>Feature sequence01 1389 412 gene locus_tag LOCUS_00010 1389 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2507 1386 gene locus_tag LOCUS_00020 2507 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3338 4519 gene locus_tag LOCUS_00030 3338 4519 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774899.1 protein_id gnl|my_center|LOCUS_00030 4700 5263 gene locus_tag LOCUS_00040 4700 5263 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853263.1 protein_id gnl|my_center|LOCUS_00040 5260 6057 gene locus_tag LOCUS_00050 5260 6057 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853285.1 protein_id gnl|my_center|LOCUS_00050 7238 6042 gene locus_tag LOCUS_00060 7238 6042 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858477.1 protein_id gnl|my_center|LOCUS_00060 7457 8503 gene locus_tag LOCUS_00070 7457 8503 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_00070 8790 8500 gene locus_tag LOCUS_00080 8790 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9247 9023 gene locus_tag LOCUS_00090 9247 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9335 9547 gene locus_tag LOCUS_00100 9335 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9697 10182 gene locus_tag LOCUS_00110 9697 10182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11228 10239 gene locus_tag LOCUS_00120 11228 10239 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858100.1 protein_id gnl|my_center|LOCUS_00120 11549 12481 gene locus_tag LOCUS_00130 11549 12481 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012661737.1 protein_id gnl|my_center|LOCUS_00130 13476 12487 gene locus_tag LOCUS_00140 13476 12487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852449.1 protein_id gnl|my_center|LOCUS_00140 15369 13477 gene locus_tag LOCUS_00150 gene metG 15369 13477 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_00150 15711 15388 gene locus_tag LOCUS_00160 15711 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16537 15704 gene locus_tag LOCUS_00170 16537 15704 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_00170 16775 16539 gene locus_tag LOCUS_00180 16775 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18266 17160 gene locus_tag LOCUS_00190 gene dapE 18266 17160 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_00190 18864 18268 gene locus_tag LOCUS_00200 18864 18268 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858199.1 protein_id gnl|my_center|LOCUS_00200 21080 18879 gene locus_tag LOCUS_00210 21080 18879 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_00210 21309 21839 gene locus_tag LOCUS_00220 21309 21839 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088482.1 protein_id gnl|my_center|LOCUS_00220 21849 22910 gene locus_tag LOCUS_00230 21849 22910 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222585.1 protein_id gnl|my_center|LOCUS_00230 22969 23886 gene locus_tag LOCUS_00240 22969 23886 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393471.1 protein_id gnl|my_center|LOCUS_00240 23883 24617 gene locus_tag LOCUS_00250 23883 24617 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_00250 24598 25347 gene locus_tag LOCUS_00260 24598 25347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26124 25372 gene locus_tag LOCUS_00270 gene flaC 26124 25372 CDS product flagellin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858476.1 protein_id gnl|my_center|LOCUS_00270 27163 26339 gene locus_tag LOCUS_00280 27163 26339 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855690.1 protein_id gnl|my_center|LOCUS_00280 29357 27261 gene locus_tag LOCUS_00290 gene cfrA 29357 27261 CDS product TonB-dependent ferric enterobactin receptor CfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891883.1 protein_id gnl|my_center|LOCUS_00290 29587 29709 gene locus_tag LOCUS_00300 29587 29709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 29747 30433 gene locus_tag LOCUS_00310 29747 30433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31719 30439 gene locus_tag LOCUS_00320 gene hisD 31719 30439 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943721.1 protein_id gnl|my_center|LOCUS_00320 32501 31770 gene locus_tag LOCUS_00330 32501 31770 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_00330 32988 32476 gene locus_tag LOCUS_00340 32988 32476 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_00340 33751 32978 gene locus_tag LOCUS_00350 gene trpC 33751 32978 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_00350 34989 33748 gene locus_tag LOCUS_00360 34989 33748 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_00360 35336 34965 gene locus_tag LOCUS_00370 35336 34965 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_00370 36031 35333 gene locus_tag LOCUS_00380 36031 35333 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_00380 37550 36018 gene locus_tag LOCUS_00390 37550 36018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 38509 37553 gene locus_tag LOCUS_00400 38509 37553 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_00400 38696 39166 gene locus_tag LOCUS_00410 38696 39166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40830 39169 gene locus_tag LOCUS_00420 40830 39169 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_00420 41107 40808 gene locus_tag LOCUS_00430 41107 40808 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_00430 42393 41104 gene locus_tag LOCUS_00440 gene gltX 42393 41104 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_00440 43074 42397 gene locus_tag LOCUS_00450 gene queC 43074 42397 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_00450 44441 43071 gene locus_tag LOCUS_00460 gene pgmL 44441 43071 CDS product phosphoglucosamine mutase PgmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891933.1 protein_id gnl|my_center|LOCUS_00460 44570 45373 gene locus_tag LOCUS_00470 gene thiF 44570 45373 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_00470 45366 46127 gene locus_tag LOCUS_00480 45366 46127 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891902.1 protein_id gnl|my_center|LOCUS_00480 46128 47306 gene locus_tag LOCUS_00490 gene thiH 46128 47306 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_00490 48208 47597 gene locus_tag LOCUS_00500 48208 47597 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858665.1 protein_id gnl|my_center|LOCUS_00500 48774 48199 gene locus_tag LOCUS_00510 48774 48199 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_00510 49108 48764 gene locus_tag LOCUS_00520 49108 48764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851272.1 protein_id gnl|my_center|LOCUS_00520 49266 49643 gene locus_tag LOCUS_00530 49266 49643 CDS product FlaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776146.1 protein_id gnl|my_center|LOCUS_00530 49646 51529 gene locus_tag LOCUS_00540 gene fliD 49646 51529 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864504.1 protein_id gnl|my_center|LOCUS_00540 51543 51929 gene locus_tag LOCUS_00550 gene fliS 51543 51929 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776169.1 protein_id gnl|my_center|LOCUS_00550 51916 52131 gene locus_tag LOCUS_00560 51916 52131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 52598 53536 gene locus_tag LOCUS_00570 52598 53536 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891823.1 protein_id gnl|my_center|LOCUS_00570 53523 55322 gene locus_tag LOCUS_00580 53523 55322 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865311.1 protein_id gnl|my_center|LOCUS_00580 56506 55373 gene locus_tag LOCUS_00590 gene truD 56506 55373 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851259.1 protein_id gnl|my_center|LOCUS_00590 57302 56484 gene locus_tag LOCUS_00600 57302 56484 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851372.1 protein_id gnl|my_center|LOCUS_00600 57661 57281 gene locus_tag LOCUS_00610 57661 57281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 57758 58129 gene locus_tag LOCUS_00620 57758 58129 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_00620 58200 58766 gene locus_tag LOCUS_00630 58200 58766 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855621.1 protein_id gnl|my_center|LOCUS_00630 59238 58801 gene locus_tag LOCUS_00640 59238 58801 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851546.1 protein_id gnl|my_center|LOCUS_00640 60557 59349 gene locus_tag LOCUS_00650 60557 59349 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_00650 61374 60544 gene locus_tag LOCUS_00660 gene galU 61374 60544 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851421.1 protein_id gnl|my_center|LOCUS_00660 62420 61437 gene locus_tag LOCUS_00670 gene flgS 62420 61437 CDS product fla regulon two-component system sensor histidine kinase FlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852488.1 protein_id gnl|my_center|LOCUS_00670 63225 62413 gene locus_tag LOCUS_00680 63225 62413 CDS product DUF234 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852402.1 protein_id gnl|my_center|LOCUS_00680 63435 63899 gene locus_tag LOCUS_00690 63435 63899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 63892 65970 gene locus_tag LOCUS_00700 63892 65970 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 protein_id gnl|my_center|LOCUS_00700 65964 67766 gene locus_tag LOCUS_00710 65964 67766 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858743.1 protein_id gnl|my_center|LOCUS_00710 68293 67949 gene locus_tag LOCUS_00720 68293 67949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 70202 68358 gene locus_tag LOCUS_00730 gene mnmC 70202 68358 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853221.1 protein_id gnl|my_center|LOCUS_00730 71716 70199 gene locus_tag LOCUS_00740 71716 70199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 72812 71700 gene locus_tag LOCUS_00750 72812 71700 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857924.1 protein_id gnl|my_center|LOCUS_00750 74014 72812 gene locus_tag LOCUS_00760 gene tyrS 74014 72812 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_00760 76213 74024 gene locus_tag LOCUS_00770 76213 74024 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_00770 76415 76197 gene locus_tag LOCUS_00780 76415 76197 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853464.1 protein_id gnl|my_center|LOCUS_00780 77147 76428 gene locus_tag LOCUS_00790 gene pyrH 77147 76428 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858454.1 protein_id gnl|my_center|LOCUS_00790 78434 77238 gene locus_tag LOCUS_00800 78434 77238 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_00800 79243 78434 gene locus_tag LOCUS_00810 79243 78434 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_00810 79901 79230 gene locus_tag LOCUS_00820 79901 79230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_00820 81061 79886 gene locus_tag LOCUS_00830 gene trmB 81061 79886 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_00830 82278 81061 gene locus_tag LOCUS_00840 82278 81061 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891920.1 protein_id gnl|my_center|LOCUS_00840 83188 82208 gene locus_tag LOCUS_00850 83188 82208 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_00850 83473 84348 gene locus_tag LOCUS_00860 83473 84348 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_00860 84899 84345 gene locus_tag LOCUS_00870 84899 84345 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852563.1 protein_id gnl|my_center|LOCUS_00870 85589 85020 gene locus_tag LOCUS_00880 gene efp 85589 85020 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 protein_id gnl|my_center|LOCUS_00880 87184 85601 gene locus_tag LOCUS_00890 gene serA 87184 85601 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_00890 87669 87181 gene locus_tag LOCUS_00900 87669 87181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852423.1 protein_id gnl|my_center|LOCUS_00900 89347 87677 gene locus_tag LOCUS_00910 89347 87677 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_00910 90288 89431 gene locus_tag LOCUS_00920 90288 89431 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_00920 91555 90278 gene locus_tag LOCUS_00930 gene aroA 91555 90278 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_00930 93888 91552 gene locus_tag LOCUS_00940 gene pheT 93888 91552 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_00940 94877 93885 gene locus_tag LOCUS_00950 gene pheS 94877 93885 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_00950 95095 95454 gene locus_tag LOCUS_00960 95095 95454 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852408.1 protein_id gnl|my_center|LOCUS_00960 96298 95456 gene locus_tag LOCUS_00970 96298 95456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 98490 96310 gene locus_tag LOCUS_00980 98490 96310 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_00980 99186 98491 gene locus_tag LOCUS_00990 99186 98491 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090667.1 protein_id gnl|my_center|LOCUS_00990 101366 99183 gene locus_tag LOCUS_01000 101366 99183 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_01000 101814 101356 gene locus_tag LOCUS_01010 101814 101356 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_01010 103058 101814 gene locus_tag LOCUS_01020 gene purD 103058 101814 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_01020 103392 103877 gene locus_tag LOCUS_01030 103392 103877 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_01030 103926 104513 gene locus_tag LOCUS_01040 103926 104513 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853338.1 protein_id gnl|my_center|LOCUS_01040 104510 105646 gene locus_tag LOCUS_01050 104510 105646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853393.1 protein_id gnl|my_center|LOCUS_01050 106077 105667 gene locus_tag LOCUS_01060 106077 105667 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_01060 106550 106077 gene locus_tag LOCUS_01070 106550 106077 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858582.1 protein_id gnl|my_center|LOCUS_01070 107278 106550 gene locus_tag LOCUS_01080 107278 106550 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176078.1 protein_id gnl|my_center|LOCUS_01080 108524 107328 gene locus_tag LOCUS_01090 108524 107328 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858475.1 protein_id gnl|my_center|LOCUS_01090 109910 108531 gene locus_tag LOCUS_01100 109910 108531 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692969.1 protein_id gnl|my_center|LOCUS_01100 111848 109920 gene locus_tag LOCUS_01110 111848 109920 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_01110 113152 111857 gene locus_tag LOCUS_01120 113152 111857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851616.1 protein_id gnl|my_center|LOCUS_01120 113339 113935 gene locus_tag LOCUS_01130 113339 113935 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492453.1 protein_id gnl|my_center|LOCUS_01130 114791 113925 gene locus_tag LOCUS_01140 114791 113925 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_01140 115780 114791 gene locus_tag LOCUS_01150 115780 114791 CDS product agamatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855829.1 protein_id gnl|my_center|LOCUS_01150 116774 115986 gene locus_tag LOCUS_01160 gene flgG 116774 115986 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852142.1 protein_id gnl|my_center|LOCUS_01160 117601 116786 gene locus_tag LOCUS_01170 117601 116786 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_01170 117660 117893 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctataagaacccccttagtttctatatgttataat 118400 118071 gene locus_tag LOCUS_01180 118400 118071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 119311 118403 gene locus_tag LOCUS_01190 gene cas1 119311 118403 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_01190 119981 119325 gene locus_tag LOCUS_01200 119981 119325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 122625 119929 gene locus_tag LOCUS_01210 122625 119929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 122781 123500 gene locus_tag LOCUS_01220 122781 123500 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856709.1 protein_id gnl|my_center|LOCUS_01220 123493 124221 gene locus_tag LOCUS_01230 123493 124221 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858785.1 protein_id gnl|my_center|LOCUS_01230 124234 124959 gene locus_tag LOCUS_01240 124234 124959 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776584.1 protein_id gnl|my_center|LOCUS_01240 124969 125694 gene locus_tag LOCUS_01250 124969 125694 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776584.1 protein_id gnl|my_center|LOCUS_01250 125691 126299 gene locus_tag LOCUS_01260 gene thiE 125691 126299 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763279.1 protein_id gnl|my_center|LOCUS_01260 126301 127086 gene locus_tag LOCUS_01270 126301 127086 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 protein_id gnl|my_center|LOCUS_01270 127746 127099 gene locus_tag LOCUS_01280 127746 127099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 128201 127743 gene locus_tag LOCUS_01290 128201 127743 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851461.1 protein_id gnl|my_center|LOCUS_01290 130179 128647 gene locus_tag LOCUS_01300 gene guaA 130179 128647 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_01300 130334 130777 gene locus_tag LOCUS_01310 130334 130777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 130764 132560 gene locus_tag LOCUS_01320 gene uvrC 130764 132560 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864614.1 protein_id gnl|my_center|LOCUS_01320 133804 132593 gene locus_tag LOCUS_01330 gene ilvA 133804 132593 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_01330 134186 133788 gene locus_tag LOCUS_01340 134186 133788 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858783.1 protein_id gnl|my_center|LOCUS_01340 134699 134331 gene locus_tag LOCUS_01350 134699 134331 CDS product YgiW/YdeI family stress tolerance OB fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208522.1 protein_id gnl|my_center|LOCUS_01350 135566 134901 gene locus_tag LOCUS_01360 135566 134901 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858132.1 protein_id gnl|my_center|LOCUS_01360 136302 135553 gene locus_tag LOCUS_01370 136302 135553 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_01370 136925 136302 gene locus_tag LOCUS_01380 136925 136302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 139870 136922 gene locus_tag LOCUS_01390 139870 136922 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858240.1 protein_id gnl|my_center|LOCUS_01390 140270 139851 gene locus_tag LOCUS_01400 140270 139851 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859143.1 protein_id gnl|my_center|LOCUS_01400 141112 140219 gene locus_tag LOCUS_01410 141112 140219 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852904.1 protein_id gnl|my_center|LOCUS_01410 142268 141102 gene locus_tag LOCUS_01420 142268 141102 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891906.1 protein_id gnl|my_center|LOCUS_01420 143803 142268 gene locus_tag LOCUS_01430 143803 142268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 144323 143784 gene locus_tag LOCUS_01440 gene lptE 144323 143784 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852685.1 protein_id gnl|my_center|LOCUS_01440 146757 144325 gene locus_tag LOCUS_01450 gene leuS 146757 144325 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_01450 147106 146768 gene locus_tag LOCUS_01460 147106 146768 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_01460 148090 147116 gene locus_tag LOCUS_01470 gene secF 148090 147116 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_01470 149603 148092 gene locus_tag LOCUS_01480 gene secD 149603 148092 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_01480 149952 149662 gene locus_tag LOCUS_01490 gene yajC 149952 149662 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_01490 150198 151190 gene locus_tag LOCUS_01500 150198 151190 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237964.1 protein_id gnl|my_center|LOCUS_01500 151349 151477 gene locus_tag LOCUS_01510 151349 151477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 152240 151545 gene locus_tag LOCUS_01520 152240 151545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852965.1 protein_id gnl|my_center|LOCUS_01520 153001 152237 gene locus_tag LOCUS_01530 153001 152237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852992.1 protein_id gnl|my_center|LOCUS_01530 154047 152998 gene locus_tag LOCUS_01540 154047 152998 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853049.1 protein_id gnl|my_center|LOCUS_01540 154944 154048 gene locus_tag LOCUS_01550 154944 154048 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_01550 156193 155003 gene locus_tag LOCUS_01560 156193 155003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_01560 158736 156193 gene locus_tag LOCUS_01570 gene secA 158736 156193 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_01570 158854 159369 gene locus_tag LOCUS_01580 158854 159369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 159865 159362 gene locus_tag LOCUS_01590 159865 159362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 161169 159862 gene locus_tag LOCUS_01600 gene pif1 161169 159862 CDS product ATP-dependent DNA helicase Pif1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853306.1 protein_id gnl|my_center|LOCUS_01600 161221 163134 gene locus_tag LOCUS_01610 161221 163134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 164323 163121 gene locus_tag LOCUS_01620 gene gltS 164323 163121 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155986.1 protein_id gnl|my_center|LOCUS_01620 165642 164488 gene locus_tag LOCUS_01630 gene ftsZ 165642 164488 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_01630 167088 165655 gene locus_tag LOCUS_01640 gene ftsA 167088 165655 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_01640 168563 167091 gene locus_tag LOCUS_01650 168563 167091 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852128.1 protein_id gnl|my_center|LOCUS_01650 169256 168669 gene locus_tag LOCUS_01660 169256 168669 CDS product class II aldolase and adducin N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933670.1 protein_id gnl|my_center|LOCUS_01660 169367 170290 gene locus_tag LOCUS_01670 gene rsmH 169367 170290 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_01670 170287 170568 gene locus_tag LOCUS_01680 170287 170568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 170568 172517 gene locus_tag LOCUS_01690 170568 172517 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831490.1 protein_id gnl|my_center|LOCUS_01690 173012 172503 gene locus_tag LOCUS_01700 173012 172503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852223.1 protein_id gnl|my_center|LOCUS_01700 173109 173987 gene locus_tag LOCUS_01710 173109 173987 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974702.1 protein_id gnl|my_center|LOCUS_01710 173989 174906 gene locus_tag LOCUS_01720 gene dmeF 173989 174906 CDS product CDF family Co(II)/Ni(II) efflux transporter DmeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207680.1 protein_id gnl|my_center|LOCUS_01720 175675 175316 gene locus_tag LOCUS_01730 175675 175316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 176994 175981 gene locus_tag LOCUS_01740 gene msrB 176994 175981 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672271.1 protein_id gnl|my_center|LOCUS_01740 179204 177093 gene locus_tag LOCUS_01750 gene feoB 179204 177093 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865443.1 protein_id gnl|my_center|LOCUS_01750 179428 179204 gene locus_tag LOCUS_01760 179428 179204 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779147.1 protein_id gnl|my_center|LOCUS_01760 179836 179760 gene locus_tag LOCUS_t00010 179836 179760 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 181943 179868 gene locus_tag LOCUS_01770 gene fusA 181943 179868 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_01770 182426 181956 gene locus_tag LOCUS_01780 gene rpsG 182426 181956 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_01780 182876 182493 gene locus_tag LOCUS_01790 gene rpsL 182876 182493 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_01790 184741 183029 gene locus_tag LOCUS_01800 184741 183029 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_01800 189425 184902 gene locus_tag LOCUS_01810 gene rpoC 189425 184902 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_01810 193557 189418 gene locus_tag LOCUS_01820 gene rpoB 193557 189418 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_01820 194026 193652 gene locus_tag LOCUS_01830 gene rplL 194026 193652 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_01830 194541 194056 gene locus_tag LOCUS_01840 gene rplJ 194541 194056 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_01840 195349 194645 gene locus_tag LOCUS_01850 gene rplA 195349 194645 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_01850 195831 195406 gene locus_tag LOCUS_01860 gene rplK 195831 195406 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_01860 196373 195843 gene locus_tag LOCUS_01870 gene nusG 196373 195843 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_01870 196562 196383 gene locus_tag LOCUS_01880 gene secE 196562 196383 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854985.1 protein_id gnl|my_center|LOCUS_01880 196651 196576 gene locus_tag LOCUS_t00020 196651 196576 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 196844 196677 gene locus_tag LOCUS_01890 gene rpmG 196844 196677 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 protein_id gnl|my_center|LOCUS_01890 198093 196894 gene locus_tag LOCUS_01900 gene tuf 198093 196894 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855271.1 protein_id gnl|my_center|LOCUS_01900 198241 198167 gene locus_tag LOCUS_t00030 198241 198167 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 198457 198381 gene locus_tag LOCUS_t00040 198457 198381 