>Feature sequence1 1900 1274 gene locus_tag LOCUS_0010 1900 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 2294 1962 gene locus_tag LOCUS_0020 2294 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 2317 4299 gene locus_tag LOCUS_0030 2317 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 4821 4345 gene locus_tag LOCUS_0040 4821 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 5872 4823 gene locus_tag LOCUS_0050 5872 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 6221 5880 gene locus_tag LOCUS_0060 gene rnpA 6221 5880 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_0060 6394 6257 gene locus_tag LOCUS_0070 gene rpmH 6394 6257 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420485.1 protein_id gnl|my_center|LOCUS_0070 6630 8030 gene locus_tag LOCUS_0080 gene dnaA 6630 8030 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_0080 8331 9437 gene locus_tag LOCUS_0090 gene dnaN 8331 9437 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035260.1 protein_id gnl|my_center|LOCUS_0090 9515 10453 gene locus_tag LOCUS_0100 gene recF 9515 10453 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_0100 10866 10450 gene locus_tag LOCUS_0110 10866 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 11663 10869 gene locus_tag LOCUS_0120 11663 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 12382 11693 gene locus_tag LOCUS_0130 12382 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 13855 12383 gene locus_tag LOCUS_0140 13855 12383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 15731 13908 gene locus_tag LOCUS_0150 15731 13908 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222039.1 protein_id gnl|my_center|LOCUS_0150 16566 15724 gene locus_tag LOCUS_0160 16566 15724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 17525 16584 gene locus_tag LOCUS_0170 17525 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 21022 17594 gene locus_tag LOCUS_0180 21022 17594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 21167 21529 gene locus_tag LOCUS_0190 21167 21529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 21531 21827 gene locus_tag LOCUS_0200 21531 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 21917 22345 gene locus_tag LOCUS_0210 21917 22345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 22455 22889 gene locus_tag LOCUS_0220 22455 22889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 23491 22958 gene locus_tag LOCUS_0230 23491 22958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 23692 24297 gene locus_tag LOCUS_0240 23692 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 24659 24294 gene locus_tag LOCUS_0250 24659 24294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 24904 24812 gene locus_tag LOCUS_t0010 24904 24812 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 24948 25439 gene locus_tag LOCUS_0260 24948 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 25529 26065 gene locus_tag LOCUS_0270 25529 26065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 27717 26098 gene locus_tag LOCUS_0280 gene groL 27717 26098 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393619.1 protein_id gnl|my_center|LOCUS_0280 28177 27920 gene locus_tag LOCUS_0290 28177 27920 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_0290 28398 30731 gene locus_tag LOCUS_0300 28398 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 30963 32234 gene locus_tag LOCUS_0310 30963 32234 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_0310 32356 33048 gene locus_tag LOCUS_0320 32356 33048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 34606 33089 gene locus_tag LOCUS_0330 gene rny 34606 33089 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050913.1 protein_id gnl|my_center|LOCUS_0330 35116 34718 gene locus_tag LOCUS_0340 35116 34718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 35479 35132 gene locus_tag LOCUS_0350 35479 35132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 36024 35464 gene locus_tag LOCUS_0360 36024 35464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 36067 37038 gene locus_tag LOCUS_0370 36067 37038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 37095 37169 gene locus_tag LOCUS_t0020 37095 37169 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 37310 38878 gene locus_tag LOCUS_0380 37310 38878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 39781 38882 gene locus_tag LOCUS_0390 39781 38882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 39922 40368 gene locus_tag LOCUS_0400 39922 40368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 41702 40440 gene locus_tag LOCUS_0410 41702 40440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 41878 42441 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcagtttcacgattagattacacgactctcaaat 42817 43839 gene locus_tag LOCUS_0420 42817 43839 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_0420 44513 43845 gene locus_tag LOCUS_0430 gene csn2 44513 43845 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_0430 44815 44510 gene locus_tag LOCUS_0440 gene cas2 44815 44510 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_0440 45695 44820 gene locus_tag LOCUS_0450 gene cas1 45695 44820 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_0450 49847 45696 gene locus_tag LOCUS_0460 gene cas9 49847 45696 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_0460 52762 50051 gene locus_tag LOCUS_0470 52762 50051 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392069.1 protein_id gnl|my_center|LOCUS_0470 52881 53084 gene locus_tag LOCUS_0480 52881 53084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 53422 53745 gene locus_tag LOCUS_0490 53422 53745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 53933 54484 gene locus_tag LOCUS_0500 53933 54484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 55731 54601 gene locus_tag LOCUS_0510 55731 54601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 57323 56274 gene locus_tag LOCUS_0520 gene tsaD 57323 56274 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141354.1 protein_id gnl|my_center|LOCUS_0520 58573 57341 gene locus_tag LOCUS_0530 58573 57341 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931069.1 protein_id gnl|my_center|LOCUS_0530 59376 58573 gene locus_tag LOCUS_0540 59376 58573 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_0540 59477 59683 gene locus_tag LOCUS_0550 59477 59683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 59729 59818 gene locus_tag LOCUS_t0030 59729 59818 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 60340 60053 gene locus_tag LOCUS_0560 60340 60053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 60730 60464 gene locus_tag LOCUS_0570 60730 60464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 61032 61298 gene locus_tag LOCUS_0580 61032 61298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 61694 61332 gene locus_tag LOCUS_0590 61694 61332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 62511 61831 gene locus_tag LOCUS_0600 62511 61831 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986511.1 protein_id gnl|my_center|LOCUS_0600 63404 62583 gene locus_tag LOCUS_0610 63404 62583 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_0610 64062 63397 gene locus_tag LOCUS_0620 64062 63397 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356064.1 protein_id gnl|my_center|LOCUS_0620 64997 64062 gene locus_tag LOCUS_0630 64997 64062 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234733.1 protein_id gnl|my_center|LOCUS_0630 65120 66724 gene locus_tag LOCUS_0640 gene pyrG 65120 66724 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_0640 66760 66969 gene locus_tag LOCUS_0650 66760 66969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 67285 66959 gene locus_tag LOCUS_0660 67285 66959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 67818 67282 gene locus_tag LOCUS_0670 gene orn 67818 67282 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021796.1 protein_id gnl|my_center|LOCUS_0670 69581 67818 gene locus_tag LOCUS_0680 gene argS 69581 67818 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_0680 69661 71064 gene locus_tag LOCUS_0690 69661 71064 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250733.1 protein_id gnl|my_center|LOCUS_0690 71629 71108 gene locus_tag LOCUS_0700 gene mscL 71629 71108 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242893.1 protein_id gnl|my_center|LOCUS_0700 72280 71666 gene locus_tag LOCUS_0710 72280 71666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 72330 73982 gene locus_tag LOCUS_0720 gene dnaG 72330 73982 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546187.1 protein_id gnl|my_center|LOCUS_0720 73998 74954 gene locus_tag LOCUS_0730 gene rpoD 73998 74954 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964612.1 protein_id gnl|my_center|LOCUS_0730 74962 