>Feature sequence01 817 1350 gene locus_tag LOCUS_0010 817 1350 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323891.1 protein_id gnl|my_center|LOCUS_0010 1482 2153 gene locus_tag LOCUS_0020 1482 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 2377 2156 gene locus_tag LOCUS_0030 2377 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 2463 2539 gene locus_tag LOCUS_t0010 2463 2539 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2551 2627 gene locus_tag LOCUS_t0020 2551 2627 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2977 3180 gene locus_tag LOCUS_0040 2977 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 3251 3586 gene locus_tag LOCUS_0050 3251 3586 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130302.1 protein_id gnl|my_center|LOCUS_0050 4163 3672 gene locus_tag LOCUS_0060 4163 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 4990 4163 gene locus_tag LOCUS_0070 4990 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 5139 6206 gene locus_tag LOCUS_0080 gene rpsA 5139 6206 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_0080 6303 6377 gene locus_tag LOCUS_t0030 6303 6377 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6460 9711 gene locus_tag LOCUS_0090 6460 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 9693 10085 gene locus_tag LOCUS_0100 9693 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 10135 11910 gene locus_tag LOCUS_0110 10135 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 11938 12228 gene locus_tag LOCUS_0120 11938 12228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 12628 13500 gene locus_tag LOCUS_0130 12628 13500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 14272 13463 gene locus_tag LOCUS_0140 gene fmt 14272 13463 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583791.1 protein_id gnl|my_center|LOCUS_0140 14920 14339 gene locus_tag LOCUS_0150 gene def 14920 14339 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_0150 16888 14933 gene locus_tag LOCUS_0160 16888 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 17037 17288 gene locus_tag LOCUS_0170 17037 17288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 17394 18938 gene locus_tag LOCUS_0180 17394 18938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 18970 19188 gene locus_tag LOCUS_0190 18970 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 19236 19784 gene locus_tag LOCUS_0200 19236 19784 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125842.1 protein_id gnl|my_center|LOCUS_0200 19821 20579 gene locus_tag LOCUS_0210 gene map 19821 20579 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933821.1 protein_id gnl|my_center|LOCUS_0210 20616 21833 gene locus_tag LOCUS_0220 gene ftsA 20616 21833 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094115.1 protein_id gnl|my_center|LOCUS_0220 21874 23052 gene locus_tag LOCUS_0230 gene ftsZ 21874 23052 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_0230 23122 23574 gene locus_tag LOCUS_0240 gene nrdR 23122 23574 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_0240 23571 23834 gene locus_tag LOCUS_0250 23571 23834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 23854 26796 gene locus_tag LOCUS_0260 gene ileS 23854 26796 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_0260 27201 27533 gene locus_tag LOCUS_0270 27201 27533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 27689 28027 gene locus_tag LOCUS_0280 27689 28027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 28029 30701 gene locus_tag LOCUS_0290 28029 30701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 30012 30196 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctgagccaactccagagccaacaccaga 30710 32128 gene locus_tag LOCUS_0300 30710 32128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 32191 32499 gene locus_tag LOCUS_0310 gene rplU 32191 32499 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883184.1 protein_id gnl|my_center|LOCUS_0310 32520 33332 gene locus_tag LOCUS_0320 32520 33332 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_0320 33333 34181 gene locus_tag LOCUS_0330 33333 34181 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_0330 35626 34193 gene locus_tag LOCUS_0340 35626 34193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 35644 36099 gene locus_tag LOCUS_0350 gene rnhA 35644 36099 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_0350 36096 36635 gene locus_tag LOCUS_0360 36096 36635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 36749 37567 gene locus_tag LOCUS_0370 36749 37567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 37701 38822 gene locus_tag LOCUS_0380 37701 38822 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 protein_id gnl|my_center|LOCUS_0380 38847 40433 gene locus_tag LOCUS_0390 38847 40433 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_0390 40455 42503 gene locus_tag LOCUS_0400 gene pcrA 40455 42503 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992872.1 protein_id gnl|my_center|LOCUS_0400 42538 43515 gene locus_tag LOCUS_0410 42538 43515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 44051 44851 gene locus_tag LOCUS_0420 gene rsmH 44051 44851 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245724.1 protein_id gnl|my_center|LOCUS_0420 45291 45608 gene locus_tag LOCUS_0430 45291 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 45759 47489 gene locus_tag LOCUS_0440 45759 47489 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272491.1 protein_id gnl|my_center|LOCUS_0440 47501 48532 gene locus_tag LOCUS_0450 gene mraY 47501 48532 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_0450 48561 49772 gene locus_tag LOCUS_0460 gene spoVE 48561 49772 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_0460 49744 50949 gene locus_tag LOCUS_0470 gene murG 49744 50949 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_0470 50949 51500 gene locus_tag LOCUS_0480 50949 51500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 51552 55841 gene locus_tag LOCUS_0490 51552 55841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 55868 55953 gene locus_tag LOCUS_t0040 55868 55953 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55975 56373 gene locus_tag LOCUS_0500 55975 56373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 56408 57178 gene locus_tag LOCUS_0510 56408 57178 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130508.1 protein_id gnl|my_center|LOCUS_0510 57258 58037 gene locus_tag LOCUS_0520 gene tpiA 57258 58037 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166983.1 protein_id gnl|my_center|LOCUS_0520 58024 58794 gene locus_tag LOCUS_0530 58024 58794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 58930 58854 gene locus_tag LOCUS_t0050 58930 58854 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 59017 58943 gene locus_tag LOCUS_t0060 59017 58943 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 59078 60052 gene locus_tag LOCUS_0540 59078 60052 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_0540 60083 60631 gene locus_tag LOCUS_0550 60083 60631 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_0550 60632 60943 gene locus_tag LOCUS_0560 gene trxA 60632 60943 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016136.1 protein_id gnl|my_center|LOCUS_0560 60943 61854 gene locus_tag LOCUS_0570 gene trxB 60943 61854 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_0570 61950 62660 gene locus_tag LOCUS_0580 61950 62660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 62908 63393 gene locus_tag LOCUS_0590 62908 63393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 63393 64973 gene locus_tag LOCUS_0600 63393 64973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 65162 66412 gene locus_tag LOCUS_0610 65162 66412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 67041 69365 gene locus_tag LOCUS_0620 67041 69365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 71559 69409 gene locus_tag LOCUS_0630 71559 69409 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082809.1 protein_id gnl|my_center|LOCUS_0630 72081 71644 gene locus_tag LOCUS_0640 72081 71644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 72186 72262 gene locus_tag LOCUS_t0070 72186 72262 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 72310 73164 gene locus_tag LOCUS_0650 72310 73164 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_0650 73202 73768 gene locus_tag LOCUS_0660 73202 73768 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_0660 73777 74658 gene locus_tag LOCUS_0670 gene htpX 73777 74658 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699683.1 protein_id gnl|my_center|LOCUS_0670 74639 75709 gene locus_tag LOCUS_0680 74639 75709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 75693 77705 gene locus_tag LOCUS_0690 gene ligA 75693 77705 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_0690 81543 78484 gene locus_tag LOCUS_0700 81543 78484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 82625 81591 gene locus_tag LOCUS_0710 82625 81591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 85139 82785 gene locus_tag LOCUS_0720 gene topA 85139 82785 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_0720 85658 85158 gene locus_tag LOCUS_0730 gene pth 85658 85158 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_0730 87199 85748 gene locus_tag LOCUS_0740 87199 85748 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_0740 87325 92250 gene locus_tag LOCUS_0750 87325 92250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 93656 92256 gene locus_tag LOCUS_0760 gene der 93656 92256 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_0760 93750 93826 gene locus_tag LOCUS_t0080 93750 93826 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 95305 93878 gene locus_tag LOCUS_0770 95305 93878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 96816 95323 gene locus_tag LOCUS_0780 gene gltX 96816 95323 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_0780 97767 96835 gene locus_tag LOCUS_0790 97767 96835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 97904 99427 gene locus_tag LOCUS_0800 97904 99427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 99881 99480 gene locus_tag LOCUS_0810 gene rpsH 99881 99480 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_0810 100165 99896 gene locus_tag LOCUS_0820 gene rpsN 100165 99896 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982921.1 protein_id gnl|my_center|LOCUS_0820 100739 100167 gene locus_tag LOCUS_0830 gene rplE 100739 100167 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_0830 100966 100742 gene locus_tag LOCUS_0840 100966 100742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 101336 100968 gene locus_tag LOCUS_0850 gene rplN 101336 100968 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_0850 101647 101336 gene locus_tag LOCUS_0860 gene rpsQ 101647 101336 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886965.1 protein_id gnl|my_center|LOCUS_0860 102069 101650 gene locus_tag LOCUS_0870 gene rplP 102069 101650 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_0870 102698 102072 gene locus_tag LOCUS_0880 gene rpsC 102698 102072 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957458.1 protein_id gnl|my_center|LOCUS_0880 103096 102698 gene locus_tag LOCUS_0890 103096 102698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 103389 103096 gene locus_tag LOCUS_0900 gene rpsS 103389 103096 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_0900 104225 103389 gene locus_tag LOCUS_0910 gene rplB 104225 103389 