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 198551 198467 gene locus_tag LOCUS_t00050 198551 198467 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 198683 198608 gene locus_tag LOCUS_t00060 198683 198608 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 200588 198795 gene locus_tag LOCUS_01910 200588 198795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 201218 200730 gene locus_tag LOCUS_01920 201218 200730 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869004.1 protein_id gnl|my_center|LOCUS_01920 201943 201236 gene locus_tag LOCUS_01930 201943 201236 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780603.1 protein_id gnl|my_center|LOCUS_01930 202055 202258 gene locus_tag LOCUS_01940 202055 202258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852760.1 protein_id gnl|my_center|LOCUS_01940 202267 204411 gene locus_tag LOCUS_01950 gene copA 202267 204411 CDS product copper-translocating P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875419.1 protein_id gnl|my_center|LOCUS_01950 204415 205557 gene locus_tag LOCUS_01960 204415 205557 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208858.1 protein_id gnl|my_center|LOCUS_01960 205600 206151 gene locus_tag LOCUS_01970 205600 206151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 206138 206965 gene locus_tag LOCUS_01980 gene lgt 206138 206965 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_01980 207876 207298 gene locus_tag LOCUS_01990 207876 207298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 208717 207845 gene locus_tag LOCUS_02000 208717 207845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 209446 208721 gene locus_tag LOCUS_02010 209446 208721 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000994578.1 protein_id gnl|my_center|LOCUS_02010 210510 209443 gene locus_tag LOCUS_02020 210510 209443 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_02020 211544 210510 gene locus_tag LOCUS_02030 211544 210510 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_02030 212565 211537 gene locus_tag LOCUS_02040 gene ruvB 212565 211537 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_02040 212886 212575 gene locus_tag LOCUS_02050 212886 212575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 213664 212870 gene locus_tag LOCUS_02060 gene panB 213664 212870 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_02060 213748 214164 gene locus_tag LOCUS_02070 213748 214164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 214212 214574 gene locus_tag LOCUS_tm00010 214212 214574 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 263 820 gene locus_tag LOCUS_02080 gene gmhA 263 820 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858021.1 protein_id gnl|my_center|LOCUS_02080 864 2045 gene locus_tag LOCUS_02090 864 2045 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476038.1 protein_id gnl|my_center|LOCUS_02090 2950 2075 gene locus_tag LOCUS_02100 gene waaF 2950 2075 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875425.1 protein_id gnl|my_center|LOCUS_02100 3998 2979 gene locus_tag LOCUS_02110 3998 2979 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_02110 5096 4035 gene locus_tag LOCUS_02120 gene rfaQ 5096 4035 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942892.1 protein_id gnl|my_center|LOCUS_02120 5956 5093 gene locus_tag LOCUS_02130 gene htrB 5956 5093 CDS product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858051.1 protein_id gnl|my_center|LOCUS_02130 6914 5949 gene locus_tag LOCUS_02140 gene waaC 6914 5949 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858077.1 protein_id gnl|my_center|LOCUS_02140 6975 7784 gene locus_tag LOCUS_02150 6975 7784 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853812.1 protein_id gnl|my_center|LOCUS_02150 7781 8596 gene locus_tag LOCUS_02160 7781 8596 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 protein_id gnl|my_center|LOCUS_02160 8597 8836 gene locus_tag LOCUS_02170 8597 8836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 8817 9296 gene locus_tag LOCUS_02180 gene pseH 8817 9296 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858467.1 protein_id gnl|my_center|LOCUS_02180 9420 10409 gene locus_tag LOCUS_02190 gene galE 9420 10409 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858414.1 protein_id gnl|my_center|LOCUS_02190 10662 12020 gene locus_tag LOCUS_02200 10662 12020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 12022 12594 gene locus_tag LOCUS_02210 12022 12594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 12591 12962 gene locus_tag LOCUS_02220 12591 12962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 12946 14415 gene locus_tag LOCUS_02230 gene mshL 12946 14415 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_02230 14412 15935 gene locus_tag LOCUS_02240 gene pilB 14412 15935 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_02240 15936 17138 gene locus_tag LOCUS_02250 15936 17138 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_02250 17183 17701 gene locus_tag LOCUS_02260 gene cetC 17183 17701 CDS product energy taxis response protein CetC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855880.1 protein_id gnl|my_center|LOCUS_02260 17705 18943 gene locus_tag LOCUS_02270 gene cetA 17705 18943 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_02270 18958 22944 gene locus_tag LOCUS_02280 gene dnaE 18958 22944 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_02280 23197 23337 gene locus_tag LOCUS_02290 23197 23337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 25733 23673 gene locus_tag LOCUS_02300 gene ccaA 25733 23673 CDS product aspartate chemotaxis receptor CcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851362.1 protein_id gnl|my_center|LOCUS_02300 26408 25875 gene locus_tag LOCUS_02310 26408 25875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 26932 26408 gene locus_tag LOCUS_02320 26932 26408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 27659 26922 gene locus_tag LOCUS_02330 gene hisIE 27659 26922 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 protein_id gnl|my_center|LOCUS_02330 28754 27669 gene locus_tag LOCUS_02340 28754 27669 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_02340 29689 28769 gene locus_tag LOCUS_02350 gene ilvE 29689 28769 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_02350 29895 30095 gene locus_tag LOCUS_02360 29895 30095 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851942.1 protein_id gnl|my_center|LOCUS_02360 30095 30613 gene locus_tag LOCUS_02370 gene bcp 30095 30613 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_02370 30619 31692 gene locus_tag LOCUS_02380 30619 31692 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_02380 31800 32246 gene locus_tag LOCUS_02390 gene fabZ 31800 32246 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_02390 32259 33044 gene locus_tag LOCUS_02400 gene lpxA 32259 33044 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_02400 33044 34258 gene locus_tag LOCUS_02410 gene clpX 33044 34258 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_02410 34268 35302 gene locus_tag LOCUS_02420 34268 35302 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_02420 35295 36041 gene locus_tag LOCUS_02430 gene mreC 35295 36041 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213296.1 protein_id gnl|my_center|LOCUS_02430 36213 39467 gene locus_tag LOCUS_02440 gene carB 36213 39467 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_02440 39515 39937 gene locus_tag LOCUS_02450 39515 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_02450 40811 39930 gene locus_tag LOCUS_02460 40811 39930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 41446 40805 gene locus_tag LOCUS_02470 41446 40805 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860322.1 protein_id gnl|my_center|LOCUS_02470 42218 41436 gene locus_tag LOCUS_02480 gene surE 42218 41436 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_02480 42299 43324 gene locus_tag LOCUS_02490 gene lpxB 42299 43324 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858730.1 protein_id gnl|my_center|LOCUS_02490 43367 43852 gene locus_tag LOCUS_02500 gene greA 43367 43852 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858660.1 protein_id gnl|my_center|LOCUS_02500 43871 44878 gene locus_tag LOCUS_02510 gene argC 43871 44878 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_02510 44875 45591 gene locus_tag LOCUS_02520 44875 45591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 45584 46540 gene locus_tag LOCUS_02530 45584 46540 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_02530 46551 48884 gene locus_tag LOCUS_02540 46551 48884 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_02540 48894 49394 gene locus_tag LOCUS_02550 48894 49394 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826355.1 protein_id gnl|my_center|LOCUS_02550 49404 50027 gene locus_tag LOCUS_02560 gene serB 49404 50027 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_02560 50037 51017 gene locus_tag LOCUS_02570 50037 51017 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_02570 51075 51611 gene locus_tag LOCUS_02580 51075 51611 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_02580 51611 52156 gene locus_tag LOCUS_02590 gene pth 51611 52156 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_02590 52209 53342 gene locus_tag LOCUS_02600 gene nspC 52209 53342 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_02600 53350 54426 gene locus_tag LOCUS_02610 gene flhB 53350 54426 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_02610 56581 54581 gene locus_tag LOCUS_02620 56581 54581 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_02620 57217 56792 gene locus_tag LOCUS_02630 57217 56792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 58497 57217 gene locus_tag LOCUS_02640 58497 57217 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_02640 59429 58497 gene locus_tag LOCUS_02650 59429 58497 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_02650 59622 60941 gene locus_tag LOCUS_02660 gene rho 59622 60941 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852852.1 protein_id gnl|my_center|LOCUS_02660 60944 62533 gene locus_tag LOCUS_02670 60944 62533 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_02670 62541 64331 gene locus_tag LOCUS_02680 gene lepA 62541 64331 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_02680 64343 64717 gene locus_tag LOCUS_02690 64343 64717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 64772 64978 gene locus_tag LOCUS_02700 64772 64978 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853198.1 protein_id gnl|my_center|LOCUS_02700 64975 65634 gene locus_tag LOCUS_02710 gene mapA 64975 65634 CDS product outer membrane lipoprotein MapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852941.1 protein_id gnl|my_center|LOCUS_02710 65644 66180 gene locus_tag LOCUS_02720 65644 66180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 66180 66749 gene locus_tag LOCUS_02730 66180 66749 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_02730 66859 66984 gene locus_tag LOCUS_02740 66859 66984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02740 67275 68156 gene locus_tag LOCUS_02750 67275 68156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 68201 70420 gene locus_tag LOCUS_02760 68201 70420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 70417 70641 gene locus_tag LOCUS_02770 70417 70641 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777686.1 protein_id gnl|my_center|LOCUS_02770 70638 71423 gene locus_tag LOCUS_02780 gene legH 70638 71423 CDS product N-acetyltransferase LegH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856586.1 protein_id gnl|my_center|LOCUS_02780 72572 71445 gene locus_tag LOCUS_02790 gene pseC 72572 71445 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856503.1 protein_id gnl|my_center|LOCUS_02790 73146 72586 gene locus_tag LOCUS_02800 gene dcd 73146 72586 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854086.1 protein_id gnl|my_center|LOCUS_02800 73271 73720 gene locus_tag LOCUS_02810 gene accB 73271 73720 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 protein_id gnl|my_center|LOCUS_02810 73717 75054 gene locus_tag LOCUS_02820 73717 75054 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_02820 75368 76342 gene locus_tag LOCUS_02830 75368 76342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02830 76373 78067 gene locus_tag LOCUS_02840 76373 78067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02840 78136 78606 gene locus_tag LOCUS_02850 78136 78606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 78582 78977 gene locus_tag LOCUS_02860 gene flgQ 78582 78977 CDS product flagellar assembly protein FlgQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852929.1 protein_id gnl|my_center|LOCUS_02860 78981 80129 gene locus_tag LOCUS_02870 gene flgR 78981 80129 CDS product fla regulon two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853038.1 protein_id gnl|my_center|LOCUS_02870 80205 81239 gene locus_tag LOCUS_02880 80205 81239 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_02880 81232 81759 gene locus_tag LOCUS_02890 81232 81759 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_02890 81775 82806 gene locus_tag LOCUS_02900 gene hemE 81775 82806 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_02900 82806 83714 gene locus_tag LOCUS_02910 82806 83714 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_02910 83794 83868 gene locus_tag LOCUS_t00070 83794 83868 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 84170 85186 gene locus_tag LOCUS_02920 gene mnmA 84170 85186 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_02920 86079 85432 gene locus_tag LOCUS_02930 86079 85432 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858510.1 protein_id gnl|my_center|LOCUS_02930 86936 86067 gene locus_tag LOCUS_02940 gene sppA 86936 86067 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_02940 88144 86924 gene locus_tag LOCUS_02950 88144 86924 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_02950 88234 88701 gene locus_tag LOCUS_02960 gene aroQ 88234 88701 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_02960 88694 89707 gene locus_tag LOCUS_02970 88694 89707 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 protein_id gnl|my_center|LOCUS_02970 89737 90192 gene locus_tag LOCUS_02980 gene folK 89737 90192 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 protein_id gnl|my_center|LOCUS_02980 90192 91535 gene locus_tag LOCUS_02990 gene flhF 90192 91535 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851941.1 protein_id gnl|my_center|LOCUS_02990 91532 92398 gene locus_tag LOCUS_03000 gene flhG 91532 92398 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_03000 92408 92752 gene locus_tag LOCUS_03010 92408 92752 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851727.1 protein_id gnl|my_center|LOCUS_03010 92724 93428 gene locus_tag LOCUS_03020 92724 93428 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859753.1 protein_id gnl|my_center|LOCUS_03020 93428 94525 gene locus_tag LOCUS_03030 gene fliM 93428 94525 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_03030 94518 95345 gene locus_tag LOCUS_03040 gene fliY 94518 95345 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851810.1 protein_id gnl|my_center|LOCUS_03040 96092 95403 gene locus_tag LOCUS_03050 96092 95403 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891841.1 protein_id gnl|my_center|LOCUS_03050 96856 96122 gene locus_tag LOCUS_03060 gene ptmA 96856 96122 CDS product flagellin modification protein PtmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857935.1 protein_id gnl|my_center|LOCUS_03060 97547 96849 gene locus_tag LOCUS_03070 gene legF 97547 96849 CDS product CMP-N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864263.1 protein_id gnl|my_center|LOCUS_03070 98437 97544 gene locus_tag LOCUS_03080 gene ptmF 98437 97544 CDS product L-glutamine-D-fructose-6-phosphate isomerase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860798.1 protein_id gnl|my_center|LOCUS_03080 99522 98434 gene locus_tag LOCUS_03090 99522 98434 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_03090 100667 99519 gene locus_tag LOCUS_03100 gene neuC 100667 99519 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_03100 101662 100664 gene locus_tag LOCUS_03110 gene legI 101662 100664 CDS product N,N'-diacetyllegionaminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864265.1 protein_id gnl|my_center|LOCUS_03110 102673 101666 gene locus_tag LOCUS_03120 gene pseI 102673 101666 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_03120 103448 102786 gene locus_tag LOCUS_03130 103448 102786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 103831 103448 gene locus_tag LOCUS_03140 gene exbD 103831 103448 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851470.1 protein_id gnl|my_center|LOCUS_03140 104254 103841 gene locus_tag LOCUS_03150 gene exbB 104254 103841 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851166.1 protein_id gnl|my_center|LOCUS_03150 105207 104434 gene locus_tag LOCUS_03160 105207 104434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 105868 105197 gene locus_tag LOCUS_03170 gene pseF 105868 105197 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_03170 106560 105871 gene locus_tag LOCUS_03180 106560 105871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 107300 106560 gene locus_tag LOCUS_03190 107300 106560 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858436.1 protein_id gnl|my_center|LOCUS_03190 107701 108729 gene locus_tag LOCUS_03200 107701 108729 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857587.1 protein_id gnl|my_center|LOCUS_03200 108922 109230 gene locus_tag LOCUS_03210 gene rplU 108922 109230 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778820.1 protein_id gnl|my_center|LOCUS_03210 109241 109498 gene locus_tag LOCUS_03220 gene rpmA 109241 109498 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_03220 109569 110609 gene locus_tag LOCUS_03230 gene obgE 109569 110609 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851611.1 protein_id gnl|my_center|LOCUS_03230 110677 111441 gene locus_tag LOCUS_03240 gene proB 110677 111441 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851769.1 protein_id gnl|my_center|LOCUS_03240 111438 112352 gene locus_tag LOCUS_03250 gene fmt 111438 112352 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_03250 112330 112965 gene locus_tag LOCUS_03260 112330 112965 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_03260 112962 113744 gene locus_tag LOCUS_03270 112962 113744 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_03270 113747 114586 gene locus_tag LOCUS_03280 113747 114586 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_03280 114649 115071 gene locus_tag LOCUS_03290 114649 115071 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_03290 115081 115593 gene locus_tag LOCUS_03300 115081 115593 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_03300 115593 116126 gene locus_tag LOCUS_03310 115593 116126 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851861.1 protein_id gnl|my_center|LOCUS_03310 116141 117658 gene locus_tag LOCUS_03320 gene atpA 116141 117658 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_03320 117668 118555 gene locus_tag LOCUS_03330 gene atpG 117668 118555 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_03330 118573 119970 gene locus_tag LOCUS_03340 gene atpD 118573 119970 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_03340 119988 120377 gene locus_tag LOCUS_03350 gene atpC 119988 120377 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_03350 120378 120947 gene locus_tag LOCUS_03360 120378 120947 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_03360 120948 121340 gene locus_tag LOCUS_03370 120948 121340 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858790.1 protein_id gnl|my_center|LOCUS_03370 121340 122116 gene locus_tag LOCUS_03380 121340 122116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 122113 123369 gene locus_tag LOCUS_03390 gene tolB 122113 123369 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_03390 123442 123924 gene locus_tag LOCUS_03400 gene pal 123442 123924 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_03400 123939 124826 gene locus_tag LOCUS_03410 123939 124826 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_03410 124843 125457 gene locus_tag LOCUS_03420 124843 125457 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_03420 125467 126378 gene locus_tag LOCUS_03430 gene fabD 125467 126378 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_03430 126375 127061 gene locus_tag LOCUS_03440 gene pfs 126375 127061 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_03440 127058 127801 gene locus_tag LOCUS_03450 127058 127801 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_03450 128275 127835 gene locus_tag LOCUS_03460 128275 127835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852445.1 protein_id gnl|my_center|LOCUS_03460 128739 128284 gene locus_tag LOCUS_03470 128739 128284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 129563 128736 gene locus_tag LOCUS_03480 129563 128736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 130204 129566 gene locus_tag LOCUS_03490 130204 129566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 131110 130214 gene locus_tag LOCUS_03500 131110 130214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 131565 131116 gene locus_tag LOCUS_03510 131565 131116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 132107 131562 gene locus_tag LOCUS_03520 132107 131562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 132787 132104 gene locus_tag LOCUS_03530 132787 132104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 133994 132780 gene locus_tag LOCUS_03540 gene nosD 133994 132780 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070836.1 protein_id gnl|my_center|LOCUS_03540 134752 133991 gene locus_tag LOCUS_03550 134752 133991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 137439 134845 gene locus_tag LOCUS_03560 137439 134845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 138273 137470 gene locus_tag LOCUS_03570 138273 137470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 140218 138563 gene locus_tag LOCUS_03580 140218 138563 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427574.1 protein_id gnl|my_center|LOCUS_03580 140503 141507 gene locus_tag LOCUS_03590 140503 141507 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857563.1 protein_id gnl|my_center|LOCUS_03590 141504 143120 gene locus_tag LOCUS_03600 141504 143120 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852018.1 protein_id gnl|my_center|LOCUS_03600 143107 144015 gene locus_tag LOCUS_03610 143107 144015 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891842.1 protein_id gnl|my_center|LOCUS_03610 144079 146898 gene locus_tag LOCUS_03620 gene uvrA 144079 146898 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_03620 148041 146938 gene locus_tag LOCUS_03630 gene nusA 148041 146938 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_03630 148227 148469 gene locus_tag LOCUS_03640 148227 148469 CDS product HP0268 family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 protein_id gnl|my_center|LOCUS_03640 148520 149776 gene locus_tag LOCUS_03650 gene miaB 148520 149776 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_03650 149784 150386 gene locus_tag LOCUS_03660 149784 150386 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_03660 150432 151457 gene locus_tag LOCUS_03670 150432 151457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858619.1 protein_id gnl|my_center|LOCUS_03670 151447 151980 gene locus_tag LOCUS_03680 151447 151980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 151970 152497 gene locus_tag LOCUS_03690 151970 152497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 153365 152472 gene locus_tag LOCUS_03700 gene tilS 153365 152472 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612475.1 protein_id gnl|my_center|LOCUS_03700 154765 153458 gene locus_tag LOCUS_03710 gene rimO 154765 153458 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_03710 155588 154767 gene locus_tag LOCUS_03720 gene panC 155588 154767 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_03720 155714 156814 gene locus_tag LOCUS_03730 gene prfB 155714 156814 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_03730 156824 157150 gene locus_tag LOCUS_03740 156824 157150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 157147 157572 gene locus_tag LOCUS_03750 157147 157572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 158232 157609 gene locus_tag LOCUS_03760 158232 157609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 158330 158611 gene locus_tag LOCUS_03770 158330 158611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 159672 158740 gene locus_tag LOCUS_03780 gene accA 159672 158740 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_03780 160883 159672 gene locus_tag LOCUS_03790 160883 159672 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_03790 161164 160931 gene locus_tag LOCUS_03800 gene acpP 161164 160931 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_03800 161965 161222 gene locus_tag LOCUS_03810 gene fabG 161965 161222 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_03810 163439 161976 gene locus_tag LOCUS_03820 gene gpmI 163439 161976 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858599.1 protein_id gnl|my_center|LOCUS_03820 163616 164680 gene locus_tag LOCUS_03830 gene mraY 163616 164680 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_03830 164685 165887 gene locus_tag LOCUS_03840 gene murD 164685 165887 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_03840 165961 166036 gene locus_tag LOCUS_t00080 165961 166036 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 166531 167148 gene locus_tag LOCUS_03850 166531 167148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 