75255 gene locus_tag LOCUS_0740 74962 75255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 75259 76176 gene locus_tag LOCUS_0750 75259 76176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 76206 76778 gene locus_tag LOCUS_0760 76206 76778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 76778 79177 gene locus_tag LOCUS_0770 76778 79177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 79193 80158 gene locus_tag LOCUS_0780 gene rhuM 79193 80158 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_0780 80189 81241 gene locus_tag LOCUS_0790 80189 81241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 81241 82098 gene locus_tag LOCUS_0800 gene mutM 81241 82098 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_0800 82210 82839 gene locus_tag LOCUS_0810 82210 82839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 83080 82829 gene locus_tag LOCUS_0820 gene rpsT 83080 82829 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_0820 83238 85268 gene locus_tag LOCUS_0830 83238 85268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 85286 85969 gene locus_tag LOCUS_0840 gene truB 85286 85969 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_0840 85999 86265 gene locus_tag LOCUS_0850 gene rpsO 85999 86265 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_0850 87033 86461 gene locus_tag LOCUS_0860 87033 86461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 87919 87143 gene locus_tag LOCUS_0870 87919 87143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 88629 87913 gene locus_tag LOCUS_0880 88629 87913 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262157.1 protein_id gnl|my_center|LOCUS_0880 89035 88613 gene locus_tag LOCUS_0890 89035 88613 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_0890 89193 91367 gene locus_tag LOCUS_0900 gene pnp 89193 91367 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_0900 91490 91696 gene locus_tag LOCUS_0910 91490 91696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 91888 94140 gene locus_tag LOCUS_0920 91888 94140 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388321.1 protein_id gnl|my_center|LOCUS_0920 94209 94577 gene locus_tag LOCUS_0930 94209 94577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 94581 95048 gene locus_tag LOCUS_0940 94581 95048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 95076 95273 gene locus_tag LOCUS_0950 95076 95273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 95285 95845 gene locus_tag LOCUS_0960 gene efp 95285 95845 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583400.1 protein_id gnl|my_center|LOCUS_0960 96015 96401 gene locus_tag LOCUS_0970 96015 96401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 96460 97470 gene locus_tag LOCUS_0980 gene pilM 96460 97470 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228636.1 protein_id gnl|my_center|LOCUS_0980 97470 98639 gene locus_tag LOCUS_0990 97470 98639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 98639 99544 gene locus_tag LOCUS_1000 98639 99544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 99544 100071 gene locus_tag LOCUS_1010 99544 100071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 100074 101837 gene locus_tag LOCUS_1020 100074 101837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 101877 102947 gene locus_tag LOCUS_1030 101877 102947 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_1030 102949 104154 gene locus_tag LOCUS_1040 102949 104154 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_1040 104629 105159 gene locus_tag LOCUS_1050 104629 105159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 106131 105163 gene locus_tag LOCUS_1060 gene xerD 106131 105163 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_1060 106192 107208 gene locus_tag LOCUS_1070 106192 107208 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065321.1 protein_id gnl|my_center|LOCUS_1070 107764 107249 gene locus_tag LOCUS_1080 107764 107249 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657947.1 protein_id gnl|my_center|LOCUS_1080 107882 107806 gene locus_tag LOCUS_t0040 107882 107806 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 107927 108955 gene locus_tag LOCUS_1090 107927 108955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 108981 109055 gene locus_tag LOCUS_t0050 108981 109055 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 109118 109193 gene locus_tag LOCUS_t0060 109118 109193 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 109724 109263 gene locus_tag LOCUS_1100 109724 109263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 110065 109989 gene locus_tag LOCUS_t0070 110065 109989 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 110138 110542 gene locus_tag LOCUS_1110 110138 110542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 110543 112177 gene locus_tag LOCUS_1120 110543 112177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 112289 112687 gene locus_tag LOCUS_1130 112289 112687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 112758 113993 gene locus_tag LOCUS_1140 112758 113993 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971520.1 protein_id gnl|my_center|LOCUS_1140 114042 114488 gene locus_tag LOCUS_1150 gene greA 114042 114488 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179966.1 protein_id gnl|my_center|LOCUS_1150 114610 115383 gene locus_tag LOCUS_1160 114610 115383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 115475 118276 gene locus_tag LOCUS_1170 115475 118276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 118333 118887 gene locus_tag LOCUS_1180 118333 118887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 118999 118923 gene locus_tag LOCUS_t0080 118999 118923 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 119068 120837 gene locus_tag LOCUS_1190 gene thrS 119068 120837 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421565.1 protein_id gnl|my_center|LOCUS_1190 120849 121640 gene locus_tag LOCUS_1200 gene miaA 120849 121640 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_1200 121624 122229 gene locus_tag LOCUS_1210 121624 122229 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_1210 122235 122684 gene locus_tag LOCUS_1220 122235 122684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 122733 123365 gene locus_tag LOCUS_1230 122733 123365 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192745.1 protein_id gnl|my_center|LOCUS_1230 123602 124411 gene locus_tag LOCUS_1240 123602 124411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 125009 124797 gene locus_tag LOCUS_1250 gene rpmB 125009 124797 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256168.1 protein_id gnl|my_center|LOCUS_1250 125358 125011 gene locus_tag LOCUS_1260 gene rplT 125358 125011 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948412.1 protein_id gnl|my_center|LOCUS_1260 125700 125362 gene locus_tag LOCUS_1270 125700 125362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 126086 125658 gene locus_tag LOCUS_1280 126086 125658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 127769 126255 gene locus_tag LOCUS_1290 127769 126255 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_1290 129406 129612 gene locus_tag LOCUS_1300 129406 129612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 129696 132278 gene locus_tag LOCUS_1310 129696 132278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 132339 134321 gene locus_tag LOCUS_1320 gene gyrB 132339 134321 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359210.1 protein_id gnl|my_center|LOCUS_1320 134335 136881 gene locus_tag LOCUS_1330 gene gyrA 134335 136881 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 protein_id gnl|my_center|LOCUS_1330 >Feature sequence2 <1 959 gene locus_tag LOCUS_1340 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393139.1:endolytic transglycosylase MltG 956 2020 gene locus_tag LOCUS_1350 956 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 2071 3375 gene locus_tag LOCUS_1360 gene obgE 2071 3375 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254297.1 protein_id gnl|my_center|LOCUS_1360 3618 5621 gene locus_tag LOCUS_1370 gene uvrB 3618 5621 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837078.1 protein_id gnl|my_center|LOCUS_1370 5703 6200 gene locus_tag LOCUS_1380 5703 6200 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_1380 6298 6570 gene locus_tag LOCUS_1390 6298 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 6601 6888 gene locus_tag LOCUS_1400 gene gatC 6601 6888 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457086.1 protein_id gnl|my_center|LOCUS_1400 6891 8282 gene locus_tag LOCUS_1410 gene gatA 6891 8282 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_1410 8282 8707 gene locus_tag LOCUS_1420 8282 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 8707 10131 gene locus_tag