 58805 gene locus_tag LOCUS_12070 58002 58805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227801.1 protein_id gnl|my_center|LOCUS_12070 58819 59307 gene locus_tag LOCUS_12080 58819 59307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 59323 60483 gene locus_tag LOCUS_12090 59323 60483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 60796 60473 gene locus_tag LOCUS_12100 60796 60473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence15 28 137 gene locus_tag LOCUS_r00010 28 137 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 346 2181 gene locus_tag LOCUS_12110 346 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2204 2422 gene locus_tag LOCUS_12120 2204 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 2470 2730 gene locus_tag LOCUS_12130 2470 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2894 3493 gene locus_tag LOCUS_12140 2894 3493 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547369.1 protein_id gnl|my_center|LOCUS_12140 5348 3531 gene locus_tag LOCUS_12150 gene dxs 5348 3531 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_12150 5755 5525 gene locus_tag LOCUS_12160 5755 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5989 6783 gene locus_tag LOCUS_12170 5989 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 7087 8928 gene locus_tag LOCUS_12180 gene typA 7087 8928 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_12180 9306 10028 gene locus_tag LOCUS_12190 9306 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 10103 10699 gene locus_tag LOCUS_12200 10103 10699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 10780 11511 gene locus_tag LOCUS_12210 10780 11511 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_12210 11514 12179 gene locus_tag LOCUS_12220 11514 12179 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860219.1 protein_id gnl|my_center|LOCUS_12220 12490 13563 gene locus_tag LOCUS_12230 gene hrcA 12490 13563 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_12230 13578 14105 gene locus_tag LOCUS_12240 gene grpE 13578 14105 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_12240 14174 15988 gene locus_tag LOCUS_12250 gene dnaK 14174 15988 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_12250 16261 17397 gene locus_tag LOCUS_12260 gene dnaJ 16261 17397 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_12260 17419 18342 gene locus_tag LOCUS_12270 gene prmA 17419 18342 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_12270 18499 19233 gene locus_tag LOCUS_12280 18499 19233 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430913.1 protein_id gnl|my_center|LOCUS_12280 19321 20106 gene locus_tag LOCUS_12290 19321 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 20220 21305 gene locus_tag LOCUS_12300 20220 21305 CDS product sugar diacid recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393831.1 protein_id gnl|my_center|LOCUS_12300 21383 22678 gene locus_tag LOCUS_12310 21383 22678 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080969.1 protein_id gnl|my_center|LOCUS_12310 22706 23182 gene locus_tag LOCUS_12320 gene greA 22706 23182 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_12320 23212 24744 gene locus_tag LOCUS_12330 gene lysS 23212 24744 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_12330 24948 27068 gene locus_tag LOCUS_12340 24948 27068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 27094 28026 gene locus_tag LOCUS_12350 27094 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 30920 28323 gene locus_tag LOCUS_12360 30920 28323 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_12360 31103 31969 gene locus_tag LOCUS_12370 31103 31969 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_12370 33139 32018 gene locus_tag LOCUS_12380 33139 32018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 34689 33139 gene locus_tag LOCUS_12390 34689 33139 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_12390 35290 34805 gene locus_tag LOCUS_12400 35290 34805 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_12400 35488 36141 gene locus_tag LOCUS_12410 35488 36141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 36160 37545 gene locus_tag LOCUS_12420 gene glmM 36160 37545 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_12420 39062 37725 gene locus_tag LOCUS_12430 39062 37725 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_12430 39465 40577 gene locus_tag LOCUS_12440 gene ald 39465 40577 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391433.1 protein_id gnl|my_center|LOCUS_12440 42103 40916 gene locus_tag LOCUS_12450 gene coaBC 42103 40916 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_12450 42338 42988 gene locus_tag LOCUS_12460 42338 42988 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892118.1 protein_id gnl|my_center|LOCUS_12460 42991 43755 gene locus_tag LOCUS_12470 42991 43755 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_12470 43814 45172 gene locus_tag LOCUS_12480 43814 45172 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707495.1 protein_id gnl|my_center|LOCUS_12480 45184 46635 gene locus_tag LOCUS_12490 45184 46635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 46654 47754 gene locus_tag LOCUS_12500 46654 47754 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_12500 47744 47941 gene locus_tag LOCUS_12510 47744 47941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 47907 50108 gene locus_tag LOCUS_12520 47907 50108 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_12520 50124 50804 gene locus_tag LOCUS_12530 gene cas5c 50124 50804 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_12530 50798 52561 gene locus_tag LOCUS_12540 gene cas8c 50798 52561 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388585.1 protein_id gnl|my_center|LOCUS_12540 52561 53418 gene locus_tag LOCUS_12550 gene cas7c 52561 53418 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_12550 53405 54025 gene locus_tag LOCUS_12560 53405 54025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 54022 55050 gene locus_tag LOCUS_12570 gene cas1c 54022 55050 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_12570 55057 55347 gene locus_tag LOCUS_12580 gene cas2 55057 55347 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384683.1 protein_id gnl|my_center|LOCUS_12580 55495 >56108 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactccgcaaggagtgtgtggattgaaat >Feature sequence16 1333 170 gene locus_tag LOCUS_12590 1333 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4255 1358 gene locus_tag LOCUS_12600 4255 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12600 4688 4296 gene locus_tag LOCUS_12610 4688 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 6291 4750 gene locus_tag LOCUS_12620 6291 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7009 6338 gene locus_tag LOCUS_12630 7009 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 7756 7073 gene locus_tag LOCUS_12640 7756 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 8421 7834 gene locus_tag LOCUS_12650 8421 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8914 8441 gene locus_tag LOCUS_12660 8914 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 9657 9073 gene locus_tag LOCUS_12670 9657 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 10168 10557 gene locus_tag LOCUS_12680 10168 10557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10795 11205 gene locus_tag LOCUS_12690 10795 11205 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_12690 12249 11275 gene locus_tag LOCUS_12700 gene rfbB 12249 11275 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_12700 13025 12246 gene locus_tag LOCUS_12710 gene rfbA 13025 12246 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_12710 13648 13235 gene locus_tag LOCUS_12720 13648 13235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 15035 13698 gene locus_tag LOCUS_12730 15035 13698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 15564 15283 gene locus_tag LOCUS_12740 15564 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 16490 15885 gene locus_tag LOCUS_12750 gene lexA 16490 15885 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_12750 21100 16739 gene locus_tag LOCUS_12760 21100 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101579182.1 protein_id gnl|my_center|LOCUS_12760 21794 21084 gene locus_tag LOCUS_12770 21794 21084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 23335 21791 gene locus_tag LOCUS_12780 23335 21791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 24365 23340 gene locus_tag LOCUS_12790 24365 23340 CDS product DUF2220 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233576.1 protein_id gnl|my_center|LOCUS_12790 24562 24368 gene locus_tag LOCUS_12800 24562 24368 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_12800 24972 24706 gene locus_tag LOCUS_12810 24972 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 25325 24969 gene locus_tag LOCUS_12820 25325 24969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 25581 25499 gene locus_tag LOCUS_t00230 25581 25499 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 25707 25624 gene locus_tag LOCUS_t00240 25707 25624 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26880 25858 gene locus_tag LOCUS_12830 26880 25858 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_12830 27929 26928 gene locus_tag LOCUS_12840 27929 26928 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_12840 28261 27929 gene locus_tag LOCUS_12850 gene darA 28261 27929 CDS product cyclic di-AMP receptor DarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242755.1 protein_id gnl|my_center|LOCUS_12850 28769 28401 gene locus_tag LOCUS_12860 gene spoVAE 28769 28401 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_12860 29784 28783 gene locus_tag LOCUS_12870 gene spoVAD 29784 28783 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_12870 30227 29781 gene locus_tag LOCUS_12880 gene spoVAC 30227 29781 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_12880 30424 30597 gene locus_tag LOCUS_12890 30424 30597 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_12890 30806 32023 gene locus_tag LOCUS_12900 30806 32023 CDS product D-aspartate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294441.1 protein_id gnl|my_center|LOCUS_12900 32046 32771 gene locus_tag LOCUS_12910 32046 32771 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_12910 33027 34508 gene locus_tag LOCUS_12920 33027 34508 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_12920 34582 35499 gene locus_tag LOCUS_12930 34582 35499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 38327 35736 gene locus_tag LOCUS_12940 38327 35736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 38474 39529 gene locus_tag LOCUS_12950 38474 39529 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775107.1 protein_id gnl|my_center|LOCUS_12950 39815 39567 gene locus_tag LOCUS_12960 39815 39567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 39952 40308 gene locus_tag LOCUS_12970 39952 40308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 40319 40729 gene locus_tag LOCUS_12980 40319 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 40744 41304 gene locus_tag LOCUS_12990 40744 41304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 42637 41411 gene locus_tag LOCUS_13000 gene pepT 42637 41411 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_13000 43294 42650 gene locus_tag LOCUS_13010 43294 42650 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775255.1 protein_id gnl|my_center|LOCUS_13010 45177 43294 gene locus_tag LOCUS_13020 45177 43294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 45349 45987 gene locus_tag LOCUS_13030 45349 45987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 45984 46379 gene locus_tag LOCUS_13040 45984 46379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 48303 46417 gene locus_tag LOCUS_13050 48303 46417 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_13050 50044 48296 gene locus_tag LOCUS_13060 50044 48296 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_13060 50508 50041 gene locus_tag LOCUS_13070 50508 50041 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022043.1 protein_id gnl|my_center|LOCUS_13070 50958 50605 gene locus_tag LOCUS_13080 50958 50605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 51286 51026 gene locus_tag LOCUS_13090 51286 51026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence17 686 273 gene locus_tag LOCUS_13100 686 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1014 940 gene locus_tag LOCUS_t00250 1014 940 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2411 1056 gene locus_tag LOCUS_13110 2411 1056 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_13110 4089 2644 gene locus_tag LOCUS_13120 4089 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5517 4294 gene locus_tag LOCUS_13130 5517 4294 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_13130 6336 5536 gene locus_tag LOCUS_13140 6336 5536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_13140 7154 6336 gene locus_tag LOCUS_13150 7154 6336 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_13150 8215 7151 gene locus_tag LOCUS_13160 8215 7151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_13160 8640 8509 gene locus_tag LOCUS_13170 8640 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 10985 8646 gene locus_tag LOCUS_13180 10985 8646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 12280 11519 gene locus_tag LOCUS_13190 12280 11519 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_13190 14338 12284 gene locus_tag LOCUS_13200 14338 12284 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_13200 15504 14410 gene locus_tag LOCUS_13210 15504 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 16508 15543 gene locus_tag LOCUS_13220 gene hprK 16508 15543 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_13220 16700 17341 gene locus_tag LOCUS_13230 16700 17341 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_13230 17348 17728 gene locus_tag LOCUS_13240 17348 17728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 19772 17979 gene locus_tag LOCUS_13250 19772 17979 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714091.1 protein_id gnl|my_center|LOCUS_13250 20997 19993 gene locus_tag LOCUS_13260 20997 19993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 22151 21117 gene locus_tag LOCUS_13270 22151 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 22386 23885 gene locus_tag LOCUS_13280 22386 23885 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_13280 24105 23932 gene locus_tag LOCUS_13290 24105 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 24213 24548 gene locus_tag LOCUS_13300 24213 24548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 26626 24725 gene locus_tag LOCUS_13310 gene htpG 26626 24725 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_13310 27037 26768 gene locus_tag LOCUS_13320 27037 26768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 27215 28504 gene locus_tag LOCUS_13330 gene serS 27215 28504 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_13330 29645 28620 gene locus_tag LOCUS_13340 gene gap 29645 28620 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_13340 29860 30309 gene locus_tag LOCUS_13350 29860 30309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 31297 30284 gene locus_tag LOCUS_13360 31297 30284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 32758 31361 gene locus_tag LOCUS_13370 32758 31361 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_13370 34093 32888 gene locus_tag LOCUS_13380 34093 32888 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_13380 34555 34160 gene locus_tag LOCUS_13390 34555 34160 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_13390 34954 34583 gene locus_tag LOCUS_13400 34954 34583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 36382 34976 gene locus_tag LOCUS_13410 36382 34976 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_13410 36937 36710 gene locus_tag LOCUS_13420 36937 36710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 37920 37069 gene locus_tag LOCUS_13430 37920 37069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 38954 38142 gene locus_tag LOCUS_13440 38954 38142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 39924 38935 gene locus_tag LOCUS_13450 39924 38935 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_13450 40116 41360 gene locus_tag LOCUS_13460 40116 41360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 42047 41436 gene locus_tag LOCUS_13470 42047 41436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 42506 42201 gene locus_tag LOCUS_13480 42506 42201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 42866 42792 gene locus_tag LOCUS_t00260 42866 42792 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 44638 42974 gene locus_tag LOCUS_13490 44638 42974 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_13490 45326 46804 gene locus_tag LOCUS_13500 45326 46804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 47160 49349 gene locus_tag LOCUS_13510 47160 