167185 168360 gene locus_tag LOCUS_03860 167185 168360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 168805 168683 gene locus_tag LOCUS_03870 168805 168683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 168960 168787 gene locus_tag LOCUS_03880 168960 168787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 169250 169666 gene locus_tag LOCUS_03890 169250 169666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 170041 169670 gene locus_tag LOCUS_03900 170041 169670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 170166 170684 gene locus_tag LOCUS_03910 170166 170684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 170783 171877 gene locus_tag LOCUS_03920 gene pglE 170783 171877 CDS product UDP-N-acetylbacillosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852877.1 protein_id gnl|my_center|LOCUS_03920 171874 173655 gene locus_tag LOCUS_03930 gene pglF 171874 173655 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (configuration-retaining) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858054.1 protein_id gnl|my_center|LOCUS_03930 173657 174562 gene locus_tag LOCUS_03940 173657 174562 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_03940 174546 175157 gene locus_tag LOCUS_03950 gene hisH 174546 175157 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880441.1 protein_id gnl|my_center|LOCUS_03950 175158 175868 gene locus_tag LOCUS_03960 gene hisA 175158 175868 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_03960 175933 176298 gene locus_tag LOCUS_03970 175933 176298 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_03970 176298 177110 gene locus_tag LOCUS_03980 176298 177110 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_03980 177110 179038 gene locus_tag LOCUS_03990 gene ftsH 177110 179038 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_03990 179031 179642 gene locus_tag LOCUS_04000 179031 179642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 179635 180366 gene locus_tag LOCUS_04010 gene pssA 179635 180366 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_04010 180492 182009 gene locus_tag LOCUS_04020 180492 182009 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980887.1 protein_id gnl|my_center|LOCUS_04020 182135 182728 gene locus_tag LOCUS_04030 182135 182728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858686.1 protein_id gnl|my_center|LOCUS_04030 182715 183104 gene locus_tag LOCUS_04040 182715 183104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 183392 184510 gene locus_tag LOCUS_04050 183392 184510 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858428.1 protein_id gnl|my_center|LOCUS_04050 184794 185843 gene locus_tag LOCUS_04060 184794 185843 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858049.1 protein_id gnl|my_center|LOCUS_04060 185840 186136 gene locus_tag LOCUS_04070 185840 186136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 186197 186400 gene locus_tag LOCUS_04080 186197 186400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 186440 186886 gene locus_tag LOCUS_04090 186440 186886 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779263.1 protein_id gnl|my_center|LOCUS_04090 186888 188744 gene locus_tag LOCUS_04100 gene flgK 186888 188744 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851396.1 protein_id gnl|my_center|LOCUS_04100 188744 189517 gene locus_tag LOCUS_04110 188744 189517 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_04110 189569 190783 gene locus_tag LOCUS_04120 189569 190783 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_04120 193168 190784 gene locus_tag LOCUS_04130 gene pflB 193168 190784 CDS product motility protein PflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858651.1 protein_id gnl|my_center|LOCUS_04130 194425 193181 gene locus_tag LOCUS_04140 gene serS 194425 193181 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_04140 195403 194435 gene locus_tag LOCUS_04150 gene trpS 195403 194435 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_04150 195943 195407 gene locus_tag LOCUS_04160 195943 195407 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_04160 197312 195927 gene locus_tag LOCUS_04170 gene der 197312 195927 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_04170 197767 197970 gene locus_tag LOCUS_04180 197767 197970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 197982 198131 gene locus_tag LOCUS_04190 197982 198131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 198211 199083 gene locus_tag LOCUS_04200 198211 199083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 199085 199315 gene locus_tag LOCUS_04210 199085 199315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 199849 200004 gene locus_tag LOCUS_04220 199849 200004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 200053 200226 gene locus_tag LOCUS_04230 200053 200226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 200407 200895 gene locus_tag LOCUS_04240 200407 200895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 200892 201059 gene locus_tag LOCUS_04250 200892 201059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 201056 201595 gene locus_tag LOCUS_04260 201056 201595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 201789 201911 gene locus_tag LOCUS_04270 201789 201911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 201915 202145 gene locus_tag LOCUS_04280 201915 202145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 202335 202667 gene locus_tag LOCUS_04290 202335 202667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 202678 202893 gene locus_tag LOCUS_04300 202678 202893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 202982 203338 gene locus_tag LOCUS_04310 202982 203338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 204566 203415 gene locus_tag LOCUS_04320 204566 203415 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459811.1 protein_id gnl|my_center|LOCUS_04320 205544 204879 gene locus_tag LOCUS_04330 205544 204879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 205678 205893 gene locus_tag LOCUS_04340 205678 205893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 205893 206165 gene locus_tag LOCUS_04350 205893 206165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 206265 207299 gene locus_tag LOCUS_04360 206265 207299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 207334 207948 gene locus_tag LOCUS_04370 207334 207948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 207959 208960 gene locus_tag LOCUS_04380 207959 208960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence03 1495 248 gene locus_tag LOCUS_04390 1495 248 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854063.1 protein_id gnl|my_center|LOCUS_04390 3065 1686 gene locus_tag LOCUS_04400 gene gltX 3065 1686 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_04400 3137 3964 gene locus_tag LOCUS_04410 gene salC 3137 3964 CDS product peptidylprolyl isomerase SalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864102.1 protein_id gnl|my_center|LOCUS_04410 5276 3966 gene locus_tag LOCUS_04420 5276 3966 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891852.1 protein_id gnl|my_center|LOCUS_04420 6016 5351 gene locus_tag LOCUS_04430 6016 5351 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852587.1 protein_id gnl|my_center|LOCUS_04430 6524 6027 gene locus_tag LOCUS_04440 6524 6027 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858699.1 protein_id gnl|my_center|LOCUS_04440 7459 6527 gene locus_tag LOCUS_04450 7459 6527 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_04450 7597 7935 gene locus_tag LOCUS_04460 7597 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7943 8254 gene locus_tag LOCUS_04470 7943 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 8310 9053 gene locus_tag LOCUS_04480 8310 9053 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869557.1 protein_id gnl|my_center|LOCUS_04480 9050 10141 gene locus_tag LOCUS_04490 gene dxr 9050 10141 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864243.1 protein_id gnl|my_center|LOCUS_04490 10197 11489 gene locus_tag LOCUS_04500 10197 11489 CDS product M99 family carboxypeptidase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869556.1 protein_id gnl|my_center|LOCUS_04500 11486 12490 gene locus_tag LOCUS_04510 gene tsaD 11486 12490 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_04510 12503 14878 gene locus_tag LOCUS_04520 12503 14878 CDS product paralyzed flagella protein PflA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851328.1 protein_id gnl|my_center|LOCUS_04520 15748 14861 gene locus_tag LOCUS_04530 gene miaA 15748 14861 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 protein_id gnl|my_center|LOCUS_04530 15871 16740 gene locus_tag LOCUS_04540 15871 16740 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_04540 16734 17240 gene locus_tag LOCUS_04550 16734 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 17230 17754 gene locus_tag LOCUS_04560 17230 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 17754 18725 gene locus_tag LOCUS_04570 gene moaA 17754 18725 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_04570 18728 19453 gene locus_tag LOCUS_04580 18728 19453 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851883.1 protein_id gnl|my_center|LOCUS_04580 19457 20038 gene locus_tag LOCUS_04590 19457 20038 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858675.1 protein_id gnl|my_center|LOCUS_04590 20038 20217 gene locus_tag LOCUS_04600 20038 20217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 20229 20621 gene locus_tag LOCUS_04610 20229 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 20618 21274 gene locus_tag LOCUS_04620 20618 21274 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851903.1 protein_id gnl|my_center|LOCUS_04620 21278 21607 gene locus_tag LOCUS_04630 21278 21607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 21585 24209 gene locus_tag LOCUS_04640 gene polA 21585 24209 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_04640 24279 25049 gene locus_tag LOCUS_04650 gene motA 24279 25049 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858693.1 protein_id gnl|my_center|LOCUS_04650 25058 25774 gene locus_tag LOCUS_04660 gene motB 25058 25774 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851120.1 protein_id gnl|my_center|LOCUS_04660 25857 26141 gene locus_tag LOCUS_04670 25857 26141 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_04670 26234 26647 gene locus_tag LOCUS_04680 gene ndk 26234 26647 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_04680 26657 27022 gene locus_tag LOCUS_04690 26657 27022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858727.1 protein_id gnl|my_center|LOCUS_04690 27024 27170 gene locus_tag LOCUS_04700 gene rpmF 27024 27170 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_04700 27179 28171 gene locus_tag LOCUS_04710 gene plsX 27179 28171 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_04710 28168 29154 gene locus_tag LOCUS_04720 28168 29154 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_04720 29159 29776 gene locus_tag LOCUS_04730 gene plsY 29159 29776 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_04730 29773 30090 gene locus_tag LOCUS_04740 29773 30090 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854273.1 protein_id gnl|my_center|LOCUS_04740 30172 30843 gene locus_tag LOCUS_04750 gene hsrA 30172 30843 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_04750 30882 32099 gene locus_tag LOCUS_04760 30882 32099 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019826.1 protein_id gnl|my_center|LOCUS_04760 32120 33595 gene locus_tag LOCUS_04770 32120 33595 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857605.1 protein_id gnl|my_center|LOCUS_04770 35893 33623 gene locus_tag LOCUS_04780 gene bamA 35893 33623 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_04780 36018 36848 gene locus_tag LOCUS_04790 36018 36848 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_04790 36915 38264 gene locus_tag LOCUS_04800 36915 38264 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_04800 38419 39303 gene locus_tag LOCUS_04810 gene lpxC 38419 39303 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_04810 39414 39746 gene locus_tag LOCUS_04820 39414 39746 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_04820 39756 40637 gene locus_tag LOCUS_04830 gene thrB 39756 40637 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888538.1 protein_id gnl|my_center|LOCUS_04830 40663 40905 gene locus_tag LOCUS_04840 40663 40905 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859353.1 protein_id gnl|my_center|LOCUS_04840 40892 43450 gene locus_tag LOCUS_04850 gene infB 40892 43450 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_04850 43447 43815 gene locus_tag LOCUS_04860 gene rbfA 43447 43815 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_04860 43812 44237 gene locus_tag LOCUS_04870 gene rimP 43812 44237 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_04870 44240 45262 gene locus_tag LOCUS_04880 gene ribD 44240 45262 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_04880 45259 45777 gene locus_tag LOCUS_04890 45259 45777 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215682.1 protein_id gnl|my_center|LOCUS_04890 45801 46334 gene locus_tag LOCUS_04900 45801 46334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 46440 46736 gene locus_tag LOCUS_04910 46440 46736 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693946.1 protein_id gnl|my_center|LOCUS_04910 46730 47005 gene locus_tag LOCUS_04920 46730 47005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 47533 47030 gene locus_tag LOCUS_04930 47533 47030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 47767 47534 gene locus_tag LOCUS_04940 47767 47534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 48061 48462 gene locus_tag LOCUS_04950 48061 48462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 49192 50895 gene locus_tag LOCUS_04960 49192 50895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 50905 51357 gene locus_tag LOCUS_04970 50905 51357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 51357 52499 gene locus_tag LOCUS_04980 51357 52499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 52426 53595 gene locus_tag LOCUS_04990 52426 53595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 53610 53954 gene locus_tag LOCUS_05000 53610 53954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 54003 55037 gene locus_tag LOCUS_05010 54003 55037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 55024 55899 gene locus_tag LOCUS_05020 55024 55899 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_05020 56032 55958 gene locus_tag LOCUS_t00090 56032 55958 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 56122 56048 gene locus_tag LOCUS_t00100 56122 56048 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 57240 56215 gene locus_tag LOCUS_05030 57240 56215 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_05030 58484 57237 gene locus_tag LOCUS_05040 58484 57237 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852758.1 protein_id gnl|my_center|LOCUS_05040 59001 58495 gene locus_tag LOCUS_05050 gene petA 59001 58495 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_05050 61031 59166 gene locus_tag LOCUS_05060 gene mnmG 61031 59166 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_05060 61164 61775 gene locus_tag LOCUS_05070 61164 61775 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_05070 61759 62439 gene locus_tag LOCUS_05080 gene pgeF 61759 62439 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014919.1 protein_id gnl|my_center|LOCUS_05080 62445 62651 gene locus_tag LOCUS_05090 62445 62651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 62837 63610 gene locus_tag LOCUS_05100 gene rpsB 62837 63610 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002892710.1 protein_id gnl|my_center|LOCUS_05100 63610 64674 gene locus_tag LOCUS_05110 gene tsf 63610 64674 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_05110 64677 65312 gene locus_tag LOCUS_05120 64677 65312 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_05120 66284 65700 gene locus_tag LOCUS_05130 66284 65700 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_05130 66876 66271 gene locus_tag LOCUS_05140 gene pglC 66876 66271 CDS product undecaprenyl phosphate N,N'-diacetylbacillosamine 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852766.1 protein_id gnl|my_center|LOCUS_05140 67984 66869 gene locus_tag LOCUS_05150 gene pglA 67984 66869 CDS product N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852885.1 protein_id gnl|my_center|LOCUS_05150 70079 67989 gene locus_tag LOCUS_05160 gene pglB 70079 67989 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_05160 71184 70063 gene locus_tag LOCUS_05170 gene pglJ 71184 70063 CDS product N-acetylgalactosamine-N,N'-diacetylbacillosaminyl-diphospho-undecaprenol 4-alpha-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852870.1 protein_id gnl|my_center|LOCUS_05170 72218 71184 gene locus_tag LOCUS_05180 72218 71184 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120712.1 protein_id gnl|my_center|LOCUS_05180 73249 72215 gene locus_tag LOCUS_05190 gene pglH 73249 72215 CDS product GalNAc-alpha-(1->4)-GalNAc-alpha-(1->3)-diNAcBac-PP-undecaprenol alpha-1,4-N-acetyl-D-galactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891911.1 protein_id gnl|my_center|LOCUS_05190 74661 73246 gene locus_tag LOCUS_05200 74661 73246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202254.1 protein_id gnl|my_center|LOCUS_05200 74946 75275 gene locus_tag LOCUS_05210 74946 75275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337920.1 protein_id gnl|my_center|LOCUS_05210 75263 76201 gene locus_tag LOCUS_05220 75263 76201 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124369.1 protein_id gnl|my_center|LOCUS_05220 76303 77499 gene locus_tag LOCUS_05230 gene lysA 76303 77499 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_05230 77499 78269 gene locus_tag LOCUS_05240 77499 78269 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858702.1 protein_id gnl|my_center|LOCUS_05240 78266 79339 gene locus_tag LOCUS_05250 gene pheA 78266 79339 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_05250 79342 80439 gene locus_tag LOCUS_05260 gene hisC 79342 80439 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_05260 80446 82152 gene locus_tag LOCUS_05270 gene fliF 80446 82152 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859425.1 protein_id gnl|my_center|LOCUS_05270 82152 83177 gene locus_tag LOCUS_05280 gene fliG 82152 83177 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_05280 83174 83995 gene locus_tag LOCUS_05290 gene fliH 83174 83995 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858748.1 protein_id gnl|my_center|LOCUS_05290 83988 85808 gene locus_tag LOCUS_05300 gene dxs 83988 85808 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858717.1 protein_id gnl|my_center|LOCUS_05300 85994 86464 gene locus_tag LOCUS_05310 85994 86464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 86461 87225 gene locus_tag LOCUS_05320 86461 87225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 87366 87776 gene locus_tag LOCUS_05330 gene perR 87366 87776 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_05330 87861 88628 gene locus_tag LOCUS_05340 87861 88628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 88629 89342 gene locus_tag LOCUS_05350 gene ubiE 88629 89342 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_05350 89339 90499 gene locus_tag LOCUS_05360 gene xseA 89339 90499 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851089.1 protein_id gnl|my_center|LOCUS_05360 90509 91585 gene locus_tag LOCUS_05370 gene serC 90509 91585 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858670.1 protein_id gnl|my_center|LOCUS_05370 92325 91729 gene locus_tag LOCUS_05380 92325 91729 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_05380 92493 93365 gene locus_tag LOCUS_05390 gene accD 92493 93365 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_05390 93365 93811 gene locus_tag LOCUS_05400 93365 93811 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_05400 93823 94179 gene locus_tag LOCUS_05410 gene dksA 93823 94179 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_05410 94190 95182 gene locus_tag LOCUS_05420 94190 95182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851806.1 protein_id gnl|my_center|LOCUS_05420 95182 96120 gene locus_tag LOCUS_05430 95182 96120 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_05430 96102 96716 gene locus_tag LOCUS_05440 gene recO 96102 96716 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_05440 96832 97379 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaaaccgagttggtttgtggtataatttgcaac 98156 97590 gene locus_tag LOCUS_05450 gene cas4 98156 97590 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042183.1 protein_id gnl|my_center|LOCUS_05450 98426 98157 gene locus_tag LOCUS_05460 98426 98157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 99383 98427 gene locus_tag LOCUS_05470 gene cas1 99383 98427 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_05470 103203 99364 gene locus_tag LOCUS_05480 103203 99364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 103446 103823 gene locus_tag LOCUS_05490 gene csx20 103446 103823 CDS product CRISPR-associated protein Csx20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_05490 103823 104197 gene locus_tag LOCUS_05500 103823 104197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 104169 105008 gene locus_tag LOCUS_05510 gene cas6 104169 105008 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_05510 104998 106533 gene locus_tag LOCUS_05520 104998 106533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 106526 106864 gene locus_tag LOCUS_05530 106526 106864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 106874 107506 gene locus_tag LOCUS_05540 gene csm3 106874 107506 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_05540 107445 108413 gene locus_tag LOCUS_05550 107445 108413 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_05550 108410 109456 gene locus_tag LOCUS_05560 gene csm5 108410 109456 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546605.1 protein_id gnl|my_center|LOCUS_05560 109465 110268 gene locus_tag LOCUS_05570 109465 110268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 110373 110768 gene locus_tag LOCUS_05580 110373 110768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 111102 111800 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attacaaacaatatgacccgatttaggggattgaaat 112989 112171 gene locus_tag LOCUS_05590 gene fabI 112989 112171 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_05590 113669 112992 gene locus_tag LOCUS_05600 113669 112992 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855528.1 protein_id gnl|my_center|LOCUS_05600 114874 113666 gene locus_tag LOCUS_05610 114874 113666 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_05610 115871 114876 gene locus_tag LOCUS_05620 gene gap 115871 114876 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_05620 115930 116478 gene locus_tag LOCUS_05630 gene nadD 115930 116478 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_05630 116468 116794 gene locus_tag LOCUS_05640 gene rsfS 116468 116794 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858238.1 protein_id gnl|my_center|LOCUS_05640 118435 116840 gene locus_tag LOCUS_05650 gene argS 118435 116840 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_05650 118647 118435 gene locus_tag LOCUS_05660 118647 118435 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852866.1 protein_id gnl|my_center|LOCUS_05660 119308 118697 gene locus_tag LOCUS_05670 gene gmk 119308 118697 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860253.1 protein_id gnl|my_center|LOCUS_05670 120903 119305 gene locus_tag LOCUS_05680 120903 119305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852900.1 protein_id gnl|my_center|LOCUS_05680 121737 120964 gene locus_tag LOCUS_05690 gene fliR 121737 120964 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_05690 124026 121942 gene locus_tag LOCUS_05700 gene ccaA 124026 121942 CDS product aspartate chemotaxis receptor CcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851362.1 protein_id gnl|my_center|LOCUS_05700 125111 124233 gene locus_tag LOCUS_05710 125111 124233 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040419.1 protein_id gnl|my_center|LOCUS_05710 125952 125122 gene locus_tag LOCUS_05720 125952 125122 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850703.1 protein_id gnl|my_center|LOCUS_05720 127132 126071 gene locus_tag LOCUS_05730 127132 126071 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_05730 127245 127850 gene locus_tag LOCUS_05740 127245 127850 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405093.1 protein_id gnl|my_center|LOCUS_05740 127847 128458 gene locus_tag LOCUS_05750 gene rdgB 127847 128458 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_05750 128547 129767 gene locus_tag LOCUS_05760 128547 129767 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_05760 129818 130018 gene locus_tag LOCUS_05770 gene rpmE 129818 130018 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_05770 130089 130850 gene locus_tag LOCUS_05780 gene rsmI 130089 130850 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_05780 130936 131622 gene locus_tag LOCUS_05790 gene rlmB 130936 131622 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_05790 131615 132520 gene locus_tag LOCUS_05800 131615 132520 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851924.1 protein_id gnl|my_center|LOCUS_05800 132514 133332 gene locus_tag LOCUS_05810 132514 133332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851994.1 protein_id gnl|my_center|LOCUS_05810 133343 134551 gene locus_tag LOCUS_05820 133343 134551 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851675.1 