LOCUS_1430 gene gatB 8707 10131 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079967.1 protein_id gnl|my_center|LOCUS_1430 10182 11402 gene locus_tag LOCUS_1440 10182 11402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 11408 12115 gene locus_tag LOCUS_1450 11408 12115 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387025.1 protein_id gnl|my_center|LOCUS_1450 12651 12118 gene locus_tag LOCUS_1460 12651 12118 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_1460 12736 14520 gene locus_tag LOCUS_1470 12736 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 14543 17281 gene locus_tag LOCUS_1480 14543 17281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 17359 19893 gene locus_tag LOCUS_1490 17359 19893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 19901 22426 gene locus_tag LOCUS_1500 19901 22426 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_1500 22473 23306 gene locus_tag LOCUS_1510 22473 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 23494 25860 gene locus_tag LOCUS_1520 23494 25860 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436320.1 protein_id gnl|my_center|LOCUS_1520 25862 26347 gene locus_tag LOCUS_1530 gene nrdG 25862 26347 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_1530 26470 27162 gene locus_tag LOCUS_1540 26470 27162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 27229 27879 gene locus_tag LOCUS_1550 gene trmD 27229 27879 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183438.1 protein_id gnl|my_center|LOCUS_1550 27876 29921 gene locus_tag LOCUS_1560 gene recG 27876 29921 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986837.1 protein_id gnl|my_center|LOCUS_1560 29931 30434 gene locus_tag LOCUS_1570 gene rsmD 29931 30434 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_1570 30712 31101 gene locus_tag LOCUS_1580 30712 31101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 31157 32239 gene locus_tag LOCUS_1590 31157 32239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 32266 32350 gene locus_tag LOCUS_t0090 32266 32350 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32729 32385 gene locus_tag LOCUS_1600 32729 32385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 34710 33916 gene locus_tag LOCUS_1610 34710 33916 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767591.1 protein_id gnl|my_center|LOCUS_1610 35656 34697 gene locus_tag LOCUS_1620 35656 34697 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_1620 35809 36993 gene locus_tag LOCUS_1630 gene tuf 35809 36993 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933844.1 protein_id gnl|my_center|LOCUS_1630 37117 37638 gene locus_tag LOCUS_1640 37117 37638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 38175 37717 gene locus_tag LOCUS_1650 38175 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 39387 40268 gene locus_tag LOCUS_1660 39387 40268 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_1660 40276 41052 gene locus_tag LOCUS_1670 40276 41052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 41039 41980 gene locus_tag LOCUS_1680 41039 41980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_1680 41982 42782 gene locus_tag LOCUS_1690 41982 42782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1690 42779 43825 gene locus_tag LOCUS_1700 42779 43825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_1700 43861 44799 gene locus_tag LOCUS_1710 43861 44799 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 protein_id gnl|my_center|LOCUS_1710 44856 46727 gene locus_tag LOCUS_1720 44856 46727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 46752 46827 gene locus_tag LOCUS_t0100 46752 46827 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 47021 48169 gene locus_tag LOCUS_1730 47021 48169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 48320 49474 gene locus_tag LOCUS_1740 48320 49474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 49610 51295 gene locus_tag LOCUS_1750 49610 51295 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_1750 51380 52705 gene locus_tag LOCUS_1760 51380 52705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 52705 53664 gene locus_tag LOCUS_1770 52705 53664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 54409 53666 gene locus_tag LOCUS_1780 54409 53666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 55872 54436 gene locus_tag LOCUS_1790 55872 54436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 55949 57949 gene locus_tag LOCUS_1800 55949 57949 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_1800 59159 57993 gene locus_tag LOCUS_1810 59159 57993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 59866 59261 gene locus_tag LOCUS_1820 59866 59261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 60281 60356 gene locus_tag LOCUS_t0110 60281 60356 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 60457 63006 gene locus_tag LOCUS_1830 60457 63006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 63031 63495 gene locus_tag LOCUS_1840 63031 63495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 63543 64784 gene locus_tag LOCUS_1850 63543 64784 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_1850 64794 65999 gene locus_tag LOCUS_1860 64794 65999 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871136.1 protein_id gnl|my_center|LOCUS_1860 66110 67483 gene locus_tag LOCUS_1870 66110 67483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 67591 67516 gene locus_tag LOCUS_t0120 67591 67516 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 67636 68649 gene locus_tag LOCUS_1880 gene trpS 67636 68649 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124091865.1 protein_id gnl|my_center|LOCUS_1880 68649 69680 gene locus_tag LOCUS_1890 68649 69680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 69680 70363 gene locus_tag LOCUS_1900 69680 70363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 70374 71141 gene locus_tag LOCUS_1910 70374 71141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 72014 71184 gene locus_tag LOCUS_1920 72014 71184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 72262 72178 gene locus_tag LOCUS_t0130 72262 72178 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 72338 72263 gene locus_tag LOCUS_t0140 72338 72263 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 73063 72401 gene locus_tag LOCUS_1930 73063 72401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 74730 73078 gene locus_tag LOCUS_1940 74730 73078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 75513 75722 gene locus_tag LOCUS_1950 75513 75722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 75826 76503 gene locus_tag LOCUS_1960 75826 76503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 76851 76516 gene locus_tag LOCUS_1970 76851 76516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 77968 77486 gene locus_tag LOCUS_1980 77968 77486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 79741 78011 gene locus_tag LOCUS_1990 79741 78011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 80047 79814 gene locus_tag LOCUS_2000 80047 79814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 80227 80153 gene locus_tag LOCUS_t0150 80227 80153 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 80348 80701 gene locus_tag LOCUS_2010 80348 80701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 80720 81265 gene locus_tag LOCUS_2020 gene nusG 80720 81265 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_2020 81329 81757 gene locus_tag LOCUS_2030 gene rplK 81329 81757 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548197.1 protein_id gnl|my_center|LOCUS_2030 81827 82549 gene locus_tag LOCUS_2040 81827 82549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 82696 83619 gene locus_tag LOCUS_2050 82696 83619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 83683 84390 gene locus_tag LOCUS_2060 83683 84390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 84399 84812 gene locus_tag LOCUS_2070 gene smpB 84399 84812 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167013.1 protein_id gnl|my_center|LOCUS_2070 84812 85591 gene locus_tag LOCUS_2080 84812 85591 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_2080 85591 86403 gene locus_tag LOCUS_2090 85591 86403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 86504 87472 gene locus_tag LOCUS_2100 gene metK 86504 87472 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_2100 87580 87909 gene locus_tag LOCUS_2110 gene rpsJ 87580 87909 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563872.1 protein_id gnl|my_center|LOCUS_2110 87975 89246 gene locus_tag LOCUS_2120 87975 89246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 89248 90018 gene locus_tag LOCUS_2130 89248 90018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_2130 90015 91178 gene locus_tag LOCUS_2140 90015 