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074682.1 protein_id gnl|my_center|LOCUS_0910 104684 104229 gene locus_tag LOCUS_0920 104684 104229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 105304 104687 gene locus_tag LOCUS_0930 gene rplD 105304 104687 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_0930 105926 105309 gene locus_tag LOCUS_0940 gene rplC 105926 105309 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081835.1 protein_id gnl|my_center|LOCUS_0940 106737 106117 gene locus_tag LOCUS_0950 106737 106117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 110705 106875 gene locus_tag LOCUS_0960 gene rpoC 110705 106875 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_0960 114096 110707 gene locus_tag LOCUS_0970 gene rpoB 114096 110707 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272205.1 protein_id gnl|my_center|LOCUS_0970 114364 114834 gene locus_tag LOCUS_0980 114364 114834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 116024 115377 gene locus_tag LOCUS_0990 116024 115377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 116494 116090 gene locus_tag LOCUS_1000 116494 116090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 118401 116560 gene locus_tag LOCUS_1010 118401 116560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 118833 118480 gene locus_tag LOCUS_1020 118833 118480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 119246 118932 gene locus_tag LOCUS_1030 119246 118932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 119530 119907 gene locus_tag LOCUS_1040 119530 119907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 120513 120007 gene locus_tag LOCUS_1050 120513 120007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 121290 120577 gene locus_tag LOCUS_1060 gene rnc 121290 120577 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_1060 121881 121291 gene locus_tag LOCUS_1070 121881 121291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 122305 121823 gene locus_tag LOCUS_1080 122305 121823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 122553 122353 gene locus_tag LOCUS_1090 122553 122353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 122706 123482 gene locus_tag LOCUS_1100 122706 123482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 125905 123518 gene locus_tag LOCUS_1110 gene leuS 125905 123518 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_1110 126516 125929 gene locus_tag LOCUS_1120 126516 125929 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_1120 126543 127064 gene locus_tag LOCUS_1130 126543 127064 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_1130 127825 127061 gene locus_tag LOCUS_1140 127825 127061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 128703 127828 gene locus_tag LOCUS_1150 128703 127828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 128813 132601 gene locus_tag LOCUS_1160 gene dnaE 128813 132601 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129735450.1 protein_id gnl|my_center|LOCUS_1160 133737 132664 gene locus_tag LOCUS_1170 133737 132664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 133767 133976 gene locus_tag LOCUS_1180 133767 133976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 134313 133969 gene locus_tag LOCUS_1190 134313 133969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 135212 134337 gene locus_tag LOCUS_1200 gene galU 135212 134337 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357314.1 protein_id gnl|my_center|LOCUS_1200 135854 135231 gene locus_tag LOCUS_1210 135854 135231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 136609 135869 gene locus_tag LOCUS_1220 136609 135869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 136829 136632 gene locus_tag LOCUS_1230 136829 136632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 137913 136810 gene locus_tag LOCUS_1240 gene xseA 137913 136810 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_1240 139034 137910 gene locus_tag LOCUS_1250 139034 137910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 139236 140255 gene locus_tag LOCUS_1260 139236 140255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 140257 140529 gene locus_tag LOCUS_1270 gene rpmA 140257 140529 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_1270 140570 142426 gene locus_tag LOCUS_1280 140570 142426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 142539 142865 gene locus_tag LOCUS_1290 142539 142865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 142976 143647 gene locus_tag LOCUS_1300 142976 143647 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_1300 144147 143701 gene locus_tag LOCUS_1310 144147 143701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 147148 144260 gene locus_tag LOCUS_1320 gene uvrA 147148 144260 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_1320 147571 147374 gene locus_tag LOCUS_1330 147571 147374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 149090 147678 gene locus_tag LOCUS_1340 gene sbcB 149090 147678 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656746.1 protein_id gnl|my_center|LOCUS_1340 149837 149094 gene locus_tag LOCUS_1350 149837 149094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 152308 149861 gene locus_tag LOCUS_1360 gene pheT 152308 149861 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961516.1 protein_id gnl|my_center|LOCUS_1360 153259 152312 gene locus_tag LOCUS_1370 gene pheS 153259 152312 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_1370 153521 153288 gene locus_tag LOCUS_1380 153521 153288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 153617 154405 gene locus_tag LOCUS_1390 153617 154405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 154445 154624 gene locus_tag LOCUS_1400 154445 154624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 156120 154669 gene locus_tag LOCUS_1410 gene metG 156120 154669 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880800.1 protein_id gnl|my_center|LOCUS_1410 156719 156138 gene locus_tag LOCUS_1420 156719 156138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 157525 156761 gene locus_tag LOCUS_1430 gene rsmA 157525 156761 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546868.1 protein_id gnl|my_center|LOCUS_1430 158603 157527 gene locus_tag LOCUS_1440 158603 157527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 159815 158628 gene locus_tag LOCUS_1450 159815 158628 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_1450 160949 159828 gene locus_tag LOCUS_1460 160949 159828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 162033 161005 gene locus_tag LOCUS_1470 gene ftsX 162033 161005 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936191.1 protein_id gnl|my_center|LOCUS_1470 162875 162033 gene locus_tag LOCUS_1480 162875 162033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 163970 162900 gene locus_tag LOCUS_1490 gene prfB 163970 162900 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_1490 165360 163972 gene locus_tag LOCUS_1500 gene murD 165360 163972 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_1500 166657 165383 gene locus_tag LOCUS_1510 166657 165383 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_1510 169375 166667 gene locus_tag LOCUS_1520 gene secA 169375 166667 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583762.1 protein_id gnl|my_center|LOCUS_1520 169793 169419 gene locus_tag LOCUS_1530 169793 169419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 171046 169793 gene locus_tag LOCUS_1540 gene serS 171046 169793 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583734.1 protein_id gnl|my_center|LOCUS_1540 172886 171093 gene locus_tag LOCUS_1550 172886 171093 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209690.1 protein_id gnl|my_center|LOCUS_1550 173841 172924 gene locus_tag LOCUS_1560 173841 172924 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715326.1 protein_id gnl|my_center|LOCUS_1560 174136 174807 gene locus_tag LOCUS_1570 174136 174807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 175639 174827 gene locus_tag LOCUS_1580 175639 174827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 177159 175642 gene locus_tag LOCUS_1590 gene lysS 177159 175642 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082221.1 protein_id gnl|my_center|LOCUS_1590 177963 177205 gene locus_tag LOCUS_1600 177963 177205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 179234 177978 gene locus_tag LOCUS_1610 gene rseP 179234 177978 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_1610 179812 179270 gene locus_tag LOCUS_1620 gene frr 179812 179270 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_1620 179847 181085 gene locus_tag LOCUS_1630 179847 181085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 181843 181082 gene locus_tag LOCUS_1640 181843 181082 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_1640 182648 182172 gene locus_tag LOCUS_1650 182648 182172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 183077 182799 gene locus_tag LOCUS_1660 183077 182799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 184043 183858 gene locus_tag LOCUS_1670 184043 183858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 185507 185421 gene locus_tag LOCUS_t0090 185507 185421 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 186131 185583 gene locus_tag LOCUS_1680 186131 185583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 186865 186227 gene locus_tag LOCUS_1690 186865 186227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 187370 186972 gene locus_tag LOCUS_1700 gene rpsI 187370 186972 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_1700 187798 187370 gene locus_tag LOCUS_1710 gene rplM 187798 187370 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 protein_id gnl|my_center|LOCUS_1710 188193 187801 gene locus_tag LOCUS_1720 gene rplQ 188193 187801 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_1720 189148 188195 gene locus_tag LOCUS_1730 189148 188195 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055961.1 protein_id gnl|my_center|LOCUS_1730 189769 189167 gene locus_tag LOCUS_1740 gene rpsD 189769 189167 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258257.1 protein_id gnl|my_center|LOCUS_1740 190212 189769 gene locus_tag LOCUS_1750 gene rpsK 190212 189769 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557092.1 protein_id gnl|my_center|LOCUS_1750 190614 190228 gene locus_tag LOCUS_1760 gene rpsM 190614 190228 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_1760 191035 190817 gene locus_tag LOCUS_1770 gene infA 191035 190817 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_1770 191918 191097 gene locus_tag LOCUS_1780 191918 191097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 193408 191936 gene locus_tag LOCUS_1790 gene secY 193408 191936 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_1790 194096 193632 gene locus_tag LOCUS_1800 gene rplO 194096 193632 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975184.1 protein_id gnl|my_center|LOCUS_1800 194749 194099 gene locus_tag LOCUS_1810 194749 194099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 195081 194752 gene locus_tag LOCUS_1820 gene rplR 195081 194752 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974252.1 protein_id gnl|my_center|LOCUS_1820 195619 195083 gene locus_tag LOCUS_1830 gene rplF 195619 195083 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_1830 195783 196361 gene locus_tag LOCUS_1840 195783 196361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 196655 196455 gene locus_tag LOCUS_1850 