protein_id gnl|my_center|LOCUS_05820 134548 135813 gene locus_tag LOCUS_05830 134548 135813 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851705.1 protein_id gnl|my_center|LOCUS_05830 135817 136155 gene locus_tag LOCUS_05840 135817 136155 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851874.1 protein_id gnl|my_center|LOCUS_05840 136330 136644 gene locus_tag LOCUS_05850 gene trxA 136330 136644 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_05850 136774 137712 gene locus_tag LOCUS_05860 gene trxB 136774 137712 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_05860 137829 138590 gene locus_tag LOCUS_05870 gene dapB 137829 138590 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_05870 138592 139932 gene locus_tag LOCUS_05880 gene purF 138592 139932 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_05880 140058 140654 gene locus_tag LOCUS_05890 140058 140654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 140665 141096 gene locus_tag LOCUS_05900 140665 141096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 141725 141522 gene locus_tag LOCUS_05910 141725 141522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 143314 141722 gene locus_tag LOCUS_05920 143314 141722 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858735.1 protein_id gnl|my_center|LOCUS_05920 144511 143324 gene locus_tag LOCUS_05930 144511 143324 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_05930 145481 144531 gene locus_tag LOCUS_05940 145481 144531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889661.1 protein_id gnl|my_center|LOCUS_05940 145783 145478 gene locus_tag LOCUS_05950 gene fliN 145783 145478 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824739.1 protein_id gnl|my_center|LOCUS_05950 146199 145780 gene locus_tag LOCUS_05960 146199 145780 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854524.1 protein_id gnl|my_center|LOCUS_05960 147066 146320 gene locus_tag LOCUS_05970 gene trpA 147066 146320 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854645.1 protein_id gnl|my_center|LOCUS_05970 148240 147059 gene locus_tag LOCUS_05980 gene trpB 148240 147059 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854204.1 protein_id gnl|my_center|LOCUS_05980 148858 148244 gene locus_tag LOCUS_05990 148858 148244 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858740.1 protein_id gnl|my_center|LOCUS_05990 149955 148855 gene locus_tag LOCUS_06000 149955 148855 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_06000 151553 149952 gene locus_tag LOCUS_06010 gene trpD 151553 149952 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858662.1 protein_id gnl|my_center|LOCUS_06010 152820 151558 gene locus_tag LOCUS_06020 152820 151558 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858746.1 protein_id gnl|my_center|LOCUS_06020 152952 153746 gene locus_tag LOCUS_06030 152952 153746 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_06030 154322 153780 gene locus_tag LOCUS_06040 154322 153780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 155019 154354 gene locus_tag LOCUS_06050 gene modB 155019 154354 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_06050 155843 155016 gene locus_tag LOCUS_06060 155843 155016 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_06060 156583 155852 gene locus_tag LOCUS_06070 gene modA 156583 155852 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_06070 157516 156728 gene locus_tag LOCUS_06080 157516 156728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 157710 158411 gene locus_tag LOCUS_06090 157710 158411 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853724.1 protein_id gnl|my_center|LOCUS_06090 158415 159008 gene locus_tag LOCUS_06100 158415 159008 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852394.1 protein_id gnl|my_center|LOCUS_06100 159005 161443 gene locus_tag LOCUS_06110 159005 161443 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_06110 161954 161469 gene locus_tag LOCUS_06120 161954 161469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 162613 162035 gene locus_tag LOCUS_06130 162613 162035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 162719 164533 gene locus_tag LOCUS_06140 162719 164533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 164544 165398 gene locus_tag LOCUS_06150 164544 165398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 165408 166658 gene locus_tag LOCUS_06160 165408 166658 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_06160 166655 167080 gene locus_tag LOCUS_06170 166655 167080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 167081 167599 gene locus_tag LOCUS_06180 167081 167599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 167680 168231 gene locus_tag LOCUS_06190 167680 168231 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_06190 168231 169349 gene locus_tag LOCUS_06200 gene carA 168231 169349 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_06200 169349 170014 gene locus_tag LOCUS_06210 169349 170014 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_06210 170011 171243 gene locus_tag LOCUS_06220 170011 171243 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_06220 171236 171922 gene locus_tag LOCUS_06230 171236 171922 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_06230 172124 173590 gene locus_tag LOCUS_06240 gene ccoN 172124 173590 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_06240 173601 174266 gene locus_tag LOCUS_06250 gene ccoO 173601 174266 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_06250 174275 174505 gene locus_tag LOCUS_06260 174275 174505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 174502 175374 gene locus_tag LOCUS_06270 174502 175374 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_06270 175376 175594 gene locus_tag LOCUS_06280 175376 175594 CDS product DUF4006 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864471.1 protein_id gnl|my_center|LOCUS_06280 175696 176298 gene locus_tag LOCUS_06290 175696 176298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_06290 176301 176834 gene locus_tag LOCUS_06300 176301 176834 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851150.1 protein_id gnl|my_center|LOCUS_06300 176824 179181 gene locus_tag LOCUS_06310 176824 179181 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_06310 179178 181940 gene locus_tag LOCUS_06320 179178 181940 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_06320 182029 182454 gene locus_tag LOCUS_06330 gene rplM 182029 182454 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_06330 182457 182846 gene locus_tag LOCUS_06340 gene rpsI 182457 182846 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851459.1 protein_id gnl|my_center|LOCUS_06340 183148 184155 gene locus_tag LOCUS_06350 gene cadF 183148 184155 CDS product fibronectin-binding outer membrane protein CadF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851185.1 protein_id gnl|my_center|LOCUS_06350 184158 184997 gene locus_tag LOCUS_06360 184158 184997 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037313.1 protein_id gnl|my_center|LOCUS_06360 184987 185643 gene locus_tag LOCUS_06370 184987 185643 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_06370 185949 189500 gene locus_tag LOCUS_06380 gene nifJ 185949 189500 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851382.1 protein_id gnl|my_center|LOCUS_06380 189868 190701 gene locus_tag LOCUS_06390 189868 190701 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_06390 190754 191554 gene locus_tag LOCUS_06400 gene kdsA 190754 191554 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_06400 191547 191873 gene locus_tag LOCUS_06410 191547 191873 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312348.1 protein_id gnl|my_center|LOCUS_06410 191870 192193 gene locus_tag LOCUS_06420 191870 192193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 192203 192673 gene locus_tag LOCUS_06430 gene ribE 192203 192673 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_06430 192675 193073 gene locus_tag LOCUS_06440 gene nusB 192675 193073 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_06440 193070 193750 gene locus_tag LOCUS_06450 gene pyrF 193070 193750 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_06450 193794 193884 gene locus_tag LOCUS_t00110 193794 193884 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 194108 195310 gene locus_tag LOCUS_06460 gene porA 194108 195310 CDS product group 1 major outer membrane porin protein PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891919.1 protein_id gnl|my_center|LOCUS_06460 196152 196724 gene locus_tag LOCUS_06470 196152 196724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 196745 198055 gene locus_tag LOCUS_06480 gene porA 196745 198055 CDS product group 1 major outer membrane porin protein PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891919.1 protein_id gnl|my_center|LOCUS_06480 198257 200665 gene locus_tag LOCUS_06490 198257 200665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 200669 202477 gene locus_tag LOCUS_06500 gene glmS 200669 202477 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_06500 204020 202782 gene locus_tag LOCUS_06510 204020 202782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167098.1 protein_id gnl|my_center|LOCUS_06510 204121 205902 gene locus_tag LOCUS_06520 204121 205902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 206790 206032 gene locus_tag LOCUS_06530 gene murI 206790 206032 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_06530 208589 206790 gene locus_tag LOCUS_06540 208589 206790 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865770.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence04 1892 174 gene locus_tag LOCUS_06550 1892 174 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_06550 2565 1894 gene locus_tag LOCUS_06560 2565 1894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_06560 3355 2600 gene locus_tag LOCUS_06570 gene pstB 3355 2600 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_06570 4176 3355 gene locus_tag LOCUS_06580 gene pstA 4176 3355 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_06580 5018 4173 gene locus_tag LOCUS_06590 gene pstC 5018 4173 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_06590 5850 5020 gene locus_tag LOCUS_06600 5850 5020 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_06600 6010 7320 gene locus_tag LOCUS_06610 6010 7320 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_06610 7304 8488 gene locus_tag LOCUS_06620 7304 8488 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_06620 9168 8494 gene locus_tag LOCUS_06630 9168 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10385 9276 gene locus_tag LOCUS_06640 10385 9276 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851763.1 protein_id gnl|my_center|LOCUS_06640 10714 11070 gene locus_tag LOCUS_06650 10714 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 11067 11651 gene locus_tag LOCUS_06660 11067 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 11655 11924 gene locus_tag LOCUS_06670 11655 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 11921 12283 gene locus_tag LOCUS_06680 11921 12283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 12270 12554 gene locus_tag LOCUS_06690 12270 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 12558 14666 gene locus_tag LOCUS_06700 12558 14666 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390606.1 protein_id gnl|my_center|LOCUS_06700 14666 14785 gene locus_tag LOCUS_06710 14666 14785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 14763 14975 gene locus_tag LOCUS_06720 14763 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 16566 15223 gene locus_tag LOCUS_06730 16566 15223 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852014.1 protein_id gnl|my_center|LOCUS_06730 18039 16633 gene locus_tag LOCUS_06740 gene aspA 18039 16633 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_06740 19296 18301 gene locus_tag LOCUS_06750 19296 18301 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_06750 19749 19315 gene locus_tag LOCUS_06760 19749 19315 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_06760 19972 19751 gene locus_tag LOCUS_06770 19972 19751 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_06770 21208 19982 gene locus_tag LOCUS_06780 21208 19982 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_06780 21362 22627 gene locus_tag LOCUS_06790 gene leuC 21362 22627 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_06790 22627 23166 gene locus_tag LOCUS_06800 22627 23166 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_06800 24003 23242 gene locus_tag LOCUS_06810 24003 23242 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 protein_id gnl|my_center|LOCUS_06810 24266 24000 gene locus_tag LOCUS_06820 gene fliQ 24266 24000 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_06820 25132 24266 gene locus_tag LOCUS_06830 25132 24266 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857964.1 protein_id gnl|my_center|LOCUS_06830 25939 25181 gene locus_tag LOCUS_06840 gene dapF 25939 25181 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_06840 26166 27356 gene locus_tag LOCUS_06850 26166 27356 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858709.1 protein_id gnl|my_center|LOCUS_06850 27370 28365 gene locus_tag LOCUS_06860 27370 28365 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002840050.1 protein_id gnl|my_center|LOCUS_06860 28362 28745 gene locus_tag LOCUS_06870 28362 28745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 28847 29410 gene locus_tag LOCUS_06880 28847 29410 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853178.1 protein_id gnl|my_center|LOCUS_06880 29864 29484 gene locus_tag LOCUS_06890 29864 29484 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298733.1 protein_id gnl|my_center|LOCUS_06890 30395 29880 gene locus_tag LOCUS_06900 gene infC 30395 29880 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_06900 32206 30392 gene locus_tag LOCUS_06910 gene thrS 32206 30392 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_06910 32363 33667 gene locus_tag LOCUS_06920 32363 33667 CDS product Na+/H+ antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864082.1 protein_id gnl|my_center|LOCUS_06920 34656 33694 gene locus_tag LOCUS_06930 34656 33694 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_06930 35415 34690 gene locus_tag LOCUS_06940 35415 34690 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868269.1 protein_id gnl|my_center|LOCUS_06940 36715 35444 gene locus_tag LOCUS_06950 36715 35444 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_06950 37889 36795 gene locus_tag LOCUS_06960 37889 36795 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855678.1 protein_id gnl|my_center|LOCUS_06960 38784 37942 gene locus_tag LOCUS_06970 38784 37942 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_06970 40861 38777 gene locus_tag LOCUS_06980 gene topA 40861 38777 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851268.1 protein_id gnl|my_center|LOCUS_06980 42353 40944 gene locus_tag LOCUS_06990 42353 40944 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_06990 43828 42350 gene locus_tag LOCUS_07000 43828 42350 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159928.1 protein_id gnl|my_center|LOCUS_07000 45630 43825 gene locus_tag LOCUS_07010 gene nuoL 45630 43825 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_07010 45928 45620 gene locus_tag LOCUS_07020 gene nuoK 45928 45620 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964311.1 protein_id gnl|my_center|LOCUS_07020 46418 45921 gene locus_tag LOCUS_07030 46418 45921 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_07030 46912 46415 gene locus_tag LOCUS_07040 46912 46415 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_07040 48179 46902 gene locus_tag LOCUS_07050 48179 46902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 49555 48176 gene locus_tag LOCUS_07060 49555 48176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 50773 49559 gene locus_tag LOCUS_07070 gene nuoF 50773 49559 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337550.1 protein_id gnl|my_center|LOCUS_07070 51251 50760 gene locus_tag LOCUS_07080 51251 50760 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_07080 52930 51248 gene locus_tag LOCUS_07090 52930 51248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 53429 52923 gene locus_tag LOCUS_07100 53429 52923 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_07100 53782 53420 gene locus_tag LOCUS_07110 gene ndhC 53782 53420 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964322.1 protein_id gnl|my_center|LOCUS_07110 54280 56571 gene locus_tag LOCUS_07120 54280 56571 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853255.1 protein_id gnl|my_center|LOCUS_07120 56581 56781 gene locus_tag LOCUS_07130 gene kcuS 56581 56781 CDS product KCU-star family selenoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867452.1 protein_id gnl|my_center|LOCUS_07130 57907 56837 gene locus_tag LOCUS_07140 57907 56837 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_07140 59439 57904 gene locus_tag LOCUS_07150 59439 57904 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 protein_id gnl|my_center|LOCUS_07150 60062 59448 gene locus_tag LOCUS_07160 gene coaE 60062 59448 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_07160 60417 60055 gene locus_tag LOCUS_07170 60417 60055 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852401.1 protein_id gnl|my_center|LOCUS_07170 60514 63324 gene locus_tag LOCUS_07180 60514 63324 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851210.1 protein_id gnl|my_center|LOCUS_07180 63367 64350 gene locus_tag LOCUS_07190 gene purM 63367 64350 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_07190 65035 64400 gene locus_tag LOCUS_07200 65035 64400 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851780.1 protein_id gnl|my_center|LOCUS_07200 65693 65028 gene locus_tag LOCUS_07210 65693 65028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 66702 65680 gene locus_tag LOCUS_07220 66702 65680 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851758.1 protein_id gnl|my_center|LOCUS_07220 68127 66763 gene locus_tag LOCUS_07230 68127 66763 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886939.1 protein_id gnl|my_center|LOCUS_07230 68227 68502 gene locus_tag LOCUS_07240 68227 68502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 69592 68810 gene locus_tag LOCUS_07250 69592 68810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 70110 69613 gene locus_tag LOCUS_07260 70110 69613 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_07260 71297 70119 gene locus_tag LOCUS_07270 71297 70119 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851486.1 protein_id gnl|my_center|LOCUS_07270 72147 71275 gene locus_tag LOCUS_07280 72147 71275 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_07280 73259 72144 gene locus_tag LOCUS_07290 73259 72144 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_07290 73647 75008 gene locus_tag LOCUS_07300 gene thiC 73647 75008 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_07300 75103 75975 gene locus_tag LOCUS_07310 75103 75975 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659065.1 protein_id gnl|my_center|LOCUS_07310 76542 75967 gene locus_tag LOCUS_07320 76542 75967 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891890.1 protein_id gnl|my_center|LOCUS_07320 78284 76539 gene locus_tag LOCUS_07330 78284 76539 CDS product bifunctional anthranilate synthase component I family protein/aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864843.1 protein_id gnl|my_center|LOCUS_07330 78371 79441 gene locus_tag LOCUS_07340 78371 79441 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_07340 79466 79840 gene locus_tag LOCUS_07350 gene ctb 79466 79840 CDS product truncated hemoglobin Ctb inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858471.1 protein_id gnl|my_center|LOCUS_07350 80419 79886 gene locus_tag LOCUS_07360 80419 79886 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918892.1 protein_id gnl|my_center|LOCUS_07360 80859 80416 gene locus_tag LOCUS_07370 80859 80416 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100664.1 protein_id gnl|my_center|LOCUS_07370 81586 80897 gene locus_tag LOCUS_07380 81586 80897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07380 81846 81601 gene locus_tag LOCUS_07390 81846 81601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 82612 81848 gene locus_tag LOCUS_07400 82612 81848 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_07400 83639 82629 gene locus_tag LOCUS_07410 83639 82629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 84718 83621 gene locus_tag LOCUS_07420 gene dcm 84718 83621 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219492.1 protein_id gnl|my_center|LOCUS_07420 85684 84731 gene locus_tag LOCUS_07430 85684 84731 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 protein_id gnl|my_center|LOCUS_07430 87657 85696 gene locus_tag LOCUS_07440 87657 85696 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_07440 88429 87626 gene locus_tag LOCUS_07450 gene rsmA 88429 87626 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_07450 88492 89253 gene locus_tag LOCUS_07460 gene hisF 88492 89253 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550994.1 protein_id gnl|my_center|LOCUS_07460 89250 89810 gene locus_tag LOCUS_07470 89250 89810 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_07470 89807 90883 gene locus_tag LOCUS_07480 gene rlmN 89807 90883 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_07480 91340 90990 gene locus_tag LOCUS_07490 91340 90990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 91472 92872 gene locus_tag LOCUS_07500 91472 92872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 93894 92929 gene locus_tag LOCUS_07510 93894 92929 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_07510 93977 95308 gene locus_tag LOCUS_07520 gene purB 93977 95308 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_07520 95324 97702 gene locus_tag LOCUS_07530 95324 97702 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_07530 97768 99228 gene locus_tag LOCUS_07540 97768 99228 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083410.1 protein_id gnl|my_center|LOCUS_07540 99695 99225 gene locus_tag LOCUS_07550 gene ruvC 99695 99225 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_07550 99824 101134 gene locus_tag LOCUS_07560 gene dnaA 99824 101134 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_07560 101269 102339 gene locus_tag LOCUS_07570 gene dnaN 101269 102339 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_07570 102348 104690 gene locus_tag LOCUS_07580 gene gyrB 102348 104690 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_07580 104699 105142 gene locus_tag LOCUS_07590 gene queF 104699 105142 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_07590 105142 106392 gene locus_tag LOCUS_07600 105142 106392 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_07600 106504 106932 gene locus_tag LOCUS_07610 106504 106932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 108630 106960 gene locus_tag LOCUS_07620 gene fhaC 108630 106960 CDS product filamentous hemagglutinin transporter protein FhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063871.1 protein_id gnl|my_center|LOCUS_07620 115211 108654 gene locus_tag LOCUS_07630 115211 108654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 116413 115349 gene locus_tag LOCUS_07640 116413 115349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 116979 116410 gene locus_tag LOCUS_07650 116979 116410 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_07650 117943 116972 gene locus_tag LOCUS_07660 117943 116972 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023287.1 protein_id gnl|my_center|LOCUS_07660 118696 117986 gene locus_tag LOCUS_07670 gene cgpA 118696 117986 CDS product glycoprotein CgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851387.1 protein_id gnl|my_center|LOCUS_07670 118972 118703 gene locus_tag LOCUS_07680 118972 118703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 120219 118969 gene locus_tag LOCUS_07690 gene eno 120219 118969 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851519.1 protein_id gnl|my_center|LOCUS_07690 121256 120219 gene locus_tag LOCUS_07700 gene recA 121256 120219 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_07700 123089 121503 gene locus_tag LOCUS_07710 123089 121503 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010001.1 protein_id gnl|my_center|LOCUS_07710 123385 123525 gene locus_tag LOCUS_07720 123385 123525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 124370 123555 gene locus_tag LOCUS_07730 124370 123555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 125341 124499 gene locus_tag LOCUS_07740 gene nfo 125341 124499 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 protein_id gnl|my_center|LOCUS_07740 125823 125338 gene locus_tag LOCUS_07750 125823 125338 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858715.1 protein_id gnl|my_center|LOCUS_07750 125937 126011 gene locus_tag LOCUS_t00120 125937 126011 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 126185 128251 gene locus_tag LOCUS_07760 126185 128251 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611900.1 protein_id gnl|my_center|LOCUS_07760 128248 129804 gene locus_tag LOCUS_07770 128248 129804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 131079 129811 gene locus_tag LOCUS_07780 131079 129811 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_07780 131820 131080 gene locus_tag LOCUS_07790 131820 131080 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858388.1 protein_id gnl|my_center|LOCUS_07790 132635 131817 gene locus_tag LOCUS_07800 132635 131817 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154906.1 protein_id gnl|my_center|LOCUS_07800 134000 132645 gene locus_tag LOCUS_07810 