91178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 91175 92170 gene locus_tag LOCUS_2150 91175 92170 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658082.1 protein_id gnl|my_center|LOCUS_2150 92172 93209 gene locus_tag LOCUS_2160 92172 93209 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_2160 93408 93776 gene locus_tag LOCUS_2170 93408 93776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 93763 98649 gene locus_tag LOCUS_2180 93763 98649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 98724 99932 gene locus_tag LOCUS_2190 gene ftsZ 98724 99932 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_2190 99959 100411 gene locus_tag LOCUS_2200 gene nrdR 99959 100411 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894570.1 protein_id gnl|my_center|LOCUS_2200 100424 100687 gene locus_tag LOCUS_2210 100424 100687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 100718 103681 gene locus_tag LOCUS_2220 gene ileS 100718 103681 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_2220 103674 105419 gene locus_tag LOCUS_2230 103674 105419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 105412 107196 gene locus_tag LOCUS_2240 105412 107196 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_2240 107250 108716 gene locus_tag LOCUS_2250 107250 108716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 108727 109314 gene locus_tag LOCUS_2260 108727 109314 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958632.1 protein_id gnl|my_center|LOCUS_2260 109314 109925 gene locus_tag LOCUS_2270 gene tmk 109314 109925 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173647.1 protein_id gnl|my_center|LOCUS_2270 109974 111575 gene locus_tag LOCUS_2280 109974 111575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 111587 112873 gene locus_tag LOCUS_2290 gene tig 111587 112873 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392064.1 protein_id gnl|my_center|LOCUS_2290 112917 113519 gene locus_tag LOCUS_2300 112917 113519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 113586 114293 gene locus_tag LOCUS_2310 113586 114293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 114286 118239 gene locus_tag LOCUS_2320 114286 118239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 118348 118761 gene locus_tag LOCUS_2330 gene rpsL 118348 118761 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_2330 118761 119240 gene locus_tag LOCUS_2340 gene rpsG 118761 119240 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_2340 119318 120319 gene locus_tag LOCUS_2350 gene gap 119318 120319 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_2350 120326 120832 gene locus_tag LOCUS_2360 gene rpiB 120326 120832 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853308.1 protein_id gnl|my_center|LOCUS_2360 120832 121482 gene locus_tag LOCUS_2370 120832 121482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 121482 122447 gene locus_tag LOCUS_2380 121482 122447 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_2380 122464 123252 gene locus_tag LOCUS_2390 122464 123252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 123268 124458 gene locus_tag LOCUS_2400 gene nifS 123268 124458 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_2400 124445 124855 gene locus_tag LOCUS_2410 124445 124855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 124885 125805 gene locus_tag LOCUS_2420 124885 125805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 125825 129172 gene locus_tag LOCUS_2430 125825 129172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 129190 129384 gene locus_tag LOCUS_2440 129190 129384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 >Feature sequence3 3187 776 gene locus_tag LOCUS_2450 3187 776 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476551.1 protein_id gnl|my_center|LOCUS_2450 3337 3912 gene locus_tag LOCUS_2460 3337 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 4734 3970 gene locus_tag LOCUS_2470 4734 3970 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393206.1 protein_id gnl|my_center|LOCUS_2470 4825 5073 gene locus_tag LOCUS_2480 4825 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 5667 5125 gene locus_tag LOCUS_2490 5667 5125 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_2490 6418 5726 gene locus_tag LOCUS_2500 6418 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 7896 6571 gene locus_tag LOCUS_2510 7896 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 11831 8004 gene locus_tag LOCUS_2520 11831 8004 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077661.1 protein_id gnl|my_center|LOCUS_2520 15201 11833 gene locus_tag LOCUS_2530 gene rpoB 15201 11833 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272205.1 protein_id gnl|my_center|LOCUS_2530 15739 15371 gene locus_tag LOCUS_2540 15739 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 16344 15826 gene locus_tag LOCUS_2550 16344 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 16774 16421 gene locus_tag LOCUS_2560 16774 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 17389 16850 gene locus_tag LOCUS_2570 17389 16850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 18369 17599 gene locus_tag LOCUS_2580 gene rnc 18369 17599 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354946.1 protein_id gnl|my_center|LOCUS_2580 18979 18371 gene locus_tag LOCUS_2590 18979 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 19433 18900 gene locus_tag LOCUS_2600 gene nusB 19433 18900 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_2600 19678 19436 gene locus_tag LOCUS_2610 19678 19436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 22294 19913 gene locus_tag LOCUS_2620 gene leuS 22294 19913 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_2620 22887 22303 gene locus_tag LOCUS_2630 22887 22303 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_2630 22959 23435 gene locus_tag LOCUS_2640 22959 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 23785 23414 gene locus_tag LOCUS_2650 23785 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 24791 23787 gene locus_tag LOCUS_2660 24791 23787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 24979 28620 gene locus_tag LOCUS_2670 gene dnaE 24979 28620 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129735450.1 protein_id gnl|my_center|LOCUS_2670 29589 28678 gene locus_tag LOCUS_2680 29589 28678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 30516 29608 gene locus_tag LOCUS_2690 30516 29608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 31008 30691 gene locus_tag LOCUS_2700 31008 30691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 31908 31033 gene locus_tag LOCUS_2710 gene galU 31908 31033 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721495.1 protein_id gnl|my_center|LOCUS_2710 32597 31962 gene locus_tag LOCUS_2720 32597 31962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 33328 32606 gene locus_tag LOCUS_2730 33328 32606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 33555 33352 gene locus_tag LOCUS_2740 33555 33352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 34627 33536 gene locus_tag LOCUS_2750 gene xseA 34627 33536 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_2750 35583 34729 gene locus_tag LOCUS_2760 35583 34729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 36567 36397 gene locus_tag LOCUS_2770 36567 36397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 36876 36604 gene locus_tag LOCUS_2780 gene rpmA 36876 36604 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_2780 37990 36878 gene locus_tag LOCUS_2790 37990 36878 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 protein_id gnl|my_center|LOCUS_2790 38761 38072 gene locus_tag LOCUS_2800 38761 38072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 40668 38827 gene locus_tag LOCUS_2810 40668 38827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 41118 40738 gene locus_tag LOCUS_2820 41118 40738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 41500 41333 gene locus_tag LOCUS_2830 41500 41333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 41664 42146 gene locus_tag LOCUS_2840 41664 42146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 45016 42143 gene locus_tag LOCUS_2850 gene uvrA 45016 42143 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462189.1 protein_id gnl|my_center|LOCUS_2850 46507 45080 gene locus_tag LOCUS_2860 gene sbcB 46507 45080 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819831.1 protein_id gnl|my_center|LOCUS_2860 47263 46511 gene locus_tag LOCUS_2870 47263 46511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 49789 47285 gene locus_tag LOCUS_2880 gene pheT 49789 47285 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775584.1 protein_id gnl|my_center|LOCUS_2880 50752 49793 gene locus_tag LOCUS_2890 50752 