>Feature sequence001 280 17 gene locus_tag LOCUS_00010 280 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 866 324 gene locus_tag LOCUS_00020 866 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2157 934 gene locus_tag LOCUS_00030 2157 934 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_00030 4122 2368 gene locus_tag LOCUS_00040 4122 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8971 4130 gene locus_tag LOCUS_00050 8971 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 9246 9031 gene locus_tag LOCUS_00060 9246 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9582 9250 gene locus_tag LOCUS_00070 9582 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10387 9686 gene locus_tag LOCUS_00080 10387 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11464 10778 gene locus_tag LOCUS_00090 11464 10778 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_00090 13024 11612 gene locus_tag LOCUS_00100 13024 11612 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_00100 13290 13021 gene locus_tag LOCUS_00110 13290 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14513 13326 gene locus_tag LOCUS_00120 14513 13326 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_00120 16251 14506 gene locus_tag LOCUS_00130 16251 14506 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_00130 16491 16261 gene locus_tag LOCUS_00140 16491 16261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 17326 16511 gene locus_tag LOCUS_00150 17326 16511 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_00150 19982 17346 gene locus_tag LOCUS_00160 gene adhE 19982 17346 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_00160 21433 20144 gene locus_tag LOCUS_00170 21433 20144 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793004.1 protein_id gnl|my_center|LOCUS_00170 21742 22803 gene locus_tag LOCUS_00180 21742 22803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23707 22790 gene locus_tag LOCUS_00190 23707 22790 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118333.1 protein_id gnl|my_center|LOCUS_00190 24911 23748 gene locus_tag LOCUS_00200 24911 23748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766592.1 protein_id gnl|my_center|LOCUS_00200 25833 24928 gene locus_tag LOCUS_00210 25833 24928 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_00210 26474 25830 gene locus_tag LOCUS_00220 gene gmhA 26474 25830 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_00220 27221 26481 gene locus_tag LOCUS_00230 27221 26481 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_00230 28728 27205 gene locus_tag LOCUS_00240 28728 27205 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_00240 32922 28744 gene locus_tag LOCUS_00250 32922 28744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 36309 32941 gene locus_tag LOCUS_00260 36309 32941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 37462 36314 gene locus_tag LOCUS_00270 37462 36314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 39804 37459 gene locus_tag LOCUS_00280 39804 37459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 43094 39846 gene locus_tag LOCUS_00290 43094 39846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 45259 43091 gene locus_tag LOCUS_00300 45259 43091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 46756 45329 gene locus_tag LOCUS_00310 46756 45329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 47260 47463 gene locus_tag LOCUS_00320 47260 47463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 47553 49007 gene locus_tag LOCUS_00330 47553 49007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 50112 49090 gene locus_tag LOCUS_00340 gene recA 50112 49090 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 protein_id gnl|my_center|LOCUS_00340 50597 50145 gene locus_tag LOCUS_00350 50597 50145 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_00350 51174 50581 gene locus_tag LOCUS_00360 51174 50581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 52763 51213 gene locus_tag LOCUS_00370 52763 51213 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_00370 54749 52902 gene locus_tag LOCUS_00380 54749 52902 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667902.1 protein_id gnl|my_center|LOCUS_00380 56228 54762 gene locus_tag LOCUS_00390 56228 54762 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_00390 56319 56243 gene locus_tag LOCUS_t00010 56319 56243 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 57911 56328 gene locus_tag LOCUS_00400 57911 56328 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337137.1 protein_id gnl|my_center|LOCUS_00400 58653 57991 gene locus_tag LOCUS_00410 gene rnc 58653 57991 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869841.1 protein_id gnl|my_center|LOCUS_00410 59751 58678 gene locus_tag LOCUS_00420 59751 58678 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_00420 61072 59753 gene locus_tag LOCUS_00430 61072 59753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 63966 61126 gene locus_tag LOCUS_00440 gene uvrA 63966 61126 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228683.1 protein_id gnl|my_center|LOCUS_00440 64750 63974 gene locus_tag LOCUS_00450 64750 63974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 65493 64750 gene locus_tag LOCUS_00460 65493 64750 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454839.1 protein_id gnl|my_center|LOCUS_00460 66302 65508 gene locus_tag LOCUS_00470 66302 65508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 66867 66304 gene locus_tag LOCUS_00480 66867 66304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 67951 66884 gene locus_tag LOCUS_00490 67951 66884 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_00490 69666 67948 gene locus_tag LOCUS_00500 69666 67948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 70815 69709 gene locus_tag LOCUS_00510 70815 69709 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881134.1 protein_id gnl|my_center|LOCUS_00510 71690 70830 gene locus_tag LOCUS_00520 gene rfbD 71690 70830 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_00520 72973 71687 gene locus_tag LOCUS_00530 72973 71687 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683949.1 protein_id gnl|my_center|LOCUS_00530 74527 72977 gene locus_tag LOCUS_00540 gene rho 74527 72977 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311067.1 protein_id gnl|my_center|LOCUS_00540 75130 74543 gene locus_tag LOCUS_00550 gene coaE 75130 74543 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_00550 78393 75142 gene locus_tag LOCUS_00560 78393 75142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 79562 78444 gene locus_tag LOCUS_00570 79562 78444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 80488 79559 gene locus_tag LOCUS_00580 80488 79559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 82203 80485 gene locus_tag LOCUS_00590 82203 80485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 82983 82228 gene locus_tag LOCUS_00600 82983 82228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 83986 82997 gene locus_tag LOCUS_00610 gene kdsD 83986 82997 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455124.1 protein_id gnl|my_center|LOCUS_00610 85089 84043 gene locus_tag LOCUS_00620 gene pta 85089 84043 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_00620 