gene hemN 134000 132645 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_07810 134428 134003 gene locus_tag LOCUS_07820 134428 134003 CDS product DUF2603 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853412.1 protein_id gnl|my_center|LOCUS_07820 135350 134421 gene locus_tag LOCUS_07830 gene argF 135350 134421 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_07830 136333 135353 gene locus_tag LOCUS_07840 gene hemB 136333 135353 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_07840 136450 137010 gene locus_tag LOCUS_07850 gene ribA 136450 137010 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_07850 137007 137546 gene locus_tag LOCUS_07860 gene rsmG 137007 137546 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853035.1 protein_id gnl|my_center|LOCUS_07860 137543 137737 gene locus_tag LOCUS_07870 137543 137737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 137734 138045 gene locus_tag LOCUS_07880 137734 138045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 138047 138928 gene locus_tag LOCUS_07890 gene htpX 138047 138928 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_07890 138928 139557 gene locus_tag LOCUS_07900 138928 139557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 140954 139560 gene locus_tag LOCUS_07910 140954 139560 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865516.1 protein_id gnl|my_center|LOCUS_07910 141092 142057 gene locus_tag LOCUS_07920 141092 142057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 142123 142314 gene locus_tag LOCUS_07930 gene rpmI 142123 142314 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851822.1 protein_id gnl|my_center|LOCUS_07930 142399 142752 gene locus_tag LOCUS_07940 gene rplT 142399 142752 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_07940 142784 143461 gene locus_tag LOCUS_07950 gene ung 142784 143461 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851931.1 protein_id gnl|my_center|LOCUS_07950 143574 144224 gene locus_tag LOCUS_07960 gene sodB 143574 144224 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494629.1 protein_id gnl|my_center|LOCUS_07960 144363 144932 gene locus_tag LOCUS_07970 144363 144932 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851702.1 protein_id gnl|my_center|LOCUS_07970 144929 147442 gene locus_tag LOCUS_07980 144929 147442 CDS product molybdopterin guanine dinucleotide-containing S/N-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891848.1 protein_id gnl|my_center|LOCUS_07980 147576 148184 gene locus_tag LOCUS_07990 147576 148184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 148494 148805 gene locus_tag LOCUS_08000 gene rpsJ 148494 148805 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_08000 148824 149402 gene locus_tag LOCUS_08010 gene rplC 148824 149402 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_08010 149399 150013 gene locus_tag LOCUS_08020 gene rplD 149399 150013 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_08020 150016 150297 gene locus_tag LOCUS_08030 150016 150297 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_08030 150299 151129 gene locus_tag LOCUS_08040 gene rplB 150299 151129 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_08040 151132 151413 gene locus_tag LOCUS_08050 gene rpsS 151132 151413 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_08050 151423 151761 gene locus_tag LOCUS_08060 gene rplV 151423 151761 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851214.1 protein_id gnl|my_center|LOCUS_08060 151763 152461 gene locus_tag LOCUS_08070 gene rpsC 151763 152461 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_08070 152461 152886 gene locus_tag LOCUS_08080 gene rplP 152461 152886 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_08080 152873 153058 gene locus_tag LOCUS_08090 gene rpmC 152873 153058 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_08090 153069 153326 gene locus_tag LOCUS_08100 gene rpsQ 153069 153326 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_08100 153326 153694 gene locus_tag LOCUS_08110 gene rplN 153326 153694 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_08110 153694 153927 gene locus_tag LOCUS_08120 153694 153927 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779437.1 protein_id gnl|my_center|LOCUS_08120 153930 154472 gene locus_tag LOCUS_08130 gene rplE 153930 154472 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_08130 154474 154659 gene locus_tag LOCUS_08140 154474 154659 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_08140 154670 155065 gene locus_tag LOCUS_08150 gene rpsH 154670 155065 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_08150 155178 155714 gene locus_tag LOCUS_08160 gene rplF 155178 155714 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_08160 155724 156080 gene locus_tag LOCUS_08170 gene rplR 155724 156080 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851411.1 protein_id gnl|my_center|LOCUS_08170 156095 156538 gene locus_tag LOCUS_08180 gene rpsE 156095 156538 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779428.1 protein_id gnl|my_center|LOCUS_08180 156548 156949 gene locus_tag LOCUS_08190 gene rplO 156548 156949 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_08190 157021 158211 gene locus_tag LOCUS_08200 gene secY 157021 158211 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_08200 158213 158974 gene locus_tag LOCUS_08210 gene map 158213 158974 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018129.1 protein_id gnl|my_center|LOCUS_08210 159014 159232 gene locus_tag LOCUS_08220 gene infA 159014 159232 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_08220 159236 159853 gene locus_tag LOCUS_08230 159236 159853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 159916 161241 gene locus_tag LOCUS_08240 gene hcp 159916 161241 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098308124.1 protein_id gnl|my_center|LOCUS_08240 161596 161964 gene locus_tag LOCUS_08250 gene rpsM 161596 161964 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_08250 161974 162366 gene locus_tag LOCUS_08260 gene rpsK 161974 162366 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_08260 162394 163020 gene locus_tag LOCUS_08270 gene rpsD 162394 163020 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_08270 163034 164032 gene locus_tag LOCUS_08280 163034 164032 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851403.1 protein_id gnl|my_center|LOCUS_08280 164049 164405 gene locus_tag LOCUS_08290 gene rplQ 164049 164405 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_08290 165062 166591 gene locus_tag LOCUS_08300 165062 166591 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_08300 166713 169079 gene locus_tag LOCUS_08310 166713 169079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 169162 169437 gene locus_tag LOCUS_08320 169162 169437 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_08320 169675 170220 gene locus_tag LOCUS_08330 169675 170220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 170201 171481 gene locus_tag LOCUS_08340 170201 171481 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_08340 171481 171828 gene locus_tag LOCUS_08350 gene panD 171481 171828 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_08350 171886 172194 gene locus_tag LOCUS_08360 171886 172194 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_08360 172191 173252 gene locus_tag LOCUS_08370 172191 173252 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851505.1 protein_id gnl|my_center|LOCUS_08370 173249 174076 gene locus_tag LOCUS_08380 173249 174076 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_08380 174079 175983 gene locus_tag LOCUS_08390 gene tkt 174079 175983 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_08390 176274 176008 gene locus_tag LOCUS_08400 176274 176008 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852023.1 protein_id gnl|my_center|LOCUS_08400 176743 176267 gene locus_tag LOCUS_08410 gene moaC 176743 176267 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131513.1 protein_id gnl|my_center|LOCUS_08410 176941 177028 gene locus_tag LOCUS_t00130 176941 177028 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 177323 177111 gene locus_tag LOCUS_08420 gene rpsU 177323 177111 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_08420 177477 178853 gene locus_tag LOCUS_08430 gene ccoG 177477 178853 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_08430 178998 180071 gene locus_tag LOCUS_08440 gene cmeA 178998 180071 CDS product multidrug efflux RND transporter periplasmic adaptor subunit CmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858646.1 protein_id gnl|my_center|LOCUS_08440 180072 183212 gene locus_tag LOCUS_08450 gene cmeB 180072 183212 CDS product multidrug efflux RND transporter permease subunit CmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872052.1 protein_id gnl|my_center|LOCUS_08450 183205 184608 gene locus_tag LOCUS_08460 gene cmeC 183205 184608 CDS product multidrug efflux transporter outer membrane subunit CmeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858696.1 protein_id gnl|my_center|LOCUS_08460 184673 186001 gene locus_tag LOCUS_08470 184673 186001 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851723.1 protein_id gnl|my_center|LOCUS_08470 186218 187360 gene locus_tag LOCUS_08480 186218 187360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 187805 187329 gene locus_tag LOCUS_08490 gene cheQ 187805 187329 CDS product cheVAW transcriptional regulator CheQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851877.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence05 1 76 gene locus_tag LOCUS_t00140 1 76 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 98 174 gene locus_tag LOCUS_t00150 98 174 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1193 834 gene locus_tag LOCUS_08500 1193 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1499 1206 gene locus_tag LOCUS_08510 1499 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1763 1506 gene locus_tag LOCUS_08520 1763 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2216 1785 gene locus_tag LOCUS_08530 2216 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 2379 2588 gene locus_tag LOCUS_08540 2379 2588 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858725.1 protein_id gnl|my_center|LOCUS_08540 4047 2656 gene locus_tag LOCUS_08550 gene argH 4047 2656 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_08550 5691 4114 gene locus_tag LOCUS_08560 gene pckA 5691 4114 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_08560 7634 5829 gene locus_tag LOCUS_08570 7634 5829 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_08570 9021 7648 gene locus_tag LOCUS_08580 9021 7648 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858451.1 protein_id gnl|my_center|LOCUS_08580 9197 9493 gene locus_tag LOCUS_08590 9197 9493 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_08590 10161 11975 gene locus_tag LOCUS_08600 gene ciaB 10161 11975 CDS product invasion protein CiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858322.1 protein_id gnl|my_center|LOCUS_08600 12076 12378 gene locus_tag LOCUS_08610 12076 12378 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_08610 12421 12506 gene locus_tag LOCUS_t00160 12421 12506 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12956 12633 gene locus_tag LOCUS_08620 12956 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 13297 15333 gene locus_tag LOCUS_08630 13297 15333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 15406 16320 gene locus_tag LOCUS_08640 gene hemH 15406 16320 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858523.1 protein_id gnl|my_center|LOCUS_08640 17409 16321 gene locus_tag LOCUS_08650 17409 16321 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853490.1 protein_id gnl|my_center|LOCUS_08650 18042 17419 gene locus_tag LOCUS_08660 18042 17419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 19239 18139 gene locus_tag LOCUS_08670 19239 18139 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_08670 19683 19453 gene locus_tag LOCUS_08680 19683 19453 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855201.1 protein_id gnl|my_center|LOCUS_08680 20933 19746 gene locus_tag LOCUS_08690 gene argJ 20933 19746 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_08690 22056 20926 gene locus_tag LOCUS_08700 22056 20926 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_08700 22266 22075 gene locus_tag LOCUS_08710 gene rpmB 22266 22075 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_08710 23119 22346 gene locus_tag LOCUS_08720 23119 22346 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852410.1 protein_id gnl|my_center|LOCUS_08720 23197 23976 gene locus_tag LOCUS_08730 gene thiD 23197 23976 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_08730 24264 24040 gene locus_tag LOCUS_08740 24264 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 24959 24318 gene locus_tag LOCUS_08750 24959 24318 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356305.1 protein_id gnl|my_center|LOCUS_08750 25924 24956 gene locus_tag LOCUS_08760 25924 24956 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852619.1 protein_id gnl|my_center|LOCUS_08760 26525 25992 gene locus_tag LOCUS_08770 26525 25992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 27865 26522 gene locus_tag LOCUS_08780 27865 26522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979161.1 protein_id gnl|my_center|LOCUS_08780 30498 27877 gene locus_tag LOCUS_08790 30498 27877 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_08790 30634 32031 gene locus_tag LOCUS_08800 gene fumC 30634 32031 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857888.1 protein_id gnl|my_center|LOCUS_08800 32535 33686 gene locus_tag LOCUS_08810 32535 33686 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853195.1 protein_id gnl|my_center|LOCUS_08810 33690 35411 gene locus_tag LOCUS_08820 33690 35411 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853190.1 protein_id gnl|my_center|LOCUS_08820 35422 36099 gene locus_tag LOCUS_08830 gene cybH 35422 36099 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853164.1 protein_id gnl|my_center|LOCUS_08830 36100 36639 gene locus_tag LOCUS_08840 36100 36639 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859319.1 protein_id gnl|my_center|LOCUS_08840 36636 38075 gene locus_tag LOCUS_08850 36636 38075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826526.1 protein_id gnl|my_center|LOCUS_08850 38062 40284 gene locus_tag LOCUS_08860 gene hypF 38062 40284 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826528.1 protein_id gnl|my_center|LOCUS_08860 40322 41077 gene locus_tag LOCUS_08870 gene hypB 40322 41077 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776330.1 protein_id gnl|my_center|LOCUS_08870 41077 41358 gene locus_tag LOCUS_08880 41077 41358 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_08880 41364 42452 gene locus_tag LOCUS_08890 gene hypD 41364 42452 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776343.1 protein_id gnl|my_center|LOCUS_08890 42453 43442 gene locus_tag LOCUS_08900 gene hypE 42453 43442 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776344.1 protein_id gnl|my_center|LOCUS_08900 43454 43795 gene locus_tag LOCUS_08910 gene hypA 43454 43795 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864538.1 protein_id gnl|my_center|LOCUS_08910 44823 43798 gene locus_tag LOCUS_08920 44823 43798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 45845 44823 gene locus_tag LOCUS_08930 gene queA 45845 44823 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_08930 46590 45832 gene locus_tag LOCUS_08940 gene tatC 46590 45832 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852171.1 protein_id gnl|my_center|LOCUS_08940 47138 46590 gene locus_tag LOCUS_08950 47138 46590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 47519 47247 gene locus_tag LOCUS_08960 gene rpsO 47519 47247 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_08960 47714 50467 gene locus_tag LOCUS_08970 gene ileS 47714 50467 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_08970 50564 51925 gene locus_tag LOCUS_08980 gene gatA 50564 51925 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 protein_id gnl|my_center|LOCUS_08980 51927 53378 gene locus_tag LOCUS_08990 gene guaB 51927 53378 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_08990 53378 54481 gene locus_tag LOCUS_09000 53378 54481 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_09000 54474 54662 gene locus_tag LOCUS_09010 54474 54662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 54655 55455 gene locus_tag LOCUS_09020 54655 55455 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_09020 55452 56750 gene locus_tag LOCUS_09030 gene murC 55452 56750 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891904.1 protein_id gnl|my_center|LOCUS_09030 56747 57079 gene locus_tag LOCUS_09040 56747 57079 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869116.1 protein_id gnl|my_center|LOCUS_09040 57079 58095 gene locus_tag LOCUS_09050 gene namA 57079 58095 CDS product NADPH dehydrogenase NamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086174.1 protein_id gnl|my_center|LOCUS_09050 58164 58652 gene locus_tag LOCUS_09060 58164 58652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09060 58645 60102 gene locus_tag LOCUS_09070 58645 60102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09070 60095 62674 gene locus_tag LOCUS_09080 60095 62674 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_09080 62785 62976 gene locus_tag LOCUS_09090 62785 62976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 63818 63099 gene locus_tag LOCUS_09100 63818 63099 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854302.1 protein_id gnl|my_center|LOCUS_09100 65799 63811 gene locus_tag LOCUS_09110 65799 63811 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_09110 66535 65810 gene locus_tag LOCUS_09120 66535 65810 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_09120 66796 68877 gene locus_tag LOCUS_09130 gene cfrA 66796 68877 CDS product TonB-dependent ferric enterobactin receptor CfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891883.1 protein_id gnl|my_center|LOCUS_09130 69307 68900 gene locus_tag LOCUS_09140 gene ybeY 69307 68900 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_09140 69887 69369 gene locus_tag LOCUS_09150 gene ppa 69887 69369 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858521.1 protein_id gnl|my_center|LOCUS_09150 70465 69890 gene locus_tag LOCUS_09160 70465 69890 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_09160 72216 70465 gene locus_tag LOCUS_09170 gene aspS 72216 70465 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_09170 72376 73233 gene locus_tag LOCUS_09180 72376 73233 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_09180 73218 74750 gene locus_tag LOCUS_09190 73218 74750 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_09190 74811 76040 gene locus_tag LOCUS_09200 gene cbrR 74811 76040 CDS product bile resistance response regulator CbrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858608.1 protein_id gnl|my_center|LOCUS_09200 76031 76792 gene locus_tag LOCUS_09210 76031 76792 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858473.1 protein_id gnl|my_center|LOCUS_09210 76801 77997 gene locus_tag LOCUS_09220 76801 77997 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852087.1 protein_id gnl|my_center|LOCUS_09220 77981 78751 gene locus_tag LOCUS_09230 77981 78751 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_09230 78760 79332 gene locus_tag LOCUS_09240 gene hisB 78760 79332 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_09240 79329 79817 gene locus_tag LOCUS_09250 79329 79817 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_09250 79859 80323 gene locus_tag LOCUS_09260 79859 80323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 80308 80781 gene locus_tag LOCUS_09270 80308 80781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 80778 81374 gene locus_tag LOCUS_09280 gene yihA 80778 81374 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_09280 81371 81829 gene locus_tag LOCUS_09290 81371 81829 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583314.1 protein_id gnl|my_center|LOCUS_09290 81796 82284 gene locus_tag LOCUS_09300 81796 82284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852364.1 protein_id gnl|my_center|LOCUS_09300 82281 84086 gene locus_tag LOCUS_09310 gene mrdA 82281 84086 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_09310 84102 85613 gene locus_tag LOCUS_09320 gene putP 84102 85613 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687602.1 protein_id gnl|my_center|LOCUS_09320 85695 85771 gene locus_tag LOCUS_t00170 85695 85771 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 85962 87245 gene locus_tag LOCUS_09330 85962 87245 CDS product integrase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107728.1 protein_id gnl|my_center|LOCUS_09330 87855 88445 gene locus_tag LOCUS_09340 87855 88445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 88523 88723 gene locus_tag LOCUS_09350 88523 88723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 88839 89864 gene locus_tag LOCUS_09360 88839 89864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 90025 90378 gene locus_tag LOCUS_09370 90025 90378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 90567 90785 gene locus_tag LOCUS_09380 90567 90785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 90785 93592 gene locus_tag LOCUS_09390 90785 93592 CDS product VirB3 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096399.1 protein_id gnl|my_center|LOCUS_09390 93593 94336 gene locus_tag LOCUS_09400 93593 94336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 94340 95371 gene locus_tag LOCUS_09410 94340 95371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 95382 95615 gene locus_tag LOCUS_09420 95382 95615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 95605 96345 gene locus_tag LOCUS_09430 95605 96345 CDS product type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065208821.1 protein_id gnl|my_center|LOCUS_09430 96342 97286 gene locus_tag LOCUS_09440 gene virB9 96342 97286 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976329.1 protein_id gnl|my_center|LOCUS_09440 97273 98508 gene locus_tag LOCUS_09450 gene virB10 97273 98508 CDS product type IV secretion system protein VirB10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264002.1 protein_id gnl|my_center|LOCUS_09450 98505 99503 gene locus_tag LOCUS_09460 gene virB11 98505 99503 CDS product P-type DNA transfer ATPase VirB11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264003.1 protein_id gnl|my_center|LOCUS_09460 99507 99767 gene locus_tag LOCUS_09470 99507 99767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 99767 100192 gene locus_tag LOCUS_09480 99767 100192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 100195 100407 gene locus_tag LOCUS_09490 100195 100407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 100397 101614 gene locus_tag LOCUS_09500 100397 101614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 101714 102523 gene locus_tag LOCUS_09510 101714 102523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 102526 104568 gene locus_tag LOCUS_09520 102526 104568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence06 1593 64 gene locus_tag LOCUS_09530 1593 64 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188420.1 protein_id gnl|my_center|LOCUS_09530 3720 1693 gene locus_tag LOCUS_09540 3720 1693 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_09540 4691 3720 gene locus_tag LOCUS_09550 gene mltG 4691 3720 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 protein_id gnl|my_center|LOCUS_09550 4621 7149 gene locus_tag LOCUS_09560 4621 7149 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858480.1 protein_id gnl|my_center|LOCUS_09560 7197 9044 gene locus_tag LOCUS_09570 gene htpG 7197 9044 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858566.1 protein_id gnl|my_center|LOCUS_09570 9235 10881 gene locus_tag LOCUS_09580 9235 10881 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851907.1 protein_id gnl|my_center|LOCUS_09580 10887 11624 gene locus_tag LOCUS_09590 10887 11624 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851599.1 protein_id gnl|my_center|LOCUS_09590 11621 13054 gene locus_tag LOCUS_09600 11621 13054 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851925.1 protein_id gnl|my_center|LOCUS_09600 13047 13706 gene locus_tag LOCUS_09610 13047 13706 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851721.1 protein_id gnl|my_center|LOCUS_09610 14873 13740 gene locus_tag LOCUS_09620 gene dccS 14873 13740 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_09620 15534 14866 gene locus_tag LOCUS_09630 gene dccR 15534 14866 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09630 15948 15538 gene locus_tag LOCUS_09640 15948 15538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 16818 16012 gene locus_tag LOCUS_09650 16818 16012 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857898.1 protein_id gnl|my_center|LOCUS_09650 17031 16822 gene locus_tag LOCUS_09660 17031 16822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 17150 17512 gene locus_tag LOCUS_09670 17150 17512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 19603 17579 gene locus_tag LOCUS_09680 gene glyS 19603 17579 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_09680 19778 19587 gene locus_tag LOCUS_09690 19778 19587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 21063 19771 gene locus_tag LOCUS_09700 21063 19771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 21539 21051 gene locus_tag LOCUS_09710 21539 21051 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_09710 22370 21540 gene locus_tag LOCUS_09720 gene purU 22370 21540 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852510.1 protein_id