49793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 51792 50809 gene locus_tag LOCUS_2900 51792 50809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 51903 52136 gene locus_tag LOCUS_2910 51903 52136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 53538 52123 gene locus_tag LOCUS_2920 gene metG 53538 52123 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_2920 54145 53561 gene locus_tag LOCUS_2930 54145 53561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 54980 54189 gene locus_tag LOCUS_2940 gene rsmA 54980 54189 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_2940 56058 54982 gene locus_tag LOCUS_2950 56058 54982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 57270 56083 gene locus_tag LOCUS_2960 57270 56083 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_2960 58425 57292 gene locus_tag LOCUS_2970 58425 57292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 59503 58466 gene locus_tag LOCUS_2980 gene ftsX 59503 58466 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236202.1 protein_id gnl|my_center|LOCUS_2980 60351 59503 gene locus_tag LOCUS_2990 60351 59503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 61447 60377 gene locus_tag LOCUS_3000 gene prfB 61447 60377 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_3000 62823 61450 gene locus_tag LOCUS_3010 gene murD 62823 61450 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583609.1 protein_id gnl|my_center|LOCUS_3010 63285 62845 gene locus_tag LOCUS_3020 63285 62845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 64592 63318 gene locus_tag LOCUS_3030 64592 63318 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964938.1 protein_id gnl|my_center|LOCUS_3030 67334 64602 gene locus_tag LOCUS_3040 gene secA 67334 64602 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_3040 67741 67376 gene locus_tag LOCUS_3050 67741 67376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 68998 67745 gene locus_tag LOCUS_3060 gene serS 68998 67745 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583734.1 protein_id gnl|my_center|LOCUS_3060 70908 69040 gene locus_tag LOCUS_3070 70908 69040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 71857 70940 gene locus_tag LOCUS_3080 71857 70940 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715326.1 protein_id gnl|my_center|LOCUS_3080 71997 72515 gene locus_tag LOCUS_3090 71997 72515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 74152 72578 gene locus_tag LOCUS_3100 gene lysS 74152 72578 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082221.1 protein_id gnl|my_center|LOCUS_3100 74887 74174 gene locus_tag LOCUS_3110 74887 74174 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215902.1 protein_id gnl|my_center|LOCUS_3110 76101 74890 gene locus_tag LOCUS_3120 gene rseP 76101 74890 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_3120 76666 76124 gene locus_tag LOCUS_3130 gene frr 76666 76124 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_3130 76767 77861 gene locus_tag LOCUS_3140 76767 77861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 78697 77948 gene locus_tag LOCUS_3150 78697 77948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 79026 78940 gene locus_tag LOCUS_t0160 79026 78940 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 81175 79085 gene locus_tag LOCUS_3160 81175 79085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 81855 81199 gene locus_tag LOCUS_3170 81855 81199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 82332 81934 gene locus_tag LOCUS_3180 gene rpsI 82332 81934 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001966744.1 protein_id gnl|my_center|LOCUS_3180 82757 82332 gene locus_tag LOCUS_3190 gene rplM 82757 82332 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 protein_id gnl|my_center|LOCUS_3190 83162 82761 gene locus_tag LOCUS_3200 gene rplQ 83162 82761 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_3200 84112 83162 gene locus_tag LOCUS_3210 84112 83162 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626433.1 protein_id gnl|my_center|LOCUS_3210 84732 84130 gene locus_tag LOCUS_3220 gene rpsD 84732 84130 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258257.1 protein_id gnl|my_center|LOCUS_3220 85166 84732 gene locus_tag LOCUS_3230 gene rpsK 85166 84732 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557092.1 protein_id gnl|my_center|LOCUS_3230 85562 85176 gene locus_tag LOCUS_3240 gene rpsM 85562 85176 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888756.1 protein_id gnl|my_center|LOCUS_3240 85962 85744 gene locus_tag LOCUS_3250 gene infA 85962 85744 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_3250 86825 86016 gene locus_tag LOCUS_3260 86825 86016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 88334 86841 gene locus_tag LOCUS_3270 gene secY 88334 86841 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_3270 89020 88559 gene locus_tag LOCUS_3280 gene rplO 89020 88559 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328073.1 protein_id gnl|my_center|LOCUS_3280 89883 89023 gene locus_tag LOCUS_3290 89883 89023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 90215 89886 gene locus_tag LOCUS_3300 gene rplR 90215 89886 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 protein_id gnl|my_center|LOCUS_3300 90753 90217 gene locus_tag LOCUS_3310 gene rplF 90753 90217 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_3310 91429 90839 gene locus_tag LOCUS_3320 gene tsf 91429 90839 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082052.1 protein_id gnl|my_center|LOCUS_3320 92135 91449 gene locus_tag LOCUS_3330 gene rpsB 92135 91449 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_3330 92296 92631 gene locus_tag LOCUS_3340 92296 92631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 93412 92690 gene locus_tag LOCUS_3350 93412 92690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 93563 93487 gene locus_tag LOCUS_t0170 93563 93487 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 93616 94653 gene locus_tag LOCUS_3360 93616 94653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 94674 95717 gene locus_tag LOCUS_3370 gene prfA 94674 95717 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256395.1 protein_id gnl|my_center|LOCUS_3370 95695 96408 gene locus_tag LOCUS_3380 95695 96408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 97602 96382 gene locus_tag LOCUS_3390 97602 96382 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_3390 98413 97625 gene locus_tag LOCUS_3400 98413 97625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 98664 99161 gene locus_tag LOCUS_3410 gene lepB 98664 99161 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425127.1 protein_id gnl|my_center|LOCUS_3410 99287 99129 gene locus_tag LOCUS_3420 99287 99129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 100674 99280 gene locus_tag LOCUS_3430 100674 99280 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_3430 100988 100737 gene locus_tag LOCUS_3440 100988 100737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 101422 101183 gene locus_tag LOCUS_3450 101422 101183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 102377 101424 gene locus_tag LOCUS_3460 102377 101424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 103041 102382 gene locus_tag LOCUS_3470 103041 102382 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_3470 103120 103455 gene locus_tag LOCUS_3480 103120 103455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 104573 103452 gene locus_tag LOCUS_3490 104573 103452 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225393.1 protein_id gnl|my_center|LOCUS_3490 104649 105737 gene locus_tag LOCUS_3500 gene queA 104649 105737 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932232.1 protein_id gnl|my_center|LOCUS_3500 105731 106849 gene locus_tag LOCUS_3510 gene tgt 105731 106849 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112950.1 protein_id gnl|my_center|LOCUS_3510 107474 106851 gene locus_tag LOCUS_3520 107474 106851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 108918 107503 gene locus_tag LOCUS_3530 gene cysS 108918 107503 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_3530 109944 108940 gene locus_tag LOCUS_3540 109944 108940 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_3540 110094 111176 gene locus_tag LOCUS_3550 gene rmuC 110094 111176 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_3550 111918 111313 gene locus_tag LOCUS_3560 gene recR 111918 111313 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_3560 112216 111920 gene locus_tag LOCUS_3570 112216 111920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 113701 112235 gene locus_tag LOCUS_3580 113701 112235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 115094 113727 gene locus_tag LOCUS_3590 gene dnaB 115094 113727 