196655 196455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 196765 197160 gene locus_tag LOCUS_1860 196765 197160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 197703 >197924 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatagtcccctaacaatttcaaatagtgtataat >Feature sequence02 889 813 gene locus_tag LOCUS_t0100 889 813 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 921 1973 gene locus_tag LOCUS_1870 gene prfA 921 1973 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356619.1 protein_id gnl|my_center|LOCUS_1870 1942 2661 gene locus_tag LOCUS_1880 1942 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 3872 2658 gene locus_tag LOCUS_1890 3872 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 4680 3892 gene locus_tag LOCUS_1900 4680 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 4949 5446 gene locus_tag LOCUS_1910 4949 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 5469 5771 gene locus_tag LOCUS_1920 5469 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 5771 6622 gene locus_tag LOCUS_1930 5771 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 6779 6594 gene locus_tag LOCUS_1940 6779 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 8145 6772 gene locus_tag LOCUS_1950 8145 6772 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_1950 8465 8214 gene locus_tag LOCUS_1960 8465 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 8873 8664 gene locus_tag LOCUS_1970 8873 8664 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_1970 9865 8900 gene locus_tag LOCUS_1980 9865 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 10539 9880 gene locus_tag LOCUS_1990 10539 9880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_1990 10634 10972 gene locus_tag LOCUS_2000 10634 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 14310 11005 gene locus_tag LOCUS_2010 14310 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 15504 14386 gene locus_tag LOCUS_2020 15504 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 15710 16135 gene locus_tag LOCUS_2030 15710 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 17256 16132 gene locus_tag LOCUS_2040 gene tgt 17256 16132 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020309519.1 protein_id gnl|my_center|LOCUS_2040 18320 17250 gene locus_tag LOCUS_2050 gene queA 18320 17250 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932232.1 protein_id gnl|my_center|LOCUS_2050 19215 18397 gene locus_tag LOCUS_2060 19215 18397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 20680 19307 gene locus_tag LOCUS_2070 gene cysS 20680 19307 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_2070 21692 20661 gene locus_tag LOCUS_2080 21692 20661 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_2080 21798 22865 gene locus_tag LOCUS_2090 gene rmuC 21798 22865 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_2090 23435 22830 gene locus_tag LOCUS_2100 gene recR 23435 22830 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582670.1 protein_id gnl|my_center|LOCUS_2100 23742 23437 gene locus_tag LOCUS_2110 23742 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 25223 23757 gene locus_tag LOCUS_2120 25223 23757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 25914 26129 gene locus_tag LOCUS_2130 25914 26129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 27589 26198 gene locus_tag LOCUS_2140 gene dnaB 27589 26198 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_2140 28973 27570 gene locus_tag LOCUS_2150 28973 27570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 29494 28976 gene locus_tag LOCUS_2160 29494 28976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 30085 29708 gene locus_tag LOCUS_2170 gene rplL 30085 29708 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_2170 30658 30131 gene locus_tag LOCUS_2180 gene rplJ 30658 30131 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776392.1 protein_id gnl|my_center|LOCUS_2180 30825 31256 gene locus_tag LOCUS_2190 gene rlmH 30825 31256 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796170.1 protein_id gnl|my_center|LOCUS_2190 32152 31253 gene locus_tag LOCUS_2200 32152 31253 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243992.1 protein_id gnl|my_center|LOCUS_2200 32262 33083 gene locus_tag LOCUS_2210 32262 33083 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769608.1 protein_id gnl|my_center|LOCUS_2210 33067 36471 gene locus_tag LOCUS_2220 33067 36471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 36521 36742 gene locus_tag LOCUS_2230 36521 36742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 37181 36762 gene locus_tag LOCUS_2240 37181 36762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 38361 37183 gene locus_tag LOCUS_2250 gene nifS 38361 37183 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_2250 39472 38723 gene locus_tag LOCUS_2260 39472 38723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 40465 39503 gene locus_tag LOCUS_2270 40465 39503 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_2270 41115 40465 gene locus_tag LOCUS_2280 gene rpe 41115 40465 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354925.1 protein_id gnl|my_center|LOCUS_2280 41615 41112 gene locus_tag LOCUS_2290 gene rpiB 41615 41112 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874952.1 protein_id gnl|my_center|LOCUS_2290 42620 41616 gene locus_tag LOCUS_2300 gene gap 42620 41616 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_2300 43968 42691 gene locus_tag LOCUS_2310 gene tig 43968 42691 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_2310 45596 43992 gene locus_tag LOCUS_2320 45596 43992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 46247 45633 gene locus_tag LOCUS_2330 gene tmk 46247 45633 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546833.1 protein_id gnl|my_center|LOCUS_2330 46837 46247 gene locus_tag LOCUS_2340 46837 46247 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029109.1 protein_id gnl|my_center|LOCUS_2340 48649 46862 gene locus_tag LOCUS_2350 48649 46862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_2350 50387 48639 gene locus_tag LOCUS_2360 50387 48639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 50801 50397 gene locus_tag LOCUS_2370 50801 50397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 51369 50851 gene locus_tag LOCUS_2380 51369 50851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 52402 51362 gene locus_tag LOCUS_2390 52402 51362 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_2390 53406 52402 gene locus_tag LOCUS_2400 53406 52402 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658082.1 protein_id gnl|my_center|LOCUS_2400 54569 53406 gene locus_tag LOCUS_2410 54569 53406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 55234 54566 gene locus_tag LOCUS_2420 55234 54566 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_2420 56505 55234 gene locus_tag LOCUS_2430 gene murF 56505 55234 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626685.1 protein_id gnl|my_center|LOCUS_2430 56909 56580 gene locus_tag LOCUS_2440 gene rpsJ 56909 56580 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563872.1 protein_id gnl|my_center|LOCUS_2440 57081 61718 gene locus_tag LOCUS_2450 57081 61718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 62754 61771 gene locus_tag LOCUS_2460 gene metK 62754 61771 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_2460 62925 63485 gene locus_tag LOCUS_2470 62925 63485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 64287 63487 gene locus_tag LOCUS_2480 64287 63487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 65264 64287 gene locus_tag LOCUS_2490 65264 64287 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_2490 65677 65264 gene locus_tag LOCUS_2500 gene smpB 65677 65264 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 protein_id gnl|my_center|LOCUS_2500 66473 65706 gene locus_tag LOCUS_2510 66473 65706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 67444 66539 gene locus_tag LOCUS_2520 67444 66539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 68282 67560 gene locus_tag LOCUS_2530 68282 67560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 68812 68384 gene locus_tag LOCUS_2540 gene rplK 68812 68384 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_2540 69425 68880 gene locus_tag LOCUS_2550 gene nusG 69425 68880 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_2550 69827 69438 gene locus_tag LOCUS_2560 69827 69438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 70705 69887 gene locus_tag LOCUS_2570 70705 69887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 72299 70728 gene locus_tag LOCUS_2580 72299 70728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 72970 72299 gene locus_tag LOCUS_2590 72970 72299 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_2590 73721 72963 gene locus_tag LOCUS_2600 73721 72963 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_2600 74574 73765 gene locus_tag LOCUS_2610 gene folD 74574 73765 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225836.1 protein_id gnl|my_center|LOCUS_2610 75595 74567 gene locus_tag LOCUS_2620 gene murB 75595 74567 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267145.1 protein_id gnl|my_center|LOCUS_2620 76173 76712 gene locus_tag LOCUS_2630 76173 76712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 76754 76966 gene locus_tag LOCUS_2640 76754 76966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 76905 77276 gene locus_tag LOCUS_2650 76905 77276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 77467 78516 gene locus_tag LOCUS_2660 gene dcm 77467 78516 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222381.1 protein_id gnl|my_center|LOCUS_2660 78513 79622 gene locus_tag LOCUS_2670 78513 79622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 79606 79926 gene locus_tag LOCUS_2680 79606 79926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 79926 80093 gene locus_tag LOCUS_2690 79926 80093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 80198 81292 gene locus_tag LOCUS_2700 80198 81292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 81817 82998 gene locus_tag LOCUS_2710 81817 82998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 83021 84718 gene locus_tag LOCUS_2720 83021 84718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 84634 84560 gene locus_tag LOCUS_t0110 84634 84560 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 84731 85246 gene locus_tag LOCUS_2730 84731 85246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 85321 87051 gene locus_tag LOCUS_2740 85321 87051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 87094 87576 gene locus_tag LOCUS_2750 87094 87576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 87662 88207 gene locus_tag LOCUS_2760 87662 88207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 88220 88552 gene locus_tag LOCUS_2770 88220 88552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 89237 88560 gene locus_tag LOCUS_2780 89237 88560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 89573 89364 gene locus_tag LOCUS_2790 89573 89364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2790 91273 89618 gene locus_tag LOCUS_2800 91273 89618 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263109.1 protein_id gnl|my_center|LOCUS_2800 91380 91305 gene locus_tag LOCUS_t0120 91380 91305 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 92074 91523 gene locus_tag LOCUS_2810 92074 91523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 92239 92682 gene locus_tag