86286 85156 gene locus_tag LOCUS_00630 86286 85156 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583303.1 protein_id gnl|my_center|LOCUS_00630 98995 86342 gene locus_tag LOCUS_00640 98995 86342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 99547 99020 gene locus_tag LOCUS_00650 99547 99020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 108242 99531 gene locus_tag LOCUS_00660 108242 99531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 109895 108288 gene locus_tag LOCUS_00670 109895 108288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 111047 110655 gene locus_tag LOCUS_00680 111047 110655 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922104.1 protein_id gnl|my_center|LOCUS_00680 113335 111515 gene locus_tag LOCUS_00690 113335 111515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 115680 113848 gene locus_tag LOCUS_00700 115680 113848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 117257 116109 gene locus_tag LOCUS_00710 117257 116109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 118299 117424 gene locus_tag LOCUS_00720 118299 117424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 119649 118330 gene locus_tag LOCUS_00730 gene mnmE 119649 118330 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039299.1 protein_id gnl|my_center|LOCUS_00730 121955 119649 gene locus_tag LOCUS_00740 121955 119649 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665246.1 protein_id gnl|my_center|LOCUS_00740 123046 121982 gene locus_tag LOCUS_00750 123046 121982 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_00750 124520 123072 gene locus_tag LOCUS_00760 124520 123072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 125442 124585 gene locus_tag LOCUS_00770 125442 124585 CDS product metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942637.1 protein_id gnl|my_center|LOCUS_00770 126549 125446 gene locus_tag LOCUS_00780 126549 125446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 127736 127257 gene locus_tag LOCUS_00790 127736 127257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 127768 128811 gene locus_tag LOCUS_00800 127768 128811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 128942 130378 gene locus_tag LOCUS_00810 gene dnaA 128942 130378 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_00810 130652 131746 gene locus_tag LOCUS_00820 gene dnaN 130652 131746 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725022.1 protein_id gnl|my_center|LOCUS_00820 131786 133018 gene locus_tag LOCUS_00830 131786 133018 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_00830 133015 133752 gene locus_tag LOCUS_00840 133015 133752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 134116 134478 gene locus_tag LOCUS_00850 134116 134478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 134558 135337 gene locus_tag LOCUS_00860 gene phoN2 134558 135337 CDS product PAP2 family phosphatase PhoN2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850662.1 protein_id gnl|my_center|LOCUS_00860 135352 137973 gene locus_tag LOCUS_00870 135352 137973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 138716 138853 gene locus_tag LOCUS_00880 138716 138853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 138883 139866 gene locus_tag LOCUS_00890 138883 139866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 140049 141194 gene locus_tag LOCUS_00900 140049 141194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 141205 142890 gene locus_tag LOCUS_00910 141205 142890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349776.1 protein_id gnl|my_center|LOCUS_00910 143111 143554 gene locus_tag LOCUS_00920 143111 143554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 143559 144866 gene locus_tag LOCUS_00930 143559 144866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 144859 146427 gene locus_tag LOCUS_00940 144859 146427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 146502 148439 gene locus_tag LOCUS_00950 146502 148439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 148580 148747 gene locus_tag LOCUS_00960 148580 148747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 148941 150428 gene locus_tag LOCUS_00970 148941 150428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 150440 150859 gene locus_tag LOCUS_00980 150440 150859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 151074 151715 gene locus_tag LOCUS_00990 151074 151715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 151867 153054 gene locus_tag LOCUS_01000 151867 153054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 153063 153581 gene locus_tag LOCUS_01010 153063 153581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 153618 154100 gene locus_tag LOCUS_01020 153618 154100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 154190 154411 gene locus_tag LOCUS_01030 154190 154411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 154780 155424 gene locus_tag LOCUS_01040 154780 155424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 155447 155968 gene locus_tag LOCUS_01050 gene yfcE 155447 155968 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 protein_id gnl|my_center|LOCUS_01050 156135 157457 gene locus_tag LOCUS_01060 156135 157457 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530046.1 protein_id gnl|my_center|LOCUS_01060 158648 157497 gene locus_tag LOCUS_01070 158648 157497 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_01070 158752 159975 gene locus_tag LOCUS_01080 158752 159975 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245531.1 protein_id gnl|my_center|LOCUS_01080 160025 160729 gene locus_tag LOCUS_01090 160025 160729 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970609.1 protein_id gnl|my_center|LOCUS_01090 160759 161514 gene locus_tag LOCUS_01100 160759 161514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 161598 164231 gene locus_tag LOCUS_01110 161598 164231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 164339 165742 gene locus_tag LOCUS_01120 164339 165742 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839714.1 protein_id gnl|my_center|LOCUS_01120 165950 167509 gene locus_tag LOCUS_01130 165950 167509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_01130 167700 168851 gene locus_tag LOCUS_01140 167700 168851 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_01140 169103 169678 gene locus_tag LOCUS_01150 169103 169678 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_01150 169647 170282 gene locus_tag LOCUS_01160 169647 170282 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740920.1 protein_id gnl|my_center|LOCUS_01160 170279 171148 gene locus_tag LOCUS_01170 170279 171148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 171256 172653 gene locus_tag LOCUS_01180 171256 172653 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053756.1 protein_id gnl|my_center|LOCUS_01180 172868 176830 gene locus_tag LOCUS_01190 172868 176830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 177015 180203 gene locus_tag LOCUS_01200 177015 180203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 180245 181030 gene locus_tag LOCUS_01210 gene fabG 180245 181030 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_01210 181101 182357 gene locus_tag LOCUS_01220 181101 