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_3590 116550 115075 gene locus_tag LOCUS_3600 116550 115075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 117114 116596 gene locus_tag LOCUS_3610 117114 116596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 117439 119196 gene locus_tag LOCUS_3620 117439 119196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 119720 119340 gene locus_tag LOCUS_3630 gene rplL 119720 119340 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_3630 120361 119837 gene locus_tag LOCUS_3640 gene rplJ 120361 119837 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643933.1 protein_id gnl|my_center|LOCUS_3640 120513 120944 gene locus_tag LOCUS_3650 120513 120944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 <122010 120990 gene locus_tag LOCUS_3660 <122010 120990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243992.1:tRNA-dihydrouridine synthase >Feature sequence4 376 870 gene locus_tag LOCUS_3670 376 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 1100 867 gene locus_tag LOCUS_3680 1100 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 1179 1255 gene locus_tag LOCUS_t0180 1179 1255 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1513 1716 gene locus_tag LOCUS_3690 1513 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 1791 2126 gene locus_tag LOCUS_3700 1791 2126 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130302.1 protein_id gnl|my_center|LOCUS_3700 2302 2619 gene locus_tag LOCUS_3710 2302 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 3532 2702 gene locus_tag LOCUS_3720 3532 2702 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_3720 3678 4745 gene locus_tag LOCUS_3730 gene rpsA 3678 4745 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_3730 4810 4884 gene locus_tag LOCUS_t0190 4810 4884 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4896 4972 gene locus_tag LOCUS_t0200 4896 4972 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5084 6859 gene locus_tag LOCUS_3740 5084 6859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 6873 7163 gene locus_tag LOCUS_3750 6873 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 7948 7160 gene locus_tag LOCUS_3760 7948 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 8516 7941 gene locus_tag LOCUS_3770 gene def 8516 7941 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_3770 10593 8530 gene locus_tag LOCUS_3780 10593 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 10739 10990 gene locus_tag LOCUS_3790 10739 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 10993 12639 gene locus_tag LOCUS_3800 10993 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 12672 12890 gene locus_tag LOCUS_3810 12672 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 13600 13031 gene locus_tag LOCUS_3820 13600 13031 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125842.1 protein_id gnl|my_center|LOCUS_3820 13684 14436 gene locus_tag LOCUS_3830 gene map 13684 14436 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_3830 15653 14433 gene locus_tag LOCUS_3840 gene ftsA 15653 14433 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_3840 15839 16141 gene locus_tag LOCUS_3850 15839 16141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 16299 16658 gene locus_tag LOCUS_3860 16299 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 16660 18360 gene locus_tag LOCUS_3870 16660 18360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 18377 19726 gene locus_tag LOCUS_3880 18377 19726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 19757 20065 gene locus_tag LOCUS_3890 gene rplU 19757 20065 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005989959.1 protein_id gnl|my_center|LOCUS_3890 20945 20094 gene locus_tag LOCUS_3900 20945 20094 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185518.1 protein_id gnl|my_center|LOCUS_3900 21817 20945 gene locus_tag LOCUS_3910 21817 20945 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_3910 23183 21744 gene locus_tag LOCUS_3920 23183 21744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 23201 23629 gene locus_tag LOCUS_3930 gene rnhA 23201 23629 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_3930 23639 24172 gene locus_tag LOCUS_3940 23639 24172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 24194 25774 gene locus_tag LOCUS_3950 24194 25774 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_3950 25774 27726 gene locus_tag LOCUS_3960 gene pcrA 25774 27726 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992853.1 protein_id gnl|my_center|LOCUS_3960 27767 28804 gene locus_tag LOCUS_3970 27767 28804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 29273 30151 gene locus_tag LOCUS_3980 gene rsmH 29273 30151 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_3980 30553 30870 gene locus_tag LOCUS_3990 30553 30870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 31032 34331 gene locus_tag LOCUS_4000 31032 34331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 34689 34934 gene locus_tag LOCUS_4010 34689 34934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 36189 35041 gene locus_tag LOCUS_4020 36189 35041 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 protein_id gnl|my_center|LOCUS_4020 36994 36182 gene locus_tag LOCUS_4030 36994 36182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 38394 37180 gene locus_tag LOCUS_4040 38394 37180 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108877.1 protein_id gnl|my_center|LOCUS_4040 38622 39824 gene locus_tag LOCUS_4050 38622 39824 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_4050 39853 41607 gene locus_tag LOCUS_4060 39853 41607 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_4060 41622 42653 gene locus_tag LOCUS_4070 gene mraY 41622 42653 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383222.1 protein_id gnl|my_center|LOCUS_4070 43195 43899 gene locus_tag LOCUS_4080 43195 43899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 43871 45133 gene locus_tag LOCUS_4090 gene murG 43871 45133 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724779.1 protein_id gnl|my_center|LOCUS_4090 45133 45672 gene locus_tag LOCUS_4100 45133 45672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 45770 46108 gene locus_tag LOCUS_4110 45770 46108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 47005 46850 gene locus_tag LOCUS_4120 47005 46850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 49988 47091 gene locus_tag LOCUS_4130 49988 47091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 51067 50036 gene locus_tag LOCUS_4140 51067 50036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 53623 51269 gene locus_tag LOCUS_4150 gene topA 53623 51269 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_4150 54527 53646 gene locus_tag LOCUS_4160 54527 53646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 55548 55030 gene locus_tag LOCUS_4170 gene pth 55548 55030 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262644.1 protein_id gnl|my_center|LOCUS_4170 55888 55577 gene locus_tag LOCUS_4180 55888 55577 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_4180 56946 56116 gene locus_tag LOCUS_4190 56946 56116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 57025 57174 gene locus_tag LOCUS_4200 57025 57174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 57449 57970 gene locus_tag LOCUS_4210 57449 57970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 59212 58028 gene locus_tag LOCUS_4220 59212 58028 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_4220 60337 59279 gene locus_tag LOCUS_4230 60337 59279 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_4230 61857 60421 gene locus_tag LOCUS_4240 61857 60421 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_4240 62852 61875 gene locus_tag LOCUS_4250 62852 61875 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107915.1 protein_id gnl|my_center|LOCUS_4250 64032 62845 gene locus_tag LOCUS_4260 gene wzy 64032 62845 CDS product oligosaccharide repeat unit polymerase Wzy inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909570.1 protein_id gnl|my_center|LOCUS_4260 65021 64044 gene locus_tag LOCUS_4270 65021 64044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 65935 65057 gene locus_tag LOCUS_4280 65935 65057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 66423 65932 gene locus_tag LOCUS_4290 66423 65932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 66883 66425 gene locus_tag LOCUS_4300 66883 66425 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_4300 67618 66884 gene locus_tag LOCUS_4310 67618 66884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 67815 68753 gene locus_tag LOCUS_4320 67815 68753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 68750 69046 gene locus_tag LOCUS_4330 68750 69046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 