49349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence18 469 200 gene locus_tag LOCUS_13520 469 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1819 923 gene locus_tag LOCUS_13530 gene truB 1819 923 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_13530 2783 1812 gene locus_tag LOCUS_13540 2783 1812 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_13540 3212 2802 gene locus_tag LOCUS_13550 gene rbfA 3212 2802 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_13550 3819 3505 gene locus_tag LOCUS_13560 3819 3505 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_13560 3791 3973 gene locus_tag LOCUS_13570 3791 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 4690 9366 gene locus_tag LOCUS_13580 4690 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 9387 10430 gene locus_tag LOCUS_13590 9387 10430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 10624 12093 gene locus_tag LOCUS_13600 10624 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 12086 13120 gene locus_tag LOCUS_13610 12086 13120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 13453 15636 gene locus_tag LOCUS_13620 13453 15636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 15840 16892 gene locus_tag LOCUS_13630 15840 16892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 16961 17794 gene locus_tag LOCUS_13640 16961 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 17830 19419 gene locus_tag LOCUS_13650 17830 19419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 19546 21426 gene locus_tag LOCUS_13660 19546 21426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 21423 24098 gene locus_tag LOCUS_13670 21423 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 24122 24856 gene locus_tag LOCUS_13680 24122 24856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 24853 29838 gene locus_tag LOCUS_13690 24853 29838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 30122 30484 gene locus_tag LOCUS_13700 30122 30484 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_13700 30499 32319 gene locus_tag LOCUS_13710 30499 32319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 35387 32367 gene locus_tag LOCUS_13720 35387 32367 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389909.1 protein_id gnl|my_center|LOCUS_13720 35617 36714 gene locus_tag LOCUS_13730 gene eutH 35617 36714 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897061.1 protein_id gnl|my_center|LOCUS_13730 36948 37499 gene locus_tag LOCUS_13740 36948 37499 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948397.1 protein_id gnl|my_center|LOCUS_13740 37496 38749 gene locus_tag LOCUS_13750 37496 38749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 40565 38883 gene locus_tag LOCUS_13760 40565 38883 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965042.1 protein_id gnl|my_center|LOCUS_13760 41555 40611 gene locus_tag LOCUS_13770 41555 40611 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_13770 42658 41735 gene locus_tag LOCUS_13780 42658 41735 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_13780 44162 42663 gene locus_tag LOCUS_13790 gene glpK 44162 42663 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_13790 44568 45152 gene locus_tag LOCUS_13800 44568 45152 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_13800 45995 45420 gene locus_tag LOCUS_13810 45995 45420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 47052 45979 gene locus_tag LOCUS_13820 gene ytvI 47052 45979 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440267.1 protein_id gnl|my_center|LOCUS_13820 47270 47977 gene locus_tag LOCUS_13830 47270 47977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence19 1066 143 gene locus_tag LOCUS_13840 1066 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 1330 2616 gene locus_tag LOCUS_13850 1330 2616 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434194.1 protein_id gnl|my_center|LOCUS_13850 2827 4776 gene locus_tag LOCUS_13860 2827 4776 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_13860 4976 6247 gene locus_tag LOCUS_13870 gene galK 4976 6247 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_13870 6240 7082 gene locus_tag LOCUS_13880 6240 7082 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_13880 7039 7521 gene locus_tag LOCUS_13890 gene rlmH 7039 7521 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_13890 7814 9721 gene locus_tag LOCUS_13900 gene mnmG 7814 9721 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_13900 9718 10458 gene locus_tag LOCUS_13910 gene rsmG 9718 10458 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_13910 10636 11397 gene locus_tag LOCUS_13920 10636 11397 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_13920 11420 12301 gene locus_tag LOCUS_13930 11420 12301 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_13930 12320 12793 gene locus_tag LOCUS_13940 12320 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 13977 12826 gene locus_tag LOCUS_13950 13977 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 14498 14061 gene locus_tag LOCUS_13960 14498 14061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393046.1 protein_id gnl|my_center|LOCUS_13960 15147 14590 gene locus_tag LOCUS_13970 gene efp 15147 14590 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_13970 16324 15269 gene locus_tag LOCUS_13980 16324 15269 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_13980 17898 16771 gene locus_tag LOCUS_13990 17898 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 20696 18069 gene locus_tag LOCUS_14000 20696 18069 CDS product glycoside hydrolase family 78 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 protein_id gnl|my_center|LOCUS_14000 21339 21007 gene locus_tag LOCUS_14010 21339 21007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 22702 21470 gene locus_tag LOCUS_14020 22702 21470 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_14020 23382 22795 gene locus_tag LOCUS_14030 23382 22795 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_14030 24152 23382 gene locus_tag LOCUS_14040 24152 23382 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_14040 24342 24190 gene locus_tag LOCUS_14050 24342 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 24512 25894 gene locus_tag LOCUS_14060 gene dnaA 24512 25894 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815138.1 protein_id gnl|my_center|LOCUS_14060 26666 27844 gene locus_tag LOCUS_14070 gene dnaN 26666 27844 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_14070 27849 28967 gene locus_tag LOCUS_14080 gene recF 27849 28967 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_14080 29387 30322 gene locus_tag LOCUS_14090 29387 30322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 30327 30677 gene locus_tag LOCUS_14100 30327 30677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 30711 30968 gene locus_tag LOCUS_14110 30711 30968 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_14110 31060 32988 gene locus_tag LOCUS_14120 gene gyrB 31060 32988 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_14120 33136 35670 gene locus_tag LOCUS_14130 gene gyrA 33136 35670 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_14130 35714 36862 gene locus_tag LOCUS_14140 gene recA 35714 36862 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_14140 36866 37513 gene locus_tag LOCUS_14150 36866 37513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 37751 39142 gene locus_tag LOCUS_14160 gene pepV 37751 39142 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_14160 39287 41005 gene locus_tag LOCUS_14170 39287 41005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 41051 42742 gene locus_tag LOCUS_14180 41051 42742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 42767 43591 gene locus_tag LOCUS_14190 42767 43591 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_14190 44024 44185 gene locus_tag LOCUS_14200 44024 44185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 45870 44293 gene locus_tag LOCUS_14210 gene rny 45870 44293 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_14210 46520 46155 gene locus_tag LOCUS_14220 46520 46155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 <47624 46655 gene locus_tag LOCUS_14230 <47624 46655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810397.1:serpin family protein >Feature sequence20 376 2112 gene locus_tag LOCUS_14240 376 2112 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_14240 2901 2293 gene locus_tag LOCUS_14250 2901 2293 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476292.1 protein_id gnl|my_center|LOCUS_14250 3375 3166 gene locus_tag LOCUS_14260 3375 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3481 3627 gene locus_tag LOCUS_14270 3481 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3988 3587 gene locus_tag LOCUS_14280 gene rpsI 3988 3587 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14280 4441 4010 gene locus_tag LOCUS_14290 gene rplM 4441 4010 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_14290 4879 5955 gene locus_tag LOCUS_14300 gene prfA 4879 5955 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_14300 5971 7029 gene locus_tag LOCUS_14310 5971 7029 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_14310 7393 7980 gene locus_tag LOCUS_14320 gene coaE 7393 7980 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_14320 8007 9089 gene locus_tag LOCUS_14330 8007 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 9134 10540 gene locus_tag LOCUS_14340 9134 10540 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861085.1 protein_id gnl|my_center|LOCUS_14340 11396 10824 gene locus_tag LOCUS_14350 11396 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 13341 11377 gene locus_tag LOCUS_14360 13341 11377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 13702 13343 gene locus_tag LOCUS_14370 13702 13343 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966708.1 protein_id gnl|my_center|LOCUS_14370 13862 14527 gene locus_tag LOCUS_14380 13862 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 15994 14660 gene locus_tag LOCUS_14390 gene gdhA 15994 14660 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476262.1 protein_id gnl|my_center|LOCUS_14390 16303 16611 gene locus_tag LOCUS_14400 gene rplU 16303 16611 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_14400 16618 16974 gene locus_tag LOCUS_14410 16618 16974 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476071.1 protein_id gnl|my_center|LOCUS_14410 17015 17293 gene locus_tag LOCUS_14420 gene rpmA 17015 17293 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_14420 17328 17828 gene locus_tag LOCUS_14430 17328 17828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 18664 17963 gene locus_tag LOCUS_14440 18664 17963 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987086.1 protein_id gnl|my_center|LOCUS_14440 18861 18936 gene locus_tag LOCUS_t00270 18861 18936 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19812 19144 gene locus_tag LOCUS_14450 19812 19144 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_14450 20090 21118 gene locus_tag LOCUS_14460 20090 21118 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_14460 21563 21168 gene locus_tag LOCUS_14470 21563 21168 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_14470 23323 21773 gene locus_tag LOCUS_14480 gene spoVB 23323 21773 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_14480 23434 24429 gene locus_tag LOCUS_14490 23434 24429 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_14490 24577 25434 gene locus_tag LOCUS_14500 24577 25434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 25705 26226 gene locus_tag LOCUS_14510 gene tadA 25705 26226 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_14510 26352 27599 gene locus_tag LOCUS_14520 26352 27599 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_14520 27743 28267 gene locus_tag LOCUS_14530 27743 28267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 28534 29772 gene locus_tag LOCUS_14540 gene pyrC 28534 29772 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_14540 29757 30845 gene locus_tag LOCUS_14550 gene carA 29757 30845 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_14550 30847 34026 gene locus_tag LOCUS_14560 gene carB 30847 34026 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126101.1 protein_id gnl|my_center|LOCUS_14560 34035 34766 gene locus_tag LOCUS_14570 gene pyrK 34035 34766 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_14570 34760 35671 gene locus_tag LOCUS_14580 34760 35671 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_14580 35671 36369 gene locus_tag LOCUS_14590 gene pyrF 35671 36369 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_14590 36559 37647 gene locus_tag LOCUS_14600 gene pyrB 36559 37647 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_14600 37842 38531 gene locus_tag LOCUS_14610 gene pnuC 37842 38531 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_14610 38789 39325 gene locus_tag LOCUS_14620 38789 39325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 39347 40117 gene locus_tag LOCUS_14630 gene rlmB 39347 40117 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_14630 40176 42428 gene locus_tag LOCUS_14640 40176 42428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 42576 43364 gene locus_tag LOCUS_14650 42576 43364 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355679.1 protein_id gnl|my_center|LOCUS_14650 43435 44145 gene locus_tag LOCUS_14660 43435 44145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_14660 44158 44937 gene locus_tag LOCUS_14670 44158 44937 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_14670 45454 45654 gene locus_tag LOCUS_14680 45454 45654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 45667 45975 gene locus_tag LOCUS_14690 gene trxA 45667 45975 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064559.1 protein_id gnl|my_center|LOCUS_14690 46090 46165 gene locus_tag LOCUS_t00280 46090 46165 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 2654 252 gene locus_tag LOCUS_14700 2654 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3013 2660 gene locus_tag LOCUS_14710 3013 2660 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_14710 3396 5675 gene locus_tag LOCUS_14720 3396 5675 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_14720 5840 6433 gene locus_tag LOCUS_14730 5840 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6449 8659 gene locus_tag LOCUS_14740 6449 8659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_14740 8973 10277 gene locus_tag LOCUS_14750 8973 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 11162 10395 gene locus_tag LOCUS_14760 gene tpiA 11162 10395 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_14760 12612 11305 gene locus_tag LOCUS_14770 12612 11305 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_14770 14041 12815 gene locus_tag LOCUS_14780 14041 12815 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_14780 15265 14231 gene locus_tag LOCUS_14790 gene mltG 15265 14231 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617473.1 protein_id gnl|my_center|LOCUS_14790 16296 15370 gene locus_tag LOCUS_14800 16296 15370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 16870 16283 gene locus_tag LOCUS_14810 16870 16283 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206416.1 protein_id gnl|my_center|LOCUS_14810 17442 16897 gene locus_tag LOCUS_14820 17442 16897 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_14820 18139 17465 gene locus_tag LOCUS_14830 18139 17465 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_14830 21264 18181 gene locus_tag LOCUS_14840 21264 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 22127 21306 gene locus_tag LOCUS_14850 22127 21306 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_14850 22878 24002 gene locus_tag LOCUS_14860 22878 24002 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_14860 24017 24772 gene locus_tag LOCUS_14870 24017 24772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 26455 24977 gene locus_tag LOCUS_14880 gene spoIVA 26455 24977 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_14880 28411 26690 gene locus_tag LOCUS_14890 28411 26690 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880188.1 protein_id gnl|my_center|LOCUS_14890 31437 28834 gene locus_tag LOCUS_14900 31437 28834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 32165 31623 gene locus_tag LOCUS_14910 gene hpt 32165 31623 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_14910 33397 32189 gene locus_tag LOCUS_14920 gene tilS 33397 32189 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865151.1 protein_id gnl|my_center|LOCUS_14920 34817 33483 gene locus_tag LOCUS_14930 34817 33483 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_14930 35029 34847 gene locus_tag LOCUS_14940 35029 34847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 35500 35054 gene locus_tag LOCUS_14950 gene rplI 35500 35054 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_14950 36475 35660 gene locus_tag LOCUS_14960 gene rlmA 36475 35660 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 protein_id gnl|my_center|LOCUS_14960 37255 36491 gene locus_tag LOCUS_14970 37255 36491 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476135.1 protein_id gnl|my_center|LOCUS_14970 37405 37950 gene locus_tag LOCUS_14980 37405 37950 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_14980 38531 37980 gene locus_tag LOCUS_14990 38531 37980 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_14990 39518 38547 gene locus_tag LOCUS_15000 39518 38547 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289735.1 protein_id gnl|my_center|LOCUS_15000 42005 39585 gene locus_tag LOCUS_15010 42005 39585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 42370 42975 gene locus_tag LOCUS_15020 42370 42975 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_15020 43842 43102 gene locus_tag LOCUS_15030 43842 43102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 44854 43895 gene locus_tag LOCUS_15040 44854 43895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 45410 44844 gene locus_tag LOCUS_15050 45410 44844 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680233.