LOCUS_2820 92239 92682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 92783 92708 gene locus_tag LOCUS_t0130 92783 92708 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 93050 92966 gene locus_tag LOCUS_t0140 93050 92966 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 93886 93098 gene locus_tag LOCUS_2830 93886 93098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 94588 93905 gene locus_tag LOCUS_2840 94588 93905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 95545 94589 gene locus_tag LOCUS_2850 95545 94589 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_2850 96558 95545 gene locus_tag LOCUS_2860 gene trpS 96558 95545 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694505.1 protein_id gnl|my_center|LOCUS_2860 96603 96679 gene locus_tag LOCUS_t0150 96603 96679 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 97145 96795 gene locus_tag LOCUS_2870 97145 96795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 97425 97135 gene locus_tag LOCUS_2880 97425 97135 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_2880 98054 97485 gene locus_tag LOCUS_2890 98054 97485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 105265 98108 gene locus_tag LOCUS_2900 105265 98108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 105428 106735 gene locus_tag LOCUS_2910 105428 106735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 106747 107544 gene locus_tag LOCUS_2920 106747 107544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 108992 107577 gene locus_tag LOCUS_2930 108992 107577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 110182 108989 gene locus_tag LOCUS_2940 110182 108989 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_2940 111431 110184 gene locus_tag LOCUS_2950 111431 110184 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_2950 111485 111560 gene locus_tag LOCUS_t0160 111485 111560 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 111583 112494 gene locus_tag LOCUS_2960 111583 112494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 112635 112495 gene locus_tag LOCUS_2970 112635 112495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 113216 112638 gene locus_tag LOCUS_2980 113216 112638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 113967 113347 gene locus_tag LOCUS_2990 113967 113347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 114532 114005 gene locus_tag LOCUS_3000 114532 114005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3000 116772 114529 gene locus_tag LOCUS_3010 116772 114529 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164979579.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3010 118769 116769 gene locus_tag LOCUS_3020 118769 116769 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_3020 118863 120323 gene locus_tag LOCUS_3030 118863 120323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 120336 121370 gene locus_tag LOCUS_3040 120336 121370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 121385 122125 gene locus_tag LOCUS_3050 121385 122125 CDS product putative folate metabolism gamma-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871979.1 protein_id gnl|my_center|LOCUS_3050 123090 122119 gene locus_tag LOCUS_3060 123090 122119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 124415 123090 gene locus_tag LOCUS_3070 124415 123090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 126212 124503 gene locus_tag LOCUS_3080 126212 124503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 126447 126372 gene locus_tag LOCUS_t0170 126447 126372 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 128341 126488 gene locus_tag LOCUS_3090 128341 126488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 129320 128355 gene locus_tag LOCUS_3100 129320 128355 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 protein_id gnl|my_center|LOCUS_3100 130413 129379 gene locus_tag LOCUS_3110 130413 129379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3110 131279 130410 gene locus_tag LOCUS_3120 131279 130410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3120 132208 131279 gene locus_tag LOCUS_3130 132208 131279 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_3130 132965 132192 gene locus_tag LOCUS_3140 132965 132192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 133871 132987 gene locus_tag LOCUS_3150 133871 132987 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_3150 134015 140929 gene locus_tag LOCUS_3160 134015 140929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 140907 141110 gene locus_tag LOCUS_3170 140907 141110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 141714 141205 gene locus_tag LOCUS_3180 141714 141205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 142324 142100 gene locus_tag LOCUS_3190 142324 142100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 >Feature sequence03 572 829 gene locus_tag LOCUS_3200 572 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 2473 2880 gene locus_tag LOCUS_3210 2473 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 2894 4228 gene locus_tag LOCUS_3220 2894 4228 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081586538.1 protein_id gnl|my_center|LOCUS_3220 4221 5825 gene locus_tag LOCUS_3230 4221 5825 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_3230 6070 7068 gene locus_tag LOCUS_3240 6070 7068 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060776566.1 protein_id gnl|my_center|LOCUS_3240 7386 7310 gene locus_tag LOCUS_t0180 7386 7310 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7445 8590 gene locus_tag LOCUS_3250 7445 8590 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582704.1 protein_id gnl|my_center|LOCUS_3250 8796 8587 gene locus_tag LOCUS_3260 8796 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 9800 8874 gene locus_tag LOCUS_3270 9800 8874 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143107.1 protein_id gnl|my_center|LOCUS_3270 10399 9854 gene locus_tag LOCUS_3280 10399 9854 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476449.1 protein_id gnl|my_center|LOCUS_3280 10559 11260 gene locus_tag LOCUS_3290 10559 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 12812 11295 gene locus_tag LOCUS_3300 gene rny 12812 11295 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050913.1 protein_id gnl|my_center|LOCUS_3300 15402 14257 gene locus_tag LOCUS_3310 15402 14257 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 protein_id gnl|my_center|LOCUS_3310 16166 15399 gene locus_tag LOCUS_3320 16166 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 18922 16262 gene locus_tag LOCUS_3330 18922 16262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 19138 20007 gene locus_tag LOCUS_3340 19138 20007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 20690 20175 gene locus_tag LOCUS_3350 20690 20175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 21226 20708 gene locus_tag LOCUS_3360 21226 20708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 21576 21244 gene locus_tag LOCUS_3370 21576 21244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 22001 21573 gene locus_tag LOCUS_3380 gene tsaE 22001 21573 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003598193.1 protein_id gnl|my_center|LOCUS_3380 22099 22470 gene locus_tag LOCUS_3390 22099 22470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 22452 23306 gene locus_tag LOCUS_3400 22452 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 23417 23341 gene locus_tag LOCUS_t0190 23417 23341 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23490 23984 gene locus_tag LOCUS_3410 23490 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 23968 24552 gene locus_tag LOCUS_3420 23968 24552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 24728 26335 gene locus_tag LOCUS_3430 24728 26335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 26363 27127 gene locus_tag LOCUS_3440 26363 27127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 27785 27090 gene locus_tag LOCUS_3450 gene murI 27785 27090 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048400.1 protein_id gnl|my_center|LOCUS_3450 27841 27915 gene locus_tag LOCUS_t0200 27841 27915 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 27931 28746 gene locus_tag LOCUS_3460 27931 28746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 29163 28786 gene locus_tag LOCUS_3470 29163 28786 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_3470 30944 29181 gene locus_tag LOCUS_3480 30944 29181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 31007 31094 gene locus_tag LOCUS_t0210 31007 31094 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 31121 31600 gene locus_tag LOCUS_3490 31121 31600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 31693 32265 gene locus_tag LOCUS_3500 31693 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 33499 32309 gene locus_tag LOCUS_3510 gene rlmD 33499 32309 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_3510 33558 33632 gene locus_tag LOCUS_t0220 33558 33632 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 34504 34112 gene locus_tag LOCUS_3520 34504 34112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 35734 34580 gene locus_tag LOCUS_3530 35734 34580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 36735 35950 gene locus_tag LOCUS_3540 36735 35950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 38693 36762 gene locus_tag LOCUS_3550 38693 36762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 38865 38941 gene locus_tag LOCUS_t0230 38865 38941 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39004 39726 gene locus_tag LOCUS_3560 39004 39726 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814431.1 protein_id gnl|my_center|LOCUS_3560 40294 39695 gene locus_tag LOCUS_3570 40294 39695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 41668 40403 gene locus_tag LOCUS_3580 41668 40403 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_3580 42312 41698 gene locus_tag LOCUS_3590 42312 41698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 42884 42432 gene locus_tag LOCUS_3600 42884 42432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 45306 43090 gene locus_tag LOCUS_3610 45306 43090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 46487 45615 gene locus_tag LOCUS_3620 46487 45615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 47756 46554 gene locus_tag LOCUS_3630 47756 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3630 48446 47781 gene locus_tag LOCUS_3640 48446 47781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3640 48996 48565 gene locus_tag LOCUS_3650 48996 48565 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_3650 50421 49045 gene locus_tag LOCUS_3660 50421 49045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 50680 50429 gene locus_tag LOCUS_3670 50680 50429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 51384 50680 gene locus_tag LOCUS_3680 51384 50680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 51466 52977 gene locus_tag LOCUS_3690 51466 52977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 53102 53026 gene locus_tag LOCUS_t0240 53102 53026 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 54578 53154 gene locus_tag LOCUS_3700 54578 53154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 55571 54594 gene locus_tag LOCUS_3710 55571 54594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 56482 55571 gene locus_tag LOCUS_3720 56482 55571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 57036 56557 gene locus_tag LOCUS_3730 gene rpsG 57036 56557 