182357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791093.1 protein_id gnl|my_center|LOCUS_01220 182462 183628 gene locus_tag LOCUS_01230 182462 183628 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence002 1511 822 gene locus_tag LOCUS_01240 1511 822 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389786.1 protein_id gnl|my_center|LOCUS_01240 2477 1728 gene locus_tag LOCUS_01250 2477 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2874 2524 gene locus_tag LOCUS_01260 2874 2524 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_01260 3669 2923 gene locus_tag LOCUS_01270 3669 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4625 3687 gene locus_tag LOCUS_01280 4625 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5588 4674 gene locus_tag LOCUS_01290 5588 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5929 5786 gene locus_tag LOCUS_01300 5929 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6750 5932 gene locus_tag LOCUS_01310 6750 5932 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 protein_id gnl|my_center|LOCUS_01310 7277 6750 gene locus_tag LOCUS_01320 7277 6750 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_01320 8277 7417 gene locus_tag LOCUS_01330 8277 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9323 8280 gene locus_tag LOCUS_01340 9323 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 10428 9307 gene locus_tag LOCUS_01350 10428 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 12482 10437 gene locus_tag LOCUS_01360 12482 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 13623 13099 gene locus_tag LOCUS_01370 13623 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 14531 13620 gene locus_tag LOCUS_01380 14531 13620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14762 15592 gene locus_tag LOCUS_01390 14762 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 15810 15658 gene locus_tag LOCUS_01400 15810 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 15842 16342 gene locus_tag LOCUS_01410 15842 16342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 16608 16372 gene locus_tag LOCUS_01420 16608 16372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 17393 16788 gene locus_tag LOCUS_01430 17393 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_01430 18653 17817 gene locus_tag LOCUS_01440 18653 17817 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_01440 19243 18650 gene locus_tag LOCUS_01450 19243 18650 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_01450 20575 19499 gene locus_tag LOCUS_01460 20575 19499 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_01460 21544 20585 gene locus_tag LOCUS_01470 21544 20585 CDS product DUF4886 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119653.1 protein_id gnl|my_center|LOCUS_01470 21633 22637 gene locus_tag LOCUS_01480 21633 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 22634 24007 gene locus_tag LOCUS_01490 gene argH 22634 24007 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_01490 24009 24743 gene locus_tag LOCUS_01500 24009 24743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 26129 24759 gene locus_tag LOCUS_01510 26129 24759 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656298.1 protein_id gnl|my_center|LOCUS_01510 26332 26257 gene locus_tag LOCUS_t00020 26332 26257 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 26545 26452 gene locus_tag LOCUS_t00030 26545 26452 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27724 26567 gene locus_tag LOCUS_01520 gene nagA 27724 26567 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830343.1 protein_id gnl|my_center|LOCUS_01520 28420 27791 gene locus_tag LOCUS_01530 28420 27791 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977382.1 protein_id gnl|my_center|LOCUS_01530 29910 28423 gene locus_tag LOCUS_01540 29910 28423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 30224 30151 gene locus_tag LOCUS_t00040 30224 30151 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30321 30245 gene locus_tag LOCUS_t00050 30321 30245 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 31712 30411 gene locus_tag LOCUS_01550 31712 30411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 33028 31745 gene locus_tag LOCUS_01560 33028 31745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 36462 33043 gene locus_tag LOCUS_01570 36462 33043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 38069 36459 gene locus_tag LOCUS_01580 38069 36459 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202555.1 protein_id gnl|my_center|LOCUS_01580 38392 38066 gene locus_tag LOCUS_01590 38392 38066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 39800 38382 gene locus_tag LOCUS_01600 39800 38382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 40273 39800 gene locus_tag LOCUS_01610 40273 39800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 40459 40301 gene locus_tag LOCUS_01620 40459 40301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 40752 40828 gene locus_tag LOCUS_t00060 40752 40828 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 41372 40833 gene locus_tag LOCUS_01630 41372 40833 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865378.1 protein_id gnl|my_center|LOCUS_01630 42100 41381 gene locus_tag LOCUS_01640 42100 41381 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_01640 42448 42119 gene locus_tag LOCUS_01650 42448 42119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_01650 43467 42445 gene locus_tag LOCUS_01660 43467 42445 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081550.1 protein_id gnl|my_center|LOCUS_01660 43842 43495 gene locus_tag LOCUS_01670 43842 43495 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081551.1 protein_id gnl|my_center|LOCUS_01670 43997 46090 gene locus_tag LOCUS_01680 43997 46090 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_01680 47021 46182 gene locus_tag LOCUS_01690 47021 46182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 47252 47632 gene locus_tag LOCUS_01700 47252 47632 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_01700 48129 47671 gene locus_tag LOCUS_01710 48129 47671 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174302.1 protein_id gnl|my_center|LOCUS_01710 48597 48139 gene locus_tag LOCUS_01720 48597 48139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 49108 48617 gene locus_tag LOCUS_01730 gene ispF 49108 48617 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929316.1 protein_id gnl|my_center|LOCUS_01730 52918 49109 gene locus_tag LOCUS_01740 gene purL 52918 49109 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455948.1 protein_id gnl|my_center|LOCUS_01740 54081 53005 gene locus_tag LOCUS_01750 gene murG 54081 53005 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_01750 55555 54086 gene locus_tag LOCUS_01760 55555 54086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 56451 55582 gene locus_tag LOCUS_01770 gene pssA 56451 55582 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_01770 57193 56465 gene locus_tag LOCUS_01780 57193 56465 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327813.1 protein_id gnl|my_center|LOCUS_01780 57730 57209 gene locus_tag LOCUS_01790 gene infC 57730 57209 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008036.1 