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence22 167 1003 gene locus_tag LOCUS_15060 gene xerD 167 1003 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_15060 1297 3210 gene locus_tag LOCUS_15070 1297 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3283 6966 gene locus_tag LOCUS_15080 3283 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 6987 8747 gene locus_tag LOCUS_15090 6987 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 9075 9611 gene locus_tag LOCUS_15100 9075 9611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 9667 10788 gene locus_tag LOCUS_15110 9667 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 10804 11934 gene locus_tag LOCUS_15120 10804 11934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 11973 13385 gene locus_tag LOCUS_15130 11973 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 13636 14340 gene locus_tag LOCUS_15140 13636 14340 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_15140 14321 15919 gene locus_tag LOCUS_15150 14321 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 15979 17841 gene locus_tag LOCUS_15160 15979 17841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 17958 19136 gene locus_tag LOCUS_15170 17958 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 19120 19347 gene locus_tag LOCUS_15180 19120 19347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 19344 21749 gene locus_tag LOCUS_15190 19344 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 21759 22652 gene locus_tag LOCUS_15200 21759 22652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_15200 25278 22789 gene locus_tag LOCUS_15210 25278 22789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 26280 25399 gene locus_tag LOCUS_15220 26280 25399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_15220 28559 26367 gene locus_tag LOCUS_15230 28559 26367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 29228 28581 gene locus_tag LOCUS_15240 29228 28581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 30645 29287 gene locus_tag LOCUS_15250 30645 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 31227 30763 gene locus_tag LOCUS_15260 31227 30763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 32765 31407 gene locus_tag LOCUS_15270 32765 31407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 32980 33360 gene locus_tag LOCUS_15280 32980 33360 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_15280 33357 34865 gene locus_tag LOCUS_15290 33357 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 34955 36610 gene locus_tag LOCUS_15300 34955 36610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 36612 37481 gene locus_tag LOCUS_15310 36612 37481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 37478 38170 gene locus_tag LOCUS_15320 37478 38170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 38336 39211 gene locus_tag LOCUS_15330 38336 39211 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433732.1 protein_id gnl|my_center|LOCUS_15330 39217 39810 gene locus_tag LOCUS_15340 39217 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 39822 41486 gene locus_tag LOCUS_15350 39822 41486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 41479 42366 gene locus_tag LOCUS_15360 41479 42366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 42479 43696 gene locus_tag LOCUS_15370 42479 43696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 43780 44511 gene locus_tag LOCUS_15380 43780 44511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence23 801 157 gene locus_tag LOCUS_15390 801 157 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_15390 1023 1271 gene locus_tag LOCUS_15400 1023 1271 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809979.1 protein_id gnl|my_center|LOCUS_15400 1576 1331 gene locus_tag LOCUS_15410 1576 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1769 1641 gene locus_tag LOCUS_15420 1769 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2666 1935 gene locus_tag LOCUS_15430 2666 1935 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_15430 4875 2659 gene locus_tag LOCUS_15440 4875 2659 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_15440 5206 4892 gene locus_tag LOCUS_15450 5206 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 6463 5276 gene locus_tag LOCUS_15460 gene metK 6463 5276 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_15460 7358 6735 gene locus_tag LOCUS_15470 7358 6735 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_15470 7584 7405 gene locus_tag LOCUS_15480 7584 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 8931 7726 gene locus_tag LOCUS_15490 gene tuf 8931 7726 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_15490 11100 9022 gene locus_tag LOCUS_15500 gene fusA 11100 9022 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_15500 11628 11158 gene locus_tag LOCUS_15510 gene rpsG 11628 11158 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_15510 11725 11543 gene locus_tag LOCUS_15520 11725 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 12222 11806 gene locus_tag LOCUS_15530 gene rpsL 12222 11806 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_15530 12553 12311 gene locus_tag LOCUS_15540 12553 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 16405 12845 gene locus_tag LOCUS_15550 gene rpoC 16405 12845 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_15550 20525 16422 gene locus_tag LOCUS_15560 gene rpoB 20525 16422 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_15560 20863 23493 gene locus_tag LOCUS_15570 gene alaS 20863 23493 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_15570 23602 23943 gene locus_tag LOCUS_15580 23602 23943 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_15580 24140 25090 gene locus_tag LOCUS_15590 24140 25090 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949031.1 protein_id gnl|my_center|LOCUS_15590 26644 25178 gene locus_tag LOCUS_15600 26644 25178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 26783 27145 gene locus_tag LOCUS_15610 26783 27145 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_15610 27189 27407 gene locus_tag LOCUS_15620 27189 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 27433 29295 gene locus_tag LOCUS_15630 27433 29295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15630 36702 29320 gene locus_tag LOCUS_15640 36702 29320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 36841 38184 gene locus_tag LOCUS_15650 36841 38184 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_15650 40140 38359 gene locus_tag LOCUS_15660 40140 38359 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026861.1 protein_id gnl|my_center|LOCUS_15660 40377 40775 gene locus_tag LOCUS_15670 40377 40775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 41000 40830 gene locus_tag LOCUS_15680 41000 40830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 41755 41024 gene locus_tag LOCUS_15690 41755 41024 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_15690 42127 42471 gene locus_tag LOCUS_15700 42127 42471 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722028.1 protein_id gnl|my_center|LOCUS_15700 42838 43137 gene locus_tag LOCUS_15710 42838 43137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence24 1092 235 gene locus_tag LOCUS_15720 1092 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1877 1083 gene locus_tag LOCUS_15730 1877 1083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_15730 2171 2302 gene locus_tag LOCUS_15740 2171 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2395 2817 gene locus_tag LOCUS_15750 gene rnpA 2395 2817 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966998.1 protein_id gnl|my_center|LOCUS_15750 2814 3047 gene locus_tag LOCUS_15760 gene yidD 2814 3047 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_15760 3090 4205 gene locus_tag LOCUS_15770 3090 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4241 5167 gene locus_tag LOCUS_15780 4241 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 5762 7171 gene locus_tag LOCUS_15790 gene mnmE 5762 7171 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_15790 7403 8104 gene locus_tag LOCUS_15800 7403 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8465 8974 gene locus_tag LOCUS_15810 gene rplJ 8465 8974 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_15810 9049 9423 gene locus_tag LOCUS_15820 gene rplL 9049 9423 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459089.1 protein_id gnl|my_center|LOCUS_15820 9585 9660 gene locus_tag LOCUS_t00290 9585 9660 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9870 10604 gene locus_tag LOCUS_15830 9870 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 10977 11393 gene locus_tag LOCUS_15840 10977 11393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13567 11720 gene locus_tag LOCUS_15850 13567 11720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_15850 15404 13557 gene locus_tag LOCUS_15860 15404 13557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_15860 16188 15535 gene locus_tag LOCUS_15870 16188 15535 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_15870 16900 16190 gene locus_tag LOCUS_15880 16900 16190 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_15880 17206 17051 gene locus_tag LOCUS_15890 17206 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 17396 17154 gene locus_tag LOCUS_15900 17396 17154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 17839 17447 gene locus_tag LOCUS_15910 17839 17447 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214503.1 protein_id gnl|my_center|LOCUS_15910 19137 18076 gene locus_tag LOCUS_15920 19137 18076 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_15920 19321 20427 gene locus_tag LOCUS_15930 19321 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 20837 20517 gene locus_tag LOCUS_15940 20837 20517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 22037 20988 gene locus_tag LOCUS_15950 22037 20988 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_15950 22259 22819 gene locus_tag LOCUS_15960 22259 22819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 22898 23635 gene locus_tag LOCUS_15970 gene cwlD 22898 23635 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048347.1 protein_id gnl|my_center|LOCUS_15970 23647 25428 gene locus_tag LOCUS_15980 23647 25428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 25466 26086 gene locus_tag LOCUS_15990 25466 26086 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_15990 26188 27615 gene locus_tag LOCUS_16000 gene radA 26188 27615 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_16000 27612 28679 gene locus_tag LOCUS_16010 27612 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 28815 29378 gene locus_tag LOCUS_16020 28815 29378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 30281 29358 gene locus_tag LOCUS_16030 30281 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 31431 30466 gene locus_tag LOCUS_16040 31431 30466 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_16040 31717 32358 gene locus_tag LOCUS_16050 31717 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 32398 33420 gene locus_tag LOCUS_16060 32398 33420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 33682 35655 gene locus_tag LOCUS_16070 33682 35655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 36240 35860 gene locus_tag LOCUS_16080 36240 35860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 36353 36577 gene locus_tag LOCUS_16090 36353 36577 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_16090 36589 37296 gene locus_tag LOCUS_16100 36589 37296 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_16100 37474 38175 gene locus_tag LOCUS_16110 37474 38175 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_16110 38361 38828 gene locus_tag LOCUS_16120 38361 38828 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_16120 38945 39670 gene locus_tag LOCUS_16130 38945 39670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 39698 40219 gene locus_tag LOCUS_16140 gene lspA 39698 40219 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_16140 40191 41132 gene locus_tag LOCUS_16150 40191 41132 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_16150 41146 41973 gene locus_tag LOCUS_16160 gene yigL 41146 41973 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285349.1 protein_id gnl|my_center|LOCUS_16160 42081 42272 gene locus_tag LOCUS_16170 42081 42272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence25 858 148 gene locus_tag LOCUS_16180 gene plsY 858 148 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_16180 2201 876 gene locus_tag LOCUS_16190 gene der 2201 876 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_16190 3632 2322 gene locus_tag LOCUS_16200 3632 2322 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_16200 4018 3836 gene locus_tag LOCUS_16210 gene rpmF 4018 3836 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_16210 4585 4076 gene locus_tag LOCUS_16220 4585 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6048 4681 gene locus_tag LOCUS_16230 6048 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6401 7171 gene locus_tag LOCUS_16240 6401 7171 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_16240 7176 7628 gene locus_tag LOCUS_16250 7176 7628 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027567.1 protein_id gnl|my_center|LOCUS_16250 7645 8172 gene locus_tag LOCUS_16260 7645 8172 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495432.1 protein_id gnl|my_center|LOCUS_16260 8188 8703 gene locus_tag LOCUS_16270 8188 8703 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_16270 8977 8762 gene locus_tag LOCUS_16280 8977 8762 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_16280 9098 9280 gene locus_tag LOCUS_16290 9098 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 9770 9453 gene locus_tag LOCUS_16300 9770 9453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 10483 9770 gene locus_tag LOCUS_16310 10483 9770 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906060.1 protein_id gnl|my_center|LOCUS_16310 11502 10486 gene locus_tag LOCUS_16320 11502 10486 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048302.1 protein_id gnl|my_center|LOCUS_16320 13115 11946 gene locus_tag LOCUS_16330 13115 11946 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_16330 14287 13118 gene locus_tag LOCUS_16340 14287 13118 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095330.1 protein_id gnl|my_center|LOCUS_16340 15224 14460 gene locus_tag LOCUS_16350 15224 14460 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_16350 16071 15235 gene locus_tag LOCUS_16360 16071 15235 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_16360 16286 18271 gene locus_tag LOCUS_16370 16286 18271 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861581.1 protein_id gnl|my_center|LOCUS_16370 19584 18328 gene locus_tag LOCUS_16380 19584 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 19998 19765 gene locus_tag LOCUS_16390 gene acpP 19998 19765 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_16390 21761 20067 gene locus_tag LOCUS_16400 21761 20067 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_16400 23365 21986 gene locus_tag LOCUS_16410 23365 21986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 24096 23416 gene locus_tag LOCUS_16420 24096 23416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 25066 24116 gene locus_tag LOCUS_16430 25066 24116 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_16430 25312 25237 gene locus_tag LOCUS_t00300 25312 25237 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26241 25531 gene locus_tag LOCUS_16440 26241 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 26753 26277 gene locus_tag LOCUS_16450 26753 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 28597 26750 gene locus_tag LOCUS_16460 28597 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 28974 28594 gene locus_tag LOCUS_16470 28974 28594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 32627 29487 gene locus_tag LOCUS_16480 