>Feature sequence0001 1491 292 gene locus_tag LOCUS_00010 1491 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4601 2970 gene locus_tag LOCUS_00020 4601 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6586 4787 gene locus_tag LOCUS_00030 6586 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7107 6673 gene locus_tag LOCUS_00040 7107 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7647 7886 gene locus_tag LOCUS_00050 7647 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8268 8558 gene locus_tag LOCUS_00060 8268 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8539 9165 gene locus_tag LOCUS_00070 8539 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9165 9482 gene locus_tag LOCUS_00080 9165 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9660 9436 gene locus_tag LOCUS_00090 9660 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9794 9864 gene locus_tag LOCUS_t00010 9794 9864 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9933 10106 gene locus_tag LOCUS_00100 9933 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10119 10499 gene locus_tag LOCUS_00110 10119 10499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10526 11644 gene locus_tag LOCUS_00120 10526 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11641 12147 gene locus_tag LOCUS_00130 11641 12147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12274 12513 gene locus_tag LOCUS_00140 12274 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12534 13010 gene locus_tag LOCUS_00150 12534 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13047 13265 gene locus_tag LOCUS_00160 13047 13265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13358 13561 gene locus_tag LOCUS_00170 13358 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13579 13956 gene locus_tag LOCUS_00180 13579 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13961 15175 gene locus_tag LOCUS_00190 13961 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 15192 15503 gene locus_tag LOCUS_00200 15192 15503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 15507 17156 gene locus_tag LOCUS_00210 15507 17156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 17309 17839 gene locus_tag LOCUS_00220 17309 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 17829 18641 gene locus_tag LOCUS_00230 17829 18641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 18631 19368 gene locus_tag LOCUS_00240 18631 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 19371 20000 gene locus_tag LOCUS_00250 19371 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 20020 20316 gene locus_tag LOCUS_00260 20020 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 20306 20662 gene locus_tag LOCUS_00270 20306 20662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 20641 21144 gene locus_tag LOCUS_00280 20641 21144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 21167 22057 gene locus_tag LOCUS_00290 21167 22057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 22057 23946 gene locus_tag LOCUS_00300 22057 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 24082 24615 gene locus_tag LOCUS_00310 24082 24615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 24630 25220 gene locus_tag LOCUS_00320 24630 25220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 25241 26293 gene locus_tag LOCUS_00330 25241 26293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040412236.1 protein_id gnl|my_center|LOCUS_00330 26319 29144 gene locus_tag LOCUS_00340 26319 29144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 29159 30076 gene locus_tag LOCUS_00350 gene thyX 29159 30076 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_00350 30112 30348 gene locus_tag LOCUS_00360 30112 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30460 30984 gene locus_tag LOCUS_00370 30460 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 30981 31619 gene locus_tag LOCUS_00380 30981 31619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 31643 32953 gene locus_tag LOCUS_00390 31643 32953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 32950 33447 gene locus_tag LOCUS_00400 32950 33447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 33480 35525 gene locus_tag LOCUS_00410 33480 35525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 35539 36372 gene locus_tag LOCUS_00420 35539 36372 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339595.1 protein_id gnl|my_center|LOCUS_00420 36369 37364 gene locus_tag LOCUS_00430 36369 37364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 37899 38096 gene locus_tag LOCUS_00440 37899 38096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 38123 40447 gene locus_tag LOCUS_00450 38123 40447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 40471 41169 gene locus_tag LOCUS_00460 40471 41169 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007836183.1 protein_id gnl|my_center|LOCUS_00460 41180 41389 gene locus_tag LOCUS_00470 41180 41389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 41738 41412 gene locus_tag LOCUS_00480 41738 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 41991 41713 gene locus_tag LOCUS_00490 41991 41713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 42261 42070 gene locus_tag LOCUS_00500 42261 42070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 42709 44151 gene locus_tag LOCUS_00510 42709 44151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 44132 46048 gene locus_tag LOCUS_00520 44132 46048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 46052 46345 gene locus_tag LOCUS_00530 46052 46345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 46346 46681 gene locus_tag LOCUS_00540 46346 46681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 46685 46933 gene locus_tag LOCUS_00550 46685 46933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 46966 47307 gene locus_tag LOCUS_00560 46966 47307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 47323 47784 gene locus_tag LOCUS_00570 47323 47784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 47794 49440 gene locus_tag LOCUS_00580 47794 49440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 49437 49973 gene locus_tag LOCUS_00590 49437 49973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 50006 50443 gene locus_tag LOCUS_00600 50006 50443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 50474 50935 gene locus_tag LOCUS_00610 50474 50935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 50890 51132 gene locus_tag LOCUS_00620 50890 51132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 51496 51173 gene locus_tag LOCUS_00630 51496 51173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 51801 51502 gene locus_tag LOCUS_00640 51801 51502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 52050 51874 gene locus_tag LOCUS_00650 52050 51874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 52188 55514 gene locus_tag LOCUS_00660 52188 55514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 55511 56554 gene locus_tag LOCUS_00670 55511 56554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 56568 57305 gene locus_tag LOCUS_00680 56568 57305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 57335 58513 gene locus_tag LOCUS_00690 57335 58513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 58839 58528 gene locus_tag LOCUS_00700 58839 58528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 60380 59181 gene locus_tag LOCUS_00710 60380 59181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 63490 61859 gene locus_tag LOCUS_00720 63490 61859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 65475 63676 gene locus_tag LOCUS_00730 65475 63676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 65996 65562 gene locus_tag LOCUS_00740 65996 65562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 66536 66775 gene locus_tag LOCUS_00750 66536 66775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 67157 67447 gene locus_tag LOCUS_00760 67157 67447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence0002 3555 2509 gene locus_tag LOCUS_00770 3555 2509 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123542.1 protein_id gnl|my_center|LOCUS_00770 4662 4201 gene locus_tag LOCUS_00780 4662 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 5682 4744 gene locus_tag LOCUS_00790 5682 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 7608 5698 gene locus_tag LOCUS_00800 7608 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 9042 7735 gene locus_tag LOCUS_00810 9042 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 9573 9226 gene locus_tag LOCUS_00820 9573 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 13336 10724 gene locus_tag LOCUS_00830 13336 10724 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015927.1 protein_id gnl|my_center|LOCUS_00830 <14449 13487 gene locus_tag LOCUS_00840 <14449 13487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083552.1:tetratricopeptide repeat protein >Feature sequence0003 2160 1912 gene locus_tag LOCUS_00850 2160 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 5091 2332 gene locus_tag LOCUS_00860 5091 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00860 6873 5107 gene locus_tag LOCUS_00870 6873 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8429 6870 gene locus_tag LOCUS_00880 8429 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 10820 8787 gene locus_tag LOCUS_00890 10820 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 <12892 10948 gene locus_tag LOCUS_00900 <12892 10948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181491.1:FN3 and LamG domain-containing metallophosphoesterase family protein >Feature sequence0004 566 1891 gene locus_tag LOCUS_00910 566 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00910 2012 3022 gene locus_tag LOCUS_00920 2012 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00920 3120 3192 gene locus_tag LOCUS_t00020 3120 3192 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3446 6844 gene locus_tag LOCUS_00930 3446 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 7570 6950 gene locus_tag LOCUS_00940 7570 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328467.1 protein_id gnl|my_center|LOCUS_00940 10291 8048 gene locus_tag LOCUS_00950 10291 8048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118101.1 protein_id gnl|my_center|LOCUS_00950 11821 10358 gene locus_tag LOCUS_00960 11821 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence0005 400 1344 gene locus_tag LOCUS_00970 400 1344 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976721.1 protein_id gnl|my_center|LOCUS_00970 1429 3588 gene locus_tag LOCUS_00980 1429 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 3796 4284 gene locus_tag LOCUS_00990 3796 4284 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_00990 4332 4514 gene locus_tag LOCUS_01000 4332 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4714 4953 gene locus_tag LOCUS_01010 4714 4953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5051 6289 gene locus_tag LOCUS_01020 gene fabF 5051 6289 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_01020 6392 6850 gene locus_tag LOCUS_01030 gene fabZ 6392 6850 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016509.1 protein_id gnl|my_center|LOCUS_01030 7018 8691 gene locus_tag LOCUS_01040 7018 8691 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_01040 9333 8818 gene locus_tag LOCUS_01050 gene hpt 9333 8818 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257905.1 protein_id gnl|my_center|LOCUS_01050 11254 9455 gene locus_tag LOCUS_01060 11254 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence0006 1161 400 gene locus_tag LOCUS_01070 1161 400 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122354.1 protein_id gnl|my_center|LOCUS_01070 4018 1898 gene locus_tag LOCUS_01080 4018 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 8503 4184 gene locus_tag LOCUS_01090 8503 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 10214 8724 gene locus_tag LOCUS_01100 10214 8724 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_01100 <11372 10377 gene locus_tag LOCUS_01110 <11372 10377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122130.1:DUF1559 domain-containing protein >Feature sequence0007 1861 167 gene locus_tag LOCUS_01120 1861 167 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530026.1 protein_id gnl|my_center|LOCUS_01120 2417 2142 gene locus_tag LOCUS_01130 2417 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2959 4290 gene locus_tag LOCUS_01140 2959 4290 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921976.1 protein_id gnl|my_center|LOCUS_01140 4889 5662 gene locus_tag LOCUS_01150 gene rpsB 4889 5662 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122857.1 protein_id gnl|my_center|LOCUS_01150 5870 6676 gene locus_tag LOCUS_01160 gene tsf 5870 6676 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087628.1 protein_id gnl|my_center|LOCUS_01160 6993 8228 gene locus_tag LOCUS_01170 6993 8228 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767192.1 protein_id gnl|my_center|LOCUS_01170 8494 10770 gene locus_tag LOCUS_01180 8494 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence0008 730 1767 gene locus_tag LOCUS_01190 730 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 1885 3252 gene locus_tag LOCUS_01200 1885 3252 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_01200 3617 4615 gene locus_tag LOCUS_01210 3617 4615 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_01210 4730 5158 gene locus_tag LOCUS_01220 4730 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5413 6732 gene locus_tag LOCUS_01230 5413 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6834 7802 gene locus_tag LOCUS_01240 6834 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_01240 7929 10448 gene locus_tag LOCUS_01250 7929 10448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence0009 2417 372 gene locus_tag LOCUS_01260 2417 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4573 2828 gene locus_tag LOCUS_01270 4573 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6948 4801 gene locus_tag LOCUS_01280 6948 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 7371 9272 gene locus_tag LOCUS_01290 7371 9272 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327691.1 protein_id gnl|my_center|LOCUS_01290 9406 10329 gene locus_tag LOCUS_01300 9406 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 >Feature sequence0010 644 1909 gene locus_tag LOCUS_01310 644 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 2574 4634 gene locus_tag LOCUS_01320 2574 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6678 4933 gene locus_tag LOCUS_01330 6678 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 7567 8517 gene locus_tag LOCUS_01340 7567 8517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 8883 9080 gene locus_tag LOCUS_01350 8883 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence0011 1364 2407 gene locus_tag LOCUS_01360 1364 2407 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_01360 4104 2599 gene locus_tag LOCUS_01370 4104 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 5859 4324 gene locus_tag LOCUS_01380 5859 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 7590 6379 gene locus_tag LOCUS_01390 7590 6379 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003544617.1 protein_id gnl|my_center|LOCUS_01390 8170 9114 gene locus_tag LOCUS_01400 gene mdh 8170 9114 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_01400 9341 9766 gene locus_tag LOCUS_01410 9341 9766 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence0012 526 2319 gene locus_tag LOCUS_01420 526 2319 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329990.1 protein_id gnl|my_center|LOCUS_01420 2576 4207 gene locus_tag LOCUS_01430 gene cimA 2576 4207 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332450.1 protein_id gnl|my_center|LOCUS_01430 4493 5821 gene locus_tag LOCUS_01440 4493 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6176 8269 gene locus_tag LOCUS_01450 6176 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 8623 8399 gene locus_tag LOCUS_01460 8623 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8561 8857 gene locus_tag LOCUS_01470 8561 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence0013 1835 858 gene locus_tag LOCUS_01480 1835 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4406 1995 gene locus_tag LOCUS_01490 gene ftsH 4406 1995 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120515.1 protein_id gnl|my_center|LOCUS_01490 5080 6666 gene locus_tag LOCUS_01500 gene pckA 5080 6666 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405091.1 protein_id gnl|my_center|LOCUS_01500 7127 8560 gene locus_tag LOCUS_01510 gene uxaC 7127 8560 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477444.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence0014 <1 1444 gene locus_tag LOCUS_01520 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein 1624 4431 gene locus_tag LOCUS_01530 1624 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 4971 6266 gene locus_tag LOCUS_01540 4971 6266 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_01540 6470 8539 gene locus_tag LOCUS_01550 6470 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence0015 2677 3267 gene locus_tag LOCUS_01560 2677 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_01560 3661 4749 gene locus_tag LOCUS_01570 3661 4749 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329092.1 protein_id gnl|my_center|LOCUS_01570 4796 5350 gene locus_tag LOCUS_01580 4796 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence0016 5378 2436 gene locus_tag LOCUS_01590 5378 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 6727 5606 gene locus_tag LOCUS_01600 6727 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 7074 7310 gene locus_tag LOCUS_01610 7074 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence0017 123 1460 gene locus_tag LOCUS_01620 123 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 1482 2672 gene locus_tag LOCUS_01630 1482 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 2759 3361 gene locus_tag LOCUS_01640 2759 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4199 3498 gene locus_tag LOCUS_01650 4199 3498 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_01650 6181 4436 gene locus_tag LOCUS_01660 6181 4436 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence0018 1116 802 gene locus_tag LOCUS_01670 1116 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1534 1175 gene locus_tag LOCUS_01680 1534 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3400 2186 gene locus_tag LOCUS_01690 3400 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 6033 3391 gene locus_tag LOCUS_01700 6033 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 6371 6141 gene locus_tag LOCUS_01710 6371 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 6802 6635 gene locus_tag LOCUS_01720 6802 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7509 6799 gene locus_tag LOCUS_01730 7509 6799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7937 7587 gene locus_tag LOCUS_01740 7937 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8075 8440 gene locus_tag LOCUS_01750 8075 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 >Feature sequence0019 <1 768 gene locus_tag LOCUS_01760 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120943.1:dihydropteroate synthase 765 2117 gene locus_tag LOCUS_01770 765 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2147 3046 gene locus_tag LOCUS_01780 2147 3046 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_01780 3154 4011 gene locus_tag LOCUS_01790 3154 4011 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_01790 4096 4941 gene locus_tag LOCUS_01800 4096 4941 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_01800 5067 5912 gene locus_tag LOCUS_01810 5067 5912 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_01810 6007 6855 gene locus_tag LOCUS_01820 6007 6855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence0020 <1 665 gene locus_tag LOCUS_01830 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942727.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase 662 1228 gene locus_tag LOCUS_01840 662 1228 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383606.1 protein_id gnl|my_center|LOCUS_01840 1349 1972 gene locus_tag LOCUS_01850 1349 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 1963 2973 gene locus_tag LOCUS_01860 gene rfaD 1963 2973 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391026.1 protein_id gnl|my_center|LOCUS_01860 3936 3169 gene locus_tag LOCUS_01870 3936 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 4472 4041 gene locus_tag LOCUS_01880 4472 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 6799 4469 gene locus_tag LOCUS_01890 6799 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 8032 7205 gene locus_tag LOCUS_01900 8032 7205 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942562.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence0021 216 1166 gene locus_tag LOCUS_01910 216 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1066 1878 gene locus_tag LOCUS_01920 1066 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 1926 3026 gene locus_tag LOCUS_01930 1926 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 3122 3481 gene locus_tag LOCUS_01940 3122 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3444 3866 gene locus_tag LOCUS_01950 3444 3866 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008115.1 protein_id gnl|my_center|LOCUS_01950 3867 4082 gene locus_tag LOCUS_01960 3867 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4153 4869 gene locus_tag LOCUS_01970 4153 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 4976 6064 gene locus_tag LOCUS_01980 4976 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 6303 6467 gene locus_tag LOCUS_01990 6303 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 7863 7789 gene locus_tag LOCUS_t00030 7863 7789 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0022 1536 829 gene locus_tag LOCUS_02000 1536 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 3299 2628 gene locus_tag LOCUS_02010 3299 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3891 3412 gene locus_tag LOCUS_02020 3891 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4836 4180 gene locus_tag LOCUS_02030 4836 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 5160 4975 gene locus_tag LOCUS_02040 5160 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5825 5262 gene locus_tag LOCUS_02050 5825 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6583 5849 gene locus_tag LOCUS_02060 6583 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 7891 6695 gene locus_tag LOCUS_02070 7891 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence0023 1686 3902 gene locus_tag LOCUS_02080 1686 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4084 6741 gene locus_tag LOCUS_02090 4084 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6784 6990 gene locus_tag LOCUS_02100 6784 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence0024 <1 749 gene locus_tag LOCUS_02110 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584016.1:serpin family protein 1066 2094 gene locus_tag LOCUS_02120 1066 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 2396 3937 gene locus_tag LOCUS_02130 2396 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4237 5832 gene locus_tag LOCUS_02140 4237 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5893 7569 gene locus_tag LOCUS_02150 5893 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence0025 6257 4839 gene locus_tag LOCUS_02160 6257 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7291 6404 gene locus_tag LOCUS_02170 gene thyX 7291 6404 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228435.1 protein_id gnl|my_center|LOCUS_02170 <8228 7498 gene locus_tag LOCUS_02180 <8228 7498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123470.1:protein-disulfide reductase DsbD family protein >Feature sequence0026 1183 422 gene locus_tag LOCUS_02190 1183 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 1657 2142 gene locus_tag LOCUS_02200 1657 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2238 2612 gene locus_tag LOCUS_02210 2238 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2650 3096 gene locus_tag LOCUS_02220 2650 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 6489 3616 gene locus_tag LOCUS_02230 6489 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence0027 457 2217 gene locus_tag LOCUS_02240 457 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 2225 2875 gene locus_tag LOCUS_02250 2225 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2897 4219 gene locus_tag LOCUS_02260 2897 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4469 5254 gene locus_tag LOCUS_02270 gene hisF 4469 5254 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_02270 5584 6735 gene locus_tag LOCUS_02280 5584 6735 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence0028 2316 616 gene locus_tag LOCUS_02290 2316 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 4459 2462 gene locus_tag LOCUS_02300 4459 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 6551 4605 gene locus_tag LOCUS_02310 6551 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 <8070 6576 gene locus_tag LOCUS_02320 <8070 6576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990818.1:formylglycine-generating enzyme family protein >Feature sequence0029 47 553 gene locus_tag LOCUS_02330 47 553 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_02330 656 1405 gene locus_tag LOCUS_02340 656 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 1748 2854 gene locus_tag LOCUS_02350 1748 2854 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922020.1 protein_id gnl|my_center|LOCUS_02350 3175 3702 gene locus_tag LOCUS_02360 3175 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6061 3833 gene locus_tag LOCUS_02370 6061 3833 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922366.1 protein_id gnl|my_center|LOCUS_02370 7546 6533 gene locus_tag LOCUS_02380 7546 6533 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence0030 615 1295 gene locus_tag LOCUS_02390 615 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 1405 2247 gene locus_tag LOCUS_02400 1405 2247 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123954.1 protein_id gnl|my_center|LOCUS_02400 3638 2379 gene locus_tag LOCUS_02410 3638 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4002 3730 gene locus_tag LOCUS_02420 4002 3730 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_02420 5490 4045 gene locus_tag LOCUS_02430 5490 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 7184 5805 gene locus_tag LOCUS_02440 gene thrC 7184 5805 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_02440 >Feature sequence0031 580 281 gene locus_tag LOCUS_02450 580 281 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324356.1 protein_id gnl|my_center|LOCUS_02450 1054 737 gene locus_tag LOCUS_02460 1054 737 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_02460 1949 1218 gene locus_tag LOCUS_02470 1949 1218 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333582.1 protein_id gnl|my_center|LOCUS_02470 2439 3440 gene locus_tag LOCUS_02480 2439 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3506 4141 gene locus_tag LOCUS_02490 3506 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 4780 5886 gene locus_tag LOCUS_02500 gene dnaN 4780 5886 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427747.1 protein_id gnl|my_center|LOCUS_02500 5907 7019 gene locus_tag LOCUS_02510 5907 7019 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_02510 7179 7529 gene locus_tag LOCUS_02520 7179 7529 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence0032 2022 2213 gene locus_tag LOCUS_02530 2022 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3253 2462 gene locus_tag LOCUS_02540 3253 2462 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325327.1 protein_id gnl|my_center|LOCUS_02540 3946 3386 gene locus_tag LOCUS_02550 gene pyrE 3946 3386 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_02550 6067 4196 gene locus_tag LOCUS_02560 6067 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 <7845 6281 gene locus_tag LOCUS_02570 <7845 6281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334446.