protein_id gnl|my_center|LOCUS_01790 59373 57859 gene locus_tag LOCUS_01800 59373 57859 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_01800 61111 59405 gene locus_tag LOCUS_01810 gene oadA 61111 59405 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_01810 61777 61148 gene locus_tag LOCUS_01820 gene plsY 61777 61148 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_01820 62723 61899 gene locus_tag LOCUS_01830 62723 61899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 63999 62800 gene locus_tag LOCUS_01840 63999 62800 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_01840 64835 63996 gene locus_tag LOCUS_01850 gene argB 64835 63996 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_01850 65955 64888 gene locus_tag LOCUS_01860 65955 64888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 66803 65970 gene locus_tag LOCUS_01870 gene lpxI 66803 65970 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_01870 67654 66893 gene locus_tag LOCUS_01880 67654 66893 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_01880 69473 67677 gene locus_tag LOCUS_01890 69473 67677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 69919 69488 gene locus_tag LOCUS_01900 69919 69488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 70860 69922 gene locus_tag LOCUS_01910 gene rsmH 70860 69922 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972059.1 protein_id gnl|my_center|LOCUS_01910 71378 70881 gene locus_tag LOCUS_01920 71378 70881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 72432 71842 gene locus_tag LOCUS_01930 72432 71842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 73054 72419 gene locus_tag LOCUS_01940 73054 72419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 74263 73202 gene locus_tag LOCUS_01950 74263 73202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 76430 74292 gene locus_tag LOCUS_01960 76430 74292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 77119 76430 gene locus_tag LOCUS_01970 77119 76430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 77361 77116 gene locus_tag LOCUS_01980 77361 77116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 77530 77405 gene locus_tag LOCUS_01990 77530 77405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 78024 77527 gene locus_tag LOCUS_02000 78024 77527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 78329 78024 gene locus_tag LOCUS_02010 78329 78024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 78533 78354 gene locus_tag LOCUS_02020 78533 78354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 78638 78946 gene locus_tag LOCUS_02030 78638 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 78943 79722 gene locus_tag LOCUS_02040 78943 79722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 80056 80553 gene locus_tag LOCUS_02050 80056 80553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 80623 81204 gene locus_tag LOCUS_02060 80623 81204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 81205 81588 gene locus_tag LOCUS_02070 81205 81588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 81596 81853 gene locus_tag LOCUS_02080 81596 81853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 81923 82495 gene locus_tag LOCUS_02090 81923 82495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 82497 83915 gene locus_tag LOCUS_02100 82497 83915 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_02100 83915 85399 gene locus_tag LOCUS_02110 83915 85399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 85396 86280 gene locus_tag LOCUS_02120 85396 86280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 86310 87194 gene locus_tag LOCUS_02130 86310 87194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 87207 87641 gene locus_tag LOCUS_02140 87207 87641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 87641 88231 gene locus_tag LOCUS_02150 87641 88231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 88234 88986 gene locus_tag LOCUS_02160 88234 88986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 89025 89369 gene locus_tag LOCUS_02170 89025 89369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 89448 90233 gene locus_tag LOCUS_02180 89448 90233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 90230 90673 gene locus_tag LOCUS_02190 90230 90673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 90673 91206 gene locus_tag LOCUS_02200 90673 91206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 91203 92339 gene locus_tag LOCUS_02210 91203 92339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 92430 92849 gene locus_tag LOCUS_02220 92430 92849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 92866 93201 gene locus_tag LOCUS_02230 92866 93201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 93201 93668 gene locus_tag LOCUS_02240 93201 93668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 93729 94940 gene locus_tag LOCUS_02250 93729 94940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 94934 95755 gene locus_tag LOCUS_02260 94934 95755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 95709 96380 gene locus_tag LOCUS_02270 95709 96380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 96380 98566 gene locus_tag LOCUS_02280 96380 98566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 99882 98818 gene locus_tag LOCUS_02290 gene hydE 99882 98818 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_02290 102088 99989 gene locus_tag LOCUS_02300 gene fusA 102088 99989 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101814.1 protein_id gnl|my_center|LOCUS_02300 102202 102126 gene locus_tag LOCUS_t00070 102202 102126 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 864 679 gene locus_tag LOCUS_02310 864 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 1076 918 gene locus_tag LOCUS_02320 1076 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2650 1106 gene locus_tag LOCUS_02330 2650 1106 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868784.1 protein_id gnl|my_center|LOCUS_02330 4898 2655 gene locus_tag LOCUS_02340 4898 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6149 4962 gene locus_tag LOCUS_02350 6149 4962 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785925.1 protein_id gnl|my_center|LOCUS_02350 8411 6171 gene locus_tag LOCUS_02360 8411 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 11661 8446 gene locus_tag LOCUS_02370 11661 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 14085 11686 gene locus_tag LOCUS_02380 14085 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 15572 14550 gene locus_tag LOCUS_02390 15572 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 16342 15572 gene locus_tag LOCUS_02400 16342 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 17466 16339 gene locus_tag LOCUS_02410 17466 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 18590 17478 gene locus_tag LOCUS_02420 18590 17478 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013588.1 protein_id gnl|my_center|LOCUS_02420 20538 18583 gene locus_tag LOCUS_02430 20538 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 21393 20542 gene locus_tag LOCUS_02440 21393 20542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 21807 21394 gene locus_tag LOCUS_02450 21807 21394 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010438282.1 