32627 29487 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858356.1 protein_id gnl|my_center|LOCUS_16480 33501 32632 gene locus_tag LOCUS_16490 33501 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 34070 33543 gene locus_tag LOCUS_16500 34070 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 35183 34104 gene locus_tag LOCUS_16510 35183 34104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 36741 35167 gene locus_tag LOCUS_16520 36741 35167 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_16520 37032 36820 gene locus_tag LOCUS_16530 37032 36820 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence26 610 185 gene locus_tag LOCUS_16540 610 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 932 687 gene locus_tag LOCUS_16550 932 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2190 1054 gene locus_tag LOCUS_16560 2190 1054 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_16560 3551 2256 gene locus_tag LOCUS_16570 3551 2256 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_16570 5028 3775 gene locus_tag LOCUS_16580 gene rhaA 5028 3775 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_16580 6668 5184 gene locus_tag LOCUS_16590 6668 5184 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_16590 7186 6887 gene locus_tag LOCUS_16600 7186 6887 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946237.1 protein_id gnl|my_center|LOCUS_16600 7762 7268 gene locus_tag LOCUS_16610 7762 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 10178 7776 gene locus_tag LOCUS_16620 10178 7776 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_16620 10455 10225 gene locus_tag LOCUS_16630 10455 10225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 11647 10577 gene locus_tag LOCUS_16640 11647 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_16640 12003 12317 gene locus_tag LOCUS_16650 12003 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 12314 13489 gene locus_tag LOCUS_16660 gene yqfD 12314 13489 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792478.1 protein_id gnl|my_center|LOCUS_16660 13518 14549 gene locus_tag LOCUS_16670 13518 14549 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16670 14546 15028 gene locus_tag LOCUS_16680 gene ybeY 14546 15028 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054692.1 protein_id gnl|my_center|LOCUS_16680 15069 16130 gene locus_tag LOCUS_16690 15069 16130 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_16690 16558 17460 gene locus_tag LOCUS_16700 gene era 16558 17460 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_16700 17513 18331 gene locus_tag LOCUS_16710 17513 18331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 18357 18986 gene locus_tag LOCUS_16720 18357 18986 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_16720 21354 19153 gene locus_tag LOCUS_16730 21354 19153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 22919 21351 gene locus_tag LOCUS_16740 22919 21351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 23663 22947 gene locus_tag LOCUS_16750 23663 22947 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_16750 24638 23679 gene locus_tag LOCUS_16760 gene gldA 24638 23679 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_16760 29726 25002 gene locus_tag LOCUS_16770 29726 25002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 32906 30465 gene locus_tag LOCUS_16780 gene pheT 32906 30465 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_16780 33939 32929 gene locus_tag LOCUS_16790 gene pheS 33939 32929 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_16790 34457 35002 gene locus_tag LOCUS_16800 34457 35002 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_16800 34999 35691 gene locus_tag LOCUS_16810 34999 35691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 35862 36572 gene locus_tag LOCUS_16820 35862 36572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence27 188 364 gene locus_tag LOCUS_16830 188 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 615 280 gene locus_tag LOCUS_16840 615 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 858 619 gene locus_tag LOCUS_16850 858 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1084 2721 gene locus_tag LOCUS_16860 1084 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3471 2842 gene locus_tag LOCUS_16870 3471 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3866 4567 gene locus_tag LOCUS_16880 3866 4567 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_16880 4580 5224 gene locus_tag LOCUS_16890 4580 5224 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_16890 5336 7165 gene locus_tag LOCUS_16900 5336 7165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_16900 7158 8966 gene locus_tag LOCUS_16910 7158 8966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_16910 9128 10729 gene locus_tag LOCUS_16920 9128 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 10975 11652 gene locus_tag LOCUS_16930 10975 11652 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459753.1 protein_id gnl|my_center|LOCUS_16930 11697 12134 gene locus_tag LOCUS_16940 11697 12134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 12450 12376 gene locus_tag LOCUS_t00310 12450 12376 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12645 12992 gene locus_tag LOCUS_16950 12645 12992 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723862.1 protein_id gnl|my_center|LOCUS_16950 13041 14378 gene locus_tag LOCUS_16960 gene ffh 13041 14378 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_16960 14471 14716 gene locus_tag LOCUS_16970 gene rpsP 14471 14716 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_16970 14729 14968 gene locus_tag LOCUS_16980 14729 14968 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_16980 15960 15097 gene locus_tag LOCUS_16990 15960 15097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 16066 16278 gene locus_tag LOCUS_17000 16066 16278 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_17000 16814 16446 gene locus_tag LOCUS_17010 16814 16446 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_17010 17920 16925 gene locus_tag LOCUS_17020 17920 16925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 20338 18161 gene locus_tag LOCUS_17030 20338 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 21056 20364 gene locus_tag LOCUS_17040 gene radC 21056 20364 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975614.1 protein_id gnl|my_center|LOCUS_17040 21241 22344 gene locus_tag LOCUS_17050 21241 22344 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_17050 22716 23435 gene locus_tag LOCUS_17060 gene yycF 22716 23435 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_17060 23452 25260 gene locus_tag LOCUS_17070 gene walK 23452 25260 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379340.1 protein_id gnl|my_center|LOCUS_17070 25513 26994 gene locus_tag LOCUS_17080 25513 26994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 27001 27906 gene locus_tag LOCUS_17090 27001 27906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 28190 29479 gene locus_tag LOCUS_17100 28190 29479 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_17100 29687 29520 gene locus_tag LOCUS_17110 29687 29520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 29647 30324 gene locus_tag LOCUS_17120 gene sdaAB 29647 30324 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232050.1 protein_id gnl|my_center|LOCUS_17120 30339 31244 gene locus_tag LOCUS_17130 gene sdaAA 30339 31244 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963993.1 protein_id gnl|my_center|LOCUS_17130 32252 31599 gene locus_tag LOCUS_17140 gene fabG 32252 31599 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356283.1 protein_id gnl|my_center|LOCUS_17140 32943 32257 gene locus_tag LOCUS_17150 32943 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 34219 33311 gene locus_tag LOCUS_17160 34219 33311 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_17160 35466 34216 gene locus_tag LOCUS_17170 35466 34216 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence28 <1 824 gene locus_tag LOCUS_17180 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006037763.1:RHS repeat-associated core domain-containing protein 868 1611 gene locus_tag LOCUS_17190 868 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1977 2612 gene locus_tag LOCUS_17200 1977 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2593 3684 gene locus_tag LOCUS_17210 2593 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3720 4055 gene locus_tag LOCUS_17220 3720 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4000 5697 gene locus_tag LOCUS_17230 4000 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 5694 6185 gene locus_tag LOCUS_17240 5694 6185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6169 7482 gene locus_tag LOCUS_17250 6169 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 7509 8150 gene locus_tag LOCUS_17260 7509 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8166 9416 gene locus_tag LOCUS_17270 8166 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 9482 9862 gene locus_tag LOCUS_17280 9482 9862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 9869 10192 gene locus_tag LOCUS_17290 9869 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 10194 10925 gene locus_tag LOCUS_17300 10194 10925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 10985 11518 gene locus_tag LOCUS_17310 10985 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 11511 12227 gene locus_tag LOCUS_17320 11511 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 12237 12413 gene locus_tag LOCUS_17330 12237 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 12403 13452 gene locus_tag LOCUS_17340 12403 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 13643 14416 gene locus_tag LOCUS_17350 13643 14416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 14449 15561 gene locus_tag LOCUS_17360 14449 15561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 15667 16656 gene locus_tag LOCUS_17370 15667 16656 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_17370 16656 17114 gene locus_tag LOCUS_17380 16656 17114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 17141 18976 gene locus_tag LOCUS_17390 17141 18976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 18988 19608 gene locus_tag LOCUS_17400 18988 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 19639 24930 gene locus_tag LOCUS_17410 19639 24930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 24946 28182 gene locus_tag LOCUS_17420 24946 28182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 28188 29495 gene locus_tag LOCUS_17430 28188 29495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964429.1 protein_id gnl|my_center|LOCUS_17430 29492 29785 gene locus_tag LOCUS_17440 29492 29785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 29802 30851 gene locus_tag LOCUS_17450 29802 30851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 30866 31384 gene locus_tag LOCUS_17460 30866 31384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 31381 32445 gene locus_tag LOCUS_17470 31381 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 32445 33353 gene locus_tag LOCUS_17480 32445 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence29 <1 1246 gene locus_tag LOCUS_17490 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein 1669 1575 gene locus_tag LOCUS_t00320 1669 1575 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1884 2813 gene locus_tag LOCUS_17500 1884 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3290 4237 gene locus_tag LOCUS_17510 3290 4237 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143314.1 protein_id gnl|my_center|LOCUS_17510 4357 5742 gene locus_tag LOCUS_17520 gene fumC 4357 5742 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_17520 5757 6533 gene locus_tag LOCUS_17530 5757 6533 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_17530 6544 6930 gene locus_tag LOCUS_17540 6544 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 6946 8937 gene locus_tag LOCUS_17550 6946 8937 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_17550 8928 9362 gene locus_tag LOCUS_17560 8928 9362 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_17560 9350 10318 gene locus_tag LOCUS_17570 9350 10318 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_17570 10321 11349 gene locus_tag LOCUS_17580 10321 11349 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_17580 11346 12185 gene locus_tag LOCUS_17590 11346 12185 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_17590 12204 12884 gene locus_tag LOCUS_17600 12204 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 12900 14513 gene locus_tag LOCUS_17610 12900 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 14565 16355 gene locus_tag LOCUS_17620 14565 16355 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_17620 16436 17068 gene locus_tag LOCUS_17630 16436 17068 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_17630 17239 18318 gene locus_tag LOCUS_17640 17239 18318 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949087.1 protein_id gnl|my_center|LOCUS_17640 19747 18362 gene locus_tag LOCUS_17650 gene gltA 19747 18362 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_17650 20582 19740 gene locus_tag LOCUS_17660 20582 19740 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_17660 20753 21826 gene locus_tag LOCUS_17670 20753 21826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 21868 22968 gene locus_tag LOCUS_17680 gene wecB 21868 22968 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243178.1 protein_id gnl|my_center|LOCUS_17680 23071 24279 gene locus_tag LOCUS_17690 23071 24279 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_17690 24292 24759 gene locus_tag LOCUS_17700 24292 24759 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_17700 24776 25702 gene locus_tag LOCUS_17710 24776 25702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 25699 26253 gene locus_tag LOCUS_17720 25699 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 26345 28738 gene locus_tag LOCUS_17730 26345 28738 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_17730 28850 29533 gene locus_tag LOCUS_17740 28850 29533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 30851 29598 gene locus_tag LOCUS_17750 gene hemW 30851 29598 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 protein_id gnl|my_center|LOCUS_17750 31765 30863 gene locus_tag LOCUS_17760 31765 30863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence30 1367 270 gene locus_tag LOCUS_17770 1367 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3464 1509 gene locus_tag LOCUS_17780 3464 1509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_17780 5215 3461 gene locus_tag LOCUS_17790 5215 3461 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_17790 5707 5264 gene locus_tag LOCUS_17800 5707 5264 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_17800 6103 5867 gene locus_tag LOCUS_17810 6103 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 6736 6227 gene locus_tag LOCUS_17820 6736 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 7360 6803 gene locus_tag LOCUS_17830 7360 6803 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_17830 8191 7370 gene locus_tag LOCUS_17840 gene dpsA 8191 7370 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_17840 8510 9556 gene locus_tag LOCUS_17850 8510 9556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 9570 10136 gene locus_tag LOCUS_17860 9570 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 10277 11026 gene locus_tag LOCUS_17870 10277 11026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 11115 11675 gene locus_tag LOCUS_17880 11115 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 13692 11731 gene locus_tag LOCUS_17890 13692 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 14957 13977 gene locus_tag LOCUS_17900 14957 13977 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_17900 16509 15199 gene locus_tag LOCUS_17910 gene mtaB 16509 15199 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964598.1 protein_id gnl|my_center|LOCUS_17910 17772 16600 gene locus_tag LOCUS_17920 17772 16600 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_17920 18515 17871 gene locus_tag LOCUS_17930 18515 17871 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263190.1 protein_id gnl|my_center|LOCUS_17930 18669 19451 gene locus_tag LOCUS_17940 18669 19451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 20417 19593 gene locus_tag LOCUS_17950 20417 19593 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_17950 21248 20430 gene locus_tag LOCUS_17960 21248 20430 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_17960 22269 21391 gene locus_tag LOCUS_17970 22269 21391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 23081 22266 gene locus_tag LOCUS_17980 gene coaW 23081 22266 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442504.1 protein_id gnl|my_center|LOCUS_17980 24143 23121 gene locus_tag LOCUS_17990 24143 23121 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_17990 25810 24386 gene locus_tag LOCUS_18000 gene purB 25810 24386 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_18000 27180 25903 gene locus_tag LOCUS_18010 27180 25903 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_18010 28600 27206 gene locus_tag LOCUS_18020 gene asnS 28600 27206 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966534.1 protein_id gnl|my_center|LOCUS_18020 28858 29862 gene locus_tag LOCUS_18030 28858 29862 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324319.