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence0033 1625 513 gene locus_tag LOCUS_02580 1625 513 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_02580 2076 2984 gene locus_tag LOCUS_02590 2076 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3266 4291 gene locus_tag LOCUS_02600 3266 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 6234 4549 gene locus_tag LOCUS_02610 6234 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 7316 6516 gene locus_tag LOCUS_02620 7316 6516 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922274.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence0034 363 941 gene locus_tag LOCUS_02630 363 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 1168 1845 gene locus_tag LOCUS_02640 1168 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3661 2216 gene locus_tag LOCUS_02650 3661 2216 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_02650 4273 7530 gene locus_tag LOCUS_02660 4273 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence0035 2510 1440 gene locus_tag LOCUS_02670 2510 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence0036 502 2895 gene locus_tag LOCUS_02680 502 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02680 2948 3472 gene locus_tag LOCUS_02690 2948 3472 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_02690 4109 3597 gene locus_tag LOCUS_02700 4109 3597 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_02700 5801 4278 gene locus_tag LOCUS_02710 5801 4278 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122265.1 protein_id gnl|my_center|LOCUS_02710 6972 5851 gene locus_tag LOCUS_02720 6972 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 7397 7047 gene locus_tag LOCUS_02730 7397 7047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 >Feature sequence0037 218 90 gene locus_tag LOCUS_02740 218 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 1472 627 gene locus_tag LOCUS_02750 1472 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02750 3484 1388 gene locus_tag LOCUS_02760 3484 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02760 5321 3675 gene locus_tag LOCUS_02770 5321 3675 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_02770 6276 5512 gene locus_tag LOCUS_02780 6276 5512 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_02780 6439 7209 gene locus_tag LOCUS_02790 gene ubiE 6439 7209 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence0038 <1 628 gene locus_tag LOCUS_02800 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339966.1:ribosome recycling factor 1089 2651 gene locus_tag LOCUS_02810 gene rny 1089 2651 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325643.1 protein_id gnl|my_center|LOCUS_02810 3968 2754 gene locus_tag LOCUS_02820 gene ribA 3968 2754 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123761.1 protein_id gnl|my_center|LOCUS_02820 4400 5275 gene locus_tag LOCUS_02830 4400 5275 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_02830 5417 7102 gene locus_tag LOCUS_02840 5417 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence0039 1952 270 gene locus_tag LOCUS_02850 1952 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 3058 2003 gene locus_tag LOCUS_02860 gene gmd 3058 2003 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_02860 4304 3321 gene locus_tag LOCUS_02870 4304 3321 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_02870 5730 4702 gene locus_tag LOCUS_02880 gene dusB 5730 4702 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334998.1 protein_id gnl|my_center|LOCUS_02880 6169 7155 gene locus_tag LOCUS_02890 6169 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence0040 27 1829 gene locus_tag LOCUS_02900 gene aspS 27 1829 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121776.1 protein_id gnl|my_center|LOCUS_02900 1968 2789 gene locus_tag LOCUS_02910 1968 2789 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121000.1 protein_id gnl|my_center|LOCUS_02910 2937 6521 gene locus_tag LOCUS_02920 gene ileS 2937 6521 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434976.1 protein_id gnl|my_center|LOCUS_02920 6657 7322 gene locus_tag LOCUS_02930 gene purN 6657 7322 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence0041 1001 2494 gene locus_tag LOCUS_02940 gene gnd 1001 2494 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119037.1 protein_id gnl|my_center|LOCUS_02940 2812 4839 gene locus_tag LOCUS_02950 2812 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4970 6484 gene locus_tag LOCUS_02960 4970 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence0042 190 2361 gene locus_tag LOCUS_02970 gene metG 190 2361 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120499.1 protein_id gnl|my_center|LOCUS_02970 2479 3723 gene locus_tag LOCUS_02980 2479 3723 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383518.1 protein_id gnl|my_center|LOCUS_02980 3720 4538 gene locus_tag LOCUS_02990 3720 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776583.1 protein_id gnl|my_center|LOCUS_02990 4513 4938 gene locus_tag LOCUS_03000 4513 4938 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691751.1 protein_id gnl|my_center|LOCUS_03000 6946 5054 gene locus_tag LOCUS_03010 6946 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence0043 649 1686 gene locus_tag LOCUS_03020 649 1686 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336191.1 protein_id gnl|my_center|LOCUS_03020 1683 2573 gene locus_tag LOCUS_03030 1683 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2570 5152 gene locus_tag LOCUS_03040 2570 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5331 6617 gene locus_tag LOCUS_03050 5331 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 >Feature sequence0044 1855 959 gene locus_tag LOCUS_03060 1855 959 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_03060 2399 1950 gene locus_tag LOCUS_03070 2399 1950 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_03070 4649 2592 gene locus_tag LOCUS_03080 4649 2592 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_03080 5542 4691 gene locus_tag LOCUS_03090 5542 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6535 5576 gene locus_tag LOCUS_03100 6535 5576 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922059.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence0045 1917 733 gene locus_tag LOCUS_03110 1917 733 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_03110 4158 2014 gene locus_tag LOCUS_03120 4158 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5678 4248 gene locus_tag LOCUS_03130 5678 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence0046 <1 2391 gene locus_tag LOCUS_03140 <1 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_111257634.1:alpha-galactosidase 2593 4695 gene locus_tag LOCUS_03150 2593 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence0047 451 4161 gene locus_tag LOCUS_03160 gene dnaE 451 4161 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119187.1 protein_id gnl|my_center|LOCUS_03160 4244 5407 gene locus_tag LOCUS_03170 4244 5407 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765249.1 protein_id gnl|my_center|LOCUS_03170 <6939 5650 gene locus_tag LOCUS_03180 <6939 5650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162490120.1:phenylacetate--CoA ligase >Feature sequence0048 1020 262 gene locus_tag LOCUS_03190 1020 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4385 1077 gene locus_tag LOCUS_03200 4385 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5269 4601 gene locus_tag LOCUS_03210 5269 4601 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_03210 5589 5659 gene locus_tag LOCUS_t00040 5589 5659 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6690 5818 gene locus_tag LOCUS_03220 6690 5818 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0049 2 970 gene locus_tag LOCUS_03230 2 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 1405 2601 gene locus_tag LOCUS_03240 1405 2601 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168149.1 protein_id gnl|my_center|LOCUS_03240 3192 4196 gene locus_tag LOCUS_03250 3192 4196 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_03250 4646 4870 gene locus_tag LOCUS_03260 4646 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812685.1 protein_id gnl|my_center|LOCUS_03260 5162 5755 gene locus_tag LOCUS_03270 5162 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence0050 665 96 gene locus_tag LOCUS_03280 gene gmk 665 96 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_03280 1596 691 gene locus_tag LOCUS_03290 1596 691 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_03290 2101 1715 gene locus_tag LOCUS_03300 2101 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3206 2451 gene locus_tag LOCUS_03310 gene tpiA 3206 2451 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121241.1 protein_id gnl|my_center|LOCUS_03310 4305 5468 gene locus_tag LOCUS_03320 4305 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 >Feature sequence0051 447 1433 gene locus_tag LOCUS_03330 447 1433 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_03330 3932 1917 gene locus_tag LOCUS_03340 3932 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5384 4158 gene locus_tag LOCUS_03350 5384 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6653 5892 gene locus_tag LOCUS_03360 6653 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence0052 <1 806 gene locus_tag LOCUS_03370 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933759.1:ABC transporter ATP-binding protein 1129 2436 gene locus_tag LOCUS_03380 gene ahcY 1129 2436 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327756.1 protein_id gnl|my_center|LOCUS_03380 2645 3952 gene locus_tag LOCUS_03390 2645 3952 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_03390 4288 6570 gene locus_tag LOCUS_03400 4288 6570 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615514.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence0053 3431 2313 gene locus_tag LOCUS_03410 3431 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 3382 3549 gene locus_tag LOCUS_03420 3382 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 5308 3920 gene locus_tag LOCUS_03430 5308 3920 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence0054 1121 762 gene locus_tag LOCUS_03440 1121 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 2552 1224 gene locus_tag LOCUS_03450 gene pgl 2552 1224 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_03450 6040 3098 gene locus_tag LOCUS_03460 6040 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 >Feature sequence0055 1658 414 gene locus_tag LOCUS_03470 1658 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2983 1958 gene locus_tag LOCUS_03480 2983 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 3634 3038 gene locus_tag LOCUS_03490 gene leuD 3634 3038 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330456.1 protein_id gnl|my_center|LOCUS_03490 5252 3819 gene locus_tag LOCUS_03500 gene leuC 5252 3819 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence0056 816 1238 gene locus_tag LOCUS_03510 816 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1264 1821 gene locus_tag LOCUS_03520 1264 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2194 5430 gene locus_tag LOCUS_03530 2194 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 >Feature sequence0057 1578 364 gene locus_tag LOCUS_03540 gene rhaT 1578 364 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209111.1 protein_id gnl|my_center|LOCUS_03540 1872 3281 gene locus_tag LOCUS_03550 1872 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3654 6230 gene locus_tag LOCUS_03560 3654 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence0058 1734 3116 gene locus_tag LOCUS_03570 1734 3116 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119953.1 protein_id gnl|my_center|LOCUS_03570 <6326 3313 gene locus_tag LOCUS_03580 <6326 3313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119226.1:MMPL family transporter >Feature sequence0059 418 1098 gene locus_tag LOCUS_03590 gene purN 418 1098 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_03590 1253 2821 gene locus_tag LOCUS_03600 1253 2821 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_03600 3150 5369 gene locus_tag LOCUS_03610 3150 5369 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329904.1 protein_id gnl|my_center|LOCUS_03610 6088 5474 gene locus_tag LOCUS_03620 6088 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence0060 2721 598 gene locus_tag LOCUS_03630 gene pnp 2721 598 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_03630 3465 3184 gene locus_tag LOCUS_03640 gene rpsO 3465 3184 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence0061 >Feature sequence0062 708 31 gene locus_tag LOCUS_03650 708 31 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253659.1 protein_id gnl|my_center|LOCUS_03650 1466 825 gene locus_tag LOCUS_03660 1466 825 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210395.1 protein_id gnl|my_center|LOCUS_03660 2123 1563 gene locus_tag LOCUS_03670 2123 1563 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209079.1 protein_id gnl|my_center|LOCUS_03670 2790 2206 gene locus_tag LOCUS_03680 2790 2206 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003383243.1 protein_id gnl|my_center|LOCUS_03680 3767 3207 gene locus_tag LOCUS_03690 3767 3207 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266647.1 protein_id gnl|my_center|LOCUS_03690 4085 4012 gene locus_tag LOCUS_t00050 4085 4012 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4739 4224 gene locus_tag LOCUS_03700 gene coaD 4739 4224 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_03700 >Feature sequence0063 2230 1013 gene locus_tag LOCUS_03710 2230 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5402 2394 gene locus_tag LOCUS_03720 5402 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence0064 1193 2356 gene locus_tag LOCUS_03730 1193 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2709 4037 gene locus_tag LOCUS_03740 2709 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4434 4964 gene locus_tag LOCUS_03750 4434 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5531 5136 gene locus_tag LOCUS_03760 5531 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence0065 1436 516 gene locus_tag LOCUS_03770 gene rbsK 1436 516 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761960.1 protein_id gnl|my_center|LOCUS_03770 2513 1539 gene locus_tag LOCUS_03780 2513 1539 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921666.1 protein_id gnl|my_center|LOCUS_03780 3559 2798 gene locus_tag LOCUS_03790 3559 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 <6192 3767 gene locus_tag LOCUS_03800 <6192 3767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence0066 385 2253 gene locus_tag LOCUS_03810 385 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 4549 3128 gene locus_tag LOCUS_03820 4549 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4647 4916 gene locus_tag LOCUS_03830 4647 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 <6184 5020 gene locus_tag LOCUS_03840 <6184 5020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788556.1:transglutaminase domain-containing protein >Feature sequence0067 <1 943 gene locus_tag LOCUS_03850 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099262999.1:phosphatidate cytidylyltransferase 1161 2093 gene locus_tag LOCUS_03860 1161 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2375 3334 gene locus_tag LOCUS_03870 2375 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3531 4841 gene locus_tag LOCUS_03880 3531 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 4828 6015 gene locus_tag LOCUS_03890 4828 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence0068 303 1154 gene locus_tag LOCUS_03900 303 1154 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_03900 1259 2308 gene locus_tag LOCUS_03910 1259 2308 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798976.1 protein_id gnl|my_center|LOCUS_03910 2391 3221 gene locus_tag LOCUS_03920 2391 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 3218 4126 gene locus_tag LOCUS_03930 3218 4126 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_03930 4297 4500 gene locus_tag LOCUS_03940 4297 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5447 4659 gene locus_tag LOCUS_03950 5447 4659 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence0069 <1 2137 gene locus_tag LOCUS_03960 <1 2137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080411.1:alpha-L-rhamnosidase 2365 2725 gene locus_tag LOCUS_tm00010 2365 2725 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3136 4044 gene locus_tag LOCUS_03970 3136 4044 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121326.1 protein_id gnl|my_center|LOCUS_03970 4232 4305 gene locus_tag LOCUS_t00060 4232 4305 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4816 4889 gene locus_tag LOCUS_t00070 4816 4889 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0070 686 54 gene locus_tag LOCUS_03980 686 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 2431 1376 gene locus_tag LOCUS_03990 2431 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2754 2464 gene locus_tag LOCUS_04000 2754 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2996 4363 gene locus_tag LOCUS_04010 2996 4363 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_04010 4681 5994 gene locus_tag LOCUS_04020 4681 5994 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence0071 463 2004 gene locus_tag LOCUS_04030 gene lysS 463 2004 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672011.1 protein_id gnl|my_center|LOCUS_04030 2410 4293 gene locus_tag LOCUS_04040 2410 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 4500 5978 gene locus_tag LOCUS_04050 4500 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence0072 221 424 gene locus_tag LOCUS_04060 221 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 657 1868 gene locus_tag LOCUS_04070 657 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1936 3291 gene locus_tag LOCUS_04080 1936 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence0073 546 875 gene locus_tag LOCUS_04090 gene rplK 546 875 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_04090 990 1676 gene locus_tag LOCUS_04100 gene rplA 990 1676 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_04100 1727 2125 gene locus_tag LOCUS_04110 gene rplJ 1727 2125 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04110 2484 2891 gene locus_tag LOCUS_04120 gene rplL 2484 2891 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324459.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence0074 408 830 gene locus_tag LOCUS_04130 408 830 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_04130 2402 1200 gene locus_tag LOCUS_04140 2402 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3875 2577 gene locus_tag LOCUS_04150 3875 2577 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_04150 4234 5430 gene locus_tag LOCUS_04160 4234 5430 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122217.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence0075 55 300 gene locus_tag LOCUS_04170 55 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1550 378 gene locus_tag LOCUS_04180 gene hydE 1550 378 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_04180 1836 2525 gene locus_tag LOCUS_04190 1836 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2802 4847 gene locus_tag LOCUS_04200 2802 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4901 5176 gene locus_tag LOCUS_04210 4901 5176 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence0076 471 659 gene locus_tag LOCUS_04220 471 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 875 1468 gene locus_tag LOCUS_04230 875 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 3340 1862 gene locus_tag LOCUS_04240 3340 1862 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence0077 1056 214 gene locus_tag LOCUS_04250 gene recO 1056 214 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119985.1 protein_id gnl|my_center|LOCUS_04250 1427 1502 gene locus_tag LOCUS_t00080 1427 1502 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3301 1805 gene locus_tag LOCUS_04260 3301 1805 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921975.1 protein_id gnl|my_center|LOCUS_04260 5681 3420 gene locus_tag LOCUS_04270 5681 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence0078 1676 1362 gene locus_tag LOCUS_04280 gene groES 1676 1362 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_04280 3493 1895 gene locus_tag LOCUS_04290 gene groL 3493 1895 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615436.1 protein_id gnl|my_center|LOCUS_04290 4656 4210 gene locus_tag LOCUS_04300 4656 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 <5948 4987 gene locus_tag LOCUS_04310 <5948 4987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099284.1:4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase >Feature sequence0079 1800 1339 gene locus_tag LOCUS_04320 1800 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2157 1816 gene locus_tag LOCUS_04330 2157 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2438 2190 gene locus_tag LOCUS_04340 2438 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 2777 2442 gene locus_tag LOCUS_04350 2777 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3071 2778 gene locus_tag LOCUS_04360 3071 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4991 3075 gene locus_tag LOCUS_04370 4991 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence0080 74 442 gene locus_tag LOCUS_04380 74 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 768 4118 gene locus_tag LOCUS_04390 768 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4343 5803 gene locus_tag LOCUS_04400 4343 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence0081 533 1708 gene locus_tag LOCUS_04410 gene galK 533 1708 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_04410 2303 1845 gene locus_tag LOCUS_04420 gene rpiB 2303 1845 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04420 3872 2595 gene locus_tag LOCUS_04430 gene clpX 3872 2595 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324828.1 protein_id gnl|my_center|LOCUS_04430 4761 4387 gene locus_tag LOCUS_04440 4761 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence0082 1574 450 gene locus_tag LOCUS_04450 1574 450 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_04450 2488 1973 gene locus_tag LOCUS_04460 2488 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3665 2529 gene locus_tag LOCUS_04470 3665 2529 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337669.1 protein_id gnl|my_center|LOCUS_04470 <5825 4103 gene locus_tag LOCUS_04480 <5825 4103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260976.1:preprotein translocase subunit SecA >Feature sequence0083 709 1452 gene locus_tag LOCUS_04490 709 1452 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_04490 1486 2457 gene locus_tag LOCUS_04500 1486 2457 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037025.1 protein_id gnl|my_center|LOCUS_04500 2635 3645 gene locus_tag LOCUS_04510 gene argC 2635 3645 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_04510 3911 5245 gene locus_tag LOCUS_04520 3911 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence0084 <1 913 gene locus_tag LOCUS_04530 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932803.1:CRISPR-associated protein Cas4 998 2029 gene locus_tag LOCUS_04540 gene cas1c 998 2029 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_04540 2111 2401 gene locus_tag LOCUS_04550 gene cas2 2111 2401 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_04550 2776 4125 gene locus_tag LOCUS_04560 2776 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 <5782 4333 gene locus_tag LOCUS_04570 <5782 4333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922374.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence0085 564 1868 gene locus_tag LOCUS_04580 564 1868 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_04580 2106 3029 gene locus_tag LOCUS_04590 2106 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3039 3407 gene locus_tag LOCUS_04600 3039 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4431 3508 gene locus_tag LOCUS_04610 4431 3508 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328629.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence0086 356 90 gene locus_tag LOCUS_04620 356 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1118 2521 gene locus_tag LOCUS_04630 1118 2521 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_04630 2776 3372 gene locus_tag LOCUS_04640 2776 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3528 5696 gene locus_tag LOCUS_04650 3528 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence0087 703 422 gene locus_tag LOCUS_04660 703 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 1127 2881 gene locus_tag LOCUS_04670 1127 2881 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119613.1 protein_id gnl|my_center|LOCUS_04670 3085 3975 gene locus_tag LOCUS_04680 3085 3975 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_04680 4639 5001 gene locus_tag LOCUS_04690 4639 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 >Feature sequence0088 204 28 gene locus_tag LOCUS_04700 204 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 492 1097 gene locus_tag LOCUS_04710 492 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1515 3155 gene locus_tag LOCUS_04720 1515 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 3283 3579 gene locus_tag LOCUS_04730 3283 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3600 4652 gene locus_tag LOCUS_04740 3600 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4836 5315 gene locus_tag LOCUS_04750 4836 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence0089 2126 312 gene locus_tag LOCUS_04760 2126 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4105 2402 gene locus_tag LOCUS_04770 4105 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 <5693 4364 gene locus_tag LOCUS_04780 <5693 4364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118443.