protein_id gnl|my_center|LOCUS_02450 22537 21809 gene locus_tag LOCUS_02460 gene tolQ 22537 21809 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649191.1 protein_id gnl|my_center|LOCUS_02460 23610 22543 gene locus_tag LOCUS_02470 gene rnhC 23610 22543 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883701.1 protein_id gnl|my_center|LOCUS_02470 24708 23611 gene locus_tag LOCUS_02480 24708 23611 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016326127.1 protein_id gnl|my_center|LOCUS_02480 25818 24736 gene locus_tag LOCUS_02490 25818 24736 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697066.1 protein_id gnl|my_center|LOCUS_02490 27021 25831 gene locus_tag LOCUS_02500 27021 25831 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391154.1 protein_id gnl|my_center|LOCUS_02500 29105 27033 gene locus_tag LOCUS_02510 gene fusA 29105 27033 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_02510 32807 29256 gene locus_tag LOCUS_02520 32807 29256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 34518 32917 gene locus_tag LOCUS_02530 34518 32917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 35929 34559 gene locus_tag LOCUS_02540 35929 34559 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028721.1 protein_id gnl|my_center|LOCUS_02540 36933 35956 gene locus_tag LOCUS_02550 36933 35956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 39361 36956 gene locus_tag LOCUS_02560 gene hrpB 39361 36956 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968081.1 protein_id gnl|my_center|LOCUS_02560 40634 39465 gene locus_tag LOCUS_02570 40634 39465 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202525.1 protein_id gnl|my_center|LOCUS_02570 41679 40783 gene locus_tag LOCUS_02580 41679 40783 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172286.1 protein_id gnl|my_center|LOCUS_02580 42623 41772 gene locus_tag LOCUS_02590 42623 41772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345583.1 protein_id gnl|my_center|LOCUS_02590 43288 42623 gene locus_tag LOCUS_02600 43288 42623 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_02600 44262 43282 gene locus_tag LOCUS_02610 44262 43282 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_02610 44615 44259 gene locus_tag LOCUS_02620 44615 44259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 46359 44623 gene locus_tag LOCUS_02630 46359 44623 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940324.1 protein_id gnl|my_center|LOCUS_02630 47327 46491 gene locus_tag LOCUS_02640 gene tsf 47327 46491 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_02640 48373 47363 gene locus_tag LOCUS_02650 48373 47363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 48673 49980 gene locus_tag LOCUS_02660 48673 49980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 49993 50649 gene locus_tag LOCUS_02670 49993 50649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 51433 50651 gene locus_tag LOCUS_02680 51433 50651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 52589 51426 gene locus_tag LOCUS_02690 52589 51426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 53377 52592 gene locus_tag LOCUS_02700 53377 52592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 54402 53398 gene locus_tag LOCUS_02710 54402 53398 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_02710 55349 54399 gene locus_tag LOCUS_02720 55349 54399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 56368 55346 gene locus_tag LOCUS_02730 56368 55346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 57495 56374 gene locus_tag LOCUS_02740 57495 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 58430 57591 gene locus_tag LOCUS_02750 gene ispH 58430 57591 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186453.1 protein_id gnl|my_center|LOCUS_02750 59220 58420 gene locus_tag LOCUS_02760 gene mazG 59220 58420 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098517.1 protein_id gnl|my_center|LOCUS_02760 60463 59231 gene locus_tag LOCUS_02770 60463 59231 CDS product pyrophosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922349.1 protein_id gnl|my_center|LOCUS_02770 60972 60508 gene locus_tag LOCUS_02780 gene ribE 60972 60508 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_02780 61902 61060 gene locus_tag LOCUS_02790 61902 61060 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008665997.1 protein_id gnl|my_center|LOCUS_02790 62917 61919 gene locus_tag LOCUS_02800 62917 61919 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_02800 63637 62924 gene locus_tag LOCUS_02810 63637 62924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 64984 63722 gene locus_tag LOCUS_02820 64984 63722 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_02820 65895 64981 gene locus_tag LOCUS_02830 65895 64981 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_02830 67001 65892 gene locus_tag LOCUS_02840 67001 65892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 70347 66991 gene locus_tag LOCUS_02850 70347 66991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 71660 70383 gene locus_tag LOCUS_02860 71660 70383 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_02860 71926 71690 gene locus_tag LOCUS_02870 71926 71690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 72822 71932 gene locus_tag LOCUS_02880 72822 71932 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072713.1 protein_id gnl|my_center|LOCUS_02880 74591 72819 gene locus_tag LOCUS_02890 gene ptsP 74591 72819 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254212.1 protein_id gnl|my_center|LOCUS_02890 74880 74596 gene locus_tag LOCUS_02900 74880 74596 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528333.1 protein_id gnl|my_center|LOCUS_02900 75877 74870 gene locus_tag LOCUS_02910 gene hprK 75877 74870 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062490.1 protein_id gnl|my_center|LOCUS_02910 76221 75886 gene locus_tag LOCUS_02920 76221 75886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 77061 76255 gene locus_tag LOCUS_02930 gene lptB 77061 76255 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047473.1 protein_id gnl|my_center|LOCUS_02930 77662 77081 gene locus_tag LOCUS_02940 77662 77081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 78180 77662 gene locus_tag LOCUS_02950 78180 77662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 78995 78177 gene locus_tag LOCUS_02960 gene kdsA 78995 78177 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_02960 79990 79022 gene locus_tag LOCUS_02970 79990 79022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 80814 79987 gene locus_tag LOCUS_02980 80814 79987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 81189 80818 gene locus_tag LOCUS_02990 81189 80818 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870072.1 protein_id gnl|my_center|LOCUS_02990 82263 81193 gene locus_tag LOCUS_03000 82263 81193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 82703 82260 gene locus_tag LOCUS_03010 gene nrdR 82703 82260 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_03010 83386 82709 gene locus_tag LOCUS_03020 83386 82709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 84300 83473 gene locus_tag LOCUS_03030 gene ribF 84300 83473 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228004.1 