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence31 1270 203 gene locus_tag LOCUS_18040 1270 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 1450 2415 gene locus_tag LOCUS_18050 1450 2415 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974650.1 protein_id gnl|my_center|LOCUS_18050 2415 3791 gene locus_tag LOCUS_18060 2415 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3809 4294 gene locus_tag LOCUS_18070 gene ybaK 3809 4294 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_18070 4312 5337 gene locus_tag LOCUS_18080 4312 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 5353 5871 gene locus_tag LOCUS_18090 5353 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 6900 5911 gene locus_tag LOCUS_18100 6900 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 7108 7494 gene locus_tag LOCUS_18110 7108 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7487 7834 gene locus_tag LOCUS_18120 7487 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 7836 8495 gene locus_tag LOCUS_18130 7836 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 8527 9294 gene locus_tag LOCUS_18140 8527 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 9322 10110 gene locus_tag LOCUS_18150 9322 10110 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892748.1 protein_id gnl|my_center|LOCUS_18150 10116 10826 gene locus_tag LOCUS_18160 10116 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 11001 12083 gene locus_tag LOCUS_18170 gene pfkA 11001 12083 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173968.1 protein_id gnl|my_center|LOCUS_18170 12148 12726 gene locus_tag LOCUS_18180 12148 12726 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016900.1 protein_id gnl|my_center|LOCUS_18180 13946 12888 gene locus_tag LOCUS_18190 13946 12888 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_18190 14159 15601 gene locus_tag LOCUS_18200 14159 15601 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_18200 15864 18152 gene locus_tag LOCUS_18210 15864 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 18308 18772 gene locus_tag LOCUS_18220 18308 18772 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905253.1 protein_id gnl|my_center|LOCUS_18220 18800 19009 gene locus_tag LOCUS_18230 18800 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 19175 19783 gene locus_tag LOCUS_18240 19175 19783 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944392.1 protein_id gnl|my_center|LOCUS_18240 20069 19863 gene locus_tag LOCUS_18250 20069 19863 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_18250 20269 20487 gene locus_tag LOCUS_18260 20269 20487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 20527 21660 gene locus_tag LOCUS_18270 20527 21660 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_18270 22138 21716 gene locus_tag LOCUS_18280 22138 21716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 22338 22141 gene locus_tag LOCUS_18290 22338 22141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 23581 22358 gene locus_tag LOCUS_18300 23581 22358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 23776 24033 gene locus_tag LOCUS_18310 23776 24033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 25535 24102 gene locus_tag LOCUS_18320 25535 24102 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869220.1 protein_id gnl|my_center|LOCUS_18320 26371 25634 gene locus_tag LOCUS_18330 26371 25634 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_18330 28236 26500 gene locus_tag LOCUS_18340 gene argS 28236 26500 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_18340 28426 29376 gene locus_tag LOCUS_18350 gene bsh 28426 29376 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence32 3076 128 gene locus_tag LOCUS_18360 3076 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 3286 5121 gene locus_tag LOCUS_18370 gene fucI 3286 5121 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_18370 5362 6150 gene locus_tag LOCUS_18380 5362 6150 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477445.1 protein_id gnl|my_center|LOCUS_18380 6832 6425 gene locus_tag LOCUS_18390 6832 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7909 7259 gene locus_tag LOCUS_18400 7909 7259 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018212010.1 protein_id gnl|my_center|LOCUS_18400 9373 7925 gene locus_tag LOCUS_18410 9373 7925 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388669.1 protein_id gnl|my_center|LOCUS_18410 10189 9431 gene locus_tag LOCUS_18420 10189 9431 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719096.1 protein_id gnl|my_center|LOCUS_18420 10762 10214 gene locus_tag LOCUS_18430 10762 10214 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815271.1 protein_id gnl|my_center|LOCUS_18430 12103 10775 gene locus_tag LOCUS_18440 12103 10775 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_18440 12443 12171 gene locus_tag LOCUS_18450 12443 12171 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016131.1 protein_id gnl|my_center|LOCUS_18450 12832 12554 gene locus_tag LOCUS_18460 gene pduA 12832 12554 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_18460 13165 12887 gene locus_tag LOCUS_18470 gene pduA 13165 12887 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_18470 13665 13360 gene locus_tag LOCUS_18480 13665 13360 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634659.1 protein_id gnl|my_center|LOCUS_18480 13961 13683 gene locus_tag LOCUS_18490 gene pduA 13961 13683 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388660.1 protein_id gnl|my_center|LOCUS_18490 14316 14002 gene locus_tag LOCUS_18500 14316 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 15533 14331 gene locus_tag LOCUS_18510 15533 14331 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015646101.1 protein_id gnl|my_center|LOCUS_18510 16010 15540 gene locus_tag LOCUS_18520 16010 15540 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388668.1 protein_id gnl|my_center|LOCUS_18520 16911 16120 gene locus_tag LOCUS_18530 16911 16120 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_18530 17516 17064 gene locus_tag LOCUS_18540 17516 17064 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836561.1 protein_id gnl|my_center|LOCUS_18540 17890 17516 gene locus_tag LOCUS_18550 17890 17516 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904036.1 protein_id gnl|my_center|LOCUS_18550 18730 17933 gene locus_tag LOCUS_18560 18730 17933 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922726.1 protein_id gnl|my_center|LOCUS_18560 21259 18731 gene locus_tag LOCUS_18570 21259 18731 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388658.1 protein_id gnl|my_center|LOCUS_18570 21683 21904 gene locus_tag LOCUS_18580 21683 21904 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_18580 21975 24134 gene locus_tag LOCUS_18590 gene feoB 21975 24134 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_18590 24176 24361 gene locus_tag LOCUS_18600 24176 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 24467 24760 gene locus_tag LOCUS_18610 24467 24760 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_18610 24760 25311 gene locus_tag LOCUS_18620 24760 25311 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_18620 25348 25776 gene locus_tag LOCUS_18630 25348 25776 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_18630 27573 25801 gene locus_tag LOCUS_18640 gene tndX 27573 25801 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_18640 27948 27658 gene locus_tag LOCUS_18650 27948 27658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 28849 27962 gene locus_tag LOCUS_18660 gene spo0J 28849 27962 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence33 442 128 gene locus_tag LOCUS_18670 442 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 548 748 gene locus_tag LOCUS_18680 548 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 1863 799 gene locus_tag LOCUS_18690 1863 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3676 1931 gene locus_tag LOCUS_18700 3676 1931 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_18700 5586 3700 gene locus_tag LOCUS_18710 5586 3700 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416938.1 protein_id gnl|my_center|LOCUS_18710 6107 5613 gene locus_tag LOCUS_18720 gene nuoE 6107 5613 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_18720 7353 6391 gene locus_tag LOCUS_18730 7353 6391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7529 8977 gene locus_tag LOCUS_18740 gene uxaC 7529 8977 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_18740 9138 8974 gene locus_tag LOCUS_18750 9138 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 9229 10101 gene locus_tag LOCUS_18760 9229 10101 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_18760 10101 10541 gene locus_tag LOCUS_18770 10101 10541 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832356.1 protein_id gnl|my_center|LOCUS_18770 10522 10974 gene locus_tag LOCUS_18780 gene rimI 10522 10974 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817348.1 protein_id gnl|my_center|LOCUS_18780 11066 12076 gene locus_tag LOCUS_18790 gene tsaD 11066 12076 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_18790 12515 13462 gene locus_tag LOCUS_18800 12515 13462 CDS product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966850.1 protein_id gnl|my_center|LOCUS_18800 13490 14473 gene locus_tag LOCUS_18810 13490 14473 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_18810 15286 14660 gene locus_tag LOCUS_18820 15286 14660 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_18820 16130 15303 gene locus_tag LOCUS_18830 16130 15303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 16563 16375 gene locus_tag LOCUS_18840 16563 16375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 17173 16631 gene locus_tag LOCUS_18850 17173 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 18393 17251 gene locus_tag LOCUS_18860 18393 17251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 18576 19064 gene locus_tag LOCUS_18870 18576 19064 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_18870 19577 19269 gene locus_tag LOCUS_18880 gene spoVG 19577 19269 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_18880 19833 21221 gene locus_tag LOCUS_18890 gene murC 19833 21221 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_18890 21353 22216 gene locus_tag LOCUS_18900 21353 22216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 22220 22915 gene locus_tag LOCUS_18910 22220 22915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 22902 23801 gene locus_tag LOCUS_18920 22902 23801 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_18920 23891 24403 gene locus_tag LOCUS_18930 23891 24403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 25193 24375 gene locus_tag LOCUS_18940 25193 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 25954 25385 gene locus_tag LOCUS_18950 25954 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 26078 26164 gene locus_tag LOCUS_t00330 26078 26164 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26335 26580 gene locus_tag LOCUS_18960 26335 26580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence34 724 224 gene locus_tag LOCUS_18970 724 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1020 721 gene locus_tag LOCUS_18980 1020 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18980 2112 1048 gene locus_tag LOCUS_18990 2112 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18990 3494 2109 gene locus_tag LOCUS_19000 3494 2109 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174192.1 protein_id gnl|my_center|LOCUS_19000 3752 5119 gene locus_tag LOCUS_19010 3752 5119 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_19010 5342 6118 gene locus_tag LOCUS_19020 5342 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 6587 7903 gene locus_tag LOCUS_19030 gene rsxC 6587 7903 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_19030 7896 8825 gene locus_tag LOCUS_19040 7896 8825 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_19040 8822 10003 gene locus_tag LOCUS_19050 8822 10003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 10000 10689 gene locus_tag LOCUS_19060 10000 10689 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_19060 10690 11289 gene locus_tag LOCUS_19070 gene rsxA 10690 11289 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_19070 11301 12131 gene locus_tag LOCUS_19080 11301 12131 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_19080 12217 12597 gene locus_tag LOCUS_19090 12217 12597 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948150.1 protein_id gnl|my_center|LOCUS_19090 12609 13115 gene locus_tag LOCUS_19100 12609 13115 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131089.1 protein_id gnl|my_center|LOCUS_19100 13195 14175 gene locus_tag LOCUS_19110 13195 14175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 14188 15237 gene locus_tag LOCUS_19120 14188 15237 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071622.1 protein_id gnl|my_center|LOCUS_19120 15429 15881 gene locus_tag LOCUS_19130 15429 15881 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_19130 15878 16594 gene locus_tag LOCUS_19140 15878 16594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 16715 17509 gene locus_tag LOCUS_19150 16715 17509 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_19150 17543 18898 gene locus_tag LOCUS_19160 17543 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 18920 19909 gene locus_tag LOCUS_19170 18920 19909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 19906 21234 gene locus_tag LOCUS_19180 19906 21234 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964346.1 protein_id gnl|my_center|LOCUS_19180 21263 22378 gene locus_tag LOCUS_19190 21263 22378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 23512 22511 gene locus_tag LOCUS_19200 23512 22511 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_19200 25707 23584 gene locus_tag LOCUS_19210 25707 23584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence35 217 1872 gene locus_tag LOCUS_19220 217 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1885 2646 gene locus_tag LOCUS_19230 1885 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 2802 3065 gene locus_tag LOCUS_19240 gene rpsT 2802 3065 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_19240 4509 3124 gene locus_tag LOCUS_19250 4509 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4678 5196 gene locus_tag LOCUS_19260 gene trmL 4678 5196 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_19260 5297 8023 gene locus_tag LOCUS_19270 gene secA 5297 8023 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_19270 8370 9065 gene locus_tag LOCUS_19280 8370 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 9086 10681 gene locus_tag LOCUS_19290 9086 10681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 10927 11538 gene locus_tag LOCUS_19300 gene lepB 10927 11538 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_19300 11750 12610 gene locus_tag LOCUS_19310 gene ylqF 11750 12610 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047861.1 protein_id gnl|my_center|LOCUS_19310 12627 13232 gene locus_tag LOCUS_19320 12627 13232 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641962.1 protein_id gnl|my_center|LOCUS_19320 13555 14172 gene locus_tag LOCUS_19330 gene rnhB 13555 14172 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163155.1 protein_id gnl|my_center|LOCUS_19330 14169 14555 gene locus_tag LOCUS_19340 14169 14555 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438259.1 protein_id gnl|my_center|LOCUS_19340 14951 14760 gene locus_tag LOCUS_19350 14951 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 15096 15848 gene locus_tag LOCUS_19360 15096 15848 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_19360 15964 17289 gene locus_tag LOCUS_19370 gene tig 15964 17289 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_19370 17406 17990 gene locus_tag LOCUS_19380 gene clpP 17406 17990 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_19380 18001 19284 gene locus_tag LOCUS_19390 gene clpX 18001 19284 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_19390 19741 21165 gene locus_tag LOCUS_19400 19741 21165 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_19400 21465 22220 gene locus_tag LOCUS_19410 21465 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 22326 23690 gene locus_tag LOCUS_19420 gene rimO 22326 23690 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_19420 23719 24315 gene locus_tag LOCUS_19430 gene pgsA 23719 24315 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991432.