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_3730 57453 57040 gene locus_tag LOCUS_3740 gene rpsL 57453 57040 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_3740 58150 57566 gene locus_tag LOCUS_3750 58150 57566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 58481 58188 gene locus_tag LOCUS_3760 58481 58188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 58728 58653 gene locus_tag LOCUS_t0250 58728 58653 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 59159 58953 gene locus_tag LOCUS_3770 59159 58953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 59931 59230 gene locus_tag LOCUS_3780 59931 59230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 59976 61223 gene locus_tag LOCUS_3790 gene murC 59976 61223 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101415.1 protein_id gnl|my_center|LOCUS_3790 61588 61220 gene locus_tag LOCUS_3800 61588 61220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 62099 61581 gene locus_tag LOCUS_3810 62099 61581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 63189 62089 gene locus_tag LOCUS_3820 63189 62089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 63228 64403 gene locus_tag LOCUS_3830 63228 64403 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976898.1 protein_id gnl|my_center|LOCUS_3830 64396 64923 gene locus_tag LOCUS_3840 64396 64923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 65709 64825 gene locus_tag LOCUS_3850 65709 64825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 67702 66248 gene locus_tag LOCUS_3860 67702 66248 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_3860 69126 67702 gene locus_tag LOCUS_3870 69126 67702 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_3870 69181 70518 gene locus_tag LOCUS_3880 gene glmM 69181 70518 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_3880 70505 70945 gene locus_tag LOCUS_3890 70505 70945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 72814 70988 gene locus_tag LOCUS_3900 gene glmS 72814 70988 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838750.1 protein_id gnl|my_center|LOCUS_3900 73882 72860 gene locus_tag LOCUS_3910 73882 72860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 74712 73879 gene locus_tag LOCUS_3920 74712 73879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 74872 75558 gene locus_tag LOCUS_3930 74872 75558 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985178.1 protein_id gnl|my_center|LOCUS_3930 75558 76337 gene locus_tag LOCUS_3940 75558 76337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 77327 76326 gene locus_tag LOCUS_3950 gene galE 77327 76326 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389959.1 protein_id gnl|my_center|LOCUS_3950 78833 77520 gene locus_tag LOCUS_3960 78833 77520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 79938 78835 gene locus_tag LOCUS_3970 gene wecB 79938 78835 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140128.1 protein_id gnl|my_center|LOCUS_3970 80605 79931 gene locus_tag LOCUS_3980 80605 79931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 82625 81690 gene locus_tag LOCUS_3990 82625 81690 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289860.1 protein_id gnl|my_center|LOCUS_3990 82758 83783 gene locus_tag LOCUS_4000 82758 83783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 85749 83773 gene locus_tag LOCUS_4010 85749 83773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 86345 85746 gene locus_tag LOCUS_4020 86345 85746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 87249 86374 gene locus_tag LOCUS_4030 87249 86374 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_4030 87642 87316 gene locus_tag LOCUS_4040 87642 87316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 87665 89581 gene locus_tag LOCUS_4050 87665 89581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 90078 89617 gene locus_tag LOCUS_4060 90078 89617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 91139 90081 gene locus_tag LOCUS_4070 91139 90081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 91487 91146 gene locus_tag LOCUS_4080 91487 91146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 91677 91540 gene locus_tag LOCUS_4090 gene rpmH 91677 91540 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_4090 91922 93319 gene locus_tag LOCUS_4100 gene dnaA 91922 93319 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_4100 93610 94716 gene locus_tag LOCUS_4110 gene dnaN 93610 94716 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_4110 94796 95737 gene locus_tag LOCUS_4120 gene recF 94796 95737 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_4120 97068 95734 gene locus_tag LOCUS_4130 97068 95734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 97908 97069 gene locus_tag LOCUS_4140 97908 97069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 98359 97943 gene locus_tag LOCUS_4150 98359 97943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 99046 98372 gene locus_tag LOCUS_4160 99046 98372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 100464 99046 gene locus_tag LOCUS_4170 100464 99046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 102310 100496 gene locus_tag LOCUS_4180 102310 100496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 103178 102303 gene locus_tag LOCUS_4190 103178 102303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 104066 103188 gene locus_tag LOCUS_4200 104066 103188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 104616 104146 gene locus_tag LOCUS_4210 104616 104146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 107677 104726 gene locus_tag LOCUS_4220 107677 104726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 107834 108286 gene locus_tag LOCUS_4230 107834 108286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 108296 108598 gene locus_tag LOCUS_4240 108296 108598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 108600 108983 gene locus_tag LOCUS_4250 108600 108983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 109056 109427 gene locus_tag LOCUS_4260 109056 109427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 109520 110671 gene locus_tag LOCUS_4270 109520 110671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 110684 111670 gene locus_tag LOCUS_4280 110684 111670 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_4280 113243 111615 gene locus_tag LOCUS_4290 113243 111615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 113837 113301 gene locus_tag LOCUS_4300 113837 113301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 114079 114687 gene locus_tag LOCUS_4310 114079 114687 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082014.1 protein_id gnl|my_center|LOCUS_4310 115077 114706 gene locus_tag LOCUS_4320 115077 114706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 115180 115272 gene locus_tag LOCUS_t0260 115180 115272 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence04 407 495 gene locus_tag LOCUS_r0010 407 495 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 74 percent of the 5S ribosomal RNA 613 831 gene locus_tag LOCUS_4330 613 831 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091076.1 protein_id gnl|my_center|LOCUS_4330 1130 828 gene locus_tag LOCUS_4340 1130 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 1849 1154 gene locus_tag LOCUS_4350 1849 1154 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814285.1 protein_id gnl|my_center|LOCUS_4350 2007 3053 gene locus_tag LOCUS_4360 gene recA 2007 3053 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532151.1 protein_id gnl|my_center|LOCUS_4360 3053 3559 gene locus_tag LOCUS_4370 3053 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 3556 4425 gene locus_tag LOCUS_4380 3556 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 5019 4417 gene locus_tag LOCUS_4390 5019 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 5839 5027 gene locus_tag LOCUS_4400 5839 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 5963 6163 gene locus_tag LOCUS_4410 5963 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 6208 6870 gene locus_tag LOCUS_4420 6208 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 8093 6867 gene locus_tag LOCUS_4430 8093 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 8704 8147 gene locus_tag LOCUS_4440 8704 8147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 8791 9342 gene locus_tag LOCUS_4450 8791 9342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 10076 9378 gene locus_tag LOCUS_4460 10076 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 10210 10977 gene locus_tag LOCUS_4470 10210 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 10991 11452 gene locus_tag LOCUS_4480 10991 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 11513 14473 gene locus_tag LOCUS_4490 11513 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 15167 14421 gene locus_tag LOCUS_4500 15167 14421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 16387 15212 gene locus_tag LOCUS_4510 16387 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 17358 16384 gene locus_tag LOCUS_4520 17358 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 19110 17431 gene locus_tag LOCUS_4530 19110 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 19290 19820 gene locus_tag LOCUS_4540 19290 19820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 19883 20497 gene locus_tag LOCUS_4550 19883 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 20550 21779 gene locus_tag LOCUS_4560 gene tyrS 20550 21779 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068272.1 protein_id gnl|my_center|LOCUS_4560 21836 22342 gene locus_tag LOCUS_4570 21836 22342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 22376 23284 gene locus_tag LOCUS_4580 gene rimK 22376 23284 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689982.1 protein_id gnl|my_center|LOCUS_4580 24753 23281 gene locus_tag LOCUS_4590 24753 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 24776 26707 gene locus_tag LOCUS_4600 gene ftsH 24776 26707 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_4600 27469 27287 gene locus_tag LOCUS_4610 27469 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 28330 29961 gene locus_tag LOCUS_4620 gene murJ 28330 29961 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946821.1 protein_id gnl|my_center|LOCUS_4620 29948 30757 gene locus_tag LOCUS_4630 29948 30757 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_4630 31081 33078 gene locus_tag LOCUS_4640 31081 33078 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_4640 33091 33393 gene locus_tag LOCUS_4650 33091 33393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 33413 34171 gene locus_tag LOCUS_4660 33413 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 34191 34850 gene locus_tag LOCUS_4670 34191 34850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_4670 34847 36325 gene locus_tag LOCUS_4680 34847 36325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 36969 36328 gene locus_tag LOCUS_4690 36969 36328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 37027 38826 gene locus_tag LOCUS_4700 gene aspS 37027 38826 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_4700 39255 38836 gene locus_tag LOCUS_4710 39255 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 39298 39374 gene locus_tag LOCUS_t0270 39298 39374 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 39399 39474 gene locus_tag LOCUS_t0280 39399 39474 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 41086 39482 gene locus_tag LOCUS_4720 41086 