protein_id gnl|my_center|LOCUS_03030 85019 84303 gene locus_tag LOCUS_03040 85019 84303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 85422 84997 gene locus_tag LOCUS_03050 gene rbfA 85422 84997 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124287.1 protein_id gnl|my_center|LOCUS_03050 87959 85386 gene locus_tag LOCUS_03060 87959 85386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 89275 87995 gene locus_tag LOCUS_03070 89275 87995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence004 862 335 gene locus_tag LOCUS_03080 862 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1334 846 gene locus_tag LOCUS_03090 1334 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1737 1324 gene locus_tag LOCUS_03100 1737 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 2902 1745 gene locus_tag LOCUS_03110 2902 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 4223 2871 gene locus_tag LOCUS_03120 4223 2871 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080843.1 protein_id gnl|my_center|LOCUS_03120 4891 4274 gene locus_tag LOCUS_03130 gene lolD 4891 4274 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_03130 6164 4902 gene locus_tag LOCUS_03140 6164 4902 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_03140 7886 6183 gene locus_tag LOCUS_03150 7886 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 8313 7900 gene locus_tag LOCUS_03160 8313 7900 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_03160 8833 8354 gene locus_tag LOCUS_03170 8833 8354 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071947.1 protein_id gnl|my_center|LOCUS_03170 9699 8866 gene locus_tag LOCUS_03180 9699 8866 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228130.1 protein_id gnl|my_center|LOCUS_03180 10531 9758 gene locus_tag LOCUS_03190 10531 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 13873 10550 gene locus_tag LOCUS_03200 13873 10550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20612 13998 gene locus_tag LOCUS_03210 20612 13998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 21709 20702 gene locus_tag LOCUS_03220 21709 20702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 22294 21728 gene locus_tag LOCUS_03230 22294 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 23000 22332 gene locus_tag LOCUS_03240 23000 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 24709 23012 gene locus_tag LOCUS_03250 24709 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 25758 24727 gene locus_tag LOCUS_03260 25758 24727 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_03260 30573 25780 gene locus_tag LOCUS_03270 30573 25780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 31243 30566 gene locus_tag LOCUS_03280 31243 30566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 32953 31259 gene locus_tag LOCUS_03290 32953 31259 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_03290 33794 32973 gene locus_tag LOCUS_03300 gene cpaB 33794 32973 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456561.1 protein_id gnl|my_center|LOCUS_03300 35538 33796 gene locus_tag LOCUS_03310 35538 33796 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_03310 36482 35622 gene locus_tag LOCUS_03320 36482 35622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 36868 36482 gene locus_tag LOCUS_03330 36868 36482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 38478 36952 gene locus_tag LOCUS_03340 38478 36952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 39162 38494 gene locus_tag LOCUS_03350 39162 38494 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010358842.1 protein_id gnl|my_center|LOCUS_03350 40043 39159 gene locus_tag LOCUS_03360 40043 39159 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082677.1 protein_id gnl|my_center|LOCUS_03360 41677 40040 gene locus_tag LOCUS_03370 41677 40040 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202540.1 protein_id gnl|my_center|LOCUS_03370 42380 41937 gene locus_tag LOCUS_03380 gene dtd 42380 41937 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_03380 44118 42397 gene locus_tag LOCUS_03390 44118 42397 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016615.1 protein_id gnl|my_center|LOCUS_03390 45489 44134 gene locus_tag LOCUS_03400 45489 44134 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_03400 46905 45535 gene locus_tag LOCUS_03410 46905 45535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 47610 46918 gene locus_tag LOCUS_03420 47610 46918 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_03420 49106 47700 gene locus_tag LOCUS_03430 49106 47700 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_03430 49270 50208 gene locus_tag LOCUS_03440 49270 50208 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_03440 51163 50324 gene locus_tag LOCUS_03450 51163 50324 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030302.1 protein_id gnl|my_center|LOCUS_03450 51753 51160 gene locus_tag LOCUS_03460 51753 51160 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_03460 52435 52683 gene locus_tag LOCUS_03470 52435 52683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 53742 52879 gene locus_tag LOCUS_03480 53742 52879 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_03480 54134 55111 gene locus_tag LOCUS_03490 54134 55111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 56011 55160 gene locus_tag LOCUS_03500 gene epmA 56011 55160 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_03500 57259 56015 gene locus_tag LOCUS_03510 57259 56015 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_03510 58627 57284 gene locus_tag LOCUS_03520 gene der 58627 57284 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392835.1 protein_id gnl|my_center|LOCUS_03520 59400 58780 gene locus_tag LOCUS_03530 59400 58780 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_03530 59561 60157 gene locus_tag LOCUS_03540 59561 60157 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_03540 61814 60255 gene locus_tag LOCUS_03550 61814 60255 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_03550 63040 61835 gene locus_tag LOCUS_03560 63040 61835 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_03560 64563 63040 gene locus_tag LOCUS_03570 64563 63040 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333793.1 protein_id gnl|my_center|LOCUS_03570 65981 64617 gene locus_tag LOCUS_03580 65981 64617 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_03580 67500 66043 gene locus_tag LOCUS_03590 67500 66043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 68434 67577 gene locus_tag LOCUS_03600 68434 67577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 68737 68444 gene locus_tag LOCUS_03610 gene yajC 68737 68444 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_03610 69904 68792 gene locus_tag LOCUS_03620 gene tgt 69904 68792 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944694.1 protein_id gnl|my_center|LOCUS_03620 70048 71268 gene locus_tag LOCUS_03630 70048 71268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 71249 71413 gene locus_tag LOCUS_03640 71249 71413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 71566 72363 gene locus_tag LOCUS_03650 71566 72363 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_03650 73650 72370 gene locus_tag LOCUS_03660 