69049 70236 gene locus_tag LOCUS_4340 69049 70236 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_4340 70879 70238 gene locus_tag LOCUS_4350 70879 70238 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219633.1 protein_id gnl|my_center|LOCUS_4350 72210 70915 gene locus_tag LOCUS_4360 72210 70915 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_4360 72915 72220 gene locus_tag LOCUS_4370 72915 72220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 73267 72893 gene locus_tag LOCUS_4380 73267 72893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 73958 73260 gene locus_tag LOCUS_4390 73958 73260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 74608 74012 gene locus_tag LOCUS_4400 gene clpP 74608 74012 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_4400 75634 74621 gene locus_tag LOCUS_4410 75634 74621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 78107 75627 gene locus_tag LOCUS_4420 78107 75627 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583832.1 protein_id gnl|my_center|LOCUS_4420 78776 78339 gene locus_tag LOCUS_4430 78776 78339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 81012 78913 gene locus_tag LOCUS_4440 gene fusA 81012 78913 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101803.1 protein_id gnl|my_center|LOCUS_4440 83349 81109 gene locus_tag LOCUS_4450 83349 81109 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003591104.1 protein_id gnl|my_center|LOCUS_4450 84485 83412 gene locus_tag LOCUS_4460 84485 83412 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_4460 85967 84534 gene locus_tag LOCUS_4470 gene pyk 85967 84534 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398560.1 protein_id gnl|my_center|LOCUS_4470 86112 86555 gene locus_tag LOCUS_4480 86112 86555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 86579 86653 gene locus_tag LOCUS_t0210 86579 86653 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 86668 86744 gene locus_tag LOCUS_t0220 86668 86744 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 88156 86783 gene locus_tag LOCUS_4490 88156 86783 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_4490 89652 88171 gene locus_tag LOCUS_4500 gene gltX 89652 88171 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_4500 89906 93139 gene locus_tag LOCUS_4510 89906 93139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 93912 93136 gene locus_tag LOCUS_4520 93912 93136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 94815 93922 gene locus_tag LOCUS_4530 94815 93922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 95059 96558 gene locus_tag LOCUS_4540 95059 96558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 97016 96615 gene locus_tag LOCUS_4550 gene rpsH 97016 96615 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178881.1 protein_id gnl|my_center|LOCUS_4550 97302 97033 gene locus_tag LOCUS_4560 gene rpsN 97302 97033 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293413.1 protein_id gnl|my_center|LOCUS_4560 97886 97302 gene locus_tag LOCUS_4570 gene rplE 97886 97302 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183032.1 protein_id gnl|my_center|LOCUS_4570 98256 97888 gene locus_tag LOCUS_4580 gene rplN 98256 97888 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_4580 98574 98257 gene locus_tag LOCUS_4590 gene rpsQ 98574 98257 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886965.1 protein_id gnl|my_center|LOCUS_4590 98996 98577 gene locus_tag LOCUS_4600 gene rplP 98996 98577 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_4600 99625 98999 gene locus_tag LOCUS_4610 gene rpsC 99625 98999 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720944.1 protein_id gnl|my_center|LOCUS_4610 100038 99625 gene locus_tag LOCUS_4620 100038 99625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 100337 100038 gene locus_tag LOCUS_4630 gene rpsS 100337 100038 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_4630 101173 100337 gene locus_tag LOCUS_4640 gene rplB 101173 100337 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074682.1 protein_id gnl|my_center|LOCUS_4640 101625 101173 gene locus_tag LOCUS_4650 101625 101173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 102248 101628 gene locus_tag LOCUS_4660 gene rplD 102248 101628 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166912.1 protein_id gnl|my_center|LOCUS_4660 102867 102250 gene locus_tag LOCUS_4670 gene rplC 102867 102250 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081835.1 protein_id gnl|my_center|LOCUS_4670 103160 103068 gene locus_tag LOCUS_r0010 103160 103068 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 78 percent of the 5S ribosomal RNA >Feature sequence5 2364 154 gene locus_tag LOCUS_4680 2364 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 4115 2694 gene locus_tag LOCUS_4690 gene der 4115 2694 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183096.1 protein_id gnl|my_center|LOCUS_4690 5710 4148 gene locus_tag LOCUS_4700 5710 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 6381 5710 gene locus_tag LOCUS_4710 6381 5710 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_4710 7204 6374 gene locus_tag LOCUS_4720 7204 6374 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_4720 8592 7345 gene locus_tag LOCUS_4730 8592 7345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 10360 8801 gene locus_tag LOCUS_4740 10360 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 11111 10374 gene locus_tag LOCUS_4750 11111 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 11855 11352 gene locus_tag LOCUS_4760 11855 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 12195 12956 gene locus_tag LOCUS_4770 12195 12956 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814140.1 protein_id gnl|my_center|LOCUS_4770 13057 12983 gene locus_tag LOCUS_t0230 13057 12983 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13146 13070 gene locus_tag LOCUS_t0240 13146 13070 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13967 13179 gene locus_tag LOCUS_4780 13967 13179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 14736 13954 gene locus_tag LOCUS_4790 14736 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 15641 14838 gene locus_tag LOCUS_4800 15641 14838 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130508.1 protein_id gnl|my_center|LOCUS_4800 16051 15653 gene locus_tag LOCUS_4810 16051 15653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 16098 16183 gene locus_tag LOCUS_t0250 16098 16183 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17075 16365 gene locus_tag LOCUS_4820 17075 16365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 17947 17057 gene locus_tag LOCUS_4830 17947 17057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 18581 18174 gene locus_tag LOCUS_4840 18581 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 18832 18665 gene locus_tag LOCUS_4850 18832 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 19843 18935 gene locus_tag LOCUS_4860 19843 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 20496 19861 gene locus_tag LOCUS_4870 20496 19861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 21502 20624 gene locus_tag LOCUS_4880 21502 20624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 22585 21857 gene locus_tag LOCUS_4890 22585 21857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 24732 23101 gene locus_tag LOCUS_4900 gene murJ 24732 23101 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_4900 26601 24790 gene locus_tag LOCUS_4910 gene aspS 26601 24790 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_4910 27100 26699 gene locus_tag LOCUS_4920 27100 26699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 28507 27320 gene locus_tag LOCUS_4930 28507 27320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 29145 28504 gene locus_tag LOCUS_4940 29145 28504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439795.1 protein_id gnl|my_center|LOCUS_4940 31105 29165 gene locus_tag LOCUS_4950 gene ftsH 31105 29165 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_4950 31136 32245 gene locus_tag LOCUS_4960 31136 32245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 37779 32242 gene locus_tag LOCUS_4970 37779 32242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 37912 39396 gene locus_tag LOCUS_4980 37912 39396 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873492.1 protein_id gnl|my_center|LOCUS_4980 40435 39488 gene locus_tag LOCUS_4990 40435 39488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 41791 40451 gene locus_tag LOCUS_5000 41791 40451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 42343 41870 gene locus_tag LOCUS_5010 42343 41870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 43458 42448 gene locus_tag LOCUS_5020 43458 42448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5020 44148 43570 