gnl|my_center|LOCUS_09720 23330 22464 gene locus_tag LOCUS_09730 23330 22464 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891872.1 protein_id gnl|my_center|LOCUS_09730 23698 23327 gene locus_tag LOCUS_09740 gene ruvX 23698 23327 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_09740 24459 23695 gene locus_tag LOCUS_09750 24459 23695 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874287.1 protein_id gnl|my_center|LOCUS_09750 25438 24443 gene locus_tag LOCUS_09760 25438 24443 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873647.1 protein_id gnl|my_center|LOCUS_09760 26503 25481 gene locus_tag LOCUS_09770 gene ilvC 26503 25481 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_09770 26642 27454 gene locus_tag LOCUS_09780 gene cheP 26642 27454 CDS product cheVAW transcriptional regulator CheP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851703.1 protein_id gnl|my_center|LOCUS_09780 27451 29373 gene locus_tag LOCUS_09790 27451 29373 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_09790 29366 30358 gene locus_tag LOCUS_09800 29366 30358 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891870.1 protein_id gnl|my_center|LOCUS_09800 30447 30833 gene locus_tag LOCUS_09810 gene rpsF 30447 30833 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_09810 30851 31471 gene locus_tag LOCUS_09820 30851 31471 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 protein_id gnl|my_center|LOCUS_09820 31482 31742 gene locus_tag LOCUS_09830 gene rpsR 31482 31742 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_09830 32150 31884 gene locus_tag LOCUS_09840 32150 31884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09840 32354 32184 gene locus_tag LOCUS_09850 32354 32184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 33586 32480 gene locus_tag LOCUS_09860 gene dnaJ 33586 32480 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_09860 33712 34383 gene locus_tag LOCUS_09870 33712 34383 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853168.1 protein_id gnl|my_center|LOCUS_09870 34380 35630 gene locus_tag LOCUS_09880 34380 35630 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857920.1 protein_id gnl|my_center|LOCUS_09880 35617 36180 gene locus_tag LOCUS_09890 gene recR 35617 36180 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_09890 36959 36177 gene locus_tag LOCUS_09900 36959 36177 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_09900 37781 36969 gene locus_tag LOCUS_09910 37781 36969 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864776.1 protein_id gnl|my_center|LOCUS_09910 38334 37792 gene locus_tag LOCUS_09920 38334 37792 CDS product DUF1882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859481.1 protein_id gnl|my_center|LOCUS_09920 39578 38334 gene locus_tag LOCUS_09930 39578 38334 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_09930 41078 39588 gene locus_tag LOCUS_09940 gene lysS 41078 39588 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_09940 41546 41079 gene locus_tag LOCUS_09950 41546 41079 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_09950 42127 41543 gene locus_tag LOCUS_09960 42127 41543 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_09960 43179 42127 gene locus_tag LOCUS_09970 43179 42127 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417568.1 protein_id gnl|my_center|LOCUS_09970 43470 43183 gene locus_tag LOCUS_09980 gene gatC 43470 43183 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 protein_id gnl|my_center|LOCUS_09980 43632 44189 gene locus_tag LOCUS_09990 43632 44189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851102.1 protein_id gnl|my_center|LOCUS_09990 44191 45192 gene locus_tag LOCUS_10000 44191 45192 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858656.1 protein_id gnl|my_center|LOCUS_10000 45192 45518 gene locus_tag LOCUS_10010 45192 45518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 45505 46131 gene locus_tag LOCUS_10020 45505 46131 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_10020 46125 46739 gene locus_tag LOCUS_10030 gene hisG 46125 46739 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_10030 46769 47872 gene locus_tag LOCUS_10040 46769 47872 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871823.1 protein_id gnl|my_center|LOCUS_10040 47874 48665 gene locus_tag LOCUS_10050 47874 48665 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852452.1 protein_id gnl|my_center|LOCUS_10050 49469 48690 gene locus_tag LOCUS_10060 49469 48690 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346150.1 protein_id gnl|my_center|LOCUS_10060 49641 50990 gene locus_tag LOCUS_10070 49641 50990 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852215.1 protein_id gnl|my_center|LOCUS_10070 51173 52450 gene locus_tag LOCUS_10080 gene murA 51173 52450 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_10080 52440 53618 gene locus_tag LOCUS_10090 52440 53618 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_10090 53665 53739 gene locus_tag LOCUS_t00180 53665 53739 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53811 54383 gene locus_tag LOCUS_10100 53811 54383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 54393 54872 gene locus_tag LOCUS_10110 gene coaD 54393 54872 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 protein_id gnl|my_center|LOCUS_10110 54862 55440 gene locus_tag LOCUS_10120 gene tmk 54862 55440 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_10120 55437 56666 gene locus_tag LOCUS_10130 gene hisS 55437 56666 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_10130 56663 58504 gene locus_tag LOCUS_10140 gene speA 56663 58504 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_10140 58507 59178 gene locus_tag LOCUS_10150 gene cysE 58507 59178 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 protein_id gnl|my_center|LOCUS_10150 59181 60353 gene locus_tag LOCUS_10160 59181 60353 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852601.1 protein_id gnl|my_center|LOCUS_10160 60445 60900 gene locus_tag LOCUS_10170 gene smpB 60445 60900 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_10170 60912 61523 gene locus_tag LOCUS_10180 60912 61523 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852711.1 protein_id gnl|my_center|LOCUS_10180 61513 61812 gene locus_tag LOCUS_10190 61513 61812 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852892.1 protein_id gnl|my_center|LOCUS_10190 61812 63899 gene locus_tag LOCUS_10200 61812 63899 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852743.1 protein_id gnl|my_center|LOCUS_10200 63903 64565 gene locus_tag LOCUS_10210 gene aat 63903 64565 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852895.1 protein_id gnl|my_center|LOCUS_10210 64608 65048 gene locus_tag LOCUS_10220 gene flgB 64608 65048 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858492.1 protein_id gnl|my_center|LOCUS_10220 65059 65553 gene locus_tag LOCUS_10230 gene flgC 65059 65553 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_10230 65557 65847 gene locus_tag LOCUS_10240 gene fliE 65557 65847 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_10240 65847 67664 gene locus_tag LOCUS_10250 65847 67664 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_10250 67735 68820 gene locus_tag LOCUS_10260 gene mqnE 67735 68820 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_10260 68830 70152 gene locus_tag LOCUS_10270 68830 70152 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856518.1 protein_id gnl|my_center|LOCUS_10270 70157 70600 gene locus_tag LOCUS_10280 70157 70600 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_10280 70601 71746 gene locus_tag LOCUS_10290 70601 71746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726670.1 protein_id gnl|my_center|LOCUS_10290 71802 72914 gene locus_tag LOCUS_10300 71802 72914 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_10300 72902 73564 gene locus_tag LOCUS_10310 72902 73564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891856.1 protein_id gnl|my_center|LOCUS_10310 74982 73561 gene locus_tag LOCUS_10320 74982 73561 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 protein_id gnl|my_center|LOCUS_10320 75701 74979 gene locus_tag LOCUS_10330 75701 74979 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852645.1 protein_id gnl|my_center|LOCUS_10330 75921 75703 gene locus_tag LOCUS_10340 75921 75703 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852622.1 protein_id gnl|my_center|LOCUS_10340 77071 76034 gene locus_tag LOCUS_10350 77071 76034 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852516.1 protein_id gnl|my_center|LOCUS_10350 77632 77081 gene locus_tag LOCUS_10360 gene ruvA 77632 77081 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 protein_id gnl|my_center|LOCUS_10360 79461 77629 gene locus_tag LOCUS_10370 79461 77629 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852626.1 protein_id gnl|my_center|LOCUS_10370 79592 80359 gene locus_tag LOCUS_10380 79592 80359 CDS product replication initiation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476546.1 protein_id gnl|my_center|LOCUS_10380 80965 80369 gene locus_tag LOCUS_10390 80965 80369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 81629 80976 gene locus_tag LOCUS_10400 81629 80976 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587397.1 protein_id gnl|my_center|LOCUS_10400 82105 81740 gene locus_tag LOCUS_10410 82105 81740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 82725 82102 gene locus_tag LOCUS_10420 82725 82102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 83409 82780 gene locus_tag LOCUS_10430 83409 82780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 84004 83741 gene locus_tag LOCUS_10440 84004 83741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 84432 84016 gene locus_tag LOCUS_10450 84432 84016 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182978.1 protein_id gnl|my_center|LOCUS_10450 85600 84449 gene locus_tag LOCUS_10460 85600 84449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10460 86418 85597 gene locus_tag LOCUS_10470 86418 85597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10470 87635 86436 gene locus_tag LOCUS_10480 87635 86436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 87928 87635 gene locus_tag LOCUS_10490 87928 87635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 88853 88017 gene locus_tag LOCUS_10500 88853 88017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 89125 88952 gene locus_tag LOCUS_10510 89125 88952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 89455 89198 gene locus_tag LOCUS_10520 89455 89198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 91395 89452 gene locus_tag LOCUS_10530 91395 89452 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014660111.1 protein_id gnl|my_center|LOCUS_10530 91789 91382 gene locus_tag LOCUS_10540 91789 91382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 92736 91786 gene locus_tag LOCUS_10550 92736 91786 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854872.1 protein_id gnl|my_center|LOCUS_10550 92971 92741 gene locus_tag LOCUS_10560 92971 92741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 94084 92981 gene locus_tag LOCUS_10570 94084 92981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 95247 94081 gene locus_tag LOCUS_10580 95247 94081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 95660 95244 gene locus_tag LOCUS_10590 95660 95244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 95680 95871 gene locus_tag LOCUS_10600 95680 95871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 96030 95905 gene locus_tag LOCUS_10610 96030 95905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 98471 96027 gene locus_tag LOCUS_10620 98471 96027 CDS product VirB4 family type IV secretion/conjugal transfer ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893960.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence07 34 1044 gene locus_tag LOCUS_10630 34 1044 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852576.1 protein_id gnl|my_center|LOCUS_10630 1047 1280 gene locus_tag LOCUS_10640 1047 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1436 1269 gene locus_tag LOCUS_10650 1436 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1681 2469 gene locus_tag LOCUS_10660 1681 2469 CDS product HrcA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891884.1 protein_id gnl|my_center|LOCUS_10660 2466 2990 gene locus_tag LOCUS_10670 gene grpE 2466 2990 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 protein_id gnl|my_center|LOCUS_10670 3012 4883 gene locus_tag LOCUS_10680 gene dnaK 3012 4883 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_10680 5935 4907 gene locus_tag LOCUS_10690 gene hemW 5935 4907 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_10690 6051 6521 gene locus_tag LOCUS_10700 6051 6521 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_10700 6521 7738 gene locus_tag LOCUS_10710 6521 7738 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_10710 7798 8277 gene locus_tag LOCUS_10720 7798 8277 CDS product HobA family DNA replication regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852154.1 protein_id gnl|my_center|LOCUS_10720 8274 8897 gene locus_tag LOCUS_10730 8274 8897 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_10730 8894 10033 gene locus_tag LOCUS_10740 gene folP 8894 10033 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_10740 10030 11976 gene locus_tag LOCUS_10750 gene ligA 10030 11976 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_10750 11966 12667 gene locus_tag LOCUS_10760 11966 12667 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_10760 12639 13529 gene locus_tag LOCUS_10770 12639 13529 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852206.1 protein_id gnl|my_center|LOCUS_10770 13526 14230 gene locus_tag LOCUS_10780 gene cmoA 13526 14230 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_10780 14324 15058 gene locus_tag LOCUS_10790 gene fliP 14324 15058 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_10790 15956 15051 gene locus_tag LOCUS_10800 15956 15051 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853271.1 protein_id gnl|my_center|LOCUS_10800 16561 15953 gene locus_tag LOCUS_10810 16561 15953 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_10810 17252 16569 gene locus_tag LOCUS_10820 17252 16569 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_10820 18390 17236 gene locus_tag LOCUS_10830 18390 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 19049 18384 gene locus_tag LOCUS_10840 gene purQ 19049 18384 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_10840 19282 19052 gene locus_tag LOCUS_10850 gene purS 19282 19052 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858611.1 protein_id gnl|my_center|LOCUS_10850 20015 19302 gene locus_tag LOCUS_10860 20015 19302 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_10860 21303 20026 gene locus_tag LOCUS_10870 21303 20026 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_10870 21470 24043 gene locus_tag LOCUS_10880 21470 24043 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858618.1 protein_id gnl|my_center|LOCUS_10880 24680 24060 gene locus_tag LOCUS_10890 24680 24060 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852054.1 protein_id gnl|my_center|LOCUS_10890 25787 24681 gene locus_tag LOCUS_10900 gene rseP 25787 24681 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_10900 25912 26553 gene locus_tag LOCUS_10910 gene rpe 25912 26553 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858571.1 protein_id gnl|my_center|LOCUS_10910 26568 27365 gene locus_tag LOCUS_10920 26568 27365 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_10920 27367 28017 gene locus_tag LOCUS_10930 27367 28017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 28031 28555 gene locus_tag LOCUS_10940 28031 28555 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853058.1 protein_id gnl|my_center|LOCUS_10940 28552 29340 gene locus_tag LOCUS_10950 28552 29340 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890476.1 protein_id gnl|my_center|LOCUS_10950 29337 29822 gene locus_tag LOCUS_10960 29337 29822 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_10960 29922 32114 gene locus_tag LOCUS_10970 29922 32114 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858520.1 protein_id gnl|my_center|LOCUS_10970 32117 33001 gene locus_tag LOCUS_10980 32117 33001 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858544.1 protein_id gnl|my_center|LOCUS_10980 33210 33515 gene locus_tag LOCUS_10990 33210 33515 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_10990 33525 34646 gene locus_tag LOCUS_11000 33525 34646 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_11000 34649 35494 gene locus_tag LOCUS_11010 34649 35494 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_11010 35491 36045 gene locus_tag LOCUS_11020 35491 36045 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_11020 36168 36653 gene locus_tag LOCUS_11030 gene fldA 36168 36653 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_11030 36678 37301 gene locus_tag LOCUS_11040 36678 37301 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_11040 37305 38459 gene locus_tag LOCUS_11050 37305 38459 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879939.1 protein_id gnl|my_center|LOCUS_11050 38456 39325 gene locus_tag LOCUS_11060 38456 39325 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_11060 39368 39877 gene locus_tag LOCUS_11070 gene fliL 39368 39877 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_11070 39874 40224 gene locus_tag LOCUS_11080 gene acpS 39874 40224 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857939.1 protein_id gnl|my_center|LOCUS_11080 40445 41209 gene locus_tag LOCUS_11090 40445 41209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 41185 41502 gene locus_tag LOCUS_11100 41185 41502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 41489 41662 gene locus_tag LOCUS_11110 41489 41662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 41911 41693 gene locus_tag LOCUS_11120 41911 41693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 42274 42912 gene locus_tag LOCUS_11130 42274 42912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 42909 43112 gene locus_tag LOCUS_11140 42909 43112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 43234 43488 gene locus_tag LOCUS_11150 43234 43488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 43844 45919 gene locus_tag LOCUS_11160 43844 45919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 45916 46287 gene locus_tag LOCUS_11170 45916 46287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 46280 46483 gene locus_tag LOCUS_11180 46280 46483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 46494 46934 gene locus_tag LOCUS_11190 46494 46934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 46936 47907 gene locus_tag LOCUS_11200 46936 47907 CDS product contractile injection system protein, VgrG/Pvc8 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104523.1 protein_id gnl|my_center|LOCUS_11200 48729 47941 gene locus_tag LOCUS_11210 48729 47941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 49134 49373 gene locus_tag LOCUS_11220 49134 49373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 51117 49690 gene locus_tag LOCUS_11230 gene glnA 51117 49690 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_11230 51985 51206 gene locus_tag LOCUS_11240 51985 51206 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_11240 52150 52074 gene locus_tag LOCUS_t00190 52150 52074 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 52307 53029 gene locus_tag LOCUS_11250 52307 53029 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_11250 53026 54294 gene locus_tag LOCUS_11260 53026 54294 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852318.1 protein_id gnl|my_center|LOCUS_11260 54295 54801 gene locus_tag LOCUS_11270 gene purE 54295 54801 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_11270 54798 55286 gene locus_tag LOCUS_11280 54798 55286 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_11280 55283 56137 gene locus_tag LOCUS_11290 gene glyQ 55283 56137 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852069.1 protein_id gnl|my_center|LOCUS_11290 56138 56863 gene locus_tag LOCUS_11300 56138 56863 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_11300 56877 57590 gene locus_tag LOCUS_11310 56877 57590 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_11310 57587 58702 gene locus_tag LOCUS_11320 gene waaA 57587 58702 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_11320 58705 59469 gene locus_tag LOCUS_11330 58705 59469 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852134.1 protein_id gnl|my_center|LOCUS_11330 60688 59570 gene locus_tag LOCUS_11340 gene tgt 60688 59570 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_11340 61597 61253 gene locus_tag LOCUS_11350 61597 61253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 64316 61608 gene locus_tag LOCUS_11360 64316 61608 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941424.1 protein_id gnl|my_center|LOCUS_11360 65060 64728 gene locus_tag LOCUS_11370 65060 64728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 66160 65105 gene locus_tag LOCUS_11380 66160 65105 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049613991.1 protein_id gnl|my_center|LOCUS_11380 66514 66275 gene locus_tag LOCUS_11390 66514 66275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 67240 71265 gene locus_tag LOCUS_11400 67240 71265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 71387 72103 gene locus_tag LOCUS_11410 71387 72103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 72525 73451 gene locus_tag LOCUS_11420 72525 73451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 73453 74520 gene locus_tag LOCUS_11430 73453 74520 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_11430 74522 75910 gene locus_tag LOCUS_11440 74522 75910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 75912 77045 gene locus_tag LOCUS_11450 75912 77045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 77042 79297 gene locus_tag LOCUS_11460 77042 79297 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022963022.1 protein_id gnl|my_center|LOCUS_11460 79558 80046 gene locus_tag LOCUS_11470 79558 80046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 80109 81530 gene locus_tag LOCUS_11480 80109 81530 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857878.1 protein_id gnl|my_center|LOCUS_11480 81540 82286 gene locus_tag LOCUS_11490 81540 82286 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852646.1 protein_id gnl|my_center|LOCUS_11490 82296 83393 gene locus_tag LOCUS_11500 gene trmA 82296 83393 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890843.