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0090 335 3481 gene locus_tag LOCUS_04790 335 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4201 3566 gene locus_tag LOCUS_04800 4201 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615698.1 protein_id gnl|my_center|LOCUS_04800 5053 4496 gene locus_tag LOCUS_04810 5053 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5280 5354 gene locus_tag LOCUS_t00090 5280 5354 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0091 <1 890 gene locus_tag LOCUS_04820 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122269.1:sugar phosphate isomerase/epimerase 1685 1284 gene locus_tag LOCUS_04830 1685 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2201 1803 gene locus_tag LOCUS_04840 2201 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3834 2473 gene locus_tag LOCUS_04850 3834 2473 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118279.1 protein_id gnl|my_center|LOCUS_04850 4835 4035 gene locus_tag LOCUS_04860 4835 4035 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_04860 5217 5558 gene locus_tag LOCUS_04870 5217 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence0092 1918 4581 gene locus_tag LOCUS_04880 1918 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence0093 2301 1831 gene locus_tag LOCUS_04890 gene arfB 2301 1831 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090218.1 protein_id gnl|my_center|LOCUS_04890 2701 3015 gene locus_tag LOCUS_04900 2701 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04900 3156 3959 gene locus_tag LOCUS_04910 3156 3959 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_04910 4106 5410 gene locus_tag LOCUS_04920 4106 5410 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence0094 214 351 gene locus_tag LOCUS_04930 214 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 981 493 gene locus_tag LOCUS_04940 981 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2284 1163 gene locus_tag LOCUS_04950 2284 1163 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_04950 2966 4681 gene locus_tag LOCUS_04960 2966 4681 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence0095 478 3333 gene locus_tag LOCUS_04970 478 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4546 3437 gene locus_tag LOCUS_04980 4546 3437 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014978.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence0096 980 456 gene locus_tag LOCUS_04990 980 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2287 1067 gene locus_tag LOCUS_05000 2287 1067 CDS product PepSY-associated TM helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203740.1 protein_id gnl|my_center|LOCUS_05000 2880 2392 gene locus_tag LOCUS_05010 2880 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3302 2937 gene locus_tag LOCUS_05020 3302 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3835 3326 gene locus_tag LOCUS_05030 3835 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 5030 3843 gene locus_tag LOCUS_05040 5030 3843 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921857.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence0097 <1 544 gene locus_tag LOCUS_05050 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932918.1:4Fe-4S dicluster domain-containing protein 613 1443 gene locus_tag LOCUS_05060 613 1443 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_05060 2002 1544 gene locus_tag LOCUS_05070 2002 1544 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680115.1 protein_id gnl|my_center|LOCUS_05070 4010 2163 gene locus_tag LOCUS_05080 4010 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence0098 904 341 gene locus_tag LOCUS_05090 gene ruvC 904 341 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_05090 2228 1221 gene locus_tag LOCUS_05100 2228 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 3122 3307 gene locus_tag LOCUS_05110 gene rpmF 3122 3307 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_05110 3591 4484 gene locus_tag LOCUS_05120 gene fabD 3591 4484 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117846.1 protein_id gnl|my_center|LOCUS_05120 4669 5436 gene locus_tag LOCUS_05130 gene fabG 4669 5436 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324898.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence0099 1245 529 gene locus_tag LOCUS_05140 1245 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2630 1416 gene locus_tag LOCUS_05150 2630 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4120 3014 gene locus_tag LOCUS_05160 4120 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence0100 >Feature sequence0101 849 1379 gene locus_tag LOCUS_05170 849 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3045 1348 gene locus_tag LOCUS_05180 3045 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3489 3067 gene locus_tag LOCUS_05190 3489 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3782 3570 gene locus_tag LOCUS_05200 3782 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence0102 1120 608 gene locus_tag LOCUS_05210 gene purE 1120 608 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222903.1 protein_id gnl|my_center|LOCUS_05210 1766 4156 gene locus_tag LOCUS_05220 1766 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence0103 1734 202 gene locus_tag LOCUS_05230 1734 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2300 5011 gene locus_tag LOCUS_05240 2300 5011 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121080.1 protein_id gnl|my_center|LOCUS_05240 5360 5160 gene locus_tag LOCUS_05250 5360 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence0104 <1 533 gene locus_tag LOCUS_05260 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016326127.1:galactose mutarotase 827 1153 gene locus_tag LOCUS_05270 827 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_05270 1531 2862 gene locus_tag LOCUS_05280 1531 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2866 3999 gene locus_tag LOCUS_05290 2866 3999 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192197.1 protein_id gnl|my_center|LOCUS_05290 4028 4726 gene locus_tag LOCUS_05300 4028 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence0105 513 587 gene locus_tag LOCUS_t00100 513 587 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 871 2073 gene locus_tag LOCUS_05310 871 2073 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330812.1 protein_id gnl|my_center|LOCUS_05310 2540 2875 gene locus_tag LOCUS_05320 2540 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2989 5085 gene locus_tag LOCUS_05330 gene uvrB 2989 5085 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0106 >Feature sequence0107 234 1088 gene locus_tag LOCUS_05340 234 1088 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120816.1 protein_id gnl|my_center|LOCUS_05340 1440 2072 gene locus_tag LOCUS_05350 1440 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2430 3161 gene locus_tag LOCUS_05360 2430 3161 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_05360 3629 4960 gene locus_tag LOCUS_05370 3629 4960 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence0108 440 769 gene locus_tag LOCUS_05380 440 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 1044 2090 gene locus_tag LOCUS_05390 1044 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3593 2199 gene locus_tag LOCUS_05400 gene mgtE 3593 2199 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence0109 1516 731 gene locus_tag LOCUS_05410 1516 731 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_05410 3203 1824 gene locus_tag LOCUS_05420 3203 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_05420 4567 3485 gene locus_tag LOCUS_05430 4567 3485 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785904.1 protein_id gnl|my_center|LOCUS_05430 5162 4671 gene locus_tag LOCUS_05440 5162 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence0110 1316 1606 gene locus_tag LOCUS_05450 1316 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2045 1839 gene locus_tag LOCUS_05460 2045 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3451 4164 gene locus_tag LOCUS_05470 3451 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence0111 643 2103 gene locus_tag LOCUS_05480 643 2103 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108686.1 protein_id gnl|my_center|LOCUS_05480 2360 4234 gene locus_tag LOCUS_05490 2360 4234 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_05490 <5196 4596 gene locus_tag LOCUS_05500 <5196 4596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786655.1:exo-alpha-sialidase note possible pseudo, internal stop codon >Feature sequence0112 398 183 gene locus_tag LOCUS_05510 398 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1951 623 gene locus_tag LOCUS_05520 1951 623 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329380.1 protein_id gnl|my_center|LOCUS_05520 4013 2304 gene locus_tag LOCUS_05530 4013 2304 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_05530 <5189 4318 gene locus_tag LOCUS_05540 <5189 4318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329383.1:type IV pilus twitching motility protein PilT >Feature sequence0113 3370 1580 gene locus_tag LOCUS_05550 3370 1580 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_05550 4499 3651 gene locus_tag LOCUS_05560 4499 3651 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_05560 5049 4588 gene locus_tag LOCUS_05570 5049 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence0114 2 250 gene locus_tag LOCUS_05580 2 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 626 928 gene locus_tag LOCUS_05590 626 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 961 1773 gene locus_tag LOCUS_05600 961 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1778 2230 gene locus_tag LOCUS_05610 1778 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2268 4184 gene locus_tag LOCUS_05620 2268 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence0115 453 1718 gene locus_tag LOCUS_05630 453 1718 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119461.1 protein_id gnl|my_center|LOCUS_05630 1894 2934 gene locus_tag LOCUS_05640 1894 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 3294 5063 gene locus_tag LOCUS_05650 3294 5063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence0116 752 393 gene locus_tag LOCUS_05660 752 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1456 788 gene locus_tag LOCUS_05670 1456 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence0117 163 2646 gene locus_tag LOCUS_05680 163 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2945 4801 gene locus_tag LOCUS_05690 2945 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence0118 344 958 gene locus_tag LOCUS_05700 344 958 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_05700 1242 2981 gene locus_tag LOCUS_05710 1242 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3360 3121 gene locus_tag LOCUS_05720 3360 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3835 3518 gene locus_tag LOCUS_05730 3835 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 <5131 4175 gene locus_tag LOCUS_05740 <5131 4175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121913.1:aminopeptidase P family protein >Feature sequence0119 <5126 3923 gene locus_tag LOCUS_05750 <5126 3923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525278.1:autotransporter domain-containing protein >Feature sequence0120 359 2254 gene locus_tag LOCUS_05760 359 2254 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence0121 794 2596 gene locus_tag LOCUS_05770 794 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2627 2902 gene locus_tag LOCUS_05780 2627 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3152 3078 gene locus_tag LOCUS_t00110 3152 3078 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3669 4868 gene locus_tag LOCUS_05790 3669 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence0122 302 2899 gene locus_tag LOCUS_05800 302 2899 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330940.1 protein_id gnl|my_center|LOCUS_05800 2949 3515 gene locus_tag LOCUS_05810 2949 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 3687 4643 gene locus_tag LOCUS_05820 3687 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence0123 894 2150 gene locus_tag LOCUS_05830 894 2150 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121149.1 protein_id gnl|my_center|LOCUS_05830 2317 2490 gene locus_tag LOCUS_05840 2317 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 2522 2740 gene locus_tag LOCUS_05850 2522 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3532 2957 gene locus_tag LOCUS_05860 3532 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 <5078 3529 gene locus_tag LOCUS_05870 <5078 3529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951379.1:DNA cytosine methyltransferase >Feature sequence0124 872 1180 gene locus_tag LOCUS_05880 872 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1180 3966 gene locus_tag LOCUS_05890 1180 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence0125 <1 1337 gene locus_tag LOCUS_05900 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406318.1:efflux RND transporter periplasmic adaptor subunit 1172 1080 gene locus_tag LOCUS_t00120 1172 1080 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1357 4578 gene locus_tag LOCUS_05910 gene mexB 1357 4578 CDS product multidrug efflux RND transporter permease subunit MexB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107312.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence0126 595 1899 gene locus_tag LOCUS_05920 595 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2422 2604 gene locus_tag LOCUS_05930 2422 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3729 2920 gene locus_tag LOCUS_05940 gene idnO 3729 2920 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998695.1 protein_id gnl|my_center|LOCUS_05940 4208 3861 gene locus_tag LOCUS_05950 4208 3861 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144212.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence0127 <1 1226 gene locus_tag LOCUS_05960 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932807.1:CRISPR-associated helicase Cas3' 1498 2259 gene locus_tag LOCUS_05970 gene cas5c 1498 2259 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_05970 2256 4241 gene locus_tag LOCUS_05980 gene cas8c 2256 4241 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602912.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0128 1661 1536 gene locus_tag LOCUS_05990 1661 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3885 1699 gene locus_tag LOCUS_06000 3885 1699 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_06000 4387 4920 gene locus_tag LOCUS_06010 4387 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence0129 316 2034 gene locus_tag LOCUS_06020 316 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2031 2816 gene locus_tag LOCUS_06030 2031 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence0130 <1 1467 gene locus_tag LOCUS_06040 <1 1467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922252.1:sialate O-acetylesterase 1553 2794 gene locus_tag LOCUS_06050 1553 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3458 2850 gene locus_tag LOCUS_06060 3458 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3709 3539 gene locus_tag LOCUS_06070 3709 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4644 3775 gene locus_tag LOCUS_06080 4644 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence0131 348 923 gene locus_tag LOCUS_06090 348 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2175 1039 gene locus_tag LOCUS_06100 2175 1039 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115569.1 protein_id gnl|my_center|LOCUS_06100 2663 2343 gene locus_tag LOCUS_06110 2663 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4704 3295 gene locus_tag LOCUS_06120 4704 3295 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence0132 658 1662 gene locus_tag LOCUS_06130 658 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 1769 4465 gene locus_tag LOCUS_06140 1769 4465 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_06140 >Feature sequence0133 870 2492 gene locus_tag LOCUS_06150 gene serA 870 2492 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326392.1 protein_id gnl|my_center|LOCUS_06150 2683 4059 gene locus_tag LOCUS_06160 2683 4059 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence0134 259 519 gene locus_tag LOCUS_06170 259 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06170 1579 509 gene locus_tag LOCUS_06180 1579 509 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_06180 2443 2060 gene locus_tag LOCUS_06190 2443 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 <4913 2611 gene locus_tag LOCUS_06200 <4913 2611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615420.1:VCBS repeat-containing protein >Feature sequence0135 2716 845 gene locus_tag LOCUS_06210 2716 845 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_06210 3524 4906 gene locus_tag LOCUS_06220 3524 4906 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689268.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence0136 <1 970 gene locus_tag LOCUS_06230 <1 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121618.1:DNA mismatch repair endonuclease MutL 2681 1137 gene locus_tag LOCUS_06240 2681 1137 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_06240 <4906 3218 gene locus_tag LOCUS_06250 <4906 3218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922147.1:primosomal protein N' >Feature sequence0137 3 1214 gene locus_tag LOCUS_06260 3 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1696 1304 gene locus_tag LOCUS_06270 1696 1304 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_06270 1838 2233 gene locus_tag LOCUS_06280 1838 2233 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891857.1 protein_id gnl|my_center|LOCUS_06280 3704 2295 gene locus_tag LOCUS_06290 3704 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4618 3818 gene locus_tag LOCUS_06300 4618 3818 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence0138 <4887 3908 gene locus_tag LOCUS_06310 <4887 3908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616236.1:FAD:protein FMN transferase >Feature sequence0139 2399 981 gene locus_tag LOCUS_06320 gene hydG 2399 981 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_06320 <4845 2709 gene locus_tag LOCUS_06330 <4845 2709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259743.1:choice-of-anchor Q domain-containing protein >Feature sequence0140 2356 1334 gene locus_tag LOCUS_06340 2356 1334 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_06340 2891 2493 gene locus_tag LOCUS_06350 2891 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4658 3081 gene locus_tag LOCUS_06360 4658 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence0141 <1 660 gene locus_tag LOCUS_06370 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118627.1:TIGR00282 family metallophosphoesterase 1625 765 gene locus_tag LOCUS_06380 1625 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2683 1808 gene locus_tag LOCUS_06390 2683 1808 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_06390 <4757 2774 gene locus_tag LOCUS_06400 <4757 2774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797468.1:pyruvate formate lyase family protein >Feature sequence0142 1442 2845 gene locus_tag LOCUS_06410 1442 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence0143 >Feature sequence0144 <1 3345 gene locus_tag LOCUS_06420 <1 3345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921428.1:general secretion pathway protein GspD >Feature sequence0145 <1 1673 gene locus_tag LOCUS_06430 <1 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764577.1:YncE family protein 1859 3076 gene locus_tag LOCUS_06440 1859 3076 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203436.1 protein_id gnl|my_center|LOCUS_06440 3429 4517 gene locus_tag LOCUS_06450 3429 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence0146 1700 753 gene locus_tag LOCUS_06460 1700 753 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_06460 3094 1883 gene locus_tag LOCUS_06470 3094 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3499 3768 gene locus_tag LOCUS_06480 3499 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence0147 777 2594 gene locus_tag LOCUS_06490 777 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence0148 21 2246 gene locus_tag LOCUS_06500 21 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2419 3942 gene locus_tag LOCUS_06510 2419 3942 CDS product glycoside hydrolase family 30 beta sandwich domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108760.1 protein_id gnl|my_center|LOCUS_06510 4544 3990 gene locus_tag LOCUS_06520 4544 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0149 469 2877 gene locus_tag LOCUS_06530 469 2877 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0150 1398 247 gene locus_tag LOCUS_06540 gene proB 1398 247 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331575.1 protein_id gnl|my_center|LOCUS_06540 1894 2616 gene locus_tag LOCUS_06550 gene hisA 1894 2616 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_06550 2762 4000 gene locus_tag LOCUS_06560 2762 4000 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325817.1 protein_id gnl|my_center|LOCUS_06560 4201 4452 gene locus_tag LOCUS_06570 4201 4452 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence0151 498 836 gene locus_tag LOCUS_06580 498 836 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_06580 2551 1022 gene locus_tag LOCUS_06590 2551 1022 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938712.1 protein_id gnl|my_center|LOCUS_06590 4152 3322 gene locus_tag LOCUS_06600 4152 3322 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence0152 1236 355 gene locus_tag LOCUS_06610 gene lsrF 1236 355 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209188.1 protein_id gnl|my_center|LOCUS_06610 1982 1380 gene locus_tag LOCUS_06620 gene dhaL 1982 1380 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267780.1 protein_id gnl|my_center|LOCUS_06620 3448 2444 gene locus_tag LOCUS_06630 gene dhaK 3448 2444 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494451.1 protein_id gnl|my_center|LOCUS_06630 4288 3743 gene locus_tag LOCUS_06640 4288 3743 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence0153 256 1944 gene locus_tag LOCUS_06650 256 1944 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905537.1 protein_id gnl|my_center|LOCUS_06650 4276 2117 gene locus_tag LOCUS_06660 4276 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence0154 141 2045 gene locus_tag LOCUS_06670 141 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2057 2398 gene locus_tag LOCUS_06680 2057 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2400 3947 gene locus_tag LOCUS_06690 2400 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence0155 852 2996 gene locus_tag LOCUS_06700 852 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3134 4042 gene locus_tag LOCUS_06710 3134 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence0156 1803 952 gene locus_tag LOCUS_06720 1803 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3151 2135 gene locus_tag LOCUS_06730 3151 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence0157 341 93 gene locus_tag LOCUS_06740 341 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 568 233 gene locus_tag LOCUS_06750 568 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1189 749 gene locus_tag LOCUS_06760 1189 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2398 1298 gene locus_tag LOCUS_06770 2398 1298 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922634.1 protein_id gnl|my_center|LOCUS_06770 3216 2776 gene locus_tag LOCUS_06780 3216 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 <4520 3356 gene locus_tag LOCUS_06790 <4520 3356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122130.1:DUF1559 domain-containing protein >Feature sequence0158 102 1679 gene locus_tag LOCUS_06800 gene terL 102 1679 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_06800 1703 3040 gene locus_tag LOCUS_06810 1703 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3091 3990 gene locus_tag LOCUS_06820 3091 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence0159 <1 1257 gene locus_tag LOCUS_06830 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119960.1:TolC family protein 1441 2475 gene locus_tag LOCUS_06840 1441 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4223 2727 gene locus_tag LOCUS_06850 4223 2727 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964632.1 protein_id gnl|my_center|LOCUS_06850 4144 4063 gene locus_tag LOCUS_t00130 4144 4063 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0160 <1 728 gene locus_tag LOCUS_06860 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226211.1:tetratricopeptide repeat protein 916 1596 gene locus_tag LOCUS_06870 916 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1600 3648 gene locus_tag LOCUS_06880 1600 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence0161 2478 358 gene locus_tag LOCUS_06890 2478 358 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122605.1 protein_id gnl|my_center|LOCUS_06890 <4494 2656 gene locus_tag LOCUS_06900 <4494 2656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121337.1:DEAD/DEAH box helicase >Feature sequence0162 775 1530 gene locus_tag LOCUS_06910 775 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1794 2999 gene locus_tag LOCUS_06920 1794 2999 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122832.1 protein_id gnl|my_center|LOCUS_06920 3418 4050 gene locus_tag LOCUS_06930 3418 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence0163 1753 4398 gene locus_tag LOCUS_06940 1753 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence0164 <1 3043 gene locus_tag LOCUS_06950 <1 3043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202280.1:DEAD/DEAH box helicase family protein 3947 3129 gene locus_tag LOCUS_06960 3947 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence0165 3080 774 gene locus_tag LOCUS_06970 gene dnaG 3080 774 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120867.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence0166 1977 346 gene locus_tag LOCUS_06980 1977 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2707 3774 gene locus_tag LOCUS_06990 2707 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence0167 632 2062 gene locus_tag LOCUS_07000 632 2062 CDS product platelet-activating factor acetylhydrolase IB subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994067.1 protein_id gnl|my_center|LOCUS_07000 2314 3180 gene locus_tag LOCUS_07010 2314 3180 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328799.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence0168 43 2145 gene locus_tag LOCUS_07020 43 2145 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_07020 2909 2436 gene locus_tag LOCUS_07030 2909 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3157 2921 gene locus_tag LOCUS_07040 3157 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence0169 203 36 gene locus_tag LOCUS_07050 203 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1445 318 gene locus_tag LOCUS_07060 1445 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1681 2562 gene locus_tag LOCUS_07070 1681 2562 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_07070 3026 4048 gene locus_tag LOCUS_07080 gene gap 3026 4048 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118955.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence0170 <1 1183 gene locus_tag LOCUS_07090 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989628.1:LemA family protein 1232 2569 gene locus_tag LOCUS_07100 1232 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2633 3850 gene locus_tag LOCUS_07110 2633 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 <4439 3883 gene locus_tag LOCUS_07120 <4439 3883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816469.