gene murA 73650 72370 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_03660 74481 73687 gene locus_tag LOCUS_03670 74481 73687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 75268 74546 gene locus_tag LOCUS_03680 75268 74546 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_03680 75590 75276 gene locus_tag LOCUS_03690 gene rsfS 75590 75276 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027523570.1 protein_id gnl|my_center|LOCUS_03690 75708 76898 gene locus_tag LOCUS_03700 gene metK 75708 76898 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680429.1 protein_id gnl|my_center|LOCUS_03700 77243 78025 gene locus_tag LOCUS_03710 77243 78025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 78428 78051 gene locus_tag LOCUS_03720 78428 78051 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_03720 78528 78453 gene locus_tag LOCUS_t00080 78528 78453 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 79367 78612 gene locus_tag LOCUS_03730 79367 78612 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091117.1 protein_id gnl|my_center|LOCUS_03730 79561 79364 gene locus_tag LOCUS_03740 79561 79364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 80473 79598 gene locus_tag LOCUS_03750 80473 79598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 83069 80631 gene locus_tag LOCUS_03760 gene pheT 83069 80631 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_03760 84510 83041 gene locus_tag LOCUS_03770 84510 83041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence005 243 4856 gene locus_tag LOCUS_03780 243 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 4875 5645 gene locus_tag LOCUS_03790 4875 5645 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093241.1 protein_id gnl|my_center|LOCUS_03790 5759 7090 gene locus_tag LOCUS_03800 5759 7090 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03800 7101 8252 gene locus_tag LOCUS_03810 7101 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 8265 8876 gene locus_tag LOCUS_03820 8265 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 8873 9448 gene locus_tag LOCUS_03830 8873 9448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 9445 10311 gene locus_tag LOCUS_03840 9445 10311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 10335 10865 gene locus_tag LOCUS_03850 10335 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 10889 11347 gene locus_tag LOCUS_03860 10889 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 11347 11811 gene locus_tag LOCUS_03870 11347 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 11808 15071 gene locus_tag LOCUS_03880 11808 15071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 15095 15997 gene locus_tag LOCUS_03890 15095 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 15998 16597 gene locus_tag LOCUS_03900 15998 16597 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037326.1 protein_id gnl|my_center|LOCUS_03900 16640 16879 gene locus_tag LOCUS_03910 16640 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 16891 17781 gene locus_tag LOCUS_03920 gene nadC 16891 17781 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_03920 17810 18547 gene locus_tag LOCUS_03930 17810 18547 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_03930 18532 19074 gene locus_tag LOCUS_03940 18532 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 19140 19715 gene locus_tag LOCUS_03950 gene efp 19140 19715 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_03950 19758 20324 gene locus_tag LOCUS_03960 gene pal 19758 20324 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176628.1 protein_id gnl|my_center|LOCUS_03960 20349 20795 gene locus_tag LOCUS_03970 20349 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 20858 21559 gene locus_tag LOCUS_03980 20858 21559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 21562 22590 gene locus_tag LOCUS_03990 gene lpxC 21562 22590 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530964.1 protein_id gnl|my_center|LOCUS_03990 22578 23363 gene locus_tag LOCUS_04000 22578 23363 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_04000 23360 25753 gene locus_tag LOCUS_04010 23360 25753 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903830.1 protein_id gnl|my_center|LOCUS_04010 26397 25750 gene locus_tag LOCUS_04020 26397 25750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 26486 27145 gene locus_tag LOCUS_04030 26486 27145 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880134.1 protein_id gnl|my_center|LOCUS_04030 27073 28008 gene locus_tag LOCUS_04040 27073 28008 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_04040 28077 28150 gene locus_tag LOCUS_t00090 28077 28150 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 28164 28249 gene locus_tag LOCUS_t00100 28164 28249 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28275 28364 gene locus_tag LOCUS_t00110 28275 28364 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28416 30335 gene locus_tag LOCUS_04050 28416 30335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 30337 31299 gene locus_tag LOCUS_04060 30337 31299 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_04060 31325 32206 gene locus_tag LOCUS_04070 31325 32206 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_04070 32203 33108 gene locus_tag LOCUS_04080 32203 33108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 33105 34109 gene locus_tag LOCUS_04090 33105 34109 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_04090 35057 41494 gene locus_tag LOCUS_04100 35057 41494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 41720 42583 gene locus_tag LOCUS_04110 gene htpX 41720 42583 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813142.1 protein_id gnl|my_center|LOCUS_04110 42628 44853 gene locus_tag LOCUS_04120 42628 44853 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_04120 45171 47873 gene locus_tag LOCUS_04130 45171 47873 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_04130 47877 48944 gene locus_tag LOCUS_04140 gene murD 47877 48944 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883536.1 protein_id gnl|my_center|LOCUS_04140 48949 49968 gene locus_tag LOCUS_04150 48949 49968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 50115 51119 gene locus_tag LOCUS_04160 gene ftsW 50115 51119 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_04160 51124 52440 gene locus_tag LOCUS_04170 gene xseA 51124 52440 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_04170 52452 53192 gene locus_tag LOCUS_04180 52452 53192 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144051.1 protein_id gnl|my_center|LOCUS_04180 53214 54092 gene locus_tag LOCUS_04190 53214 54092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 54188 54667 gene locus_tag LOCUS_04200 54188 54667 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416946.1 protein_id gnl|my_center|LOCUS_04200 54686 55081 gene locus_tag LOCUS_04210 54686 55081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_04210 55103 56890 gene locus_tag LOCUS_04220 gene nuoF 55103 56890 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_04220 56910 58709 gene locus_tag LOCUS_04230 56910 58709 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_04230 58830 58914 gene locus_tag LOCUS_t00120 58830 58914 