39482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 41792 41088 gene locus_tag LOCUS_4730 41792 41088 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434049.1 protein_id gnl|my_center|LOCUS_4730 41917 43026 gene locus_tag LOCUS_4740 gene nusA 41917 43026 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428238.1 protein_id gnl|my_center|LOCUS_4740 43956 43072 gene locus_tag LOCUS_4750 43956 43072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 44100 46256 gene locus_tag LOCUS_4760 44100 46256 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_4760 46311 47819 gene locus_tag LOCUS_4770 46311 47819 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860226.1 protein_id gnl|my_center|LOCUS_4770 47829 47915 gene locus_tag LOCUS_t0290 47829 47915 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48756 49496 gene locus_tag LOCUS_4780 48756 49496 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_4780 49520 50761 gene locus_tag LOCUS_4790 49520 50761 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148852.1 protein_id gnl|my_center|LOCUS_4790 50773 51714 gene locus_tag LOCUS_4800 gene arcC 50773 51714 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113951.1 protein_id gnl|my_center|LOCUS_4800 51763 52785 gene locus_tag LOCUS_4810 gene ptcA 51763 52785 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355587.1 protein_id gnl|my_center|LOCUS_4810 52787 54241 gene locus_tag LOCUS_4820 52787 54241 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732183.1 protein_id gnl|my_center|LOCUS_4820 54225 55322 gene locus_tag LOCUS_4830 gene aguA 54225 55322 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_4830 55378 56970 gene locus_tag LOCUS_4840 gene gpmI 55378 56970 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_4840 56977 57666 gene locus_tag LOCUS_4850 56977 57666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 57653 58486 gene locus_tag LOCUS_4860 gene galU 57653 58486 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792462.1 protein_id gnl|my_center|LOCUS_4860 58505 59863 gene locus_tag LOCUS_4870 gene radA 58505 59863 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_4870 59877 60911 gene locus_tag LOCUS_4880 59877 60911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 60988 61467 gene locus_tag LOCUS_4890 gene ruvC 60988 61467 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_4890 61475 62053 gene locus_tag LOCUS_4900 gene ruvA 61475 62053 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_4900 62133 62603 gene locus_tag LOCUS_4910 62133 62603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 62662 63660 gene locus_tag LOCUS_4920 62662 63660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 63758 64018 gene locus_tag LOCUS_4930 63758 64018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 64032 64649 gene locus_tag LOCUS_4940 64032 64649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 65038 64757 gene locus_tag LOCUS_4950 65038 64757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 65217 65660 gene locus_tag LOCUS_4960 65217 65660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 65697 66686 gene locus_tag LOCUS_4970 gene ychF 65697 66686 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973917.1 protein_id gnl|my_center|LOCUS_4970 66769 67128 gene locus_tag LOCUS_4980 66769 67128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 67322 67248 gene locus_tag LOCUS_t0300 67322 67248 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 67858 67385 gene locus_tag LOCUS_4990 67858 67385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 67916 69349 gene locus_tag LOCUS_5000 gene pyk 67916 69349 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125075.1 protein_id gnl|my_center|LOCUS_5000 69369 70445 gene locus_tag LOCUS_5010 69369 70445 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_5010 70818 70492 gene locus_tag LOCUS_5020 70818 70492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5020 71032 73131 gene locus_tag LOCUS_5030 gene fusA 71032 73131 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488930.1 protein_id gnl|my_center|LOCUS_5030 73288 73875 gene locus_tag LOCUS_5040 73288 73875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 73999 74400 gene locus_tag LOCUS_5050 73999 74400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 74548 75018 gene locus_tag LOCUS_5060 74548 75018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 75193 76377 gene locus_tag LOCUS_5070 gene tuf 75193 76377 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_5070 76765 76424 gene locus_tag LOCUS_5080 76765 76424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 76889 79372 gene locus_tag LOCUS_5090 76889 79372 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583832.1 protein_id gnl|my_center|LOCUS_5090 79365 80366 gene locus_tag LOCUS_5100 79365 80366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 80385 80978 gene locus_tag LOCUS_5110 gene clpP 80385 80978 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_5110 81034 81579 gene locus_tag LOCUS_5120 81034 81579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 81579 82190 gene locus_tag LOCUS_5130 81579 82190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 82190 82948 gene locus_tag LOCUS_5140 82190 82948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 83157 83840 gene locus_tag LOCUS_5150 83157 83840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 83843 84205 gene locus_tag LOCUS_5160 83843 84205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 84189 84866 gene locus_tag LOCUS_5170 84189 84866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 84912 86267 gene locus_tag LOCUS_5180 84912 86267 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_5180 86297 86938 gene locus_tag LOCUS_5190 86297 86938 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219633.1 protein_id gnl|my_center|LOCUS_5190 88101 86941 gene locus_tag LOCUS_5200 88101 86941 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_5200 88238 92086 gene locus_tag LOCUS_5210 88238 92086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 92112 93212 gene locus_tag LOCUS_5220 92112 93212 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_5220 93308 94492 gene locus_tag LOCUS_5230 93308 94492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 94523 94789 gene locus_tag LOCUS_5240 94523 94789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 95236 95309 gene locus_tag LOCUS_t0310 95236 95309 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence05 446 219 gene locus_tag LOCUS_5250 446 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 3281 717 gene locus_tag LOCUS_5260 gene gyrA 3281 717 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 protein_id gnl|my_center|LOCUS_5260 5303 3309 gene locus_tag LOCUS_5270 gene gyrB 5303 3309 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359210.1 protein_id gnl|my_center|LOCUS_5270 8010 5380 gene locus_tag LOCUS_5280 8010 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 8321 8007 gene locus_tag LOCUS_5290 8321 8007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 9951 11465 gene locus_tag LOCUS_5300 9951 11465 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_5300 11645 12073 gene locus_tag LOCUS_5310 11645 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 12153 12347 gene locus_tag LOCUS_5320 12153 12347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 12350 12697 gene locus_tag LOCUS_5330 gene rplT 12350 12697 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948412.1 protein_id gnl|my_center|LOCUS_5330 12699 12908 gene locus_tag LOCUS_5340 gene rpmB 12699 12908 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_5340 14149 13283 gene locus_tag LOCUS_5350 14149 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 14963 14328 gene locus_tag LOCUS_5360 14963 14328 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_5360 15412 14963 gene locus_tag LOCUS_5370 15412 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 16028 15423 gene locus_tag LOCUS_5380 16028 15423 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_5380 16791 16012 gene locus_tag LOCUS_5390 gene miaA 16791 16012 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001548613.1 protein_id gnl|my_center|LOCUS_5390 17555 16836 gene locus_tag LOCUS_5400 17555 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5400 18608 17661 gene locus_tag LOCUS_5410 18608 17661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5410 18677 18753 gene locus_tag LOCUS_t0320 18677 18753 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19324 18809 gene locus_tag LOCUS_5420 19324 18809 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657947.1 protein_id gnl|my_center|LOCUS_5420 19397 20335 gene locus_tag LOCUS_5430 gene xerD 19397 20335 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_5430 20781 20332 gene locus_tag LOCUS_5440 20781 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 22344 21139 gene locus_tag LOCUS_5450 22344 21139 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_5450 23416 22346 gene locus_tag LOCUS_5460 23416 22346 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_5460 25228 23456 gene locus_tag LOCUS_5470 25228 23456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 25744 25232 gene locus_tag LOCUS_5480 25744 25232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 26632 25745 gene locus_tag LOCUS_5490 26632 25745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 27786 26647 gene locus_tag LOCUS_5500 27786 26647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 28832 27786 gene locus_tag LOCUS_5510 28832 27786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 29436 28858 gene locus_tag LOCUS_5520 29436 28858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 29971 29411 gene locus_tag LOCUS_5530 gene efp 29971 29411 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938955.1 protein_id gnl|my_center|LOCUS_5530 30181 29984 gene locus_tag LOCUS_5540 30181 29984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 30795 30325 gene locus_tag LOCUS_5550 30795 30325 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339883.1 protein_id gnl|my_center|LOCUS_5550 31163 30798 gene locus_tag LOCUS_5560 gene rpsF 31163 30798 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974940.1 protein_id gnl|my_center|LOCUS_5560 33398 31230 gene locus_tag LOCUS_5570 33398 31230 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388321.1 protein_id gnl|my_center|LOCUS_5570 33848 33645 gene locus_tag LOCUS_5580 33848 33645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 34427 33981 gene locus_tag LOCUS_5590 gene greA 34427 33981 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129554.1 protein_id gnl|my_center|LOCUS_5590 35597 34476 gene locus_tag LOCUS_5600 35597 34476 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971520.1 protein_id gnl|my_center|LOCUS_5600 37541 35907 gene locus_tag LOCUS_5610 37541 35907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 37945 37541 gene locus_tag LOCUS_5620 37945 37541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 38268 38192 gene locus_tag LOCUS_t0330 38268 38192 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 38362 38766 gene locus_tag LOCUS_5630 38362 38766 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_5630 38750 39460 gene locus_tag LOCUS_5640 38750 39460 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 protein_id gnl|my_center|LOCUS_5640 39454 40212 gene locus_tag LOCUS_5650 39454 40212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 40287 