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence36 216 899 gene locus_tag LOCUS_19440 216 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 905 1678 gene locus_tag LOCUS_19450 905 1678 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_19450 1978 1772 gene locus_tag LOCUS_19460 1978 1772 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_19460 2409 4481 gene locus_tag LOCUS_19470 gene fusA 2409 4481 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_19470 5370 4603 gene locus_tag LOCUS_19480 5370 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 5615 7036 gene locus_tag LOCUS_19490 gene miaB 5615 7036 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_19490 7170 9773 gene locus_tag LOCUS_19500 gene mutS 7170 9773 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_19500 9916 10650 gene locus_tag LOCUS_19510 9916 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 10729 12807 gene locus_tag LOCUS_19520 gene mutL 10729 12807 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837650.1 protein_id gnl|my_center|LOCUS_19520 12835 13965 gene locus_tag LOCUS_19530 gene tgt 12835 13965 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_19530 14326 15213 gene locus_tag LOCUS_19540 14326 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 16677 15454 gene locus_tag LOCUS_19550 gene tyrS 16677 15454 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_19550 18099 17029 gene locus_tag LOCUS_19560 18099 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 19844 18168 gene locus_tag LOCUS_19570 gene recN 19844 18168 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_19570 20317 19865 gene locus_tag LOCUS_19580 20317 19865 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_19580 21254 20349 gene locus_tag LOCUS_19590 21254 20349 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_19590 22053 21274 gene locus_tag LOCUS_19600 22053 21274 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_19600 22304 24070 gene locus_tag LOCUS_19610 22304 24070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence37 1612 422 gene locus_tag LOCUS_19620 1612 422 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_19620 1817 1614 gene locus_tag LOCUS_19630 1817 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 1970 3316 gene locus_tag LOCUS_19640 1970 3316 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_19640 3340 3987 gene locus_tag LOCUS_19650 3340 3987 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_19650 4027 5667 gene locus_tag LOCUS_19660 4027 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5790 6353 gene locus_tag LOCUS_19670 5790 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 9462 6505 gene locus_tag LOCUS_19680 9462 6505 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_19680 10289 9687 gene locus_tag LOCUS_19690 10289 9687 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_19690 10764 10291 gene locus_tag LOCUS_19700 10764 10291 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964912.1 protein_id gnl|my_center|LOCUS_19700 11183 10899 gene locus_tag LOCUS_19710 11183 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 11302 12186 gene locus_tag LOCUS_19720 11302 12186 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421915.1 protein_id gnl|my_center|LOCUS_19720 13046 12213 gene locus_tag LOCUS_19730 13046 12213 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986202.1 protein_id gnl|my_center|LOCUS_19730 14706 13375 gene locus_tag LOCUS_19740 14706 13375 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_19740 14865 15677 gene locus_tag LOCUS_19750 14865 15677 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_19750 15971 18142 gene locus_tag LOCUS_19760 gene nrdD 15971 18142 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_19760 18154 18717 gene locus_tag LOCUS_19770 gene nrdG 18154 18717 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_19770 19584 19333 gene locus_tag LOCUS_19780 19584 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 19780 19601 gene locus_tag LOCUS_19790 19780 19601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 19933 20685 gene locus_tag LOCUS_19800 19933 20685 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_19800 20984 20718 gene locus_tag LOCUS_19810 20984 20718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 21161 21373 gene locus_tag LOCUS_19820 21161 21373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 21493 22038 gene locus_tag LOCUS_19830 21493 22038 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_19830 22061 23647 gene locus_tag LOCUS_19840 22061 23647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence38 280 2166 gene locus_tag LOCUS_19850 280 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2484 2741 gene locus_tag LOCUS_19860 2484 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2738 4195 gene locus_tag LOCUS_19870 2738 4195 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_19870 4214 5650 gene locus_tag LOCUS_19880 4214 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 7343 5793 gene locus_tag LOCUS_19890 gene cls 7343 5793 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_19890 7590 7880 gene locus_tag LOCUS_19900 gene rpsF 7590 7880 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_19900 7902 8333 gene locus_tag LOCUS_19910 gene ssb 7902 8333 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583716.1 protein_id gnl|my_center|LOCUS_19910 8388 8639 gene locus_tag LOCUS_19920 gene rpsR 8388 8639 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359407.1 protein_id gnl|my_center|LOCUS_19920 8840 10834 gene locus_tag LOCUS_19930 8840 10834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 11734 10892 gene locus_tag LOCUS_19940 11734 10892 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_19940 11999 12844 gene locus_tag LOCUS_19950 11999 12844 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964110.1 protein_id gnl|my_center|LOCUS_19950 12848 14014 gene locus_tag LOCUS_19960 gene alr 12848 14014 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_19960 14948 14148 gene locus_tag LOCUS_19970 14948 14148 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_19970 15126 16232 gene locus_tag LOCUS_19980 15126 16232 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_19980 16252 17145 gene locus_tag LOCUS_19990 16252 17145 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355143.1 protein_id gnl|my_center|LOCUS_19990 17159 18034 gene locus_tag LOCUS_20000 17159 18034 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355144.1 protein_id gnl|my_center|LOCUS_20000 18031 19626 gene locus_tag LOCUS_20010 18031 19626 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601692.1 protein_id gnl|my_center|LOCUS_20010 19695 20429 gene locus_tag LOCUS_20020 19695 20429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 20750 21772 gene locus_tag LOCUS_20030 20750 21772 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_20030 21786 22742 gene locus_tag LOCUS_20040 21786 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence39 210 380 gene locus_tag LOCUS_20050 210 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 459 1970 gene locus_tag LOCUS_20060 459 1970 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047851.1 protein_id gnl|my_center|LOCUS_20060 2494 2183 gene locus_tag LOCUS_20070 2494 2183 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481834.1 protein_id gnl|my_center|LOCUS_20070 3070 2507 gene locus_tag LOCUS_20080 3070 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985662.1 protein_id gnl|my_center|LOCUS_20080 3680 3234 gene locus_tag LOCUS_20090 3680 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4402 3683 gene locus_tag LOCUS_20100 4402 3683 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_20100 4652 5197 gene locus_tag LOCUS_20110 4652 5197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 protein_id gnl|my_center|LOCUS_20110 5356 5703 gene locus_tag LOCUS_20120 5356 5703 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_20120 5700 5963 gene locus_tag LOCUS_20130 5700 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6325 6582 gene locus_tag LOCUS_20140 6325 6582 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_20140 7105 6950 gene locus_tag LOCUS_20150 7105 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 7187 7630 gene locus_tag LOCUS_20160 7187 7630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 7691 9148 gene locus_tag LOCUS_20170 gene hydG 7691 9148 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_20170 9166 10371 gene locus_tag LOCUS_20180 gene hydF 9166 10371 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_20180 10639 10454 gene locus_tag LOCUS_20190 10639 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 10954 10826 gene locus_tag LOCUS_20200 10954 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 11903 11244 gene locus_tag LOCUS_20210 11903 11244 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_20210 12007 13608 gene locus_tag LOCUS_20220 gene hcp 12007 13608 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_20220 14084 13692 gene locus_tag LOCUS_20230 14084 13692 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_20230 16670 14130 gene locus_tag LOCUS_20240 16670 14130 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_20240 16821 18335 gene locus_tag LOCUS_20250 16821 18335 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_20250 18558 19079 gene locus_tag LOCUS_20260 18558 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 19104 20501 gene locus_tag LOCUS_20270 19104 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 20513 21682 gene locus_tag LOCUS_20280 20513 21682 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence40 198 1112 gene locus_tag LOCUS_20290 198 1112 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775527.1 protein_id gnl|my_center|LOCUS_20290 1920 1156 gene locus_tag LOCUS_20300 1920 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9626 1896 gene locus_tag LOCUS_20310 9626 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20310 9987 9649 gene locus_tag LOCUS_20320 9987 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 10802 9987 gene locus_tag LOCUS_20330 10802 9987 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286575.1 protein_id gnl|my_center|LOCUS_20330 11512 10799 gene locus_tag LOCUS_20340 11512 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 12204 11512 gene locus_tag LOCUS_20350 12204 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 12435 12241 gene locus_tag LOCUS_20360 12435 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 13046 12435 gene locus_tag LOCUS_20370 13046 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 15509 13074 gene locus_tag LOCUS_20380 15509 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 16091 15570 gene locus_tag LOCUS_20390 16091 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 16635 16168 gene locus_tag LOCUS_20400 16635 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 17049 16645 gene locus_tag LOCUS_20410 17049 16645 CDS product DUF4320 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272175.1 protein_id gnl|my_center|LOCUS_20410 17930 17064 gene locus_tag LOCUS_20420 17930 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272176.1 protein_id gnl|my_center|LOCUS_20420 18663 17827 gene locus_tag LOCUS_20430 18663 17827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 19395 18664 gene locus_tag LOCUS_20440 19395 18664 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272698.1 protein_id gnl|my_center|LOCUS_20440 20155 19403 gene locus_tag LOCUS_20450 20155 19403 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458858.1 protein_id gnl|my_center|LOCUS_20450 20604 20275 gene locus_tag LOCUS_20460 20604 20275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 21017 20778 gene locus_tag LOCUS_20470 21017 20778 CDS product DUF6133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272752.1 protein_id gnl|my_center|LOCUS_20470 21308 21069 gene locus_tag LOCUS_20480 21308 21069 CDS product DUF6133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272752.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence41 856 251 gene locus_tag LOCUS_20490 856 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1181 2200 gene locus_tag LOCUS_20500 gene trpS 1181 2200 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_20500 2214 3326 gene locus_tag LOCUS_20510 2214 3326 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_20510 3369 4130 gene locus_tag LOCUS_20520 3369 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4456 4127 gene locus_tag LOCUS_20530 4456 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4882 4529 gene locus_tag LOCUS_20540 4882 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 5152 4904 gene locus_tag LOCUS_20550 5152 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5283 5792 gene locus_tag LOCUS_20560 5283 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5970 6200 gene locus_tag LOCUS_20570 gene acpP 5970 6200 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_20570 6333 6746 gene locus_tag LOCUS_20580 6333 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 6837 7631 gene locus_tag LOCUS_20590 6837 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 7902 8318 gene locus_tag LOCUS_20600 gene nusB 7902 8318 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230256.1 protein_id gnl|my_center|LOCUS_20600 8398 9348 gene locus_tag LOCUS_20610 8398 9348 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_20610 9899 11122 gene locus_tag LOCUS_20620 gene xseA 9899 11122 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_20620 11125 11373 gene locus_tag LOCUS_20630 gene xseB 11125 11373 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428410.1 protein_id gnl|my_center|LOCUS_20630 11370 12260 gene locus_tag LOCUS_20640 11370 12260 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_20640 12379 13593 gene locus_tag LOCUS_20650 12379 13593 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_20650 13845 13636 gene locus_tag LOCUS_20660 13845 13636 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_20660 13968 15020 gene locus_tag LOCUS_20670 13968 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 16997 15369 gene locus_tag LOCUS_20680 gene groL 16997 15369 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_20680 17306 17022 gene locus_tag LOCUS_20690 17306 17022 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_20690 17685 19019 gene locus_tag LOCUS_20700 17685 19019 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938025.1 protein_id gnl|my_center|LOCUS_20700 19621 19064 gene locus_tag LOCUS_20710 19621 19064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 20368 19649 gene locus_tag LOCUS_20720 20368 19649 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027034.1 protein_id gnl|my_center|LOCUS_20720 20601 20939 gene locus_tag LOCUS_20730 20601 20939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence42 174 524 gene locus_tag LOCUS_20740 174 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 593 1042 gene locus_tag LOCUS_20750 593 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 1582 1100 gene locus_tag LOCUS_20760 1582 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 2317 1655 gene locus_tag LOCUS_20770 2317 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 2526 3098 gene locus_tag LOCUS_20780 2526 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808298.1 protein_id gnl|my_center|LOCUS_20780 4451 3276 gene locus_tag LOCUS_20790 4451 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 5002 4448 gene locus_tag LOCUS_20800 5002 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 5204 5611 gene locus_tag LOCUS_20810 5204 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 5744 6370 gene locus_tag LOCUS_20820 5744 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6389 8071 gene locus_tag LOCUS_20830 6389 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 8606 8232 gene locus_tag LOCUS_20840 8606 8232 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385301.1 protein_id gnl|my_center|LOCUS_20840 9502 8657 gene locus_tag LOCUS_20850 gene prmC 9502 8657 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529462.1 protein_id gnl|my_center|LOCUS_20850 10500 9499 gene locus_tag LOCUS_20860 10500 9499 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_20860 10899 10651 gene locus_tag LOCUS_20870 10899 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 11964 11107 gene locus_tag LOCUS_20880 11964 11107 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964640.1 protein_id gnl|my_center|LOCUS_20880 12760 12110 gene locus_tag LOCUS_20890 12760 12110 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889796.1 protein_id gnl|my_center|LOCUS_20890 12916 13590 gene locus_tag LOCUS_20900 12916 13590 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 protein_id gnl|my_center|LOCUS_20900 13820 15466 gene locus_tag LOCUS_20910 gene gpmI 13820 15466 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_20910 15524 15976 gene locus_tag LOCUS_20920 15524 15976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 