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence0171 >Feature sequence0172 431 1336 gene locus_tag LOCUS_07130 431 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 1414 2352 gene locus_tag LOCUS_07140 1414 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 <4427 2562 gene locus_tag LOCUS_07150 <4427 2562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784055.1:glycoside hydrolase family 127 protein >Feature sequence0173 2 832 gene locus_tag LOCUS_07160 2 832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326694.1 protein_id gnl|my_center|LOCUS_07160 932 2668 gene locus_tag LOCUS_07170 932 2668 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_07170 2817 3437 gene locus_tag LOCUS_07180 2817 3437 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_07180 3774 4340 gene locus_tag LOCUS_07190 3774 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence0174 1751 831 gene locus_tag LOCUS_07200 gene folD 1751 831 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922068.1 protein_id gnl|my_center|LOCUS_07200 3550 2144 gene locus_tag LOCUS_07210 3550 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4122 3676 gene locus_tag LOCUS_07220 4122 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence0175 212 1408 gene locus_tag LOCUS_07230 212 1408 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence0176 >Feature sequence0177 1 2052 gene locus_tag LOCUS_07240 1 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3401 2556 gene locus_tag LOCUS_07250 3401 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4128 3646 gene locus_tag LOCUS_07260 4128 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence0178 1990 2820 gene locus_tag LOCUS_07270 1990 2820 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence0179 2351 3073 gene locus_tag LOCUS_07280 gene rpe 2351 3073 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106173.1 protein_id gnl|my_center|LOCUS_07280 3212 4042 gene locus_tag LOCUS_07290 gene accD 3212 4042 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence0180 42 2150 gene locus_tag LOCUS_07300 gene clpB 42 2150 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_07300 4060 2264 gene locus_tag LOCUS_07310 4060 2264 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922207.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence0181 208 1224 gene locus_tag LOCUS_07320 208 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2212 3012 gene locus_tag LOCUS_07330 2212 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3204 3428 gene locus_tag LOCUS_07340 3204 3428 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229484.1 protein_id gnl|my_center|LOCUS_07340 <4358 3579 gene locus_tag LOCUS_07350 <4358 3579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338730.1:twin-arginine translocase subunit TatC >Feature sequence0182 3415 4014 gene locus_tag LOCUS_07360 3415 4014 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_07360 4217 4290 gene locus_tag LOCUS_t00140 4217 4290 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0183 965 1903 gene locus_tag LOCUS_07370 965 1903 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790919.1 protein_id gnl|my_center|LOCUS_07370 <4322 2530 gene locus_tag LOCUS_07380 <4322 2530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence0184 >Feature sequence0185 <1 1575 gene locus_tag LOCUS_07390 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196768251.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 1648 2583 gene locus_tag LOCUS_07400 1648 2583 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393471.1 protein_id gnl|my_center|LOCUS_07400 2602 3360 gene locus_tag LOCUS_07410 2602 3360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_07410 3357 4133 gene locus_tag LOCUS_07420 3357 4133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0186 377 3058 gene locus_tag LOCUS_07430 377 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0187 276 2651 gene locus_tag LOCUS_07440 276 2651 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921450.1 protein_id gnl|my_center|LOCUS_07440 2988 2758 gene locus_tag LOCUS_07450 2988 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence0188 <1 1132 gene locus_tag LOCUS_07460 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990818.1:formylglycine-generating enzyme family protein 2387 1320 gene locus_tag LOCUS_07470 2387 1320 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121700.1 protein_id gnl|my_center|LOCUS_07470 2724 2458 gene locus_tag LOCUS_07480 2724 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3992 2922 gene locus_tag LOCUS_07490 3992 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence0189 3812 2484 gene locus_tag LOCUS_07500 3812 2484 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence0190 709 1491 gene locus_tag LOCUS_07510 709 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 1527 2984 gene locus_tag LOCUS_07520 1527 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence0191 >Feature sequence0192 1118 159 gene locus_tag LOCUS_07530 1118 159 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211128.1 protein_id gnl|my_center|LOCUS_07530 1604 1380 gene locus_tag LOCUS_07540 1604 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3148 1655 gene locus_tag LOCUS_07550 gene hemG 3148 1655 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122777.1 protein_id gnl|my_center|LOCUS_07550 <4269 3198 gene locus_tag LOCUS_07560 <4269 3198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922567.1:3-oxoacyl-ACP synthase III >Feature sequence0193 2630 1332 gene locus_tag LOCUS_07570 2630 1332 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333174.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence0194 320 159 gene locus_tag LOCUS_07580 320 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1811 768 gene locus_tag LOCUS_07590 1811 768 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence0195 1 300 gene locus_tag LOCUS_07600 1 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 393 3608 gene locus_tag LOCUS_07610 gene mexF 393 3608 CDS product multidrug efflux RND transporter permease subunit MexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089834.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence0196 2419 542 gene locus_tag LOCUS_07620 2419 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3041 4048 gene locus_tag LOCUS_07630 3041 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence0197 <1 653 gene locus_tag LOCUS_07640 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881359.1:sodium-dependent transporter 748 2430 gene locus_tag LOCUS_07650 748 2430 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_07650 2579 3655 gene locus_tag LOCUS_07660 2579 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence0198 3984 115 gene locus_tag LOCUS_07670 3984 115 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030935.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence0199 3030 2167 gene locus_tag LOCUS_07680 3030 2167 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_07680 3888 3094 gene locus_tag LOCUS_07690 gene larB 3888 3094 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence0200 <1 888 gene locus_tag LOCUS_07700 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108336.1:glycoside hydrolase family 78 protein 1076 3097 gene locus_tag LOCUS_07710 1076 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4063 3194 gene locus_tag LOCUS_07720 4063 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence0201 1139 2224 gene locus_tag LOCUS_07730 1139 2224 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 protein_id gnl|my_center|LOCUS_07730 2687 3220 gene locus_tag LOCUS_07740 2687 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3217 3615 gene locus_tag LOCUS_07750 3217 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence0202 >Feature sequence0203 539 1702 gene locus_tag LOCUS_07760 539 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1815 2039 gene locus_tag LOCUS_07770 1815 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2144 2800 gene locus_tag LOCUS_07780 2144 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2873 3799 gene locus_tag LOCUS_07790 2873 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence0204 <4029 2838 gene locus_tag LOCUS_07800 <4029 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099259466.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0205 1435 464 gene locus_tag LOCUS_07810 1435 464 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_07810 1804 1719 gene locus_tag LOCUS_t00150 1804 1719 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2169 2084 gene locus_tag LOCUS_t00160 2169 2084 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2915 2253 gene locus_tag LOCUS_07820 2915 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326821.1 protein_id gnl|my_center|LOCUS_07820 3290 3649 gene locus_tag LOCUS_07830 3290 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence0206 456 2063 gene locus_tag LOCUS_07840 gene cysS 456 2063 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921769.1 protein_id gnl|my_center|LOCUS_07840 2160 3350 gene locus_tag LOCUS_07850 2160 3350 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122947.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0207 1166 387 gene locus_tag LOCUS_07860 1166 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922519.1 protein_id gnl|my_center|LOCUS_07860 2488 1163 gene locus_tag LOCUS_07870 2488 1163 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122076.1 protein_id gnl|my_center|LOCUS_07870 3272 2913 gene locus_tag LOCUS_07880 3272 2913 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016210.1 protein_id gnl|my_center|LOCUS_07880 3762 3349 gene locus_tag LOCUS_07890 gene queD 3762 3349 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264135.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0208 607 1284 gene locus_tag LOCUS_07900 607 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1437 2084 gene locus_tag LOCUS_07910 1437 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2214 2744 gene locus_tag LOCUS_07920 2214 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057457.1 protein_id gnl|my_center|LOCUS_07920 2923 3525 gene locus_tag LOCUS_07930 2923 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0209 <1 3381 gene locus_tag LOCUS_07940 <1 3381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 3979 3647 gene locus_tag LOCUS_07950 3979 3647 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460300.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence0210 <3998 231 gene locus_tag LOCUS_07960 <3998 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333812.1:DNA-directed RNA polymerase subunit beta' >Feature sequence0211 3519 1351 gene locus_tag LOCUS_07970 gene asnB 3519 1351 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence0212 <1 858 gene locus_tag LOCUS_07980 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764578.1:PTS cellobiose transporter subunit IIC >Feature sequence0213 1196 306 gene locus_tag LOCUS_07990 1196 306 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_07990 1813 1391 gene locus_tag LOCUS_08000 1813 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2819 1884 gene locus_tag LOCUS_08010 2819 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3106 2822 gene locus_tag LOCUS_08020 3106 2822 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118934.1 protein_id gnl|my_center|LOCUS_08020 3630 3103 gene locus_tag LOCUS_08030 3630 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 3960 3778 gene locus_tag LOCUS_08040 3960 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence0214 <3954 2461 gene locus_tag LOCUS_08050 <3954 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082990.1:alpha-N-arabinofuranosidase >Feature sequence0215 >Feature sequence0216 >Feature sequence0217 1434 2630 gene locus_tag LOCUS_08060 1434 2630 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_08060 <3926 2700 gene locus_tag LOCUS_08070 <3926 2700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458920.1:cation-translocating P-type ATPase >Feature sequence0218 1402 413 gene locus_tag LOCUS_08080 1402 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2031 1633 gene locus_tag LOCUS_08090 2031 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 <3920 2277 gene locus_tag LOCUS_08100 <3920 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein >Feature sequence0219 780 1298 gene locus_tag LOCUS_08110 780 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1889 1461 gene locus_tag LOCUS_08120 1889 1461 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence0220 399 3164 gene locus_tag LOCUS_08130 399 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence0221 386 1384 gene locus_tag LOCUS_08140 386 1384 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_08140 1430 2017 gene locus_tag LOCUS_08150 1430 2017 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_08150 2180 2860 gene locus_tag LOCUS_08160 2180 2860 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943559.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence0222 1200 589 gene locus_tag LOCUS_08170 1200 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1651 1818 gene locus_tag LOCUS_08180 1651 1818 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064219.1 protein_id gnl|my_center|LOCUS_08180 1952 3388 gene locus_tag LOCUS_08190 1952 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence0223 2034 2693 gene locus_tag LOCUS_08200 2034 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence0224 422 1459 gene locus_tag LOCUS_08210 422 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 1909 2748 gene locus_tag LOCUS_08220 1909 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2760 3008 gene locus_tag LOCUS_08230 2760 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence0225 1274 141 gene locus_tag LOCUS_08240 1274 141 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_08240 3513 1495 gene locus_tag LOCUS_08250 gene argS 3513 1495 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120594.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence0226 1617 532 gene locus_tag LOCUS_08260 1617 532 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_08260 3033 1936 gene locus_tag LOCUS_08270 3033 1936 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_08270 3850 3263 gene locus_tag LOCUS_08280 3850 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence0227 346 3804 gene locus_tag LOCUS_08290 346 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence0228 15 596 gene locus_tag LOCUS_08300 15 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 742 1857 gene locus_tag LOCUS_08310 742 1857 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0229 1748 591 gene locus_tag LOCUS_08320 1748 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2445 3200 gene locus_tag LOCUS_08330 2445 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329496.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence0230 1446 910 gene locus_tag LOCUS_08340 1446 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1835 1443 gene locus_tag LOCUS_08350 1835 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3117 2032 gene locus_tag LOCUS_08360 3117 2032 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326673.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0231 2417 1128 gene locus_tag LOCUS_08370 gene lysA 2417 1128 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369915.1 protein_id gnl|my_center|LOCUS_08370 3559 2540 gene locus_tag LOCUS_08380 3559 2540 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence0232 >Feature sequence0233 1352 114 gene locus_tag LOCUS_08390 1352 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1952 3139 gene locus_tag LOCUS_08400 1952 3139 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence0234 1377 499 gene locus_tag LOCUS_08410 gene hisG 1377 499 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_08410 1954 1547 gene locus_tag LOCUS_08420 gene hisI 1954 1547 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937424.1 protein_id gnl|my_center|LOCUS_08420 <3789 2221 gene locus_tag LOCUS_08430 <3789 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427762.1:valine--tRNA ligase >Feature sequence0235 1048 617 gene locus_tag LOCUS_08440 1048 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2231 1200 gene locus_tag LOCUS_08450 2231 1200 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_08450 2666 3547 gene locus_tag LOCUS_08460 2666 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence0236 1997 1176 gene locus_tag LOCUS_08470 1997 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 <3780 2179 gene locus_tag LOCUS_08480 <3780 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990688.1:leucine-rich repeat protein >Feature sequence0237 2710 95 gene locus_tag LOCUS_08490 2710 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 <3779 3135 gene locus_tag LOCUS_08500 <3779 3135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962374.1:PfkB family carbohydrate kinase >Feature sequence0238 1123 347 gene locus_tag LOCUS_08510 1123 347 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_08510 3150 1726 gene locus_tag LOCUS_08520 3150 1726 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence0239 662 318 gene locus_tag LOCUS_08530 662 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 1001 750 gene locus_tag LOCUS_08540 gene yidD 1001 750 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635605.1 protein_id gnl|my_center|LOCUS_08540 1519 1019 gene locus_tag LOCUS_08550 1519 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2133 1516 gene locus_tag LOCUS_08560 2133 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3558 2344 gene locus_tag LOCUS_08570 3558 2344 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227721.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence0240 1031 3559 gene locus_tag LOCUS_08580 1031 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence0241 <1 533 gene locus_tag LOCUS_08590 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456515.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit D 623 1234 gene locus_tag LOCUS_08600 gene nqrE 623 1234 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303538.1 protein_id gnl|my_center|LOCUS_08600 1254 2513 gene locus_tag LOCUS_08610 gene nqrF 1254 2513 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_08610 2853 3515 gene locus_tag LOCUS_08620 2853 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0242 1294 1367 gene locus_tag LOCUS_t00170 1294 1367 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1874 1569 gene locus_tag LOCUS_08630 1874 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2352 2149 gene locus_tag LOCUS_08640 2352 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2850 2575 gene locus_tag LOCUS_08650 2850 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence0243 3536 2655 gene locus_tag LOCUS_08660 gene speB 3536 2655 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937728.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence0244 337 627 gene locus_tag LOCUS_08670 337 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 980 2614 gene locus_tag LOCUS_08680 gene ptsP 980 2614 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_08680 2901 3569 gene locus_tag LOCUS_08690 2901 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence0245 1750 218 gene locus_tag LOCUS_08700 1750 218 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_08700 2689 1808 gene locus_tag LOCUS_08710 2689 1808 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122730.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence0246 1031 1924 gene locus_tag LOCUS_08720 1031 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence0247 976 2790 gene locus_tag LOCUS_08730 976 2790 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616191.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0248 1358 237 gene locus_tag LOCUS_08740 1358 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence0249 884 1783 gene locus_tag LOCUS_08750 884 1783 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121957.1 protein_id gnl|my_center|LOCUS_08750 1828 2988 gene locus_tag LOCUS_08760 1828 2988 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922041.1 protein_id gnl|my_center|LOCUS_08760 <3695 3090 gene locus_tag LOCUS_08770 <3695 3090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122354.1:prolyl oligopeptidase family serine peptidase >Feature sequence0250 1772 144 gene locus_tag LOCUS_08780 1772 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2305 1775 gene locus_tag LOCUS_08790 gene hslV 2305 1775 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081403.1 protein_id gnl|my_center|LOCUS_08790 3432 2467 gene locus_tag LOCUS_08800 3432 2467 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence0251 1 1146 gene locus_tag LOCUS_08810 1 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1203 2048 gene locus_tag LOCUS_08820 1203 2048 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942025.1 protein_id gnl|my_center|LOCUS_08820 3281 2169 gene locus_tag LOCUS_08830 gene ald 3281 2169 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869878.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0252 123 1136 gene locus_tag LOCUS_08840 123 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1160 1957 gene locus_tag LOCUS_08850 1160 1957 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_08850 2558 3490 gene locus_tag LOCUS_08860 2558 3490 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence0253 214 140 gene locus_tag LOCUS_t00180 214 140 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1162 488 gene locus_tag LOCUS_08870 1162 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1735 1202 gene locus_tag LOCUS_08880 1735 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08880 3234 2302 gene locus_tag LOCUS_08890 3234 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence0254 1000 2841 gene locus_tag LOCUS_08900 1000 2841 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922444.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence0255 1854 862 gene locus_tag LOCUS_08910 1854 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2742 1942 gene locus_tag LOCUS_08920 2742 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 <3666 2857 gene locus_tag LOCUS_08930 <3666 2857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922304.1:fumarylacetoacetate hydrolase family protein >Feature sequence0256 292 35 gene locus_tag LOCUS_08940 292 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 537 349 gene locus_tag LOCUS_08950 gene rpmC 537 349 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 protein_id gnl|my_center|LOCUS_08950 1071 664 gene locus_tag LOCUS_08960 gene rplP 1071 664 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121605.1 protein_id gnl|my_center|LOCUS_08960 1735 1019 gene locus_tag LOCUS_08970 gene rpsC 1735 1019 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_08970 2141 1788 gene locus_tag LOCUS_08980 gene rplV 2141 1788 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_08980 2426 2160 gene locus_tag LOCUS_08990 gene rpsS 2426 2160 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_08990 3387 2530 gene locus_tag LOCUS_09000 gene rplB 3387 2530 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121603.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0257 <1 2297 gene locus_tag LOCUS_09010 <1 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922846.1:IRE (iron responsive element) 2540 3157 gene locus_tag LOCUS_09020 2540 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3354 3279 gene locus_tag LOCUS_t00190 3354 3279 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0258 47 238 gene locus_tag LOCUS_09030 47 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 499 1701 gene locus_tag LOCUS_09040 gene argJ 499 1701 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119260.1 protein_id gnl|my_center|LOCUS_09040 1818 2273 gene locus_tag LOCUS_09050 1818 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2863 2387 gene locus_tag LOCUS_09060 2863 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 <3657 2988 gene locus_tag LOCUS_09070 <3657 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037228130.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence0259 659 1675 gene locus_tag LOCUS_09080 gene pheS 659 1675 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_09080 1850 2881 gene locus_tag LOCUS_09090 1850 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0260 296 1672 gene locus_tag LOCUS_09100 296 1672 CDS product sn-glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066917.1 protein_id gnl|my_center|LOCUS_09100 2153 1971 gene locus_tag LOCUS_09110 2153 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2996 2178 gene locus_tag LOCUS_09120 2996 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence0261 666 2636 gene locus_tag LOCUS_09130 666 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2711 3199 gene locus_tag LOCUS_09140 gene smpB 2711 3199 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence0262 844 944 gene locus_tag LOCUS_t00200 844 944 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1034 2431 gene locus_tag LOCUS_09150 gene argH 1034 2431 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0263 2685 2221 gene locus_tag LOCUS_09160 2685 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 <3641 2948 gene locus_tag LOCUS_09170 <3641 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868128.1:iron ABC transporter permease >Feature sequence0264 798 1622 gene locus_tag LOCUS_09180 798 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 1693 2715 gene locus_tag LOCUS_09190 1693 2715 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146579476.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence0265 <3633 589 gene locus_tag LOCUS_09200 <3633 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665250.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence0266 3073 218 gene locus_tag LOCUS_09210 3073 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence0267 264 1229 gene locus_tag LOCUS_09220 264 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1440 1829 gene locus_tag LOCUS_09230 1440 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3267 3605 gene locus_tag LOCUS_09240 3267 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence0268 1492 620 gene locus_tag LOCUS_09250 1492 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1980 1624 gene locus_tag LOCUS_09260 1980 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 <3607 2348 gene locus_tag LOCUS_09270 <3607 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence0269 3162 1342 gene locus_tag LOCUS_09280 gene hcp 3162 1342 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870473.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0270 26 1594 gene locus_tag LOCUS_09290 26 1594 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_09290 1754 2464 gene locus_tag LOCUS_09300 1754 2464 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869187.1 protein_id gnl|my_center|LOCUS_09300 2621 3253 gene locus_tag LOCUS_09310 2621 3253 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869187.1 protein_id gnl|my_center|LOCUS_09310 >Feature sequence0271 122 2545 gene locus_tag LOCUS_09320 122 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2889 3176 gene locus_tag LOCUS_09330 2889 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3372 3509 gene locus_tag LOCUS_09340 3372 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence0272 451 1332 gene locus_tag LOCUS_09350 451 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_09350 1713 2885 gene locus_tag LOCUS_09360 1713 2885 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922635.