40754 gene locus_tag LOCUS_5660 40287 40754 CDS product DUF5684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028234.1 protein_id gnl|my_center|LOCUS_5660 40815 40889 gene locus_tag LOCUS_t0340 40815 40889 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 40934 41009 gene locus_tag LOCUS_t0350 40934 41009 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 42042 41014 gene locus_tag LOCUS_5670 42042 41014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 42168 42244 gene locus_tag LOCUS_t0360 42168 42244 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 42644 42342 gene locus_tag LOCUS_5680 gene rpsO 42644 42342 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_5680 43321 42617 gene locus_tag LOCUS_5690 gene truB 43321 42617 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_5690 45455 43350 gene locus_tag LOCUS_5700 45455 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 45609 45935 gene locus_tag LOCUS_5710 45609 45935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 46551 45916 gene locus_tag LOCUS_5720 46551 45916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 47475 46618 gene locus_tag LOCUS_5730 gene mutM 47475 46618 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_5730 48528 47476 gene locus_tag LOCUS_5740 48528 47476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 49493 48543 gene locus_tag LOCUS_5750 gene rhuM 49493 48543 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_5750 52205 49626 gene locus_tag LOCUS_5760 52205 49626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 53329 52223 gene locus_tag LOCUS_5770 53329 52223 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_5770 53919 53344 gene locus_tag LOCUS_5780 53919 53344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 54852 53941 gene locus_tag LOCUS_5790 54852 53941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 55240 54857 gene locus_tag LOCUS_5800 55240 54857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 56204 55248 gene locus_tag LOCUS_5810 gene rpoD 56204 55248 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_5810 57857 56220 gene locus_tag LOCUS_5820 57857 56220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 57906 58517 gene locus_tag LOCUS_5830 57906 58517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 58541 59035 gene locus_tag LOCUS_5840 gene mscL 58541 59035 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_5840 59371 59072 gene locus_tag LOCUS_5850 59371 59072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 59892 59368 gene locus_tag LOCUS_5860 gene orn 59892 59368 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770781.1 protein_id gnl|my_center|LOCUS_5860 61691 59892 gene locus_tag LOCUS_5870 gene argS 61691 59892 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455463.1 protein_id gnl|my_center|LOCUS_5870 63315 61705 gene locus_tag LOCUS_5880 gene pyrG 63315 61705 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_5880 63555 64385 gene locus_tag LOCUS_5890 63555 64385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 64399 65004 gene locus_tag LOCUS_5900 64399 65004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 65110 65021 gene locus_tag LOCUS_t0370 65110 65021 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 65195 66682 gene locus_tag LOCUS_5910 65195 66682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 66745 67533 gene locus_tag LOCUS_5920 66745 67533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_5920 67536 68768 gene locus_tag LOCUS_5930 67536 68768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_5930 68787 70103 gene locus_tag LOCUS_5940 68787 70103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 70108 71052 gene locus_tag LOCUS_5950 70108 71052 CDS product peptidoglycan bridge formation peptidyltransferase VanK-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461306.1 protein_id gnl|my_center|LOCUS_5950 72100 71390 gene locus_tag LOCUS_5960 72100 71390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 72608 72162 gene locus_tag LOCUS_5970 72608 72162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 72930 72721 gene locus_tag LOCUS_5980 72930 72721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 73378 76293 gene locus_tag LOCUS_5990 73378 76293 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_5990 76390 76692 gene locus_tag LOCUS_6000 76390 76692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 76676 77086 gene locus_tag LOCUS_6010 76676 77086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 77846 77070 gene locus_tag LOCUS_6020 77846 77070 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767591.1 protein_id gnl|my_center|LOCUS_6020 78790 77846 gene locus_tag LOCUS_6030 78790 77846 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_6030 78819 80216 gene locus_tag LOCUS_6040 78819 80216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 82426 80252 gene locus_tag LOCUS_6050 gene pnp 82426 80252 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_6050 82636 82932 gene locus_tag LOCUS_6060 82636 82932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 84613 82991 gene locus_tag LOCUS_6070 gene groL 84613 82991 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_6070 84884 84627 gene locus_tag LOCUS_6080 84884 84627 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_6080 85137 87335 gene locus_tag LOCUS_6090 85137 87335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 87471 88520 gene locus_tag LOCUS_6100 87471 88520 CDS product DUF4325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682079.1 protein_id gnl|my_center|LOCUS_6100 88528 89919 gene locus_tag LOCUS_6110 88528 89919 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768129.1 protein_id gnl|my_center|LOCUS_6110 90702 89956 gene locus_tag LOCUS_6120 90702 89956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 91193 90777 gene locus_tag LOCUS_6130 91193 90777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 91583 91290 gene locus_tag LOCUS_6140 91583 91290 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870896.1 protein_id gnl|my_center|LOCUS_6140 >Feature sequence06 105 458 gene locus_tag LOCUS_6150 105 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2320 488 gene locus_tag LOCUS_6160 gene typA 2320 488 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_6160 2408 2484 gene locus_tag LOCUS_t0380 2408 2484 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2509 2585 gene locus_tag LOCUS_t0390 2509 2585 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3143 2655 gene locus_tag LOCUS_6170 3143 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 3485 3162 gene locus_tag LOCUS_6180 3485 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 4349 3573 gene locus_tag LOCUS_6190 4349 3573 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475600.1 protein_id gnl|my_center|LOCUS_6190 4405 5604 gene locus_tag LOCUS_6200 4405 5604 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064599.1 protein_id gnl|my_center|LOCUS_6200 5591 6634 gene locus_tag LOCUS_6210 gene mnmA 5591 6634 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 protein_id gnl|my_center|LOCUS_6210 6662 8617 gene locus_tag LOCUS_6220 6662 8617 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_6220 8645 9952 gene locus_tag LOCUS_6230 8645 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 10733 10011 gene locus_tag LOCUS_6240 10733 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 11379 10675 gene locus_tag LOCUS_6250 11379 10675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 12975 11401 gene locus_tag LOCUS_6260 12975 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 12965 14857 gene locus_tag LOCUS_6270 12965 14857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 14857 16566 gene locus_tag LOCUS_6280 14857 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 16563 17633 gene locus_tag LOCUS_6290 16563 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 17670 18956 gene locus_tag LOCUS_6300 gene obgE 17670 18956 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048021.1 protein_id gnl|my_center|LOCUS_6300 19239 23447 gene locus_tag LOCUS_6310 19239 23447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 23440 23871 gene locus_tag LOCUS_6320 23440 23871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 23886 25883 gene locus_tag LOCUS_6330 gene uvrB 23886 25883 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837078.1 protein_id gnl|my_center|LOCUS_6330 25908 26252 gene locus_tag LOCUS_6340 25908 26252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 26296 26583 gene locus_tag LOCUS_6350 gene gatC 26296 26583 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_6350 26586 27965 gene locus_tag LOCUS_6360 gene gatA 26586 27965 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_6360 27965 28387 gene locus_tag LOCUS_6370 27965 28387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 28389 29822 gene locus_tag LOCUS_6380 gene gatB 28389 29822 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079967.1 protein_id gnl|my_center|LOCUS_6380 29850 31052 gene locus_tag LOCUS_6390 29850 31052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 31067 31777 gene locus_tag LOCUS_6400 gene ung 31067 31777 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_6400 32392 31778 gene locus_tag LOCUS_6410 32392 31778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 32491 34281 gene locus_tag LOCUS_6420 32491 34281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 34299 36956 gene locus_tag LOCUS_6430 34299 36956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 36842 39697 gene locus_tag LOCUS_6440 36842 39697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 39705 42233 gene locus_tag LOCUS_6450 39705 42233 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_6450 42278 43177 gene locus_tag LOCUS_6460 42278 43177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 43319 45664 gene locus_tag LOCUS_6470 43319 45664 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_6470 45664 46173 gene locus_tag LOCUS_6480 gene nrdG 45664 46173 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_6480 46285 46977 gene locus_tag LOCUS_6490 46285 46977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 47185 48054 gene locus_tag LOCUS_6500 47185 48054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 48035 48451 gene locus_tag LOCUS_6510 48035 48451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 48438 48644 gene locus_tag LOCUS_6520 48438 48644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 48745 48924 gene locus_tag LOCUS_6530 48745 48924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 49163 49789 gene locus_tag LOCUS_6540 49163 49789 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902203.1 protein_id gnl|my_center|LOCUS_6540 49830 50294 gene locus_tag LOCUS_6550 49830 50294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 50467 51861 gene locus_tag LOCUS_6560 50467 51861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6560 51846 52085 gene locus_tag LOCUS_6570 51846 52085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 52088 54703 gene locus_tag LOCUS_6580 52088 54703 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_6580 55393 55139 gene locus_tag LOCUS_6590 55393 55139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 55479 57065 gene locus_tag LOCUS_6600 55479 57065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 57236 57817 gene locus_tag LOCUS_6610 57236 57817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 58114 57821 gene