16014 16424 gene locus_tag LOCUS_20930 16014 16424 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644790.1 protein_id gnl|my_center|LOCUS_20930 16464 17846 gene locus_tag LOCUS_20940 16464 17846 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_20940 18019 18615 gene locus_tag LOCUS_20950 gene spoIIR 18019 18615 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_20950 19546 18575 gene locus_tag LOCUS_20960 19546 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 19731 20411 gene locus_tag LOCUS_20970 gene sigK 19731 20411 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence43 118 43 gene locus_tag LOCUS_t00340 118 43 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1384 257 gene locus_tag LOCUS_20980 1384 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 1582 1658 gene locus_tag LOCUS_t00350 1582 1658 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1683 1757 gene locus_tag LOCUS_t00360 1683 1757 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2271 2086 gene locus_tag LOCUS_20990 2271 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 3143 2319 gene locus_tag LOCUS_21000 3143 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4375 3497 gene locus_tag LOCUS_21010 4375 3497 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_21010 4570 5961 gene locus_tag LOCUS_21020 4570 5961 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860625.1 protein_id gnl|my_center|LOCUS_21020 5973 8543 gene locus_tag LOCUS_21030 5973 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 8636 10249 gene locus_tag LOCUS_21040 8636 10249 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_21040 10391 10996 gene locus_tag LOCUS_21050 10391 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 11209 12294 gene locus_tag LOCUS_21060 11209 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 12675 14657 gene locus_tag LOCUS_21070 12675 14657 CDS product alpha-L-rhamnosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695108.1 protein_id gnl|my_center|LOCUS_21070 14756 15652 gene locus_tag LOCUS_21080 14756 15652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 15922 16614 gene locus_tag LOCUS_21090 15922 16614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 16753 18156 gene locus_tag LOCUS_21100 16753 18156 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_21100 19253 18213 gene locus_tag LOCUS_21110 19253 18213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 19786 19361 gene locus_tag LOCUS_21120 19786 19361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 20146 19814 gene locus_tag LOCUS_21130 20146 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence44 227 57 gene locus_tag LOCUS_21140 227 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 2405 465 gene locus_tag LOCUS_21150 2405 465 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861254.1 protein_id gnl|my_center|LOCUS_21150 2538 3833 gene locus_tag LOCUS_21160 2538 3833 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965885.1 protein_id gnl|my_center|LOCUS_21160 3963 4880 gene locus_tag LOCUS_21170 3963 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 5045 5254 gene locus_tag LOCUS_21180 5045 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5254 6708 gene locus_tag LOCUS_21190 5254 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 6710 7921 gene locus_tag LOCUS_21200 6710 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 7921 8601 gene locus_tag LOCUS_21210 7921 8601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 protein_id gnl|my_center|LOCUS_21210 8786 9181 gene locus_tag LOCUS_21220 gene nudG 8786 9181 CDS product CTP pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781866.1 protein_id gnl|my_center|LOCUS_21220 10015 9260 gene locus_tag LOCUS_21230 10015 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 15556 10028 gene locus_tag LOCUS_21240 15556 10028 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152082941.1 protein_id gnl|my_center|LOCUS_21240 16954 15680 gene locus_tag LOCUS_21250 16954 15680 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_21250 17404 18708 gene locus_tag LOCUS_21260 17404 18708 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_21260 18822 20174 gene locus_tag LOCUS_21270 18822 20174 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028108.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence45 397 203 gene locus_tag LOCUS_21280 397 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1193 615 gene locus_tag LOCUS_21290 1193 615 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582845.1 protein_id gnl|my_center|LOCUS_21290 1443 2867 gene locus_tag LOCUS_21300 1443 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 3047 3610 gene locus_tag LOCUS_21310 3047 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 3641 4618 gene locus_tag LOCUS_21320 3641 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 4707 5603 gene locus_tag LOCUS_21330 gene gpr 4707 5603 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662627.1 protein_id gnl|my_center|LOCUS_21330 6461 5712 gene locus_tag LOCUS_21340 6461 5712 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972765.1 protein_id gnl|my_center|LOCUS_21340 6638 6997 gene locus_tag LOCUS_21350 6638 6997 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_21350 7182 8063 gene locus_tag LOCUS_21360 7182 8063 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_21360 8176 8451 gene locus_tag LOCUS_21370 8176 8451 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_21370 8471 9073 gene locus_tag LOCUS_21380 gene gmk 8471 9073 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131468.1 protein_id gnl|my_center|LOCUS_21380 9374 9667 gene locus_tag LOCUS_21390 9374 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 9667 12123 gene locus_tag LOCUS_21400 gene priA 9667 12123 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_21400 12219 12707 gene locus_tag LOCUS_21410 gene def 12219 12707 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_21410 12771 12890 gene locus_tag LOCUS_21420 12771 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 12895 13833 gene locus_tag LOCUS_21430 gene fmt 12895 13833 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703637.1 protein_id gnl|my_center|LOCUS_21430 13966 15273 gene locus_tag LOCUS_21440 gene rsmB 13966 15273 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_21440 15324 16358 gene locus_tag LOCUS_21450 gene rlmN 15324 16358 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_21450 16461 17228 gene locus_tag LOCUS_21460 16461 17228 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648703.1 protein_id gnl|my_center|LOCUS_21460 17244 18503 gene locus_tag LOCUS_21470 17244 18503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 18500 19438 gene locus_tag LOCUS_21480 gene rsgA 18500 19438 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence46 342 1844 gene locus_tag LOCUS_21490 342 1844 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_21490 6753 1915 gene locus_tag LOCUS_21500 6753 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 7526 6750 gene locus_tag LOCUS_21510 7526 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 8043 7540 gene locus_tag LOCUS_21520 8043 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 8612 8088 gene locus_tag LOCUS_21530 8612 8088 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 protein_id gnl|my_center|LOCUS_21530 9403 8774 gene locus_tag LOCUS_21540 9403 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 10244 9561 gene locus_tag LOCUS_21550 10244 9561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 10939 10256 gene locus_tag LOCUS_21560 10939 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 11705 10956 gene locus_tag LOCUS_21570 11705 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 11821 12660 gene locus_tag LOCUS_21580 11821 12660 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869770.1 protein_id gnl|my_center|LOCUS_21580 13204 13893 gene locus_tag LOCUS_21590 13204 13893 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_21590 15046 14213 gene locus_tag LOCUS_21600 15046 14213 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363043.1 protein_id gnl|my_center|LOCUS_21600 16436 15030 gene locus_tag LOCUS_21610 16436 15030 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_21610 16727 18958 gene locus_tag LOCUS_21620 gene pflB 16727 18958 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964298.1 protein_id gnl|my_center|LOCUS_21620 18962 19660 gene locus_tag LOCUS_21630 gene pflA 18962 19660 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence47 547 350 gene locus_tag LOCUS_21640 547 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21640 925 1467 gene locus_tag LOCUS_21650 925 1467 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_21650 1460 2026 gene locus_tag LOCUS_21660 1460 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 2028 3641 gene locus_tag LOCUS_21670 2028 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 3644 4123 gene locus_tag LOCUS_21680 3644 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 4090 5583 gene locus_tag LOCUS_21690 4090 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 5580 7334 gene locus_tag LOCUS_21700 5580 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 7334 7999 gene locus_tag LOCUS_21710 7334 7999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 protein_id gnl|my_center|LOCUS_21710 8082 8783 gene locus_tag LOCUS_21720 8082 8783 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_21720 8795 9451 gene locus_tag LOCUS_21730 8795 9451 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_21730 9547 10377 gene locus_tag LOCUS_21740 9547 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 10374 11396 gene locus_tag LOCUS_21750 10374 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21750 11359 13236 gene locus_tag LOCUS_21760 11359 13236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_21760 14052 13291 gene locus_tag LOCUS_21770 14052 13291 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614999.1 protein_id gnl|my_center|LOCUS_21770 14998 14075 gene locus_tag LOCUS_21780 14998 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 16235 15324 gene locus_tag LOCUS_21790 16235 15324 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458873.1 protein_id gnl|my_center|LOCUS_21790 17189 16314 gene locus_tag LOCUS_21800 17189 16314 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902813.1 protein_id gnl|my_center|LOCUS_21800 17801 17277 gene locus_tag LOCUS_21810 17801 17277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence48 183 377 gene locus_tag LOCUS_21820 gene thiS 183 377 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_21820 379 1014 gene locus_tag LOCUS_21830 gene thiF 379 1014 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_21830 1031 1801 gene locus_tag LOCUS_21840 1031 1801 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_21840 1812 3065 gene locus_tag LOCUS_21850 gene thiH 1812 3065 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_21850 3076 3711 gene locus_tag LOCUS_21860 gene thiE 3076 3711 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_21860 3708 4343 gene locus_tag LOCUS_21870 3708 4343 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966506.1 protein_id gnl|my_center|LOCUS_21870 4412 5215 gene locus_tag LOCUS_21880 gene thiD 4412 5215 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_21880 5217 5879 gene locus_tag LOCUS_21890 gene tenA 5217 5879 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198338.1 protein_id gnl|my_center|LOCUS_21890 6789 5944 gene locus_tag LOCUS_21900 6789 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 6944 10600 gene locus_tag LOCUS_21910 6944 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 10606 12834 gene locus_tag LOCUS_21920 10606 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 14165 12867 gene locus_tag LOCUS_21930 14165 12867 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_21930 14420 15229 gene locus_tag LOCUS_21940 14420 15229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 15265 16557 gene locus_tag LOCUS_21950 15265 16557 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence49 582 196 gene locus_tag LOCUS_21960 582 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 744 1748 gene locus_tag LOCUS_21970 gene plsX 744 1748 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_21970 1772 2494 gene locus_tag LOCUS_21980 gene rnc 1772 2494 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_21980 2491 3516 gene locus_tag LOCUS_21990 2491 3516 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047864.1 protein_id gnl|my_center|LOCUS_21990 3535 7158 gene locus_tag LOCUS_22000 gene smc 3535 7158 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_22000 7229 8140 gene locus_tag LOCUS_22010 gene ftsY 7229 8140 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723863.1 protein_id gnl|my_center|LOCUS_22010 8171 8785 gene locus_tag LOCUS_22020 8171 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 8808 9101 gene locus_tag LOCUS_22030 8808 9101 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_22030 9251 9859 gene locus_tag LOCUS_22040 gene nadD 9251 9859 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_22040 9856 10485 gene locus_tag LOCUS_22050 9856 10485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 10521 11663 gene locus_tag LOCUS_22060 10521 11663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 11794 12183 gene locus_tag LOCUS_22070 gene rsfS 11794 12183 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431718.1 protein_id gnl|my_center|LOCUS_22070 12218 14620 gene locus_tag LOCUS_22080 gene leuS 12218 14620 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_22080 14710 15009 gene locus_tag LOCUS_22090 14710 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 14937 15224 gene locus_tag LOCUS_22100 14937 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence50 2345 207 gene locus_tag LOCUS_22110 gene dnaK 2345 207 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902322.1 protein_id gnl|my_center|LOCUS_22110 3567 2404 gene locus_tag LOCUS_22120 3567 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 4791 3625 gene locus_tag LOCUS_22130 4791 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 5074 8529 gene locus_tag LOCUS_22140 5074 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 8553 9152 gene locus_tag LOCUS_22150 8553 9152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 9393 11624 gene locus_tag LOCUS_22160 9393 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 13319 11835 gene locus_tag LOCUS_22170 13319 11835 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_22170 13600 14721 gene locus_tag LOCUS_22180 13600 14721 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence51 595 164 gene locus_tag LOCUS_22190 595 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1035 598 gene locus_tag LOCUS_22200 1035 598 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266702.1 protein_id gnl|my_center|LOCUS_22200 1245 2414 gene locus_tag LOCUS_22210 1245 2414 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436749.1 protein_id gnl|my_center|LOCUS_22210 2466 3359 gene locus_tag LOCUS_22220 gene ispE 2466 3359 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458917.1 protein_id gnl|my_center|LOCUS_22220 3824 3543 gene locus_tag LOCUS_22230 3824 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 5267 3888 gene locus_tag LOCUS_22240 5267 3888 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930436.1 protein_id gnl|my_center|LOCUS_22240 6601 5225 gene locus_tag LOCUS_22250 gene scfB 6601 5225 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_22250 6824 6675 gene locus_tag LOCUS_22260 gene scfA 6824 6675 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_22260 8139 6931 gene locus_tag LOCUS_22270 8139 6931 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_22270 8422 10755 gene locus_tag LOCUS_22280 8422 10755 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_22280 13089 10819 gene locus_tag LOCUS_22290 gene topA 13089 10819 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence52 1480 275 gene locus_tag LOCUS_22300 1480 275 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 protein_id gnl|my_center|LOCUS_22300 1641 4649 gene locus_tag LOCUS_22310 1641 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4646 5698 gene locus_tag LOCUS_22320 4646 5698 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986645.1 protein_id gnl|my_center|LOCUS_22320 5695 6771 gene locus_tag LOCUS_22330 5695 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 7082 8563 gene locus_tag LOCUS_22340 7082 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9535 8603 gene locus_tag LOCUS_22350 9535 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 10598 9738 gene locus_tag LOCUS_22360 10598 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 11210 10728 gene locus_tag LOCUS_22370 11210 10728 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_22370 11663 12760 gene locus_tag LOCUS_22380 11663 