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence0273 >Feature sequence0274 22 2184 gene locus_tag LOCUS_09370 22 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence0275 <3573 2779 gene locus_tag LOCUS_09380 <3573 2779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:TlpA disulfide reductase family protein >Feature sequence0276 2343 217 gene locus_tag LOCUS_09390 2343 217 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921899.1 protein_id gnl|my_center|LOCUS_09390 3281 2598 gene locus_tag LOCUS_09400 3281 2598 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence0277 <1 1602 gene locus_tag LOCUS_09410 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546696.1:monovalent cation:proton antiporter-2 (CPA2) family protein 1843 2877 gene locus_tag LOCUS_09420 1843 2877 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_09420 2906 3448 gene locus_tag LOCUS_09430 2906 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence0278 1062 76 gene locus_tag LOCUS_09440 gene fmt 1062 76 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123937.1 protein_id gnl|my_center|LOCUS_09440 1330 2235 gene locus_tag LOCUS_09450 1330 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2413 3381 gene locus_tag LOCUS_09460 gene larE 2413 3381 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence0279 3298 773 gene locus_tag LOCUS_09470 3298 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence0280 >Feature sequence0281 <3536 2859 gene locus_tag LOCUS_09480 <3536 2859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240270.1:NAD-dependent protein deacetylase >Feature sequence0282 190 1197 gene locus_tag LOCUS_09490 gene ilvC 190 1197 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339869.1 protein_id gnl|my_center|LOCUS_09490 1386 2603 gene locus_tag LOCUS_09500 1386 2603 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921834.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence0283 >Feature sequence0284 1418 2515 gene locus_tag LOCUS_09510 1418 2515 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921857.1 protein_id gnl|my_center|LOCUS_09510 2626 3330 gene locus_tag LOCUS_09520 2626 3330 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0285 1119 94 gene locus_tag LOCUS_09530 1119 94 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_09530 1800 1255 gene locus_tag LOCUS_09540 1800 1255 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067038.1 protein_id gnl|my_center|LOCUS_09540 <3524 2065 gene locus_tag LOCUS_09550 <3524 2065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144334.1:NB-ARC domain-containing protein >Feature sequence0286 404 886 gene locus_tag LOCUS_09560 404 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 900 2846 gene locus_tag LOCUS_09570 900 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence0287 >Feature sequence0288 <3502 1673 gene locus_tag LOCUS_09580 <3502 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167355187.1:autotransporter domain-containing protein >Feature sequence0289 1639 155 gene locus_tag LOCUS_09590 gene mtaB 1639 155 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123590.1 protein_id gnl|my_center|LOCUS_09590 3451 1697 gene locus_tag LOCUS_09600 3451 1697 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333284.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0290 <1 731 gene locus_tag LOCUS_09610 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852963.1:cytochrome c biogenesis protein CcsA 849 2081 gene locus_tag LOCUS_09620 849 2081 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679211.1 protein_id gnl|my_center|LOCUS_09620 2561 2106 gene locus_tag LOCUS_09630 2561 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence0291 383 3232 gene locus_tag LOCUS_09640 383 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence0292 1162 53 gene locus_tag LOCUS_09650 1162 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 1418 1543 gene locus_tag LOCUS_09660 1418 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 2002 2583 gene locus_tag LOCUS_09670 2002 2583 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence0293 2502 400 gene locus_tag LOCUS_09680 gene fusA 2502 400 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence0294 1088 186 gene locus_tag LOCUS_09690 1088 186 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_09690 2068 1190 gene locus_tag LOCUS_09700 gene murB 2068 1190 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_09700 2799 2305 gene locus_tag LOCUS_09710 gene nrdR 2799 2305 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327006.1 protein_id gnl|my_center|LOCUS_09710 3470 2889 gene locus_tag LOCUS_09720 3470 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence0295 2157 1108 gene locus_tag LOCUS_09730 2157 1108 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120930.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence0296 1216 59 gene locus_tag LOCUS_09740 1216 59 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122130.1 protein_id gnl|my_center|LOCUS_09740 2970 1732 gene locus_tag LOCUS_09750 2970 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence0297 <1 635 gene locus_tag LOCUS_09760 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615514.1:AMP-binding protein 995 2275 gene locus_tag LOCUS_09770 995 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence0298 <1 515 gene locus_tag LOCUS_09780 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104604.1:LysR family transcriptional regulator 656 1450 gene locus_tag LOCUS_09790 gene dapB 656 1450 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123511.1 protein_id gnl|my_center|LOCUS_09790 1829 2047 gene locus_tag LOCUS_09800 gene rpmE 1829 2047 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_09800 2322 3395 gene locus_tag LOCUS_09810 gene prfA 2322 3395 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence0299 >Feature sequence0300 565 1101 gene locus_tag LOCUS_09820 gene rplI 565 1101 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_09820 2560 1559 gene locus_tag LOCUS_09830 2560 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence0301 <1 838 gene locus_tag LOCUS_09840 <1 838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325730.1:ribose-phosphate pyrophosphokinase 1147 2169 gene locus_tag LOCUS_09850 gene hemB 1147 2169 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940811.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence0302 564 827 gene locus_tag LOCUS_09860 564 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1940 3256 gene locus_tag LOCUS_09870 1940 3256 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence0303 3184 2432 gene locus_tag LOCUS_09880 3184 2432 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340094.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0304 1603 353 gene locus_tag LOCUS_09890 1603 353 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_09890 2293 3234 gene locus_tag LOCUS_09900 2293 3234 CDS product DNA integrity scanning protein DisA nucleotide-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615923.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0305 >Feature sequence0306 1797 136 gene locus_tag LOCUS_09910 1797 136 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence0307 1216 2385 gene locus_tag LOCUS_09920 1216 2385 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_09920 2734 2519 gene locus_tag LOCUS_09930 2734 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3137 2859 gene locus_tag LOCUS_09940 3137 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence0308 >Feature sequence0309 2389 320 gene locus_tag LOCUS_09950 2389 320 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0310 <1 1099 gene locus_tag LOCUS_09960 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325404.1:DUF1559 domain-containing protein 1268 1756 gene locus_tag LOCUS_09970 1268 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2177 3280 gene locus_tag LOCUS_09980 2177 3280 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118064.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence0311 339 1199 gene locus_tag LOCUS_09990 339 1199 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118509.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence0312 1596 1426 gene locus_tag LOCUS_10000 1596 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2212 1946 gene locus_tag LOCUS_10010 2212 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence0313 1399 2649 gene locus_tag LOCUS_10020 gene trpB 1399 2649 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0314 628 1836 gene locus_tag LOCUS_10030 628 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1951 2925 gene locus_tag LOCUS_10040 1951 2925 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence0315 >Feature sequence0316 159 800 gene locus_tag LOCUS_10050 159 800 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328106.1 protein_id gnl|my_center|LOCUS_10050 884 1243 gene locus_tag LOCUS_10060 884 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1300 1734 gene locus_tag LOCUS_10070 1300 1734 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142402.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence0317 111 2006 gene locus_tag LOCUS_10080 111 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2106 2789 gene locus_tag LOCUS_10090 2106 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence0318 679 1680 gene locus_tag LOCUS_10100 679 1680 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_10100 2287 2087 gene locus_tag LOCUS_10110 2287 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence0319 1869 664 gene locus_tag LOCUS_10120 1869 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence0320 873 295 gene locus_tag LOCUS_10130 gene lyxE 873 295 CDS product D-lyxose ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234400.1 protein_id gnl|my_center|LOCUS_10130 1480 1812 gene locus_tag LOCUS_10140 1480 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0321 635 285 gene locus_tag LOCUS_10150 gene rplT 635 285 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_10150 1181 885 gene locus_tag LOCUS_10160 1181 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2094 1417 gene locus_tag LOCUS_10170 2094 1417 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_10170 2654 2572 gene locus_tag LOCUS_t00210 2654 2572 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0322 1852 266 gene locus_tag LOCUS_10180 1852 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3337 1922 gene locus_tag LOCUS_10190 3337 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence0323 1973 2953 gene locus_tag LOCUS_10200 gene cysK 1973 2953 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907957.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence0324 1066 563 gene locus_tag LOCUS_10210 1066 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1934 3043 gene locus_tag LOCUS_10220 1934 3043 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921829.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence0325 409 576 gene locus_tag LOCUS_10230 409 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 573 893 gene locus_tag LOCUS_10240 573 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 890 1219 gene locus_tag LOCUS_10250 890 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1216 1482 gene locus_tag LOCUS_10260 1216 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1479 1727 gene locus_tag LOCUS_10270 1479 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1724 2179 gene locus_tag LOCUS_10280 1724 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2272 2847 gene locus_tag LOCUS_10290 2272 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence0326 166 489 gene locus_tag LOCUS_10300 166 489 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294592.1 protein_id gnl|my_center|LOCUS_10300 663 2081 gene locus_tag LOCUS_10310 663 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence0327 1424 1573 gene locus_tag LOCUS_10320 1424 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1646 2089 gene locus_tag LOCUS_10330 1646 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence0328 643 50 gene locus_tag LOCUS_10340 643 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3195 841 gene locus_tag LOCUS_10350 3195 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence0329 2035 380 gene locus_tag LOCUS_10360 gene pgm 2035 380 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005019871.1 protein_id gnl|my_center|LOCUS_10360 3187 2144 gene locus_tag LOCUS_10370 3187 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence0330 114 428 gene locus_tag LOCUS_10380 114 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 425 940 gene locus_tag LOCUS_10390 425 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 976 1046 gene locus_tag LOCUS_t00220 976 1046 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1112 1588 gene locus_tag LOCUS_10400 1112 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1625 1993 gene locus_tag LOCUS_10410 1625 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2031 2966 gene locus_tag LOCUS_10420 2031 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence0331 17 2815 gene locus_tag LOCUS_10430 gene acnA 17 2815 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence0332 266 739 gene locus_tag LOCUS_10440 266 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 859 1320 gene locus_tag LOCUS_10450 859 1320 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325476.1 protein_id gnl|my_center|LOCUS_10450 1632 3053 gene locus_tag LOCUS_10460 1632 3053 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence0333 619 999 gene locus_tag LOCUS_10470 619 999 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_10470 1587 2612 gene locus_tag LOCUS_10480 gene epmA 1587 2612 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921800.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence0334 252 2153 gene locus_tag LOCUS_10490 252 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0335 1251 574 gene locus_tag LOCUS_10500 1251 574 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922323.1 protein_id gnl|my_center|LOCUS_10500 2866 1406 gene locus_tag LOCUS_10510 gene gcvPB 2866 1406 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460674.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence0336 198 3080 gene locus_tag LOCUS_10520 198 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0337 1406 330 gene locus_tag LOCUS_10530 1406 330 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118345.1 protein_id gnl|my_center|LOCUS_10530 2252 1716 gene locus_tag LOCUS_10540 2252 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2978 2472 gene locus_tag LOCUS_10550 2978 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10550 >Feature sequence0338 <1 1652 gene locus_tag LOCUS_10560 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615526.1:organic solvent tolerance protein OstA note possible pseudo, internal stop codon 1746 2234 gene locus_tag LOCUS_10570 1746 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10570 >Feature sequence0339 >Feature sequence0340 635 1492 gene locus_tag LOCUS_10580 635 1492 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence0341 1052 2365 gene locus_tag LOCUS_10590 1052 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0342 2861 2043 gene locus_tag LOCUS_10600 2861 2043 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814443.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence0343 <1 1144 gene locus_tag LOCUS_10610 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665225.1:DUF1570 domain-containing protein 1441 2472 gene locus_tag LOCUS_10620 gene xylA 1441 2472 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730977.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0344 431 141 gene locus_tag LOCUS_10630 431 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 708 914 gene locus_tag LOCUS_10640 708 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 965 1225 gene locus_tag LOCUS_10650 965 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1209 1520 gene locus_tag LOCUS_10660 1209 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3181 1559 gene locus_tag LOCUS_10670 3181 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence0345 1027 557 gene locus_tag LOCUS_10680 gene rpsG 1027 557 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_10680 1694 1305 gene locus_tag LOCUS_10690 gene rpsL 1694 1305 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326865.1 protein_id gnl|my_center|LOCUS_10690 2951 2022 gene locus_tag LOCUS_10700 2951 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence0346 >Feature sequence0347 424 1008 gene locus_tag LOCUS_10710 424 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1276 3180 gene locus_tag LOCUS_10720 1276 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence0348 1418 432 gene locus_tag LOCUS_10730 1418 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1906 1989 gene locus_tag LOCUS_t00230 1906 1989 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2993 >3226 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attataccagaactaaaattcctcgcaagccatagc >Feature sequence0349 739 350 gene locus_tag LOCUS_10740 739 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1683 832 gene locus_tag LOCUS_10750 1683 832 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120692.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence0350 418 101 gene locus_tag LOCUS_10760 gene rplW 418 101 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_10760 1105 476 gene locus_tag LOCUS_10770 gene rplD 1105 476 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_10770 1885 1166 gene locus_tag LOCUS_10780 gene rplC 1885 1166 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_10780 2322 1993 gene locus_tag LOCUS_10790 gene rpsJ 2322 1993 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_10790 3200 2964 gene locus_tag LOCUS_10800 3200 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence0351 102 575 gene locus_tag LOCUS_10810 102 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 579 2342 gene locus_tag LOCUS_10820 579 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2405 3121 gene locus_tag LOCUS_10830 2405 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0352 27 419 gene locus_tag LOCUS_10840 27 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 476 1351 gene locus_tag LOCUS_10850 476 1351 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990818.1 protein_id gnl|my_center|LOCUS_10850 3003 1432 gene locus_tag LOCUS_10860 3003 1432 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence0353 429 61 gene locus_tag LOCUS_10870 gene rplR 429 61 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_10870 1152 601 gene locus_tag LOCUS_10880 gene rplF 1152 601 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_10880 1848 1453 gene locus_tag LOCUS_10890 gene rpsH 1848 1453 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_10890 2052 1867 gene locus_tag LOCUS_10900 2052 1867 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326809.1 protein_id gnl|my_center|LOCUS_10900 2631 2080 gene locus_tag LOCUS_10910 gene rplE 2631 2080 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391575.1 protein_id gnl|my_center|LOCUS_10910 2982 2650 gene locus_tag LOCUS_10920 gene rplX 2982 2650 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence0354 1021 89 gene locus_tag LOCUS_10930 1021 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1812 1264 gene locus_tag LOCUS_10940 gene infC 1812 1264 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329878.1 protein_id gnl|my_center|LOCUS_10940 3179 2130 gene locus_tag LOCUS_10950 3179 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence0355 3179 744 gene locus_tag LOCUS_10960 3179 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0356 88 1263 gene locus_tag LOCUS_10970 88 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1315 1665 gene locus_tag LOCUS_10980 1315 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence0357 <1 736 gene locus_tag LOCUS_10990 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008292761.1:PEGA domain-containing protein 1065 1931 gene locus_tag LOCUS_11000 1065 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2041 2592 gene locus_tag LOCUS_11010 2041 2592 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0358 1497 208 gene locus_tag LOCUS_11020 1497 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence0359 <1 1125 gene locus_tag LOCUS_11030 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326035.1:molecular chaperone DnaK 1690 1265 gene locus_tag LOCUS_11040 1690 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence0360 882 1514 gene locus_tag LOCUS_11050 882 1514 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324826.1 protein_id gnl|my_center|LOCUS_11050 1604 2248 gene locus_tag LOCUS_11060 gene pth 1604 2248 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_11060 2395 2814 gene locus_tag LOCUS_11070 gene rpsF 2395 2814 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324824.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence0361 200 616 gene locus_tag LOCUS_11080 200 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1802 801 gene locus_tag LOCUS_11090 1802 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <3142 2110 gene locus_tag LOCUS_11100 <3142 2110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582623.1:ParB/RepB/Spo0J family partition protein >Feature sequence0362 1530 2813 gene locus_tag LOCUS_11110 gene serS 1530 2813 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_11110 2926 3138 gene locus_tag LOCUS_11120 2926 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence0363 <1 568 gene locus_tag LOCUS_11130 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921963.1:rhomboid family intramembrane serine protease note possible pseudo, internal stop codon 569 691 gene locus_tag LOCUS_11140 569 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 812 1525 gene locus_tag LOCUS_11150 gene hisN 812 1525 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11150 2324 1833 gene locus_tag LOCUS_11160 2324 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 <3132 2456 gene locus_tag LOCUS_11170 <3132 2456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121132.1:DUF1559 domain-containing protein >Feature sequence0364 <1 681 gene locus_tag LOCUS_11180 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120220.1:6,7-dimethyl-8-ribityllumazine synthase 819 1286 gene locus_tag LOCUS_11190 gene nusB 819 1286 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_11190 1410 2321 gene locus_tag LOCUS_11200 gene ftsY 1410 2321 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331084.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0365 1325 2452 gene locus_tag LOCUS_11210 gene queA 1325 2452 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence0366 847 290 gene locus_tag LOCUS_11220 847 290 CDS product RNase III inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645538.1 protein_id gnl|my_center|LOCUS_11220 1980 910 gene locus_tag LOCUS_11230 1980 910 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327113.1 protein_id gnl|my_center|LOCUS_11230 <3117 2300 gene locus_tag LOCUS_11240 <3117 2300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein >Feature sequence0367 104 1375 gene locus_tag LOCUS_11250 104 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1486 2919 gene locus_tag LOCUS_11260 1486 2919 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976070.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence0368 2185 551 gene locus_tag LOCUS_11270 2185 551 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_11270 3105 2254 gene locus_tag LOCUS_11280 3105 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence0369 497 573 gene locus_tag LOCUS_t00240 497 573 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 694 768 gene locus_tag LOCUS_t00250 694 768 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1316 2746 gene locus_tag LOCUS_11290 gene purB 1316 2746 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence0370 >Feature sequence0371 607 1590 gene locus_tag LOCUS_11300 gene miaA 607 1590 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_11300 2320 1667 gene locus_tag LOCUS_11310 2320 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence0372 868 80 gene locus_tag LOCUS_11320 868 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 1398 961 gene locus_tag LOCUS_11330 1398 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_11330 2624 1530 gene locus_tag LOCUS_11340 2624 1530 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338937.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0373 2428 1055 gene locus_tag LOCUS_11350 2428 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 3084 2569 gene locus_tag LOCUS_11360 3084 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence0374 2134 1727 gene locus_tag LOCUS_11370 2134 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence0375 2985 1909 gene locus_tag LOCUS_11380 2985 1909 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123411.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0376 >Feature sequence0377 1539 469 gene locus_tag LOCUS_11390 1539 469 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224004.1 protein_id gnl|my_center|LOCUS_11390 2457 1567 gene locus_tag LOCUS_11400 2457 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence0378 <1 1158 gene locus_tag LOCUS_11410 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921653.1:acetylhydrolase >Feature sequence0379 >Feature sequence0380 >Feature sequence0381 651 268 gene locus_tag LOCUS_11420 651 268 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_11420 1548 745 gene locus_tag LOCUS_11430 1548 745 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330043.1 protein_id gnl|my_center|LOCUS_11430 2761 3052 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tacaccgtctgcaagccggttt >Feature sequence0382 954 1859 gene locus_tag LOCUS_11440 954 1859 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021030.1 protein_id gnl|my_center|LOCUS_11440 2179 2616 gene locus_tag LOCUS_11450 2179 2616 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326614.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence0383 1330 227 gene locus_tag LOCUS_11460 gene prfB 1330 227 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 protein_id gnl|my_center|LOCUS_11460 2893 1664 gene locus_tag LOCUS_11470 2893 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence0384 364 1773 gene locus_tag LOCUS_11480 364 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1829 2647 gene locus_tag LOCUS_11490 1829 2647 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence0385 719 919 gene locus_tag LOCUS_11500 719 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1061 1576 gene locus_tag LOCUS_11510 1061 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1577 2392 gene locus_tag LOCUS_11520 1577 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence0386 40 1503 gene locus_tag LOCUS_11530 40 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence0387 952 68 gene locus_tag LOCUS_11540 952 68 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016994.1 protein_id gnl|my_center|LOCUS_11540 1691 1116 gene locus_tag LOCUS_11550 1691 1116 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789736.1 protein_id gnl|my_center|LOCUS_11550 1999 2073 gene locus_tag LOCUS_t00260 1999 2073 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2987 2280 gene locus_tag LOCUS_11560 2987 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 >Feature sequence0388 <1 1361 gene locus_tag LOCUS_11570 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921382.1:terpene cyclase/mutase family protein note possible pseudo, internal stop codon 1365 1790 gene locus_tag LOCUS_11580 1365 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11580 >Feature sequence0389 1442 810 gene locus_tag LOCUS_11590 1442 810 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326966.1 protein_id gnl|my_center|LOCUS_11590 2669 1773 gene locus_tag LOCUS_11600 gene dapA 2669 1773 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921565.