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence08 282 1865 gene locus_tag LOCUS_11510 282 1865 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010001.1 protein_id gnl|my_center|LOCUS_11510 3928 2096 gene locus_tag LOCUS_11520 3928 2096 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852169.1 protein_id gnl|my_center|LOCUS_11520 4284 3925 gene locus_tag LOCUS_11530 4284 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4507 4268 gene locus_tag LOCUS_11540 4507 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4737 4504 gene locus_tag LOCUS_11550 4737 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852327.1 protein_id gnl|my_center|LOCUS_11550 4897 6873 gene locus_tag LOCUS_11560 gene uvrB 4897 6873 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_11560 7875 7258 gene locus_tag LOCUS_11570 7875 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11570 8555 7944 gene locus_tag LOCUS_11580 8555 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11580 9757 8552 gene locus_tag LOCUS_11590 9757 8552 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611261.1 protein_id gnl|my_center|LOCUS_11590 11131 9758 gene locus_tag LOCUS_11600 gene pta 11131 9758 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891877.1 protein_id gnl|my_center|LOCUS_11600 11203 11916 gene locus_tag LOCUS_11610 gene flgH 11203 11916 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_11610 12737 11946 gene locus_tag LOCUS_11620 12737 11946 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_11620 14116 12737 gene locus_tag LOCUS_11630 14116 12737 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_11630 14843 14127 gene locus_tag LOCUS_11640 14843 14127 CDS product plasminogen-binding N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852692.1 protein_id gnl|my_center|LOCUS_11640 14976 16139 gene locus_tag LOCUS_11650 14976 16139 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_11650 16142 17497 gene locus_tag LOCUS_11660 gene mgtE 16142 17497 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969209.1 protein_id gnl|my_center|LOCUS_11660 17482 18069 gene locus_tag LOCUS_11670 17482 18069 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855131.1 protein_id gnl|my_center|LOCUS_11670 19033 18071 gene locus_tag LOCUS_11680 19033 18071 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947834.1 protein_id gnl|my_center|LOCUS_11680 20787 19033 gene locus_tag LOCUS_11690 20787 19033 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669793.1 protein_id gnl|my_center|LOCUS_11690 21548 20787 gene locus_tag LOCUS_11700 21548 20787 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002819467.1 protein_id gnl|my_center|LOCUS_11700 22197 21496 gene locus_tag LOCUS_11710 gene dut 22197 21496 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_11710 22837 22304 gene locus_tag LOCUS_11720 gene ciaI 22837 22304 CDS product intracellular survival protein CiaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826203.1 protein_id gnl|my_center|LOCUS_11720 22940 23347 gene locus_tag LOCUS_11730 22940 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851336.1 protein_id gnl|my_center|LOCUS_11730 23719 23339 gene locus_tag LOCUS_11740 23719 23339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 26535 23716 gene locus_tag LOCUS_11750 26535 23716 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263825.1 protein_id gnl|my_center|LOCUS_11750 27161 26535 gene locus_tag LOCUS_11760 27161 26535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 27342 27476 gene locus_tag LOCUS_11770 27342 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 27485 27817 gene locus_tag LOCUS_11780 gene rnpA 27485 27817 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853349.1 protein_id gnl|my_center|LOCUS_11780 28230 29804 gene locus_tag LOCUS_11790 gene yidC 28230 29804 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_11790 29794 30684 gene locus_tag LOCUS_11800 29794 30684 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_11800 30681 31991 gene locus_tag LOCUS_11810 gene mnmE 30681 31991 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_11810 32009 34204 gene locus_tag LOCUS_11820 gene purL 32009 34204 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858406.1 protein_id gnl|my_center|LOCUS_11820 34201 34926 gene locus_tag LOCUS_11830 34201 34926 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_11830 34936 36468 gene locus_tag LOCUS_11840 gene purH 34936 36468 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_11840 36583 38172 gene locus_tag LOCUS_11850 36583 38172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 38290 38694 gene locus_tag LOCUS_11860 38290 38694 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853315.1 protein_id gnl|my_center|LOCUS_11860 38898 38725 gene locus_tag LOCUS_11870 38898 38725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 40268 38919 gene locus_tag LOCUS_11880 40268 38919 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_11880 40984 40349 gene locus_tag LOCUS_11890 40984 40349 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_11890 41058 41999 gene locus_tag LOCUS_11900 41058 41999 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460935.1 protein_id gnl|my_center|LOCUS_11900 41999 42676 gene locus_tag LOCUS_11910 41999 42676 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546324.1 protein_id gnl|my_center|LOCUS_11910 42669 43598 gene locus_tag LOCUS_11920 42669 43598 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_11920 43666 45012 gene locus_tag LOCUS_11930 gene ffh 43666 45012 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_11930 45082 45309 gene locus_tag LOCUS_11940 gene rpsP 45082 45309 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852274.1 protein_id gnl|my_center|LOCUS_11940 45309 45554 gene locus_tag LOCUS_11950 45309 45554 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_11950 45544 46074 gene locus_tag LOCUS_11960 gene rimM 45544 46074 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852323.1 protein_id gnl|my_center|LOCUS_11960 46077 46766 gene locus_tag LOCUS_11970 gene trmD 46077 46766 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_11970 46776 47132 gene locus_tag LOCUS_11980 gene rplS 46776 47132 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_11980 47214 47546 gene locus_tag LOCUS_11990 47214 47546 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852534.1 protein_id gnl|my_center|LOCUS_11990 49528 47588 gene locus_tag LOCUS_12000 49528 47588 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_12000 50070 49525 gene locus_tag LOCUS_12010 gene maf 50070 49525 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855005.1 protein_id gnl|my_center|LOCUS_12010 50564 50067 gene locus_tag LOCUS_12020 50564 50067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 53095 50561 gene locus_tag LOCUS_12030 gene alaS 53095 50561 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_12030 53258 53467 gene locus_tag LOCUS_12040 53258 53467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 53528 54832 gene locus_tag LOCUS_12050 53528 54832 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_12050 54829 55797 gene locus_tag LOCUS_12060 54829 55797 CDS product type II asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612390.1 protein_id gnl|my_center|LOCUS_12060 55920 57266 gene locus_tag LOCUS_12070 55920 57266 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_12070 57368 58810 gene locus_tag LOCUS_12080 gene pyk 57368 58810 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_12080 58810 60036 gene locus_tag LOCUS_12090 58810 60036 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858609.1 protein_id gnl|my_center|LOCUS_12090 60023 61822 gene locus_tag LOCUS_12100 gene recG 60023 61822 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858588.1 protein_id gnl|my_center|LOCUS_12100 61859 63133 gene locus_tag LOCUS_12110 61859 63133 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864147.1 protein_id gnl|my_center|LOCUS_12110 65711 63144 gene locus_tag LOCUS_12120 65711 63144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852788.1 protein_id gnl|my_center|LOCUS_12120 65953 66216 gene locus_tag LOCUS_12130 gene groES 65953 66216 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_12130 66231 67868 gene locus_tag LOCUS_12140 gene groL 66231 67868 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_12140 68659 68120 gene locus_tag LOCUS_12150 68659 68120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 68864 68652 gene locus_tag LOCUS_12160 68864 68652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 69839 68874 gene locus_tag LOCUS_12170 69839 68874 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198211.1 protein_id gnl|my_center|LOCUS_12170 70599 69814 gene locus_tag LOCUS_12180 gene fabG 70599 69814 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086858.1 protein_id gnl|my_center|LOCUS_12180 71277 70600 gene locus_tag LOCUS_12190 71277 70600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 71999 71274 gene locus_tag LOCUS_12200 71999 71274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 72228 72001 gene locus_tag LOCUS_12210 72228 72001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 73693 72221 gene locus_tag LOCUS_12220 73693 72221 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_12220 75641 73785 gene locus_tag LOCUS_12230 gene rpoD 75641 73785 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_12230 77316 75862 gene locus_tag LOCUS_12240 77316 75862 CDS product bifunctional 2-methylcitrate dehydratase/aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706120.1 protein_id gnl|my_center|LOCUS_12240 78454 77327 gene locus_tag LOCUS_12250 gene prpC 78454 77327 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271319.1 protein_id gnl|my_center|LOCUS_12250 79335 78451 gene locus_tag LOCUS_12260 gene prpB 79335 78451 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945814.1 protein_id gnl|my_center|LOCUS_12260 81242 79332 gene locus_tag LOCUS_12270 81242 79332 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477696.1 protein_id gnl|my_center|LOCUS_12270 81486 82406 gene locus_tag LOCUS_12280 81486 82406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 82549 82875 gene locus_tag LOCUS_12290 82549 82875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 83032 83107 gene locus_tag LOCUS_t00200 83032 83107 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 83112 83187 gene locus_tag LOCUS_t00210 83112 83187 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 340 567 gene locus_tag LOCUS_12300 340 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 619 2799 gene locus_tag LOCUS_12310 619 2799 CDS product type IA DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235749.1 protein_id gnl|my_center|LOCUS_12310 2868 3218 gene locus_tag LOCUS_12320 2868 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3220 4197 gene locus_tag LOCUS_12330 3220 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4305 12314 gene locus_tag LOCUS_12340 4305 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 12435 13100 gene locus_tag LOCUS_12350 12435 13100 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_12350 15665 13149 gene locus_tag LOCUS_12360 15665 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 16214 15666 gene locus_tag LOCUS_12370 16214 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 16459 16758 gene locus_tag LOCUS_12380 16459 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 16793 17026 gene locus_tag LOCUS_12390 16793 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 17026 18498 gene locus_tag LOCUS_12400 17026 18498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 18482 19267 gene locus_tag LOCUS_12410 18482 19267 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262671.1 protein_id gnl|my_center|LOCUS_12410 19489 20169 gene locus_tag LOCUS_12420 19489 20169 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587397.1 protein_id gnl|my_center|LOCUS_12420 20182 20445 gene locus_tag LOCUS_12430 20182 20445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 21846 20584 gene locus_tag LOCUS_12440 21846 20584 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116616918.1 protein_id gnl|my_center|LOCUS_12440 22818 24392 gene locus_tag LOCUS_12450 22818 24392 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010001.1 protein_id gnl|my_center|LOCUS_12450 24686 25858 gene locus_tag LOCUS_12460 24686 25858 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261000.1 protein_id gnl|my_center|LOCUS_12460 25845 27014 gene locus_tag LOCUS_12470 25845 27014 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_12470 27174 28649 gene locus_tag LOCUS_12480 27174 28649 CDS product acetyl-CoA carboxylase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856595.1 protein_id gnl|my_center|LOCUS_12480 28653 28865 gene locus_tag LOCUS_12490 28653 28865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 28816 29583 gene locus_tag LOCUS_12500 28816 29583 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853863.1 protein_id gnl|my_center|LOCUS_12500 29639 30463 gene locus_tag LOCUS_12510 29639 30463 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852998.1 protein_id gnl|my_center|LOCUS_12510 30472 31239 gene locus_tag LOCUS_12520 30472 31239 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_12520 31229 32155 gene locus_tag LOCUS_12530 gene pdxA 31229 32155 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075036.1 protein_id gnl|my_center|LOCUS_12530 32191 33732 gene locus_tag LOCUS_12540 32191 33732 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864548.1 protein_id gnl|my_center|LOCUS_12540 33815 36583 gene locus_tag LOCUS_12550 gene flgL 33815 36583 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852538.1 protein_id gnl|my_center|LOCUS_12550 36833 38878 gene locus_tag LOCUS_12560 36833 38878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 38896 39156 gene locus_tag LOCUS_12570 38896 39156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 39149 39577 gene locus_tag LOCUS_12580 39149 39577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 39586 40464 gene locus_tag LOCUS_12590 39586 40464 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_12590 40464 41726 gene locus_tag LOCUS_12600 gene hemA 40464 41726 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_12600 41726 43429 gene locus_tag LOCUS_12610 41726 43429 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 protein_id gnl|my_center|LOCUS_12610 43426 43836 gene locus_tag LOCUS_12620 43426 43836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 43833 44753 gene locus_tag LOCUS_12630 gene hemC 43833 44753 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_12630 44847 47918 gene locus_tag LOCUS_12640 gene ccsA 44847 47918 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852963.1 protein_id gnl|my_center|LOCUS_12640 47939 48370 gene locus_tag LOCUS_12650 47939 48370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 48542 51097 gene locus_tag LOCUS_12660 48542 51097 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852522.1 protein_id gnl|my_center|LOCUS_12660 53029 51170 gene locus_tag LOCUS_12670 53029 51170 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891905.1 protein_id gnl|my_center|LOCUS_12670 53253 54344 gene locus_tag LOCUS_12680 gene ispG 53253 54344 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_12680 54337 55734 gene locus_tag LOCUS_12690 54337 55734 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_12690 55984 58002 gene locus_tag LOCUS_12700 55984 58002 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611900.1 protein_id gnl|my_center|LOCUS_12700 58615 57992 gene locus_tag LOCUS_12710 gene nth 58615 57992 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_12710 58728 59540 gene locus_tag LOCUS_12720 gene peb4 58728 59540 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_12720 59553 60617 gene locus_tag LOCUS_12730 gene fbaA 59553 60617 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852272.1 protein_id gnl|my_center|LOCUS_12730 60707 62086 gene locus_tag LOCUS_12740 60707 62086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 62083 63069 gene locus_tag LOCUS_12750 62083 63069 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858561.1 protein_id gnl|my_center|LOCUS_12750 63059 63907 gene locus_tag LOCUS_12760 63059 63907 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852217.1 protein_id gnl|my_center|LOCUS_12760 64179 64490 gene locus_tag LOCUS_12770 64179 64490 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855637.1 protein_id gnl|my_center|LOCUS_12770 64493 64981 gene locus_tag LOCUS_12780 gene fldA 64493 64981 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_12780 65021 65524 gene locus_tag LOCUS_12790 gene luxS 65021 65524 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_12790 65611 65526 gene locus_tag LOCUS_t00220 65611 65526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 66534 65674 gene locus_tag LOCUS_12800 66534 65674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12800 67014 66535 gene locus_tag LOCUS_12810 67014 66535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12810 67883 67023 gene locus_tag LOCUS_12820 gene ftsY 67883 67023 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_12820 68425 67883 gene locus_tag LOCUS_12830 68425 67883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 68482 69111 gene locus_tag LOCUS_12840 68482 69111 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875342.1 protein_id gnl|my_center|LOCUS_12840 69041 70597 gene locus_tag LOCUS_12850 gene rny 69041 70597 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_12850 70606 71235 gene locus_tag LOCUS_12860 70606 71235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 71235 71795 gene locus_tag LOCUS_12870 71235 71795 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856055.1 protein_id gnl|my_center|LOCUS_12870 71798 73003 gene locus_tag LOCUS_12880 71798 73003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence10 <1 628 gene locus_tag LOCUS_12890 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852395.1:flagellin A 951 1820 gene locus_tag LOCUS_12900 gene zupT 951 1820 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851840.1 protein_id gnl|my_center|LOCUS_12900 2083 1817 gene locus_tag LOCUS_12910 2083 1817 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_12910 4110 2086 gene locus_tag LOCUS_12920 4110 2086 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919663.1 protein_id gnl|my_center|LOCUS_12920 5314 4094 gene locus_tag LOCUS_12930 5314 4094 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878829.1 protein_id gnl|my_center|LOCUS_12930 5774 5301 gene locus_tag LOCUS_12940 5774 5301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860510.1 protein_id gnl|my_center|LOCUS_12940 6024 5764 gene locus_tag LOCUS_12950 6024 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 7292 6021 gene locus_tag LOCUS_12960 gene hemL 7292 6021 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864846.1 protein_id gnl|my_center|LOCUS_12960 7647 7282 gene locus_tag LOCUS_12970 7647 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852485.1 protein_id gnl|my_center|LOCUS_12970 7724 8575 gene locus_tag LOCUS_12980 gene folD 7724 8575 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_12980 8579 9412 gene locus_tag LOCUS_12990 gene lepB 8579 9412 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_12990 9495 9944 gene locus_tag LOCUS_13000 gene rpiB 9495 9944 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853308.1 protein_id gnl|my_center|LOCUS_13000 9935 10267 gene locus_tag LOCUS_13010 9935 10267 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853247.1 protein_id gnl|my_center|LOCUS_13010 10291 10836 gene locus_tag LOCUS_13020 gene apt 10291 10836 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_13020 10839 11444 gene locus_tag LOCUS_13030 10839 11444 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853249.1 protein_id gnl|my_center|LOCUS_13030 11434 12906 gene locus_tag LOCUS_13040 11434 12906 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_13040 12906 14009 gene locus_tag LOCUS_13050 gene ychF 12906 14009 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_13050 14442 17219 gene locus_tag LOCUS_13060 gene napA 14442 17219 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_13060 17222 17974 gene locus_tag LOCUS_13070 gene napG 17222 17974 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852504.1 protein_id gnl|my_center|LOCUS_13070 17971 18756 gene locus_tag LOCUS_13080 gene napH 17971 18756 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891886.1 protein_id gnl|my_center|LOCUS_13080 18753 19289 gene locus_tag LOCUS_13090 18753 19289 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_13090 19286 19747 gene locus_tag LOCUS_13100 19286 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 19747 20643 gene locus_tag LOCUS_13110 19747 20643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 20643 20981 gene locus_tag LOCUS_13120 20643 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 21796 21035 gene locus_tag LOCUS_13130 gene truA 21796 21035 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852636.1 protein_id gnl|my_center|LOCUS_13130 22821 21796 gene locus_tag LOCUS_13140 22821 21796 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852624.1 protein_id gnl|my_center|LOCUS_13140 23552 22818 gene locus_tag LOCUS_13150 23552 22818 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858757.1 protein_id gnl|my_center|LOCUS_13150 24229 23552 gene locus_tag LOCUS_13160 24229 23552 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_13160 24897 24226 gene locus_tag LOCUS_13170 24897 24226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852539.1 protein_id gnl|my_center|LOCUS_13170 26054 24894 gene locus_tag LOCUS_13180 gene coaBC 26054 24894 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852470.1 protein_id gnl|my_center|LOCUS_13180 27300 26044 gene locus_tag LOCUS_13190 gene glmU 27300 26044 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 protein_id gnl|my_center|LOCUS_13190 27483 28676 gene locus_tag LOCUS_13200 27483 28676 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852311.1 protein_id gnl|my_center|LOCUS_13200 28676 30601 gene locus_tag LOCUS_13210 28676 30601 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697391.1 protein_id gnl|my_center|LOCUS_13210 30603 31898 gene locus_tag LOCUS_13220 30603 31898 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891866.1 protein_id gnl|my_center|LOCUS_13220 31899 33155 gene locus_tag LOCUS_13230 31899 33155 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873165.1 protein_id gnl|my_center|LOCUS_13230 34373 33126 gene locus_tag LOCUS_13240 34373 33126 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_13240 35069 34395 gene locus_tag LOCUS_13250 35069 34395 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_13250 36527 35115 gene locus_tag LOCUS_13260 gene htrA 36527 35115 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_13260 36679 37566 gene locus_tag LOCUS_13270 36679 37566 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853234.1 protein_id gnl|my_center|LOCUS_13270 37577 37936 gene locus_tag LOCUS_13280 gene hspR 37577 37936 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_13280 37942 39609 gene locus_tag LOCUS_13290 37942 39609 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_13290 39612 41048 gene locus_tag LOCUS_13300 39612 41048 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393930.1 protein_id gnl|my_center|LOCUS_13300 41057 41818 gene locus_tag LOCUS_13310 41057 41818 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 protein_id gnl|my_center|LOCUS_13310 41925 42605 gene locus_tag LOCUS_13320 41925 42605 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_13320 42785 43327 gene locus_tag LOCUS_13330 gene thiE 42785 43327 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545604.1 protein_id gnl|my_center|LOCUS_13330 43385 44806 gene locus_tag LOCUS_13340 gene gatB 43385 44806 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_13340 44928 45818 gene locus_tag LOCUS_13350 44928 45818 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_13350 45815 46873 gene locus_tag LOCUS_13360 45815 46873 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_13360 47304 46870 gene locus_tag LOCUS_13370 47304 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 48166 47291 gene locus_tag LOCUS_13380 gene rarD 48166 47291 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176139.1 protein_id gnl|my_center|LOCUS_13380 48909 48166 gene locus_tag LOCUS_13390 48909 48166 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647711.1 protein_id gnl|my_center|LOCUS_13390 49558 48920 gene locus_tag LOCUS_13400 49558 48920 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005633396.1 protein_id gnl|my_center|LOCUS_13400 50324 49575 gene locus_tag LOCUS_13410 gene tcyA 50324 49575 CDS product cystine ABC transporter substrate-binding lipoprotein TcyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246699.1 protein_id gnl|my_center|LOCUS_13410 50983 50441 gene locus_tag LOCUS_13420 gene pgsA 50983 50441 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_13420 51768 50980 gene locus_tag LOCUS_13430 51768 50980 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_13430 52661 51768 gene locus_tag LOCUS_13440 gene dapA 52661 51768 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_13440 53905 52658 gene locus_tag LOCUS_13450 53905 52658 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_13450 54964 53906 gene locus_tag LOCUS_13460 54964 53906 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_13460 55091 55963 gene locus_tag LOCUS_13470 55091 55963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 56754 55960 gene locus_tag LOCUS_13480 56754 55960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 58486 56732 gene locus_tag LOCUS_13490 58486 56732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_13490 59838 58462 gene locus_tag LOCUS_13500 gene cysS 59838 58462 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852611.1 protein_id gnl|my_center|LOCUS_13500 <60535 59825 gene locus_tag LOCUS_13510 <60535 59825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209611242.1:murein biosynthesis integral membrane protein MurJ >Feature sequence11 1518 385 gene locus_tag LOCUS_13520 gene pseC 1518 385 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_13520 2272 1532 gene locus_tag LOCUS_13530 2272 1532 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852555.1 protein_id gnl|my_center|LOCUS_13530 2357 2947 gene locus_tag LOCUS_13540 2357 2947 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_13540 3435 2950 gene locus_tag LOCUS_13550 3435 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4287 3445 gene locus_tag LOCUS_13560 gene cmoB 4287 3445 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_13560 4459 4280 gene locus_tag LOCUS_13570 4459 4280 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853385.1 protein_id gnl|my_center|LOCUS_13570 4524 5792 gene locus_tag LOCUS_13580 4524 5792 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_13580 6996 5827 gene locus_tag LOCUS_13590 6996 5827 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015749.1 protein_id gnl|my_center|LOCUS_13590 7613 7086 gene locus_tag LOCUS_13600 gene raiA 7613 7086 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016408.1 protein_id gnl|my_center|LOCUS_13600 8103 7663 gene locus_tag LOCUS_13610 8103 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 8885 8100 gene locus_tag LOCUS_13620 8885 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9343 8882 gene locus_tag LOCUS_13630 9343 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9876 9487 gene locus_tag LOCUS_13640 gene fliW 9876 9487 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852982.1 protein_id gnl|my_center|LOCUS_13640 10036 10683 gene locus_tag LOCUS_13650 10036 10683 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852961.1 protein_id gnl|my_center|LOCUS_13650 10692 13061 gene locus_tag LOCUS_13660 gene lon 10692 13061 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_13660 13196 14629 gene locus_tag LOCUS_13670 13196 14629 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856117.1 protein_id gnl|my_center|LOCUS_13670 14712 15188 gene locus_tag LOCUS_13680 14712 15188 CDS product Cj1386 family hemin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858381.1 protein_id gnl|my_center|LOCUS_13680 15235 15648 gene locus_tag LOCUS_13690 15235 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 16580 15672 gene locus_tag LOCUS_13700 gene cysK 16580 15672 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_13700 17003 16590 gene locus_tag LOCUS_13710 17003 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 18271 17000 gene locus_tag LOCUS_13720 18271 17000 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_13720 18532 19668 gene locus_tag LOCUS_13730 gene pseA 18532 19668 CDS product pseudaminic acid biosynthesis protein PseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856493.1 