12760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 12773 12958 gene locus_tag LOCUS_22390 12773 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence53 789 184 gene locus_tag LOCUS_22400 789 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 1815 802 gene locus_tag LOCUS_22410 1815 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 2046 3023 gene locus_tag LOCUS_22420 2046 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3537 4982 gene locus_tag LOCUS_22430 3537 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 5365 5036 gene locus_tag LOCUS_22440 5365 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5535 6035 gene locus_tag LOCUS_22450 5535 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 6141 6839 gene locus_tag LOCUS_22460 6141 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 6920 7195 gene locus_tag LOCUS_22470 6920 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 10143 7237 gene locus_tag LOCUS_22480 10143 7237 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_22480 10802 10284 gene locus_tag LOCUS_22490 10802 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 12289 11021 gene locus_tag LOCUS_22500 12289 11021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence54 139 65 gene locus_tag LOCUS_t00370 139 65 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1199 252 gene locus_tag LOCUS_22510 1199 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1802 1263 gene locus_tag LOCUS_22520 1802 1263 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837199.1 protein_id gnl|my_center|LOCUS_22520 1994 2070 gene locus_tag LOCUS_t00380 1994 2070 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2097 2172 gene locus_tag LOCUS_t00390 2097 2172 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2626 2390 gene locus_tag LOCUS_22530 2626 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 4934 2655 gene locus_tag LOCUS_22540 4934 2655 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_22540 6078 4954 gene locus_tag LOCUS_22550 6078 4954 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921834.1 protein_id gnl|my_center|LOCUS_22550 7659 6106 gene locus_tag LOCUS_22560 7659 6106 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_22560 9024 7663 gene locus_tag LOCUS_22570 gene trkA 9024 7663 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_22570 10164 9157 gene locus_tag LOCUS_22580 10164 9157 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_22580 10902 10411 gene locus_tag LOCUS_22590 10902 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 11485 10922 gene locus_tag LOCUS_22600 11485 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 11843 11487 gene locus_tag LOCUS_22610 11843 11487 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_22610 12190 12106 gene locus_tag LOCUS_t00400 12190 12106 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence55 42 126 gene locus_tag LOCUS_t00410 42 126 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 382 705 gene locus_tag LOCUS_22620 382 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 906 1634 gene locus_tag LOCUS_22630 906 1634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681925.1 protein_id gnl|my_center|LOCUS_22630 1631 2362 gene locus_tag LOCUS_22640 1631 2362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956797.1 protein_id gnl|my_center|LOCUS_22640 2375 2818 gene locus_tag LOCUS_22650 2375 2818 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549799.1 protein_id gnl|my_center|LOCUS_22650 2815 3255 gene locus_tag LOCUS_22660 2815 3255 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549798.1 protein_id gnl|my_center|LOCUS_22660 3971 4987 gene locus_tag LOCUS_22670 3971 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 5688 5050 gene locus_tag LOCUS_22680 5688 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 6239 5688 gene locus_tag LOCUS_22690 6239 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 7122 6550 gene locus_tag LOCUS_22700 7122 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 7961 7134 gene locus_tag LOCUS_22710 7961 7134 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548564.1 protein_id gnl|my_center|LOCUS_22710 8919 7972 gene locus_tag LOCUS_22720 8919 7972 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_22720 9414 9926 gene locus_tag LOCUS_22730 9414 9926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence56 399 959 gene locus_tag LOCUS_22740 399 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 956 2407 gene locus_tag LOCUS_22750 956 2407 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054058.1 protein_id gnl|my_center|LOCUS_22750 3815 2466 gene locus_tag LOCUS_22760 3815 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4704 4030 gene locus_tag LOCUS_22770 gene pyrE 4704 4030 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458955.1 protein_id gnl|my_center|LOCUS_22770 6346 4796 gene locus_tag LOCUS_22780 6346 4796 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_22780 6469 8889 gene locus_tag LOCUS_22790 6469 8889 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_22790 9183 8974 gene locus_tag LOCUS_22800 9183 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 10785 10366 gene locus_tag LOCUS_22810 10785 10366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence57 1569 586 gene locus_tag LOCUS_22820 1569 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2060 1656 gene locus_tag LOCUS_22830 2060 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 5518 2615 gene locus_tag LOCUS_22840 5518 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 7597 5918 gene locus_tag LOCUS_22850 7597 5918 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_22850 8069 9514 gene locus_tag LOCUS_22860 8069 9514 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869156.1 protein_id gnl|my_center|LOCUS_22860 9624 9791 gene locus_tag LOCUS_22870 9624 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 9798 10730 gene locus_tag LOCUS_22880 gene cysK 9798 10730 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence58 280 71 gene locus_tag LOCUS_22890 280 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 512 297 gene locus_tag LOCUS_22900 512 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 793 578 gene locus_tag LOCUS_22910 793 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 1071 736 gene locus_tag LOCUS_22920 1071 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1389 1150 gene locus_tag LOCUS_22930 1389 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 1661 1927 gene locus_tag LOCUS_22940 1661 1927 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_22940 1920 2198 gene locus_tag LOCUS_22950 1920 2198 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_22950 2265 3710 gene locus_tag LOCUS_22960 2265 3710 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186602.1 protein_id gnl|my_center|LOCUS_22960 4322 3948 gene locus_tag LOCUS_22970 4322 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 5030 4449 gene locus_tag LOCUS_22980 5030 4449 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_22980 5355 5047 gene locus_tag LOCUS_22990 5355 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 5764 6675 gene locus_tag LOCUS_23000 5764 6675 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_23000 7717 6854 gene locus_tag LOCUS_23010 7717 6854 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_23010 8645 7764 gene locus_tag LOCUS_23020 8645 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 8755 9153 gene locus_tag LOCUS_23030 8755 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 9428 10357 gene locus_tag LOCUS_23040 9428 10357 CDS product DUF6017 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861119.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence59 1120 494 gene locus_tag LOCUS_23050 1120 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2223 1282 gene locus_tag LOCUS_23060 2223 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 3447 2227 gene locus_tag LOCUS_23070 3447 2227 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_23070 3758 3447 gene locus_tag LOCUS_23080 3758 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 5269 3782 gene locus_tag LOCUS_23090 5269 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5616 5254 gene locus_tag LOCUS_23100 5616 5254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5764 5591 gene locus_tag LOCUS_23110 5764 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 6848 5748 gene locus_tag LOCUS_23120 6848 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 7074 8264 gene locus_tag LOCUS_23130 7074 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 8287 8607 gene locus_tag LOCUS_23140 8287 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 8962 9996 gene locus_tag LOCUS_23150 8962 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence60 267 1205 gene locus_tag LOCUS_23160 267 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1682 1218 gene locus_tag LOCUS_23170 1682 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 1842 2372 gene locus_tag LOCUS_23180 1842 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 2567 3034 gene locus_tag LOCUS_23190 2567 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3131 3865 gene locus_tag LOCUS_23200 3131 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 3968 4420 gene locus_tag LOCUS_23210 3968 4420 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_23210 5009 4641 gene locus_tag LOCUS_23220 5009 4641 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_23220 5478 5047 gene locus_tag LOCUS_23230 5478 5047 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 protein_id gnl|my_center|LOCUS_23230 7127 5751 gene locus_tag LOCUS_23240 gene mgtE 7127 5751 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680769.1 protein_id gnl|my_center|LOCUS_23240 8458 7166 gene locus_tag LOCUS_23250 8458 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence61 1550 264 gene locus_tag LOCUS_23260 1550 264 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_23260 2475 1666 gene locus_tag LOCUS_23270 2475 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3031 2462 gene locus_tag LOCUS_23280 3031 2462 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_23280 4099 3227 gene locus_tag LOCUS_23290 gene hslO 4099 3227 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_23290 5060 4263 gene locus_tag LOCUS_23300 5060 4263 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_23300 6413 5073 gene locus_tag LOCUS_23310 6413 5073 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_23310 7484 6486 gene locus_tag LOCUS_23320 7484 6486 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence62 2234 432 gene locus_tag LOCUS_23330 2234 432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_23330 4066 2231 gene locus_tag LOCUS_23340 4066 2231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_23340 4765 4361 gene locus_tag LOCUS_23350 4765 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 5652 4777 gene locus_tag LOCUS_23360 5652 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 6724 5630 gene locus_tag LOCUS_23370 6724 5630 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_23370 7392 6721 gene locus_tag LOCUS_23380 7392 6721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_23380 >Feature sequence63 3363 238 gene locus_tag LOCUS_23390 3363 238 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085775.1 protein_id gnl|my_center|LOCUS_23390 3627 4460 gene locus_tag LOCUS_23400 3627 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5757 4519 gene locus_tag LOCUS_23410 5757 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 5990 5805 gene locus_tag LOCUS_23420 5990 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6813 6340 gene locus_tag LOCUS_23430 6813 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6991 6788 gene locus_tag LOCUS_23440 6991 6788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence64 1603 191 gene locus_tag LOCUS_23450 1603 191 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_23450 2146 1805 gene locus_tag LOCUS_23460 gene rplS 2146 1805 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_23460 3717 2347 gene locus_tag LOCUS_23470 3717 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 4489 5925 gene locus_tag LOCUS_23480 4489 5925 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460073.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence65 1930 263 gene locus_tag LOCUS_23490 1930 263 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836509.1 protein_id gnl|my_center|LOCUS_23490 4339 2153 gene locus_tag LOCUS_23500 4339 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 5567 4626 gene locus_tag LOCUS_23510 5567 4626 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_23510 6409 5582 gene locus_tag LOCUS_23520 6409 5582 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence66 1072 59 gene locus_tag LOCUS_23530 1072 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1472 1669 gene locus_tag LOCUS_23540 1472 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2412 2322 gene locus_tag LOCUS_t00420 2412 2322 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2783 2499 gene locus_tag LOCUS_23550 2783 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 3113 5221 gene locus_tag LOCUS_23560 3113 5221 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_23560 5328 5693 gene locus_tag LOCUS_23570 5328 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence67 1324 317 gene locus_tag LOCUS_23580 gene asnA 1324 317 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_23580 1939 1667 gene locus_tag LOCUS_23590 1939 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 1836 3287 gene locus_tag LOCUS_23600 1836 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 5001 3346 gene locus_tag LOCUS_23610 5001 3346 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_23610 5201 5686 gene locus_tag LOCUS_23620 5201 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence68 224 598 gene locus_tag LOCUS_23630 224 598 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461784.1 protein_id gnl|my_center|LOCUS_23630 579 947 gene locus_tag LOCUS_23640 579 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 975 1478 gene locus_tag LOCUS_23650 975 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1945 2193 gene locus_tag LOCUS_23660 1945 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2180 3277 gene locus_tag LOCUS_23670 2180 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 3367 4167 gene locus_tag LOCUS_23680 3367 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence69 253 897 gene locus_tag LOCUS_23690 253 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 933 1553 gene locus_tag LOCUS_23700 933 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 >Feature sequence70 2380 2225 gene locus_tag LOCUS_23710 2380 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 3519 2647 gene locus_tag LOCUS_23720 3519 2647 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence71 1696 467 gene locus_tag LOCUS_23730 1696 467 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_23730 2362 1910 gene locus_tag LOCUS_23740 2362 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2607 2341 gene locus_tag LOCUS_23750 2607 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence72 1746 2471 gene locus_tag LOCUS_23760 1746 2471 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_23760 2498 2617 gene locus_tag LOCUS_23770 2498 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence73 206 1435 gene locus_tag LOCUS_23780 206 1435 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_23780 1452 2045 gene locus_tag LOCUS_23790 gene purN 1452 2045 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_23790 2158 2559 gene locus_tag LOCUS_23800 2158 2559 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_23800 >Feature sequence74 253 405 gene locus_tag LOCUS_23810 253 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 420 926 gene locus_tag LOCUS_23820 420 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 951 1838 gene locus_tag LOCUS_23830 951 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 2053 2292 gene locus_tag LOCUS_23840 2053 2292 CDS product DUF6133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272752.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence75 173 493 gene locus_tag LOCUS_23850 173 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 538 924 gene locus_tag LOCUS_23860 538 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1049 1426 gene locus_tag LOCUS_23870 1049 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1906 1442 gene locus_tag LOCUS_23880 1906 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence76 338 901 gene locus_tag LOCUS_23890 338 901 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_23890 911 1870 gene locus_tag LOCUS_23900 911 1870 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence77 2 259 gene locus_tag LOCUS_23910 2 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 261 1205 gene locus_tag LOCUS_23920 261 1205 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_23920