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence0390 2660 1842 gene locus_tag LOCUS_11610 gene panB 2660 1842 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122138.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0391 318 1937 gene locus_tag LOCUS_11620 318 1937 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_11620 2347 2661 gene locus_tag LOCUS_11630 gene rplU 2347 2661 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence0392 >Feature sequence0393 2688 562 gene locus_tag LOCUS_11640 2688 562 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence0394 >Feature sequence0395 255 650 gene locus_tag LOCUS_11650 255 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 660 1091 gene locus_tag LOCUS_11660 660 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1131 1589 gene locus_tag LOCUS_11670 1131 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1646 2065 gene locus_tag LOCUS_11680 1646 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2104 2364 gene locus_tag LOCUS_11690 2104 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0396 <1 681 gene locus_tag LOCUS_11700 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130548.1:nucleotidyltransferase domain-containing protein 1274 861 gene locus_tag LOCUS_11710 1274 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2130 1336 gene locus_tag LOCUS_11720 2130 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence0397 18 2081 gene locus_tag LOCUS_11730 18 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2129 2608 gene locus_tag LOCUS_11740 2129 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence0398 638 1906 gene locus_tag LOCUS_11750 638 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_11750 2445 2518 gene locus_tag LOCUS_t00270 2445 2518 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0399 >Feature sequence0400 <1 736 gene locus_tag LOCUS_11760 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035889.1:AAA family ATPase 750 1439 gene locus_tag LOCUS_11770 750 1439 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence0401 >Feature sequence0402 <1 1656 gene locus_tag LOCUS_11780 <1 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121201.1:excinuclease ABC subunit UvrC >Feature sequence0403 753 1688 gene locus_tag LOCUS_11790 753 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 <2954 1853 gene locus_tag LOCUS_11800 <2954 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence0404 >Feature sequence0405 2545 1268 gene locus_tag LOCUS_11810 2545 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence0406 >Feature sequence0407 <2934 1828 gene locus_tag LOCUS_11820 <2934 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096321.1:phage portal protein >Feature sequence0408 447 2312 gene locus_tag LOCUS_11830 447 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence0409 1800 2171 gene locus_tag LOCUS_11840 1800 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence0410 <2926 1277 gene locus_tag LOCUS_11850 <2926 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence0411 2662 1502 gene locus_tag LOCUS_11860 gene aroC 2662 1502 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence0412 2628 136 gene locus_tag LOCUS_11870 2628 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence0413 <1 2749 gene locus_tag LOCUS_11880 <1 2749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122073.1:leucine--tRNA ligase >Feature sequence0414 441 1883 gene locus_tag LOCUS_11890 gene lpdA 441 1883 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393264.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence0415 329 201 gene locus_tag LOCUS_11900 329 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 929 552 gene locus_tag LOCUS_11910 gene gcvH 929 552 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_11910 2276 1167 gene locus_tag LOCUS_11920 gene gcvT 2276 1167 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732261.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence0416 1275 1033 gene locus_tag LOCUS_11930 gene infA 1275 1033 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556767.1 protein_id gnl|my_center|LOCUS_11930 1819 2079 gene locus_tag LOCUS_11940 1819 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333356.1 protein_id gnl|my_center|LOCUS_11940 2163 2753 gene locus_tag LOCUS_11950 gene folE 2163 2753 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336701.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0417 2303 639 gene locus_tag LOCUS_11960 gene gltX 2303 639 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922083.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence0418 2633 75 gene locus_tag LOCUS_11970 2633 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence0419 2210 2137 gene locus_tag LOCUS_t00280 2210 2137 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <2899 2341 gene locus_tag LOCUS_11980 <2899 2341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244356.1:UDP-glucose 4-epimerase GalE >Feature sequence0420 >Feature sequence0421 329 616 gene locus_tag LOCUS_11990 329 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2144 885 gene locus_tag LOCUS_12000 gene sat 2144 885 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438012.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0422 >Feature sequence0423 <2889 912 gene locus_tag LOCUS_12010 <2889 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261422.1:SslE/AcfD family lipoprotein zinc metalloprotease >Feature sequence0424 1047 2516 gene locus_tag LOCUS_12020 1047 2516 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081938.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence0425 2095 2 gene locus_tag LOCUS_12030 gene fusA 2095 2 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121593.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0426 140 56 gene locus_tag LOCUS_t00290 140 56 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 490 407 gene locus_tag LOCUS_t00300 490 407 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1259 1405 gene locus_tag LOCUS_12040 1259 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence0427 1593 139 gene locus_tag LOCUS_12050 1593 139 CDS product aldehyde dehydrogenase EutE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333579.1 protein_id gnl|my_center|LOCUS_12050 2128 1823 gene locus_tag LOCUS_12060 2128 1823 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324359.1 protein_id gnl|my_center|LOCUS_12060 <2872 2153 gene locus_tag LOCUS_12070 <2872 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583303.1:acetate kinase >Feature sequence0428 2059 2670 gene locus_tag LOCUS_12080 2059 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence0429 1249 59 gene locus_tag LOCUS_12090 1249 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1537 1271 gene locus_tag LOCUS_12100 1537 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1674 1549 gene locus_tag LOCUS_12110 1674 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2864 1674 gene locus_tag LOCUS_12120 2864 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence0430 364 1551 gene locus_tag LOCUS_12130 364 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 <2862 1687 gene locus_tag LOCUS_12140 <2862 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193485025.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence0431 976 290 gene locus_tag LOCUS_12150 976 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence0432 <2853 1147 gene locus_tag LOCUS_12160 <2853 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence0433 753 1661 gene locus_tag LOCUS_12170 753 1661 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203438.1 protein_id gnl|my_center|LOCUS_12170 1821 2567 gene locus_tag LOCUS_12180 1821 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence0434 1612 524 gene locus_tag LOCUS_12190 1612 524 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969480.1 protein_id gnl|my_center|LOCUS_12190 2814 1720 gene locus_tag LOCUS_12200 gene wecB 2814 1720 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence0435 >Feature sequence0436 1261 437 gene locus_tag LOCUS_12210 1261 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1702 1277 gene locus_tag LOCUS_12220 1702 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1986 1696 gene locus_tag LOCUS_12230 1986 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2258 1983 gene locus_tag LOCUS_12240 2258 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2596 2255 gene locus_tag LOCUS_12250 2596 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence0437 142 624 gene locus_tag LOCUS_12260 gene rpsE 142 624 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_12260 624 1121 gene locus_tag LOCUS_12270 gene rplO 624 1121 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899800.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence0438 <2843 2199 gene locus_tag LOCUS_12280 <2843 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123159.1:SGNH/GDSL hydrolase family protein >Feature sequence0439 611 2086 gene locus_tag LOCUS_12290 611 2086 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence0440 <1 512 gene locus_tag LOCUS_12300 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765775.1:glycosyl hydrolase >Feature sequence0441 1113 52 gene locus_tag LOCUS_12310 gene holA 1113 52 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326016.1 protein_id gnl|my_center|LOCUS_12310 1856 1287 gene locus_tag LOCUS_12320 1856 1287 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340258.1 protein_id gnl|my_center|LOCUS_12320 2343 2576 gene locus_tag LOCUS_12330 2343 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0442 <1 1165 gene locus_tag LOCUS_12340 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047817229.1:transglutaminase domain-containing protein 2819 1329 gene locus_tag LOCUS_12350 2819 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence0443 1731 337 gene locus_tag LOCUS_12360 1731 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 <2831 1920 gene locus_tag LOCUS_12370 <2831 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117840.1:A/G-specific adenine glycosylase >Feature sequence0444 <1 1024 gene locus_tag LOCUS_12380 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333876.1:sugar phosphate isomerase/epimerase 1394 1978 gene locus_tag LOCUS_12390 1394 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12390 2045 2737 gene locus_tag LOCUS_12400 2045 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12400 >Feature sequence0445 >Feature sequence0446 434 874 gene locus_tag LOCUS_12410 434 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 920 1501 gene locus_tag LOCUS_12420 920 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1567 1914 gene locus_tag LOCUS_12430 1567 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1904 2233 gene locus_tag LOCUS_12440 1904 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2308 2514 gene locus_tag LOCUS_12450 2308 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence0447 2521 1169 gene locus_tag LOCUS_12460 2521 1169 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812397.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence0448 <1 2192 gene locus_tag LOCUS_12470 <1 2192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099263491.1:circumsporozoite protein- membrane associated protein >Feature sequence0449 508 1350 gene locus_tag LOCUS_12480 508 1350 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118265.1 protein_id gnl|my_center|LOCUS_12480 1534 1839 gene locus_tag LOCUS_12490 1534 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0450 1549 158 gene locus_tag LOCUS_12500 1549 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <2813 1693 gene locus_tag LOCUS_12510 <2813 1693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122228.1:glycogen debranching protein GlgX >Feature sequence0451 >Feature sequence0452 1536 64 gene locus_tag LOCUS_12520 1536 64 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382881.1 protein_id gnl|my_center|LOCUS_12520 2603 1644 gene locus_tag LOCUS_12530 2603 1644 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12530 >Feature sequence0453 1671 478 gene locus_tag LOCUS_12540 gene ispG 1671 478 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence0454 <1 2545 gene locus_tag LOCUS_12550 <1 2545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616162.1:serine/threonine-protein kinase >Feature sequence0455 >Feature sequence0456 >Feature sequence0457 <1 2297 gene locus_tag LOCUS_12560 <1 2297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120395.1:PD-(D/E)XK nuclease family protein 2313 2567 gene locus_tag LOCUS_12570 2313 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence0458 992 645 gene locus_tag LOCUS_12580 992 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 1521 2267 gene locus_tag LOCUS_12590 1521 2267 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117867.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence0459 324 503 gene locus_tag LOCUS_12600 324 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1591 443 gene locus_tag LOCUS_12610 1591 443 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922050.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence0460 662 820 gene locus_tag LOCUS_12620 662 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 853 1371 gene locus_tag LOCUS_12630 853 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1506 2639 gene locus_tag LOCUS_12640 1506 2639 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325404.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0461 2312 228 gene locus_tag LOCUS_12650 gene flhA 2312 228 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121805.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence0462 2677 161 gene locus_tag LOCUS_12660 2677 161 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence0463 273 1664 gene locus_tag LOCUS_12670 273 1664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097691.1 protein_id gnl|my_center|LOCUS_12670 1915 2661 gene locus_tag LOCUS_12680 1915 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence0464 1795 401 gene locus_tag LOCUS_12690 1795 401 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence0465 1337 609 gene locus_tag LOCUS_12700 gene thiE 1337 609 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078223.1 protein_id gnl|my_center|LOCUS_12700 2287 1415 gene locus_tag LOCUS_12710 gene thiM 2287 1415 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence0466 1147 2460 gene locus_tag LOCUS_12720 1147 2460 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence0467 1826 360 gene locus_tag LOCUS_12730 1826 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 <2733 1936 gene locus_tag LOCUS_12740 <2733 1936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence0468 549 298 gene locus_tag LOCUS_12750 549 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 2484 613 gene locus_tag LOCUS_12760 2484 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence0469 >Feature sequence0470 213 2027 gene locus_tag LOCUS_12770 213 2027 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326639.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence0471 714 1523 gene locus_tag LOCUS_12780 714 1523 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_12780 1703 2431 gene locus_tag LOCUS_12790 1703 2431 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329136.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence0472 867 577 gene locus_tag LOCUS_12800 867 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1247 864 gene locus_tag LOCUS_12810 1247 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1755 1468 gene locus_tag LOCUS_12820 1755 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence0473 122 577 gene locus_tag LOCUS_12830 122 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1178 2005 gene locus_tag LOCUS_12840 1178 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2220 2561 gene locus_tag LOCUS_12850 2220 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence0474 59 361 gene locus_tag LOCUS_12860 59 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 358 687 gene locus_tag LOCUS_12870 358 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1353 772 gene locus_tag LOCUS_12880 1353 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1844 1377 gene locus_tag LOCUS_12890 1844 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2445 1864 gene locus_tag LOCUS_12900 2445 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2693 2466 gene locus_tag LOCUS_12910 2693 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0475 2235 748 gene locus_tag LOCUS_12920 2235 748 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324175.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence0476 >Feature sequence0477 <1 855 gene locus_tag LOCUS_12930 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 2050 1214 gene locus_tag LOCUS_12940 gene cysT 2050 1214 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074247.1 protein_id gnl|my_center|LOCUS_12940 <2688 2154 gene locus_tag LOCUS_12950 <2688 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074246.1:sulfate ABC transporter substrate-binding protein >Feature sequence0478 419 186 gene locus_tag LOCUS_12960 419 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence0479 475 2313 gene locus_tag LOCUS_12970 475 2313 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0480 509 1105 gene locus_tag LOCUS_12980 509 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence0481 2081 657 gene locus_tag LOCUS_12990 2081 657 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121489.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence0482 >Feature sequence0483 1727 231 gene locus_tag LOCUS_13000 1727 231 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811458.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence0484 176 835 gene locus_tag LOCUS_13010 176 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1515 880 gene locus_tag LOCUS_13020 1515 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2016 1642 gene locus_tag LOCUS_13030 2016 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence0485 >Feature sequence0486 >Feature sequence0487 2223 742 gene locus_tag LOCUS_13040 2223 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2580 2344 gene locus_tag LOCUS_13050 2580 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0488 491 1534 gene locus_tag LOCUS_13060 491 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence0489 <1 624 gene locus_tag LOCUS_13070 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877350.1:DUF89 domain-containing protein 832 762 gene locus_tag LOCUS_t00310 832 762 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1162 1830 gene locus_tag LOCUS_13080 1162 1830 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_13080 2044 2541 gene locus_tag LOCUS_13090 2044 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence0490 354 1337 gene locus_tag LOCUS_13100 354 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence0491 737 1543 gene locus_tag LOCUS_13110 737 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence0492 1301 126 gene locus_tag LOCUS_13120 1301 126 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122949.1 protein_id gnl|my_center|LOCUS_13120 1543 2358 gene locus_tag LOCUS_13130 1543 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence0493 705 2390 gene locus_tag LOCUS_13140 705 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence0494 >Feature sequence0495 907 335 gene locus_tag LOCUS_13150 907 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence0496 >Feature sequence0497 <2629 80 gene locus_tag LOCUS_13160 <2629 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810321.1:carbamoyl-phosphate synthase large subunit >Feature sequence0498 137 1372 gene locus_tag LOCUS_13170 137 1372 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_13170 1393 2211 gene locus_tag LOCUS_13180 1393 2211 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071349.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0499 1574 600 gene locus_tag LOCUS_13190 1574 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence0500 521 844 gene locus_tag LOCUS_13200 521 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1156 1647 gene locus_tag LOCUS_13210 1156 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2076 2288 gene locus_tag LOCUS_13220 2076 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence0501 1516 665 gene locus_tag LOCUS_13230 1516 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 <2615 1740 gene locus_tag LOCUS_13240 <2615 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123533.1:xylulokinase >Feature sequence0502 >Feature sequence0503 >Feature sequence0504 314 1990 gene locus_tag LOCUS_13250 314 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0505 1218 331 gene locus_tag LOCUS_13260 1218 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2601 1315 gene locus_tag LOCUS_13270 2601 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence0506 1028 618 gene locus_tag LOCUS_13280 1028 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1500 1045 gene locus_tag LOCUS_13290 1500 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1868 1500 gene locus_tag LOCUS_13300 1868 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2079 1873 gene locus_tag LOCUS_13310 2079 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2336 2094 gene locus_tag LOCUS_13320 2336 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence0507 1579 2499 gene locus_tag LOCUS_13330 1579 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence0508 >Feature sequence0509 148 1554 gene locus_tag LOCUS_13340 gene gltA 148 1554 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence0510 825 1532 gene locus_tag LOCUS_13350 825 1532 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334461.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence0511 >Feature sequence0512 778 1317 gene locus_tag LOCUS_13360 778 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1855 1490 gene locus_tag LOCUS_13370 1855 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence0513 2344 1034 gene locus_tag LOCUS_13380 2344 1034 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence0514 2146 635 gene locus_tag LOCUS_13390 2146 635 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence0515 1108 71 gene locus_tag LOCUS_13400 1108 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 <2571 1550 gene locus_tag LOCUS_13410 <2571 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114759.1:efflux transporter outer membrane subunit >Feature sequence0516 1164 523 gene locus_tag LOCUS_13420 1164 523 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328552.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0517 <1 691 gene locus_tag LOCUS_13430 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325011.1:IMP dehydrogenase 961 1809 gene locus_tag LOCUS_13440 961 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <2563 1910 gene locus_tag LOCUS_13450 <2563 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444002.1:alpha/beta hydrolase >Feature sequence0518 <1 1848 gene locus_tag LOCUS_13460 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860391.1:leucine-rich repeat protein >Feature sequence0519 >Feature sequence0520 2453 990 gene locus_tag LOCUS_13470 2453 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence0521 2195 1440 gene locus_tag LOCUS_13480 2195 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence0522 <1 765 gene locus_tag LOCUS_13490 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853222.1:radical SAM protein 1078 821 gene locus_tag LOCUS_13500 1078 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1348 1644 gene locus_tag LOCUS_13510 1348 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence0523 2193 484 gene locus_tag LOCUS_13520 2193 484 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence0524 314 1741 gene locus_tag LOCUS_13530 314 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence0525 <1 674 gene locus_tag LOCUS_13540 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112138.1:DUF1254 domain-containing protein 806 1507 gene locus_tag LOCUS_13550 806 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2432 1782 gene locus_tag LOCUS_13560 2432 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340960.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence0526 46 1083 gene locus_tag LOCUS_13570 46 1083 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence0527 2165 1440 gene locus_tag LOCUS_13580 2165 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence0528 124 1311 gene locus_tag LOCUS_13590 124 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1308 2237 gene locus_tag LOCUS_13600 1308 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence0529 >Feature sequence0530 >Feature sequence0531 513 1211 gene locus_tag LOCUS_13610 513 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence0532 782 108 gene locus_tag LOCUS_13620 782 108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 protein_id gnl|my_center|LOCUS_13620 1609 779 gene locus_tag LOCUS_13630 1609 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 2497 1637 gene locus_tag LOCUS_13640 2497 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence0533 1879 542 gene locus_tag LOCUS_13650 1879 542 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence0534 <1 727 gene locus_tag LOCUS_13660 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870226.1:acetylornithine transaminase 733 1656 gene locus_tag LOCUS_13670 gene argF 733 1656 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921923.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence0535 916 1596 gene locus_tag LOCUS_13680 916 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765473.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0536 1222 71 gene locus_tag LOCUS_13690 1222 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1845 1336 gene locus_tag LOCUS_13700 1845 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 <2490 1974 gene locus_tag LOCUS_13710 <2490 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047816503.1:DUF1559 domain-containing protein >Feature sequence0537 1166 138 gene locus_tag LOCUS_13720 1166 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence0538 <1 803 gene locus_tag LOCUS_13730 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921381.1:YdjY domain-containing protein note possible pseudo, internal stop codon 800 1927 gene locus_tag LOCUS_13740 800 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0539 634 11 gene locus_tag LOCUS_13750 634 11 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968527.1 protein_id gnl|my_center|LOCUS_13750 1292 1894 gene locus_tag LOCUS_13760 1292 1894 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence0540 >Feature sequence0541 725 796 gene locus_tag LOCUS_t00320 725 796 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2021 1497 gene locus_tag LOCUS_13770 2021 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2349 2477 gene locus_tag LOCUS_13780 2349 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence0542 942 1508 gene locus_tag LOCUS_13790 gene efp 942 1508 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814655.