protein_id gnl|my_center|LOCUS_13730 19793 21019 gene locus_tag LOCUS_13740 19793 21019 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_13740 21042 22103 gene locus_tag LOCUS_13750 21042 22103 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852607.1 protein_id gnl|my_center|LOCUS_13750 22112 23299 gene locus_tag LOCUS_13760 gene ftsW 22112 23299 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 protein_id gnl|my_center|LOCUS_13760 23296 24312 gene locus_tag LOCUS_13770 gene murG 23296 24312 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_13770 24476 24772 gene locus_tag LOCUS_13780 24476 24772 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_13780 24876 25121 gene locus_tag LOCUS_13790 24876 25121 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_13790 25105 25497 gene locus_tag LOCUS_13800 gene tsaE 25105 25497 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 protein_id gnl|my_center|LOCUS_13800 25490 26218 gene locus_tag LOCUS_13810 gene lptB 25490 26218 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_13810 26218 27456 gene locus_tag LOCUS_13820 26218 27456 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852268.1 protein_id gnl|my_center|LOCUS_13820 27506 28540 gene locus_tag LOCUS_13830 gene aroB 27506 28540 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_13830 28537 30093 gene locus_tag LOCUS_13840 28537 30093 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 protein_id gnl|my_center|LOCUS_13840 30090 31334 gene locus_tag LOCUS_13850 gene mtaB 30090 31334 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_13850 31321 32985 gene locus_tag LOCUS_13860 31321 32985 CDS product ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852990.1 protein_id gnl|my_center|LOCUS_13860 32978 33502 gene locus_tag LOCUS_13870 gene mog 32978 33502 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002842823.1 protein_id gnl|my_center|LOCUS_13870 33582 33989 gene locus_tag LOCUS_13880 33582 33989 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007242046.1 protein_id gnl|my_center|LOCUS_13880 33986 35515 gene locus_tag LOCUS_13890 33986 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478646.1 protein_id gnl|my_center|LOCUS_13890 35520 36236 gene locus_tag LOCUS_13900 35520 36236 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497656.1 protein_id gnl|my_center|LOCUS_13900 36253 36441 gene locus_tag LOCUS_13910 36253 36441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence12 1423 38 gene locus_tag LOCUS_13920 1423 38 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852850.1 protein_id gnl|my_center|LOCUS_13920 1608 2696 gene locus_tag LOCUS_13930 1608 2696 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816245.1 protein_id gnl|my_center|LOCUS_13930 2686 3300 gene locus_tag LOCUS_13940 2686 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3290 3970 gene locus_tag LOCUS_13950 gene bioC 3290 3970 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205939.1 protein_id gnl|my_center|LOCUS_13950 5326 3971 gene locus_tag LOCUS_13960 gene bioA 5326 3971 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_13960 6018 5335 gene locus_tag LOCUS_13970 gene bioD 6018 5335 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_13970 6155 7957 gene locus_tag LOCUS_13980 6155 7957 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851929.1 protein_id gnl|my_center|LOCUS_13980 8147 8650 gene locus_tag LOCUS_13990 8147 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 9938 8643 gene locus_tag LOCUS_14000 9938 8643 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_14000 10633 9935 gene locus_tag LOCUS_14010 10633 9935 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_14010 10907 10626 gene locus_tag LOCUS_14020 10907 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 11009 11875 gene locus_tag LOCUS_14030 11009 11875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 12497 11865 gene locus_tag LOCUS_14040 12497 11865 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900903.1 protein_id gnl|my_center|LOCUS_14040 12849 12487 gene locus_tag LOCUS_14050 12849 12487 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851707.1 protein_id gnl|my_center|LOCUS_14050 14039 12915 gene locus_tag LOCUS_14060 14039 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 14721 14032 gene locus_tag LOCUS_14070 14721 14032 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689290.1 protein_id gnl|my_center|LOCUS_14070 15521 14721 gene locus_tag LOCUS_14080 15521 14721 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049230919.1 protein_id gnl|my_center|LOCUS_14080 16525 15518 gene locus_tag LOCUS_14090 16525 15518 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705777.1 protein_id gnl|my_center|LOCUS_14090 18336 16663 gene locus_tag LOCUS_14100 18336 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 18487 19803 gene locus_tag LOCUS_14110 18487 19803 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002906848.1 protein_id gnl|my_center|LOCUS_14110 19982 20482 gene locus_tag LOCUS_14120 gene nrfH 19982 20482 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891930.1 protein_id gnl|my_center|LOCUS_14120 20542 22398 gene locus_tag LOCUS_14130 20542 22398 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858075.1 protein_id gnl|my_center|LOCUS_14130 22654 23634 gene locus_tag LOCUS_14140 22654 23634 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857563.1 protein_id gnl|my_center|LOCUS_14140 24464 23838 gene locus_tag LOCUS_14150 24464 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 24686 27481 gene locus_tag LOCUS_14160 gene flgE 24686 27481 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002882660.1 protein_id gnl|my_center|LOCUS_14160 27887 27968 gene locus_tag LOCUS_t00230 27887 27968 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 29487 30101 gene locus_tag LOCUS_14170 29487 30101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 30202 30432 gene locus_tag LOCUS_14180 30202 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 30416 31423 gene locus_tag LOCUS_14190 30416 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 31822 32118 gene locus_tag LOCUS_14200 31822 32118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 <33381 32339 gene locus_tag LOCUS_14210 <33381 32339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007851503.1:tyrosine-type recombinase/integrase >Feature sequence13 <1 747 gene locus_tag LOCUS_14220 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858687.1:prohibitin family protein 757 1494 gene locus_tag LOCUS_14230 gene hisIE 757 1494 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 protein_id gnl|my_center|LOCUS_14230 1484 2008 gene locus_tag LOCUS_14240 1484 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2008 2541 gene locus_tag LOCUS_14250 2008 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2683 4743 gene locus_tag LOCUS_14260 gene ccaA 2683 4743 CDS product aspartate chemotaxis receptor CcaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851362.1 protein_id gnl|my_center|LOCUS_14260 5219 5079 gene locus_tag LOCUS_14270 5219 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 9458 5472 gene locus_tag LOCUS_14280 gene dnaE 9458 5472 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_14280 10711 9473 gene locus_tag LOCUS_14290 gene cetA 10711 9473 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_14290 11233 10715 gene locus_tag LOCUS_14300 gene cetC 11233 10715 CDS product energy taxis response protein CetC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855880.1 protein_id gnl|my_center|LOCUS_14300 12480 11278 gene locus_tag LOCUS_14310 12480 11278 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_14310 14004 12481 gene locus_tag LOCUS_14320 gene pilB 14004 12481 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_14320 15470 14001 gene locus_tag LOCUS_14330 gene mshL 15470 14001 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_14330 15825 15454 gene locus_tag LOCUS_14340 15825 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 16394 15822 gene locus_tag LOCUS_14350 16394 15822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 17754 16396 gene locus_tag LOCUS_14360 17754 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 18996 18007 gene locus_tag LOCUS_14370 gene galE 18996 18007 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858414.1 protein_id gnl|my_center|LOCUS_14370 19599 19120 gene locus_tag LOCUS_14380 gene pseH 19599 19120 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858467.1 protein_id gnl|my_center|LOCUS_14380 19819 19580 gene locus_tag LOCUS_14390 19819 19580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 20635 19820 gene locus_tag LOCUS_14400 20635 19820 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225694.1 protein_id gnl|my_center|LOCUS_14400 21441 20632 gene locus_tag LOCUS_14410 21441 20632 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853812.1 protein_id gnl|my_center|LOCUS_14410 21502 22467 gene locus_tag LOCUS_14420 gene waaC 21502 22467 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858077.1 protein_id gnl|my_center|LOCUS_14420 22460 23323 gene locus_tag LOCUS_14430 gene htrB 22460 23323 CDS product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858051.1 protein_id gnl|my_center|LOCUS_14430 23320 24381 gene locus_tag LOCUS_14440 gene rfaQ 23320 24381 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942892.1 protein_id gnl|my_center|LOCUS_14440 24418 25437 gene locus_tag LOCUS_14450 24418 25437 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_14450 25466 26341 gene locus_tag LOCUS_14460 gene waaF 25466 26341 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875425.1 protein_id gnl|my_center|LOCUS_14460 27552 26371 gene locus_tag LOCUS_14470 27552 26371 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476038.1 protein_id gnl|my_center|LOCUS_14470 28153 27596 gene locus_tag LOCUS_14480 gene gmhA 28153 27596 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858021.1 protein_id gnl|my_center|LOCUS_14480 29539 28163 gene locus_tag LOCUS_14490 gene rfaE1 29539 28163 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858114.1 protein_id gnl|my_center|LOCUS_14490 30504 29539 gene locus_tag LOCUS_14500 gene rfaD 30504 29539 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858041.1 protein_id gnl|my_center|LOCUS_14500 31007 30501 gene locus_tag LOCUS_14510 gene gmhB 31007 30501 CDS product D-glycero-alpha-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853963.1 protein_id gnl|my_center|LOCUS_14510 31167 31475 gene locus_tag LOCUS_14520 31167 31475 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852762.1 protein_id gnl|my_center|LOCUS_14520 31773 31540 gene locus_tag LOCUS_14530 gene ccoS 31773 31540 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852798.1 protein_id gnl|my_center|LOCUS_14530 33065 31776 gene locus_tag LOCUS_14540 33065 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence14 1394 378 gene locus_tag LOCUS_14550 1394 378 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852104.1 protein_id gnl|my_center|LOCUS_14550 2274 1396 gene locus_tag LOCUS_14560 gene era 2274 1396 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852114.1 protein_id gnl|my_center|LOCUS_14560 3593 2271 gene locus_tag LOCUS_14570 gene hslU 3593 2271 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_14570 4133 3597 gene locus_tag LOCUS_14580 gene hslV 4133 3597 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_14580 4576 4133 gene locus_tag LOCUS_14590 gene rplI 4576 4133 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_14590 5360 4620 gene locus_tag LOCUS_14600 5360 4620 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_14600 5584 5357 gene locus_tag LOCUS_14610 gene csrA 5584 5357 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852854.1 protein_id gnl|my_center|LOCUS_14610 6399 5572 gene locus_tag LOCUS_14620 gene truB 6399 5572 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_14620 8444 6396 gene locus_tag LOCUS_14630 8444 6396 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_14630 8631 9497 gene locus_tag LOCUS_14640 8631 9497 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461665.1 protein_id gnl|my_center|LOCUS_14640 9930 9484 gene locus_tag LOCUS_14650 9930 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852822.1 protein_id gnl|my_center|LOCUS_14650 11645 9933 gene locus_tag LOCUS_14660 11645 9933 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891907.1 protein_id gnl|my_center|LOCUS_14660 12879 11647 gene locus_tag LOCUS_14670 gene sstT 12879 11647 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858067.1 protein_id gnl|my_center|LOCUS_14670 13171 14364 gene locus_tag LOCUS_14680 gene metK 13171 14364 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852836.1 protein_id gnl|my_center|LOCUS_14680 14368 16083 gene locus_tag LOCUS_14690 14368 16083 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852245.1 protein_id gnl|my_center|LOCUS_14690 16096 16482 gene locus_tag LOCUS_14700 16096 16482 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990749.1 protein_id gnl|my_center|LOCUS_14700 16479 16796 gene locus_tag LOCUS_14710 16479 16796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 16789 17403 gene locus_tag LOCUS_14720 16789 17403 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_14720 17525 19201 gene locus_tag LOCUS_14730 17525 19201 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_14730 19204 19668 gene locus_tag LOCUS_14740 gene ilvN 19204 19668 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_14740 19668 20615 gene locus_tag LOCUS_14750 gene lpxD 19668 20615 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_14750 20631 22721 gene locus_tag LOCUS_14760 20631 22721 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860421.1 protein_id gnl|my_center|LOCUS_14760 23148 25409 gene locus_tag LOCUS_14770 gene metE 23148 25409 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404021.1 protein_id gnl|my_center|LOCUS_14770 25462 26412 gene locus_tag LOCUS_14780 25462 26412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence15 <1 1254 gene locus_tag LOCUS_14790 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000010001.1:flagellin B 2746 1436 gene locus_tag LOCUS_14800 gene fliI 2746 1436 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_14800 3330 2743 gene locus_tag LOCUS_14810 gene folE 3330 2743 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_14810 3460 4758 gene locus_tag LOCUS_14820 gene tig 3460 4758 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_14820 4758 5339 gene locus_tag LOCUS_14830 gene clpP 4758 5339 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_14830 5355 6422 gene locus_tag LOCUS_14840 5355 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 6424 6942 gene locus_tag LOCUS_14850 gene def 6424 6942 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851936.1 protein_id gnl|my_center|LOCUS_14850 6939 8453 gene locus_tag LOCUS_14860 6939 8453 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851902.1 protein_id gnl|my_center|LOCUS_14860 8450 9847 gene locus_tag LOCUS_14870 8450 9847 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954017.1 protein_id gnl|my_center|LOCUS_14870 9838 10422 gene locus_tag LOCUS_14880 gene purN 9838 10422 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864335.1 protein_id gnl|my_center|LOCUS_14880 10415 11134 gene locus_tag LOCUS_14890 10415 11134 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819827.1 protein_id gnl|my_center|LOCUS_14890 11246 11323 gene locus_tag LOCUS_t00240 11246 11323 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11328 11404 gene locus_tag LOCUS_t00250 11328 11404 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 11422 11498 gene locus_tag LOCUS_t00260 11422 11498 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11527 11603 gene locus_tag LOCUS_t00270 11527 11603 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11644 11728 gene locus_tag LOCUS_t00280 11644 11728 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12114 14090 gene locus_tag LOCUS_14900 12114 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14100 15083 gene locus_tag LOCUS_14910 14100 15083 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705777.1 protein_id gnl|my_center|LOCUS_14910 15080 15895 gene locus_tag LOCUS_14920 15080 15895 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049230919.1 protein_id gnl|my_center|LOCUS_14920 15892 16569 gene locus_tag LOCUS_14930 15892 16569 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689290.1 protein_id gnl|my_center|LOCUS_14930 16562 17686 gene locus_tag LOCUS_14940 16562 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 18200 18541 gene locus_tag LOCUS_14950 18200 18541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence16 386 1438 gene locus_tag LOCUS_14960 386 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1435 2562 gene locus_tag LOCUS_14970 1435 2562 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039954.1 protein_id gnl|my_center|LOCUS_14970 2552 3469 gene locus_tag LOCUS_14980 gene wlaN 2552 3469 CDS product beta-1,3 galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858039.1 protein_id gnl|my_center|LOCUS_14980 5610 3598 gene locus_tag LOCUS_14990 5610 3598 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611900.1 protein_id gnl|my_center|LOCUS_14990 6148 5603 gene locus_tag LOCUS_15000 6148 5603 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852466.1 protein_id gnl|my_center|LOCUS_15000 7320 6145 gene locus_tag LOCUS_15010 7320 6145 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_15010 7683 7396 gene locus_tag LOCUS_15020 7683 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 8359 7736 gene locus_tag LOCUS_15030 8359 7736 CDS product UPF0323 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854351.1 protein_id gnl|my_center|LOCUS_15030 9554 8412 gene locus_tag LOCUS_15040 9554 8412 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782235.1 protein_id gnl|my_center|LOCUS_15040 10621 9551 gene locus_tag LOCUS_15050 gene aroC 10621 9551 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851463.1 protein_id gnl|my_center|LOCUS_15050 11308 10631 gene locus_tag LOCUS_15060 gene rnc 11308 10631 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_15060 11740 11309 gene locus_tag LOCUS_15070 gene rnhA 11740 11309 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851277.1 protein_id gnl|my_center|LOCUS_15070 12725 11718 gene locus_tag LOCUS_15080 12725 11718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851401.1 protein_id gnl|my_center|LOCUS_15080 12786 14432 gene locus_tag LOCUS_15090 gene dnaG 12786 14432 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851181.1 protein_id gnl|my_center|LOCUS_15090 14429 15412 gene locus_tag LOCUS_15100 14429 15412 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_15100 15420 16253 gene locus_tag LOCUS_15110 15420 16253 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612245.1 protein_id gnl|my_center|LOCUS_15110 16646 16425 gene locus_tag LOCUS_15120 16646 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence17 635 560 gene locus_tag LOCUS_t00290 635 560 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 771 845 gene locus_tag LOCUS_t00300 771 845 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 851 937 gene locus_tag LOCUS_t00310 851 937 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 947 1020 gene locus_tag LOCUS_t00320 947 1020 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1037 1189 gene locus_tag LOCUS_15130 1037 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1196 1285 gene locus_tag LOCUS_t00330 1196 1285 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1316 2506 gene locus_tag LOCUS_15140 1316 2506 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857707.1 protein_id gnl|my_center|LOCUS_15140 3092 2472 gene locus_tag LOCUS_15150 gene thyX 3092 2472 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_15150 3701 3102 gene locus_tag LOCUS_15160 3701 3102 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853752.1 protein_id gnl|my_center|LOCUS_15160 3844 4587 gene locus_tag LOCUS_15170 gene peb2 3844 4587 CDS product AcfC family adhesin PEB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858781.1 protein_id gnl|my_center|LOCUS_15170 6441 4639 gene locus_tag LOCUS_15180 gene typA 6441 4639 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_15180 6592 8277 gene locus_tag LOCUS_15190 6592 8277 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891831.1 protein_id gnl|my_center|LOCUS_15190 8334 9179 gene locus_tag LOCUS_15200 8334 9179 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_15200 9176 10810 gene locus_tag LOCUS_15210 9176 10810 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805291.1 protein_id gnl|my_center|LOCUS_15210 11147 12367 gene locus_tag LOCUS_15220 11147 12367 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965477.1 protein_id gnl|my_center|LOCUS_15220 12367 12906 gene locus_tag LOCUS_15230 12367 12906 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858190.1 protein_id gnl|my_center|LOCUS_15230 12990 14141 gene locus_tag LOCUS_15240 12990 14141 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence18 1679 249 gene locus_tag LOCUS_15250 1679 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 3593 1917 gene locus_tag LOCUS_15260 3593 1917 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851485.1 protein_id gnl|my_center|LOCUS_15260 4045 3674 gene locus_tag LOCUS_15270 4045 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780440.1 protein_id gnl|my_center|LOCUS_15270 5406 4048 gene locus_tag LOCUS_15280 5406 4048 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780438.1 protein_id gnl|my_center|LOCUS_15280 6522 5416 gene locus_tag LOCUS_15290 6522 5416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858304.1 protein_id gnl|my_center|LOCUS_15290 7809 6628 gene locus_tag LOCUS_15300 7809 6628 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851835.1 protein_id gnl|my_center|LOCUS_15300 8704 7793 gene locus_tag LOCUS_15310 8704 7793 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016040.1 protein_id gnl|my_center|LOCUS_15310 9247 8720 gene locus_tag LOCUS_15320 gene tpx 9247 8720 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852593.1 protein_id gnl|my_center|LOCUS_15320 9675 9322 gene locus_tag LOCUS_15330 9675 9322 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 protein_id gnl|my_center|LOCUS_15330 10334 9723 gene locus_tag LOCUS_15340 gene pyrE 10334 9723 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_15340 10894 10337 gene locus_tag LOCUS_15350 gene frr 10894 10337 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_15350 11240 10905 gene locus_tag LOCUS_15360 gene secG 11240 10905 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851915.1 protein_id gnl|my_center|LOCUS_15360 12017 11328 gene locus_tag LOCUS_15370 12017 11328 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence19 299 1369 gene locus_tag LOCUS_15380 gene aroC 299 1369 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851463.1 protein_id gnl|my_center|LOCUS_15380 1366 2508 gene locus_tag LOCUS_15390 1366 2508 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782235.1 protein_id gnl|my_center|LOCUS_15390 2561 3184 gene locus_tag LOCUS_15400 2561 3184 CDS product UPF0323 family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854351.1 protein_id gnl|my_center|LOCUS_15400 3237 3524 gene locus_tag LOCUS_15410 3237 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3600 4775 gene locus_tag LOCUS_15420 3600 4775 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858689.1 protein_id gnl|my_center|LOCUS_15420 4772 5317 gene locus_tag LOCUS_15430 4772 5317 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852466.1 protein_id gnl|my_center|LOCUS_15430 5310 7322 gene locus_tag LOCUS_15440 5310 7322 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611900.1 protein_id gnl|my_center|LOCUS_15440 8368 7451 gene locus_tag LOCUS_15450 gene wlaN 8368 7451 CDS product beta-1,3 galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858039.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence20 1649 633 gene locus_tag LOCUS_15460 1649 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 2691 1630 gene locus_tag LOCUS_15470 2691 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3419 2688 gene locus_tag LOCUS_15480 gene kdsB 3419 2688 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_15480 5146 3416 gene locus_tag LOCUS_15490 gene thrC 5146 3416 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852451.1 protein_id gnl|my_center|LOCUS_15490 5985 5143 gene locus_tag LOCUS_15500 gene argB 5985 5143 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706280.1 protein_id gnl|my_center|LOCUS_15500 6838 5969 gene locus_tag LOCUS_15510 6838 5969 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852582.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence21 1010 2305 gene locus_tag LOCUS_15520 1010 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2878 2333 gene locus_tag LOCUS_15530 2878 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 4146 2875 gene locus_tag LOCUS_15540 4146 2875 CDS product arsenic transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891918.1 protein_id gnl|my_center|LOCUS_15540 5225 4155 gene locus_tag LOCUS_15550 5225 4155 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851455.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence22 1322 2251 gene locus_tag LOCUS_15560 1322 2251 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_15560 2806 2318 gene locus_tag LOCUS_15570 2806 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3082 2849 gene locus_tag LOCUS_15580 3082 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3525 3091 gene locus_tag LOCUS_15590 3525 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15590