gene locus_tag LOCUS_5030 gene ruvA 44148 43570 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_5030 44637 44158 gene locus_tag LOCUS_5040 gene ruvC 44637 44158 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_5040 45991 44639 gene locus_tag LOCUS_5050 gene radA 45991 44639 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_5050 46829 45993 gene locus_tag LOCUS_5060 gene galU 46829 45993 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870852.1 protein_id gnl|my_center|LOCUS_5060 48445 46859 gene locus_tag LOCUS_5070 gene gpmI 48445 46859 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_5070 52746 48520 gene locus_tag LOCUS_5080 52746 48520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 52745 52900 gene locus_tag LOCUS_5090 52745 52900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 54107 53052 gene locus_tag LOCUS_5100 gene aguA 54107 53052 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_5100 55587 54133 gene locus_tag LOCUS_5110 55587 54133 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732183.1 protein_id gnl|my_center|LOCUS_5110 56606 55587 gene locus_tag LOCUS_5120 gene ptcA 56606 55587 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002282737.1 protein_id gnl|my_center|LOCUS_5120 59203 56666 gene locus_tag LOCUS_5130 59203 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 60193 59252 gene locus_tag LOCUS_5140 gene arcC 60193 59252 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113951.1 protein_id gnl|my_center|LOCUS_5140 61470 60211 gene locus_tag LOCUS_5150 61470 60211 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831993.1 protein_id gnl|my_center|LOCUS_5150 61975 61544 gene locus_tag LOCUS_5160 61975 61544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 62952 62521 gene locus_tag LOCUS_5170 62952 62521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 >Feature sequence6 1057 302 gene locus_tag LOCUS_5180 1057 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 2079 1162 gene locus_tag LOCUS_5190 2079 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 3193 2081 gene locus_tag LOCUS_5200 3193 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 4108 3836 gene locus_tag LOCUS_5210 4108 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 4745 4224 gene locus_tag LOCUS_5220 4745 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 6853 4847 gene locus_tag LOCUS_5230 gene ligA 6853 4847 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_5230 7952 6837 gene locus_tag LOCUS_5240 7952 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 8811 7933 gene locus_tag LOCUS_5250 gene htpX 8811 7933 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699683.1 protein_id gnl|my_center|LOCUS_5250 9403 8825 gene locus_tag LOCUS_5260 9403 8825 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_5260 9501 9577 gene locus_tag LOCUS_t0260 9501 9577 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9663 10037 gene locus_tag LOCUS_5270 9663 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 10128 12278 gene locus_tag LOCUS_5280 10128 12278 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082809.1 protein_id gnl|my_center|LOCUS_5280 12439 12364 gene locus_tag LOCUS_t0270 12439 12364 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12483 13784 gene locus_tag LOCUS_5290 gene hisS 12483 13784 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_5290 13801 14370 gene locus_tag LOCUS_5300 13801 14370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 15039 14350 gene locus_tag LOCUS_5310 15039 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 15676 15023 gene locus_tag LOCUS_5320 15676 15023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 15932 15654 gene locus_tag LOCUS_5330 15932 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 16061 16912 gene locus_tag LOCUS_5340 16061 16912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 17021 16945 gene locus_tag LOCUS_t0280 17021 16945 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17121 17045 gene locus_tag LOCUS_t0290 17121 17045 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 18326 17247 gene locus_tag LOCUS_5350 18326 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 19334 18390 gene locus_tag LOCUS_5360 19334 18390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 20291 19344 gene locus_tag LOCUS_5370 20291 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 21017 20385 gene locus_tag LOCUS_5380 21017 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 21973 21122 gene locus_tag LOCUS_5390 21973 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 22760 21960 gene locus_tag LOCUS_5400 22760 21960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 26139 22852 gene locus_tag LOCUS_5410 26139 22852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 27087 26473 gene locus_tag LOCUS_5420 27087 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 27253 27167 gene locus_tag LOCUS_t0300 27253 27167 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27336 27263 gene locus_tag LOCUS_t0310 27336 27263 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28886 27684 gene locus_tag LOCUS_5430 28886 27684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 33909 28984 gene locus_tag LOCUS_5440 33909 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 34708 34004 gene locus_tag LOCUS_5450 34708 34004 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565310.1 protein_id gnl|my_center|LOCUS_5450 36074 34719 gene locus_tag LOCUS_5460 36074 34719 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_5460 37301 36102 gene locus_tag LOCUS_5470 37301 36102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 >Feature sequence7 2693 906 gene locus_tag LOCUS_5480 2693 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 2744 4450 gene locus_tag LOCUS_5490 2744 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 5226 5957 gene locus_tag LOCUS_5500 5226 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 7282 5960 gene locus_tag LOCUS_5510 7282 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 9190 7310 gene locus_tag LOCUS_5520 9190 7310 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_5520 9784 9236 gene locus_tag LOCUS_5530 9784 9236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 10230 9853 gene locus_tag LOCUS_5540 10230 9853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 11321 10287 gene locus_tag LOCUS_5550 gene mnmA 11321 10287 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286726.1 protein_id gnl|my_center|LOCUS_5550 12531 11314 gene locus_tag LOCUS_5560 12531 11314 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064599.1 protein_id gnl|my_center|LOCUS_5560 13074 12547 gene locus_tag LOCUS_5570 13074 12547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 13442 13098 gene locus_tag LOCUS_5580 13442 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 14318 13509 gene locus_tag LOCUS_5590 14318 13509 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528321.1 protein_id gnl|my_center|LOCUS_5590 15031 14402 gene locus_tag LOCUS_5600 15031 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 16956 15127 gene locus_tag LOCUS_5610 gene typA 16956 15127 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_5610 17705 17052 gene locus_tag LOCUS_5620 17705 17052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 17853 19295 gene locus_tag LOCUS_5630 17853 19295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 19295 19834 gene locus_tag LOCUS_5640 19295 19834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 >Feature sequence8 1048 281 gene locus_tag LOCUS_5650 1048 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 2535 1390 gene locus_tag LOCUS_5660 2535 1390 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964256.1 protein_id gnl|my_center|LOCUS_5660 2799 2713 gene locus_tag LOCUS_t0320 2799 2713 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4429 2822 gene locus_tag LOCUS_5670 4429 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 6612 4486 gene locus_tag LOCUS_5680 6612 4486 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_5680 6758 7615 gene locus_tag LOCUS_5690 6758 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 8777 7662 gene locus_tag LOCUS_5700 gene nusA 8777 7662 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172799.1 protein_id gnl|my_center|LOCUS_5700 8968 8893 gene locus_tag LOCUS_t0330 8968 8893 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9937 9029 gene locus_tag LOCUS_5710 gene rimK 9937 9029 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_5710 10462 9959 gene locus_tag LOCUS_5720 10462 9959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 11721 10492 gene locus_tag LOCUS_5730 gene tyrS 11721 10492 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870294.1 protein_id gnl|my_center|LOCUS_5730