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence0543 803 1963 gene locus_tag LOCUS_13800 803 1963 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785425.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0544 <2469 881 gene locus_tag LOCUS_13810 <2469 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546373.1:cytochrome c peroxidase >Feature sequence0545 >Feature sequence0546 <1 567 gene locus_tag LOCUS_13820 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942383.1:indolepyruvate oxidoreductase subunit beta 735 1967 gene locus_tag LOCUS_13830 735 1967 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence0547 >Feature sequence0548 >Feature sequence0549 >Feature sequence0550 >Feature sequence0551 663 1475 gene locus_tag LOCUS_13840 663 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329547.1 protein_id gnl|my_center|LOCUS_13840 1769 2125 gene locus_tag LOCUS_13850 1769 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2313 2400 gene locus_tag LOCUS_t00330 2313 2400 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0552 >Feature sequence0553 >Feature sequence0554 2 211 gene locus_tag LOCUS_13860 2 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1613 309 gene locus_tag LOCUS_13870 1613 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0555 >Feature sequence0556 764 471 gene locus_tag LOCUS_13880 764 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence0557 <1 571 gene locus_tag LOCUS_13890 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003726032.1:ribonuclease PH 710 1435 gene locus_tag LOCUS_13900 710 1435 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922652.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence0558 >Feature sequence0559 <1 1478 gene locus_tag LOCUS_13910 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324371.1:30S ribosomal protein S1 2096 1668 gene locus_tag LOCUS_13920 2096 1668 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943046.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence0560 2084 102 gene locus_tag LOCUS_13930 gene thrS 2084 102 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence0561 792 1190 gene locus_tag LOCUS_13940 792 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2093 1290 gene locus_tag LOCUS_13950 2093 1290 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921509.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence0562 1132 131 gene locus_tag LOCUS_13960 1132 131 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_13960 2012 1320 gene locus_tag LOCUS_13970 2012 1320 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence0563 209 640 gene locus_tag LOCUS_13980 209 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13980 >Feature sequence0564 267 860 gene locus_tag LOCUS_13990 gene clpP 267 860 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_13990 1186 1971 gene locus_tag LOCUS_14000 1186 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0565 443 1459 gene locus_tag LOCUS_14010 443 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence0566 1427 84 gene locus_tag LOCUS_14020 1427 84 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_14020 2330 1557 gene locus_tag LOCUS_14030 2330 1557 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence0567 <1 730 gene locus_tag LOCUS_14040 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121990.1:phosphopantothenoylcysteine decarboxylase 847 1713 gene locus_tag LOCUS_14050 847 1713 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_14050 1864 2358 gene locus_tag LOCUS_14060 1864 2358 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence0568 >Feature sequence0569 1567 2055 gene locus_tag LOCUS_14070 gene tsaE 1567 2055 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405136.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence0570 175 1317 gene locus_tag LOCUS_14080 gene pheA 175 1317 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence0571 >Feature sequence0572 >Feature sequence0573 <1 1541 gene locus_tag LOCUS_14090 <1 1541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460092.1:ASKHA domain-containing protein note possible pseudo, internal stop codon >Feature sequence0574 >Feature sequence0575 <2401 1137 gene locus_tag LOCUS_14100 <2401 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922459.1:trypsin-like peptidase domain-containing protein >Feature sequence0576 1970 975 gene locus_tag LOCUS_14110 gene fba 1970 975 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence0577 535 14 gene locus_tag LOCUS_14120 535 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 969 583 gene locus_tag LOCUS_14130 969 583 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_14130 2367 1177 gene locus_tag LOCUS_14140 2367 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0578 608 1507 gene locus_tag LOCUS_14150 608 1507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence0579 570 2150 gene locus_tag LOCUS_14160 570 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0580 150 1211 gene locus_tag LOCUS_14170 150 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 1249 1950 gene locus_tag LOCUS_14180 1249 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence0581 1384 497 gene locus_tag LOCUS_14190 1384 497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838698.1 protein_id gnl|my_center|LOCUS_14190 1797 1381 gene locus_tag LOCUS_14200 1797 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence0582 27 683 gene locus_tag LOCUS_14210 27 683 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence0583 <1 596 gene locus_tag LOCUS_14220 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944067.1:amino acid-binding protein 711 1196 gene locus_tag LOCUS_14230 711 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence0584 617 159 gene locus_tag LOCUS_14240 617 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1230 2165 gene locus_tag LOCUS_14250 1230 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14250 >Feature sequence0585 214 708 gene locus_tag LOCUS_14260 gene dtd 214 708 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence0586 >Feature sequence0587 662 435 gene locus_tag LOCUS_14270 662 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0588 <1 821 gene locus_tag LOCUS_14280 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089239.1:ankyrin repeat domain-containing protein 923 1672 gene locus_tag LOCUS_14290 923 1672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence0589 255 1463 gene locus_tag LOCUS_14300 255 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0590 >Feature sequence0591 246 1544 gene locus_tag LOCUS_14310 246 1544 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_14310 <2360 1681 gene locus_tag LOCUS_14320 <2360 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392432.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence0592 658 2235 gene locus_tag LOCUS_14330 gene dnaK 658 2235 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence0593 <1 718 gene locus_tag LOCUS_14340 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008671040.1:terpene cyclase/mutase family protein 1033 1974 gene locus_tag LOCUS_14350 1033 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0594 1749 1162 gene locus_tag LOCUS_14360 gene hisB 1749 1162 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390535.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence0595 <1 1482 gene locus_tag LOCUS_14370 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021597.1:DNA topoisomerase VI subunit B >Feature sequence0596 <1 2210 gene locus_tag LOCUS_14380 <1 2210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393549.1:multidrug efflux RND transporter permease subunit >Feature sequence0597 >Feature sequence0598 2024 264 gene locus_tag LOCUS_14390 2024 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence0599 <2336 251 gene locus_tag LOCUS_14400 <2336 251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458979.1:phenylalanine--tRNA ligase subunit beta >Feature sequence0600 >Feature sequence0601 >Feature sequence0602 87 878 gene locus_tag LOCUS_14410 87 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1028 1981 gene locus_tag LOCUS_14420 1028 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence0603 1055 27 gene locus_tag LOCUS_14430 gene tsaD 1055 27 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338414.1 protein_id gnl|my_center|LOCUS_14430 <2316 1223 gene locus_tag LOCUS_14440 <2316 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275506.1:phosphodiester glycosidase family protein >Feature sequence0604 239 1972 gene locus_tag LOCUS_14450 239 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence0605 1202 288 gene locus_tag LOCUS_14460 1202 288 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_14460 2213 1299 gene locus_tag LOCUS_14470 2213 1299 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816446.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence0606 802 1617 gene locus_tag LOCUS_14480 802 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence0607 496 951 gene locus_tag LOCUS_14490 496 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1702 1004 gene locus_tag LOCUS_14500 1702 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence0608 >Feature sequence0609 >Feature sequence0610 2259 1951 gene locus_tag LOCUS_14510 2259 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence0611 919 389 gene locus_tag LOCUS_14520 919 389 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_14520 1372 1148 gene locus_tag LOCUS_14530 1372 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14530 2182 1376 gene locus_tag LOCUS_14540 gene ychF 2182 1376 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962805.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14540 >Feature sequence0612 >Feature sequence0613 2050 1220 gene locus_tag LOCUS_14550 2050 1220 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496786.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence0614 <2285 477 gene locus_tag LOCUS_14560 <2285 477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327661.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence0615 606 7 gene locus_tag LOCUS_14570 606 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 826 584 gene locus_tag LOCUS_14580 826 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence0616 <2284 96 gene locus_tag LOCUS_14590 <2284 96 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037247075.1:DNA gyrase subunit B >Feature sequence0617 >Feature sequence0618 1904 984 gene locus_tag LOCUS_14600 1904 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence0619 431 1984 gene locus_tag LOCUS_14610 431 1984 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence0620 <1 1192 gene locus_tag LOCUS_14620 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence0621 909 1838 gene locus_tag LOCUS_14630 gene rsmH 909 1838 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121784.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence0622 512 1996 gene locus_tag LOCUS_14640 512 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence0623 <1 550 gene locus_tag LOCUS_14650 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966058.1:TetR/AcrR family transcriptional regulator 925 1158 gene locus_tag LOCUS_14660 gene acpP 925 1158 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163100.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence0624 456 295 gene locus_tag LOCUS_14670 456 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1545 502 gene locus_tag LOCUS_14680 1545 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2208 1801 gene locus_tag LOCUS_14690 2208 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence0625 145 480 gene locus_tag LOCUS_14700 145 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 548 1561 gene locus_tag LOCUS_14710 gene rarD 548 1561 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704249.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence0626 >Feature sequence0627 >Feature sequence0628 <1 1744 gene locus_tag LOCUS_14720 <1 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026198738.1:[FeFe] hydrogenase, group A >Feature sequence0629 <1 521 gene locus_tag LOCUS_14730 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324315.1:DUF1559 domain-containing protein 597 1136 gene locus_tag LOCUS_14740 597 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence0630 2242 1085 gene locus_tag LOCUS_14750 2242 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence0631 1206 1694 gene locus_tag LOCUS_14760 1206 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence0632 >Feature sequence0633 82 753 gene locus_tag LOCUS_14770 82 753 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence0634 552 1811 gene locus_tag LOCUS_14780 552 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 1886 2146 gene locus_tag LOCUS_14790 1886 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence0635 718 2016 gene locus_tag LOCUS_14800 718 2016 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence0636 342 1781 gene locus_tag LOCUS_14810 342 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence0637 <2219 1154 gene locus_tag LOCUS_14820 <2219 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616119.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence0638 <2219 1176 gene locus_tag LOCUS_14830 <2219 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228625.1:LutB/LldF family L-lactate oxidation iron-sulfur protein >Feature sequence0639 <2219 1047 gene locus_tag LOCUS_14840 <2219 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118969.1:xylose isomerase >Feature sequence0640 207 2003 gene locus_tag LOCUS_14850 207 2003 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777006.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence0641 234 1370 gene locus_tag LOCUS_14860 234 1370 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922273.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence0642 1970 810 gene locus_tag LOCUS_14870 gene recA 1970 810 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047813294.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0643 348 1301 gene locus_tag LOCUS_14880 348 1301 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338657.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence0644 <2206 1687 gene locus_tag LOCUS_14890 <2206 1687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922132.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence0645 >Feature sequence0646 415 1494 gene locus_tag LOCUS_14900 415 1494 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922840.1 protein_id gnl|my_center|LOCUS_14900 <2201 1644 gene locus_tag LOCUS_14910 <2201 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922668.1:tetratricopeptide repeat protein >Feature sequence0647 1659 415 gene locus_tag LOCUS_14920 1659 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence0648 625 32 gene locus_tag LOCUS_14930 625 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0649 >Feature sequence0650 1054 842 gene locus_tag LOCUS_14940 1054 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence0651 <1 1036 gene locus_tag LOCUS_14950 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256280.1:thiamine phosphate synthase >Feature sequence0652 1141 467 gene locus_tag LOCUS_14960 1141 467 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0653 2079 1225 gene locus_tag LOCUS_14970 2079 1225 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence0654 >Feature sequence0655 1871 843 gene locus_tag LOCUS_14980 1871 843 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence0656 >Feature sequence0657 703 98 gene locus_tag LOCUS_14990 703 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2089 884 gene locus_tag LOCUS_15000 gene dnaJ 2089 884 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390648.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence0658 1942 149 gene locus_tag LOCUS_15010 1942 149 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332180.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence0659 77 391 gene locus_tag LOCUS_15020 77 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 494 1543 gene locus_tag LOCUS_15030 494 1543 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence0660 1011 46 gene locus_tag LOCUS_15040 1011 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1576 1004 gene locus_tag LOCUS_15050 1576 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0661 >Feature sequence0662 >Feature sequence0663 1159 107 gene locus_tag LOCUS_15060 1159 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 <2166 1260 gene locus_tag LOCUS_15070 <2166 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939056.1:[FeFe] hydrogenase H-cluster maturation GTPase HydF >Feature sequence0664 >Feature sequence0665 1035 574 gene locus_tag LOCUS_15080 1035 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 <2163 1254 gene locus_tag LOCUS_15090 <2163 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122130.1:DUF1559 domain-containing protein >Feature sequence0666 252 1574 gene locus_tag LOCUS_15100 252 1574 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence0667 990 202 gene locus_tag LOCUS_15110 990 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 <2158 1186 gene locus_tag LOCUS_15120 <2158 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392224.1:S-methyl-5-thioribose-1-phosphate isomerase >Feature sequence0668 >Feature sequence0669 424 1494 gene locus_tag LOCUS_15130 424 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence0670 >Feature sequence0671 172 414 gene locus_tag LOCUS_15140 172 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1653 748 gene locus_tag LOCUS_15150 1653 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0672 1247 1669 gene locus_tag LOCUS_15160 gene ndk 1247 1669 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence0673 >Feature sequence0674 321 875 gene locus_tag LOCUS_15170 321 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 926 2017 gene locus_tag LOCUS_15180 926 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence0675 <1 1449 gene locus_tag LOCUS_15190 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204967.1:alanine--tRNA ligase >Feature sequence0676 1217 357 gene locus_tag LOCUS_15200 1217 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence0677 >Feature sequence0678 1624 32 gene locus_tag LOCUS_15210 gene hcp 1624 32 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927070.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence0679 60 1556 gene locus_tag LOCUS_15220 60 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence0680 >Feature sequence0681 <1 686 gene locus_tag LOCUS_15230 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937380.1:AAA family ATPase >Feature sequence0682 >Feature sequence0683 693 872 gene locus_tag LOCUS_15240 693 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 903 1259 gene locus_tag LOCUS_15250 903 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15250 >Feature sequence0684 <1 1226 gene locus_tag LOCUS_15260 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007340662.1:DNA-directed RNA polymerase subunit beta >Feature sequence0685 >Feature sequence0686 <1 1852 gene locus_tag LOCUS_15270 <1 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339602.1:BamA/TamA family outer membrane protein >Feature sequence0687 >Feature sequence0688 1428 1003 gene locus_tag LOCUS_15280 gene rpsI 1428 1003 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886821.1 protein_id gnl|my_center|LOCUS_15280 1987 1496 gene locus_tag LOCUS_15290 gene rplM 1987 1496 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328021.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence0689 <1 805 gene locus_tag LOCUS_15300 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120182.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0690 >Feature sequence0691 829 1623 gene locus_tag LOCUS_15310 829 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1934 1671 gene locus_tag LOCUS_15320 1934 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence0692 <1 892 gene locus_tag LOCUS_15330 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119341.1:DUF1559 domain-containing protein 1050 1544 gene locus_tag LOCUS_15340 1050 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 >Feature sequence0693 >Feature sequence0694 <1 1387 gene locus_tag LOCUS_15350 <1 1387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462263.1:asparagine--tRNA ligase >Feature sequence0695 >Feature sequence0696 >Feature sequence0697 <1 1480 gene locus_tag LOCUS_15360 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence0698 134 1336 gene locus_tag LOCUS_15370 134 1336 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence0699 <2095 104 gene locus_tag LOCUS_15380 <2095 104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000194527.1:sucrose-6-phosphate hydrolase >Feature sequence0700 1659 706 gene locus_tag LOCUS_15390 1659 706 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence0701 >Feature sequence0702 <1 1334 gene locus_tag LOCUS_15400 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000940790.1:type 8 capsular polysaccharide synthesis protein Cap8D >Feature sequence0703 >Feature sequence0704 1269 1355 gene locus_tag LOCUS_t00340 1269 1355 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0705 >Feature sequence0706 >Feature sequence0707 747 1973 gene locus_tag LOCUS_15410 gene glgC 747 1973 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence0708 1406 2053 gene locus_tag LOCUS_15420 1406 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence0709 754 2031 gene locus_tag LOCUS_15430 gene hemA 754 2031 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334460.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence0710 >Feature sequence0711 65 331 gene locus_tag LOCUS_15440 65 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 328 768 gene locus_tag LOCUS_15450 328 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1077 1490 gene locus_tag LOCUS_15460 1077 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1518 1835 gene locus_tag LOCUS_15470 1518 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1875 2027 gene locus_tag LOCUS_15480 1875 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence0712 545 1291 gene locus_tag LOCUS_15490 545 1291 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_15490 1509 1679 gene locus_tag LOCUS_15500 1509 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0713 >Feature sequence0714 >Feature sequence0715 <2043 476 gene locus_tag LOCUS_15510 <2043 476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615850.1:YidC/Oxa1 family insertase periplasmic-domain containing protein >Feature sequence0716 1968 670 gene locus_tag LOCUS_15520 1968 670 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence0717 >Feature sequence0718 <1 1600 gene locus_tag LOCUS_15530 <1 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006312103.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0719 511 149 gene locus_tag LOCUS_15540 511 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 948 1610 gene locus_tag LOCUS_15550 948 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0720 <1 1441 gene locus_tag LOCUS_15560 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase >Feature sequence0721 >Feature sequence0722 1409 957 gene locus_tag LOCUS_15570 gene rplS 1409 957 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814465.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence0723 >Feature sequence0724 3 1310 gene locus_tag LOCUS_15580 3 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence0725 <1 759 gene locus_tag LOCUS_15590 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284395.1:SDR family oxidoreductase >Feature sequence0726 <2020 488 gene locus_tag LOCUS_15600 <2020 488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922340.1:DNA-processing protein DprA >Feature sequence0727 >Feature sequence0728 54 1487 gene locus_tag LOCUS_15610 gene lpxB 54 1487 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence0729 125 1096 gene locus_tag LOCUS_15620 125 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1232 1825 gene locus_tag LOCUS_15630 1232 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0730 <2007 372 gene locus_tag LOCUS_15640 <2007 372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530591.1:ATP-binding protein >Feature sequence0731 349 654 gene locus_tag LOCUS_15650 349 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15650 784 1683 gene locus_tag LOCUS_15660 784 1683 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence0732 863 252 gene locus_tag LOCUS_15670 863 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1609 809 gene locus_tag LOCUS_15680 1609 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0733 >Feature sequence0734 >Feature sequence0735 1160 162 gene locus_tag LOCUS_15690 1160 162 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101599.1 protein_id gnl|my_center|LOCUS_15690 1550 1248 gene locus_tag LOCUS_15700 1550 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15700 >Feature sequence0736 843 376 gene locus_tag LOCUS_15710 843 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 <1990 877 gene locus_tag LOCUS_15720 <1990 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338728.1:DUF1559 domain-containing protein >Feature sequence0737 >Feature sequence0738 1410 223 gene locus_tag LOCUS_15730 1410 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1547 1792 gene locus_tag LOCUS_15740 1547 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence0739 1937 324 gene locus_tag LOCUS_15750 1937 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence0740 505 1401 gene locus_tag LOCUS_15760 505 1401 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053070.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence0741 715 1680 gene locus_tag LOCUS_15770 715 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence0742 630 1673 gene locus_tag LOCUS_15780 630 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0743 >Feature sequence0744 >Feature sequence0745 >Feature sequence0746 >Feature sequence0747 >Feature sequence0748 1540 323 gene locus_tag LOCUS_15790 gene nspC 1540 323 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence0749 >Feature sequence0750 <1 544 gene locus_tag LOCUS_15800 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262267.1:formate--tetrahydrofolate ligase >Feature sequence0751 <1 714 gene locus_tag LOCUS_15810 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942654.1:cysteine desulfurase NifS 1638 886 gene locus_tag LOCUS_15820 gene pyrH 1638 886 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261659.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence0752 >Feature sequence0753 >Feature sequence0754 1204 1737 gene locus_tag LOCUS_15830 1204 1737 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870448.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence0755 403 185 gene locus_tag LOCUS_15840 403 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1500 352 gene locus_tag LOCUS_15850 1500 352 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324315.