locus_tag LOCUS_6620 58114 57821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 58409 58564 gene locus_tag LOCUS_6630 58409 58564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 58551 59108 gene locus_tag LOCUS_6640 58551 59108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 59086 60198 gene locus_tag LOCUS_6650 59086 60198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 60253 60177 gene locus_tag LOCUS_t0400 60253 60177 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 60320 60991 gene locus_tag LOCUS_6660 gene trmD 60320 60991 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183438.1 protein_id gnl|my_center|LOCUS_6660 60969 63188 gene locus_tag LOCUS_6670 gene recG 60969 63188 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986837.1 protein_id gnl|my_center|LOCUS_6670 63190 63987 gene locus_tag LOCUS_6680 63190 63987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 63978 64496 gene locus_tag LOCUS_6690 gene rsmD 63978 64496 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_6690 64539 64976 gene locus_tag LOCUS_6700 64539 64976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 65000 66091 gene locus_tag LOCUS_6710 65000 66091 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724021.1 protein_id gnl|my_center|LOCUS_6710 66121 66204 gene locus_tag LOCUS_t0410 66121 66204 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 1166 927 gene locus_tag LOCUS_6720 1166 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 1984 3264 gene locus_tag LOCUS_6730 1984 3264 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_6730 4535 5179 gene locus_tag LOCUS_6740 4535 5179 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_6740 5176 5679 gene locus_tag LOCUS_6750 5176 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 5992 6687 gene locus_tag LOCUS_6760 5992 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 6753 8078 gene locus_tag LOCUS_6770 6753 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 8053 8388 gene locus_tag LOCUS_6780 8053 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 8960 9613 gene locus_tag LOCUS_6790 8960 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 9635 10546 gene locus_tag LOCUS_6800 9635 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 10651 11535 gene locus_tag LOCUS_6810 10651 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 11517 12200 gene locus_tag LOCUS_6820 11517 12200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 12443 12838 gene locus_tag LOCUS_6830 12443 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6830 13031 13363 gene locus_tag LOCUS_6840 13031 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 14456 13401 gene locus_tag LOCUS_6850 gene ruvB 14456 13401 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_6850 14592 15290 gene locus_tag LOCUS_6860 14592 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 15401 15796 gene locus_tag LOCUS_6870 15401 15796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 16857 16315 gene locus_tag LOCUS_6880 16857 16315 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_6880 17174 16953 gene locus_tag LOCUS_6890 17174 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 17310 18011 gene locus_tag LOCUS_6900 17310 18011 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_6900 18021 18425 gene locus_tag LOCUS_6910 18021 18425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 18706 19311 gene locus_tag LOCUS_6920 18706 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 19344 21905 gene locus_tag LOCUS_6930 19344 21905 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549665.1 protein_id gnl|my_center|LOCUS_6930 21994 22551 gene locus_tag LOCUS_6940 21994 22551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 >Feature sequence08 1278 2018 gene locus_tag LOCUS_6950 1278 2018 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_6950 2020 2595 gene locus_tag LOCUS_6960 2020 2595 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704257.1 protein_id gnl|my_center|LOCUS_6960 3937 2651 gene locus_tag LOCUS_6970 gene eno 3937 2651 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_6970 3992 4519 gene locus_tag LOCUS_6980 3992 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 4516 5817 gene locus_tag LOCUS_6990 4516 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 5869 6096 gene locus_tag LOCUS_7000 5869 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 6098 7825 gene locus_tag LOCUS_7010 6098 7825 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724033.1 protein_id gnl|my_center|LOCUS_7010 7863 7952 gene locus_tag LOCUS_t0420 7863 7952 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8044 11208 gene locus_tag LOCUS_7020 8044 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 11380 12243 gene locus_tag LOCUS_7030 11380 12243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 12252 13100 gene locus_tag LOCUS_7040 12252 13100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 13215 13874 gene locus_tag LOCUS_7050 13215 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 13972 14931 gene locus_tag LOCUS_7060 13972 14931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 14951 15904 gene locus_tag LOCUS_7070 14951 15904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 15976 17130 gene locus_tag LOCUS_7080 15976 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 17246 18643 gene locus_tag LOCUS_7090 17246 18643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 18653 19237 gene locus_tag LOCUS_7100 18653 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 >Feature sequence09 13 311 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatagtcccctaacaatttcaaatagtgtataat 701 375 gene locus_tag LOCUS_7110 gene cas2 701 375 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_7110 1599 706 gene locus_tag LOCUS_7120 gene cas1 1599 706 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002797819.1 protein_id gnl|my_center|LOCUS_7120 4691 1575 gene locus_tag LOCUS_7130 gene cas9 4691 1575 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_7130 5489 4899 gene locus_tag LOCUS_7140 gene tsf 5489 4899 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082052.1 protein_id gnl|my_center|LOCUS_7140 6196 5510 gene locus_tag LOCUS_7150 gene rpsB 6196 5510 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_7150 6415 6783 gene locus_tag LOCUS_7160 6415 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 6865 7197 gene locus_tag LOCUS_7170 6865 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 7245 8207 gene locus_tag LOCUS_7180 7245 8207 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107732.1 protein_id gnl|my_center|LOCUS_7180 8456 8208 gene locus_tag LOCUS_7190 8456 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 8550 9068 gene locus_tag LOCUS_7200 8550 9068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 9235 11220 gene locus_tag LOCUS_7210 9235 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 >Feature sequence10 293 1324 gene locus_tag LOCUS_7220 293 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 1308 1970 gene locus_tag LOCUS_7230 1308 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 2163 2576 gene locus_tag LOCUS_7240 2163 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 2595 3737 gene locus_tag LOCUS_7250 2595 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 3895 4461 gene locus_tag LOCUS_7260 3895 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7260 4466 6052 gene locus_tag LOCUS_7270 4466 6052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 6210 6515 gene locus_tag LOCUS_7280 6210 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 6520 6750 gene locus_tag LOCUS_7290 6520 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 6752 7066 gene locus_tag LOCUS_7300 6752 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 7133 7381 gene locus_tag LOCUS_7310 7133 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 7530 7874 gene locus_tag LOCUS_7320 7530 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 7888 8328 gene locus_tag LOCUS_7330 7888 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 8393 8539 gene locus_tag LOCUS_7340 8393 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 8670 9446 gene locus_tag LOCUS_7350 8670 9446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 9433 11610 gene locus_tag LOCUS_7360 9433 11610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 >Feature sequence11 3332 3416 gene locus_tag LOCUS_t0430 3332 3416 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3661 4488 gene locus_tag LOCUS_7370 3661 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 4501 5664 gene locus_tag LOCUS_7380 4501 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 5664 6299 gene locus_tag LOCUS_7390 5664 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 6283 6972 gene locus_tag LOCUS_7400 6283 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 7423 6902 gene locus_tag LOCUS_7410 7423 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 8798 7509 gene locus_tag LOCUS_7420 gene hisS 8798 7509 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_7420 8839 8914 gene locus_tag LOCUS_t0440 8839 8914 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 2837 459 gene locus_tag LOCUS_7430 2837 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 3214 2837 gene locus_tag LOCUS_7440 3214 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 3363 3288 gene locus_tag LOCUS_t0450 3363 3288 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3519 3998 gene locus_tag LOCUS_7450 3519 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 4015 4090 gene locus_tag LOCUS_t0460 4015 4090 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence13 924 13 gene locus_tag LOCUS_7460 924 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 1022 947 gene locus_tag LOCUS_t0470 1022 947 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1076 2323 gene locus_tag LOCUS_7470 1076 2323 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_7470 2325 3518 gene locus_tag LOCUS_7480 2325 3518 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_7480 3515 4930 gene locus_tag LOCUS_7490 3515 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 5580 4963 gene locus_tag LOCUS_7500 5580 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7500 >Feature sequence14 2805 2305 gene locus_tag LOCUS_7510 gene pth 2805 2305 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_7510 4346 2895 gene locus_tag LOCUS_7520 4346 2895 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_7520 >Feature sequence15 151 840 gene locus_tag LOCUS_7530 151 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7530 827 1660 gene locus_tag LOCUS_7540 gene galU 827 1660 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792462.1 protein_id gnl|my_center|LOCUS_7540 1679 3037 gene locus_tag LOCUS_7550 gene radA 1679 3037 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_7550 3051 4085 gene locus_tag LOCUS_7560 3051 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 4162 4641 gene locus_tag LOCUS_7570 gene ruvC 4162 4641 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_7570 4649 5227 gene locus_tag LOCUS_7580 gene ruvA 4649 5227 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_7580 >Feature sequence16 42 692 gene locus_tag LOCUS_7590 42 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 706 1242 gene locus_tag LOCUS_7600 706 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 1344 1895 gene locus_tag LOCUS_7610 1344 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610