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence0756 >Feature sequence0757 339 1499 gene locus_tag LOCUS_15860 339 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence0758 >Feature sequence0759 >Feature sequence0760 2 151 gene locus_tag LOCUS_15870 2 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 525 1463 gene locus_tag LOCUS_15880 525 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence0761 365 1462 gene locus_tag LOCUS_15890 gene nadA 365 1462 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence0762 <1 1170 gene locus_tag LOCUS_15900 <1 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922226.1:SdrD B-like domain-containing protein >Feature sequence0763 >Feature sequence0764 328 1446 gene locus_tag LOCUS_15910 328 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence0765 <1 1668 gene locus_tag LOCUS_15920 <1 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120445.1:elongation factor G >Feature sequence0766 >Feature sequence0767 <1 729 gene locus_tag LOCUS_15930 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121206.1:uroporphyrinogen-III C-methyltransferase <1921 836 gene locus_tag LOCUS_15940 <1921 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118020.1:L-rhamnose isomerase >Feature sequence0768 <1 548 gene locus_tag LOCUS_15950 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201937.1:DUF4965 domain-containing protein >Feature sequence0769 >Feature sequence0770 <1 1095 gene locus_tag LOCUS_15960 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122554.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0771 1313 1005 gene locus_tag LOCUS_15970 1313 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence0772 550 1776 gene locus_tag LOCUS_15980 550 1776 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence0773 >Feature sequence0774 1386 418 gene locus_tag LOCUS_15990 1386 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence0775 1292 1026 gene locus_tag LOCUS_16000 1292 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence0776 479 1669 gene locus_tag LOCUS_16010 gene galK 479 1669 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence0777 1540 944 gene locus_tag LOCUS_16020 1540 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence0778 1405 1019 gene locus_tag LOCUS_16030 1405 1019 CDS product Imm51 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787134.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence0779 170 1306 gene locus_tag LOCUS_16040 170 1306 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_16040 1468 1818 gene locus_tag LOCUS_16050 1468 1818 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326696.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence0780 >Feature sequence0781 361 1482 gene locus_tag LOCUS_16060 gene trpS 361 1482 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245134.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence0782 1837 782 gene locus_tag LOCUS_16070 1837 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence0783 >Feature sequence0784 >Feature sequence0785 387 1577 gene locus_tag LOCUS_16080 387 1577 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392999.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence0786 >Feature sequence0787 >Feature sequence0788 1503 289 gene locus_tag LOCUS_16090 1503 289 CDS product glycoside hydrolase family 76 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108035.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence0789 <1 552 gene locus_tag LOCUS_16100 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268292.1:glycosyltransferase family 4 protein >Feature sequence0790 866 1129 gene locus_tag LOCUS_16110 866 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence0791 766 1641 gene locus_tag LOCUS_16120 766 1641 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327663.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence0792 1252 416 gene locus_tag LOCUS_16130 1252 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 <1869 1361 gene locus_tag LOCUS_16140 <1869 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260609.1:ABC transporter ATP-binding protein >Feature sequence0793 >Feature sequence0794 >Feature sequence0795 741 97 gene locus_tag LOCUS_16150 741 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 1627 1154 gene locus_tag LOCUS_16160 gene rpiB 1627 1154 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence0796 >Feature sequence0797 1017 439 gene locus_tag LOCUS_16170 1017 439 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_16170 1428 1853 gene locus_tag LOCUS_16180 1428 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence0798 <1860 1191 gene locus_tag LOCUS_16190 <1860 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922184.1:DNA gyrase subunit A >Feature sequence0799 >Feature sequence0800 1776 772 gene locus_tag LOCUS_16200 1776 772 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence0801 >Feature sequence0802 1528 203 gene locus_tag LOCUS_16210 1528 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence0803 1216 887 gene locus_tag LOCUS_16220 1216 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0804 18 1610 gene locus_tag LOCUS_16230 18 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence0805 >Feature sequence0806 334 1422 gene locus_tag LOCUS_16240 334 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16240 1851 1651 gene locus_tag LOCUS_16250 1851 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0807 200 128 gene locus_tag LOCUS_t00350 200 128 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0808 >Feature sequence0809 <1 843 gene locus_tag LOCUS_16260 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922020.1:DUF1559 domain-containing protein 836 1375 gene locus_tag LOCUS_16270 836 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence0810 910 116 gene locus_tag LOCUS_16280 910 116 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_16280 <1846 1197 gene locus_tag LOCUS_16290 <1846 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880434.1:1,4-alpha-glucan branching protein GlgB >Feature sequence0811 >Feature sequence0812 >Feature sequence0813 1799 942 gene locus_tag LOCUS_16300 1799 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence0814 1602 277 gene locus_tag LOCUS_16310 1602 277 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0815 >Feature sequence0816 131 442 gene locus_tag LOCUS_16320 131 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence0817 6 1112 gene locus_tag LOCUS_16330 6 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1173 1661 gene locus_tag LOCUS_16340 gene ruvX 1173 1661 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence0818 >Feature sequence0819 >Feature sequence0820 >Feature sequence0821 877 89 gene locus_tag LOCUS_16350 877 89 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921444.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence0822 1685 1146 gene locus_tag LOCUS_16360 gene accB 1685 1146 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence0823 >Feature sequence0824 <1815 295 gene locus_tag LOCUS_16370 <1815 295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121304.1:DNA mismatch repair protein MutS >Feature sequence0825 >Feature sequence0826 >Feature sequence0827 <1804 1245 gene locus_tag LOCUS_16380 <1804 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332037.1:ABC transporter ATP-binding protein >Feature sequence0828 <1 1365 gene locus_tag LOCUS_16390 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334261.1:F0F1 ATP synthase subunit alpha >Feature sequence0829 632 60 gene locus_tag LOCUS_16400 gene tadA 632 60 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_16400 1237 773 gene locus_tag LOCUS_16410 1237 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence0830 >Feature sequence0831 256 1695 gene locus_tag LOCUS_16420 256 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence0832 >Feature sequence0833 70 267 gene locus_tag LOCUS_16430 gene rpsU 70 267 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence0834 411 1253 gene locus_tag LOCUS_16440 411 1253 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0835 >Feature sequence0836 <1 656 gene locus_tag LOCUS_16450 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082285.1:glycoside hydrolase family 5 protein >Feature sequence0837 1540 182 gene locus_tag LOCUS_16460 1540 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence0838 468 716 gene locus_tag LOCUS_16470 468 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence0839 699 61 gene locus_tag LOCUS_16480 699 61 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_16480 <1784 877 gene locus_tag LOCUS_16490 <1784 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000704565.1:dipeptide epimerase >Feature sequence0840 <1783 308 gene locus_tag LOCUS_16500 <1783 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615945.1:terpene cyclase/mutase family protein >Feature sequence0841 >Feature sequence0842 1015 942 gene locus_tag LOCUS_t00360 1015 942 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0843 >Feature sequence0844 >Feature sequence0845 >Feature sequence0846 >Feature sequence0847 1336 419 gene locus_tag LOCUS_16510 1336 419 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922316.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0848 >Feature sequence0849 <1 928 gene locus_tag LOCUS_16520 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476101.1:aminotransferase class V-fold PLP-dependent enzyme 948 1643 gene locus_tag LOCUS_16530 948 1643 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence0850 <1772 806 gene locus_tag LOCUS_16540 <1772 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943205.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence0851 553 1494 gene locus_tag LOCUS_16550 553 1494 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence0852 1652 225 gene locus_tag LOCUS_16560 1652 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921376.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence0853 397 1281 gene locus_tag LOCUS_16570 397 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence0854 >Feature sequence0855 661 389 gene locus_tag LOCUS_16580 661 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1194 778 gene locus_tag LOCUS_16590 1194 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence0856 >Feature sequence0857 <1 1161 gene locus_tag LOCUS_16600 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922561.1:2-isopropylmalate synthase >Feature sequence0858 >Feature sequence0859 >Feature sequence0860 431 1537 gene locus_tag LOCUS_16610 431 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence0861 1261 809 gene locus_tag LOCUS_16620 1261 809 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119076.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence0862 >Feature sequence0863 >Feature sequence0864 1463 837 gene locus_tag LOCUS_16630 1463 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1744 1604 gene locus_tag LOCUS_16640 1744 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence0865 1204 1277 gene locus_tag LOCUS_t00370 1204 1277 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1360 1434 gene locus_tag LOCUS_t00380 1360 1434 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0866 >Feature sequence0867 <1 1198 gene locus_tag LOCUS_16650 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123577.1:sigma-54 dependent transcriptional regulator >Feature sequence0868 >Feature sequence0869 <1737 943 gene locus_tag LOCUS_16660 <1737 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202977.1:cobaltochelatase subunit CobN >Feature sequence0870 >Feature sequence0871 >Feature sequence0872 >Feature sequence0873 >Feature sequence0874 <1733 418 gene locus_tag LOCUS_16670 <1733 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117884.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence0875 >Feature sequence0876 >Feature sequence0877 1631 972 gene locus_tag LOCUS_16680 1631 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence0878 688 170 gene locus_tag LOCUS_16690 688 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence0879 1578 541 gene locus_tag LOCUS_16700 1578 541 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence0880 656 240 gene locus_tag LOCUS_16710 656 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1139 873 gene locus_tag LOCUS_16720 1139 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0881 552 205 gene locus_tag LOCUS_16730 552 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16730 1257 658 gene locus_tag LOCUS_16740 1257 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16740 >Feature sequence0882 3 548 gene locus_tag LOCUS_16750 3 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 598 1635 gene locus_tag LOCUS_16760 598 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence0883 575 408 gene locus_tag LOCUS_16770 gene rpmG 575 408 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324504.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence0884 >Feature sequence0885 >Feature sequence0886 1478 186 gene locus_tag LOCUS_16780 1478 186 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0887 68 553 gene locus_tag LOCUS_16790 68 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence0888 >Feature sequence0889 145 792 gene locus_tag LOCUS_16800 145 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence0890 398 1381 gene locus_tag LOCUS_16810 398 1381 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence0891 <1 1449 gene locus_tag LOCUS_16820 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922084.1:TolC family protein >Feature sequence0892 725 1138 gene locus_tag LOCUS_16830 725 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0893 >Feature sequence0894 >Feature sequence0895 1282 167 gene locus_tag LOCUS_16840 1282 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence0896 1431 661 gene locus_tag LOCUS_16850 gene larB 1431 661 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence0897 302 1084 gene locus_tag LOCUS_16860 302 1084 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence0898 1003 98 gene locus_tag LOCUS_16870 1003 98 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence0899 388 1683 gene locus_tag LOCUS_16880 388 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0900 782 1333 gene locus_tag LOCUS_16890 782 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence0901 >Feature sequence0902 1480 512 gene locus_tag LOCUS_16900 1480 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence0903 <1694 733 gene locus_tag LOCUS_16910 <1694 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303078.1:acetylxylan esterase >Feature sequence0904 870 52 gene locus_tag LOCUS_16920 870 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence0905 603 130 gene locus_tag LOCUS_16930 603 130 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_16930 <1689 781 gene locus_tag LOCUS_16940 <1689 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118046.1:family 78 glycoside hydrolase catalytic domain >Feature sequence0906 736 1062 gene locus_tag LOCUS_16950 736 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0907 <1688 425 gene locus_tag LOCUS_16960 <1688 425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615422.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0908 >Feature sequence0909 >Feature sequence0910 >Feature sequence0911 >Feature sequence0912 209 1462 gene locus_tag LOCUS_16970 209 1462 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence0913 318 704 gene locus_tag LOCUS_16980 318 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16980 >Feature sequence0914 >Feature sequence0915 >Feature sequence0916 122 601 gene locus_tag LOCUS_16990 122 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1250 750 gene locus_tag LOCUS_17000 1250 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence0917 711 786 gene locus_tag LOCUS_t00390 711 786 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0918 <1672 1036 gene locus_tag LOCUS_17010 <1672 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334279.1:J domain-containing protein >Feature sequence0919 >Feature sequence0920 >Feature sequence0921 >Feature sequence0922 281 1093 gene locus_tag LOCUS_17020 281 1093 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339558.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence0923 >Feature sequence0924 24 989 gene locus_tag LOCUS_17030 24 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence0925 >Feature sequence0926 422 3 gene locus_tag LOCUS_17040 422 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence0927 >Feature sequence0928 485 1594 gene locus_tag LOCUS_17050 485 1594 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence0929 >Feature sequence0930 160 1200 gene locus_tag LOCUS_17060 160 1200 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence0931 <1654 271 gene locus_tag LOCUS_17070 <1654 271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118530.1:peptidase >Feature sequence0932 117 43 gene locus_tag LOCUS_t00400 117 43 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 443 1204 gene locus_tag LOCUS_17080 443 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence0933 <1 1168 gene locus_tag LOCUS_17090 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_231846185.1:3-dehydroquinate synthase >Feature sequence0934 581 36 gene locus_tag LOCUS_17100 581 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1645 689 gene locus_tag LOCUS_17110 1645 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence0935 >Feature sequence0936 75 2 gene locus_tag LOCUS_t00410 75 2 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 253 180 gene locus_tag LOCUS_t00420 253 180 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 702 385 gene locus_tag LOCUS_17120 702 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence0937 >Feature sequence0938 1420 248 gene locus_tag LOCUS_17130 1420 248 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0939 >Feature sequence0940 429 1568 gene locus_tag LOCUS_17140 429 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 >Feature sequence0946 >Feature sequence0947 <1618 280 gene locus_tag LOCUS_17150 <1618 280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122094.1:DUF1559 domain-containing protein >Feature sequence0948 <1 531 gene locus_tag LOCUS_17160 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036729.1:bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL >Feature sequence0949 >Feature sequence0950 358 504 gene locus_tag LOCUS_17170 358 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence0951 >Feature sequence0952 >Feature sequence0953 1419 136 gene locus_tag LOCUS_17180 1419 136 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence0954 1537 695 gene locus_tag LOCUS_17190 1537 695 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence0955 515 81 gene locus_tag LOCUS_17200 515 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 <1609 1025 gene locus_tag LOCUS_17210 <1609 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256629.1:alpha-glucan family phosphorylase >Feature sequence0956 >Feature sequence0957 214 987 gene locus_tag LOCUS_17220 214 987 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267287.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence0958 300 1478 gene locus_tag LOCUS_17230 300 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0959 >Feature sequence0960 <1597 657 gene locus_tag LOCUS_17240 <1597 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957598.1:DNA helicase RecQ >Feature sequence0961 1325 132 gene locus_tag LOCUS_17250 1325 132 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665238.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0962 >Feature sequence0963 <1 723 gene locus_tag LOCUS_17260 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121390.1:undecaprenyl-diphosphate phosphatase >Feature sequence0964 1295 1582 gene locus_tag LOCUS_17270 1295 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence0965 1044 1502 gene locus_tag LOCUS_17280 1044 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17280 >Feature sequence0966 >Feature sequence0967 <1592 104 gene locus_tag LOCUS_17290 <1592 104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326639.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0968 1024 569 gene locus_tag LOCUS_17300 1024 569 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 43 1212 gene locus_tag LOCUS_17310 43 1212 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324545.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 >Feature sequence0976 1062 190 gene locus_tag LOCUS_17320 1062 190 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_17320 <1580 1077 gene locus_tag LOCUS_17330 <1580 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259250.1:MoxR family ATPase >Feature sequence0977 <1 803 gene locus_tag LOCUS_17340 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583848.1:DUF814 domain-containing protein 914 1336 gene locus_tag LOCUS_17350 914 1336 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 1503 823 gene locus_tag LOCUS_17360 1503 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence0981 <1 699 gene locus_tag LOCUS_17370 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120484.1:translation initiation factor IF-2 906 1361 gene locus_tag LOCUS_17380 906 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence0982 >Feature sequence0983 >Feature sequence0984 499 864 gene locus_tag LOCUS_17390 499 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1572 940 gene locus_tag LOCUS_17400 1572 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence0985 <1 915 gene locus_tag LOCUS_17410 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338728.1:DUF1559 domain-containing protein 1060 1476 gene locus_tag LOCUS_17420 1060 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence0986 <1567 539 gene locus_tag LOCUS_17430 <1567 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615454.1:DUF1559 domain-containing protein >Feature sequence0987 <1 712 gene locus_tag LOCUS_17440 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328432.1:protein arginine kinase 1199 870 gene locus_tag LOCUS_17450 1199 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence0988 >Feature sequence0989 829 500 gene locus_tag LOCUS_17460 829 500 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence0990 527 1105 gene locus_tag LOCUS_17470 527 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence0991 80 1033 gene locus_tag LOCUS_17480 gene lpxC 80 1033 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0992 >Feature sequence0993 <1559 189 gene locus_tag LOCUS_17490 <1559 189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037249708.1:ComEC/Rec2 family competence protein >Feature sequence0994 76 222 gene locus_tag LOCUS_17500 76 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 1017 517 gene locus_tag LOCUS_17510 1017 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 1256 1014 gene locus_tag LOCUS_17520 1256 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence0995 701 201 gene locus_tag LOCUS_17530 gene ilvN 701 201 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence0996 >Feature sequence0997 >Feature sequence0998 >Feature sequence0999 >Feature sequence1000 1379 756 gene locus_tag LOCUS_17540 1379 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence1001 >Feature sequence1002 191 451 gene locus_tag LOCUS_17550 191 451 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_17550 1412 600 gene locus_tag LOCUS_17560 1412 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence1003 1367 453 gene locus_tag LOCUS_17570 1367 453 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122318.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence1004 <1545 132 gene locus_tag LOCUS_17580 <1545 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324175.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence1005 417 635 gene locus_tag LOCUS_17590 417 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008672712.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence1006 >Feature sequence1007 <1543 474 gene locus_tag LOCUS_17600 <1543 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327631.1:ABC transporter permease >Feature sequence1008 <1 959 gene locus_tag LOCUS_17610 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327900.1:UvrD-helicase domain-containing protein >Feature sequence1009 98 1219 gene locus_tag LOCUS_17620 98 1219 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence1010 <1540 437 gene locus_tag LOCUS_17630 <1540 437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922336.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 >Feature sequence1014 >Feature sequence1015 438 1010 gene locus_tag LOCUS_17640 438 1010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329551.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence1016 >Feature sequence1017 342 1049 gene locus_tag LOCUS_17650 342 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1157 1534 gene locus_tag LOCUS_17660 1157 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence1018 <1 1211 gene locus_tag LOCUS_17670 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121304.1:DNA mismatch repair protein MutS >Feature sequence1019 <1 884 gene locus_tag LOCUS_17680 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921690.1:acetylxylan esterase >Feature sequence1020 312 596 gene locus_tag LOCUS_17690 312 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 641 910 gene locus_tag LOCUS_17700 641 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 907 1209 gene locus_tag LOCUS_17710 907 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence1021 >Feature sequence1022 1442 54 gene locus_tag LOCUS_17720 1442 54 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327204.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence1023 326 505 gene locus_tag LOCUS_17730 326 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 742 816 gene locus_tag LOCUS_t00430 742 816 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1024 1524 679 gene locus_tag LOCUS_17740 gene argB 1524 679 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence1025 >Feature sequence1026 >Feature sequence1027 >Feature sequence1028 946 41 gene locus_tag LOCUS_17750 946 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence1029 >Feature sequence1030 692 862 gene locus_tag LOCUS_17760 692 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence1031 >Feature sequence1032 447 256 gene locus_tag LOCUS_17770 447 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence1033 >Feature sequence1034 274 1203 gene locus_tag LOCUS_17780 274 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence1035 >Feature sequence1036 >Feature sequence1037 >Feature sequence1038 <1 961 gene locus_tag LOCUS_17790 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119119.1:ribosome small subunit-dependent GTPase A >Feature sequence1039 >Feature sequence1040 >Feature sequence1041 <1508 893 gene locus_tag LOCUS_17800 <1508 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331929.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence1042 <1 1316 gene locus_tag LOCUS_17810 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921757.1:efflux RND transporter permease subunit >Feature sequence1043 669 974 gene locus_tag LOCUS_17820 669 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1227 1478 gene locus_tag LOCUS_17830 1227 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence1044 1458 187 gene locus_tag LOCUS_17840 1458 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence1045