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 58921 58995 gene locus_tag LOCUS_t00130 58921 58995 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 59033 60907 gene locus_tag LOCUS_04240 59033 60907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 60911 61723 gene locus_tag LOCUS_04250 gene rsmA 60911 61723 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883692.1 protein_id gnl|my_center|LOCUS_04250 61710 62996 gene locus_tag LOCUS_04260 61710 62996 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_04260 63011 63895 gene locus_tag LOCUS_04270 63011 63895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 63915 65186 gene locus_tag LOCUS_04280 gene lysA 63915 65186 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_04280 65183 67405 gene locus_tag LOCUS_04290 65183 67405 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943959.1 protein_id gnl|my_center|LOCUS_04290 67402 69081 gene locus_tag LOCUS_04300 gene lnt 67402 69081 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383553.1 protein_id gnl|my_center|LOCUS_04300 69178 70659 gene locus_tag LOCUS_04310 69178 70659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 70661 71773 gene locus_tag LOCUS_04320 70661 71773 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_04320 71826 72641 gene locus_tag LOCUS_04330 71826 72641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 72715 74730 gene locus_tag LOCUS_04340 72715 74730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 74779 75519 gene locus_tag LOCUS_04350 74779 75519 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028128.1 protein_id gnl|my_center|LOCUS_04350 75522 76022 gene locus_tag LOCUS_04360 gene lspA 75522 76022 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965414.1 protein_id gnl|my_center|LOCUS_04360 76019 76705 gene locus_tag LOCUS_04370 76019 76705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 77732 76716 gene locus_tag LOCUS_04380 gene fmt 77732 76716 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence006 37 756 gene locus_tag LOCUS_04390 37 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 995 2092 gene locus_tag LOCUS_04400 995 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 2237 4207 gene locus_tag LOCUS_04410 2237 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 5572 4268 gene locus_tag LOCUS_04420 5572 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 5702 6496 gene locus_tag LOCUS_04430 5702 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6602 7777 gene locus_tag LOCUS_04440 6602 7777 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_04440 7813 10323 gene locus_tag LOCUS_04450 7813 10323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 11453 10320 gene locus_tag LOCUS_04460 11453 10320 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108695.1 protein_id gnl|my_center|LOCUS_04460 11543 11986 gene locus_tag LOCUS_04470 11543 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 12015 12194 gene locus_tag LOCUS_04480 gene rpmF 12015 12194 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_04480 12224 13276 gene locus_tag LOCUS_04490 gene plsX 12224 13276 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_04490 13276 15849 gene locus_tag LOCUS_04500 gene leuS 13276 15849 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775383.1 protein_id gnl|my_center|LOCUS_04500 15882 16436 gene locus_tag LOCUS_04510 15882 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 16490 16768 gene locus_tag LOCUS_04520 16490 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 16774 17226 gene locus_tag LOCUS_04530 gene smpB 16774 17226 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085183.1 protein_id gnl|my_center|LOCUS_04530 17278 18618 gene locus_tag LOCUS_04540 gene secY 17278 18618 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_04540 18738 20192 gene locus_tag LOCUS_04550 18738 20192 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_04550 20185 20679 gene locus_tag LOCUS_04560 20185 20679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 20698 21567 gene locus_tag LOCUS_04570 gene folD 20698 21567 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_04570 21564 21911 gene locus_tag LOCUS_04580 21564 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 21968 25630 gene locus_tag LOCUS_04590 21968 25630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 25650 27062 gene locus_tag LOCUS_04600 gene dnaX 25650 27062 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_04600 27065 27505 gene locus_tag LOCUS_04610 27065 27505 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741984.1 protein_id gnl|my_center|LOCUS_04610 28062 27571 gene locus_tag LOCUS_04620 28062 27571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 28785 28150 gene locus_tag LOCUS_04630 28785 28150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 30031 30975 gene locus_tag LOCUS_04640 30031 30975 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272390.1 protein_id gnl|my_center|LOCUS_04640 31067 31681 gene locus_tag LOCUS_04650 31067 31681 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_04650 31773 33227 gene locus_tag LOCUS_04660 gene lysS 31773 33227 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004512.1 protein_id gnl|my_center|LOCUS_04660 33229 34026 gene locus_tag LOCUS_04670 33229 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 34059 36272 gene locus_tag LOCUS_04680 34059 36272 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679930.1 protein_id gnl|my_center|LOCUS_04680 36356 36799 gene locus_tag LOCUS_04690 36356 36799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 36943 36867 gene locus_tag LOCUS_t00140 36943 36867 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 37061 38578 gene locus_tag LOCUS_04700 37061 38578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 38575 40494 gene locus_tag LOCUS_04710 38575 40494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 40498 41796 gene locus_tag LOCUS_04720 40498 41796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 41826 43439 gene locus_tag LOCUS_04730 41826 43439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_04730 43444 44118 gene locus_tag LOCUS_04740 gene cmk 43444 44118 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_04740 44119 44991 gene locus_tag LOCUS_04750 44119 44991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970051.1 protein_id gnl|my_center|LOCUS_04750 45010 46233 gene locus_tag LOCUS_04760 45010 46233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764944.1 protein_id gnl|my_center|LOCUS_04760 46352 48106 gene locus_tag LOCUS_04770 46352 48106 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_04770 48134 48364 gene locus_tag LOCUS_04780 48134 48364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 48405 49406 gene locus_tag LOCUS_04790 gene gap 48405 49406 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785248.1 protein_id gnl|my_center|LOCUS_04790 49622 50104 gene locus_tag LOCUS_04800 49622 50104 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_04800 50101 50343 gene locus_tag LOCUS_04810 50101 50343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 50346 50576 gene locus_tag LOCUS_04820 50346 50576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 51091 54768 gene locus_tag LOCUS_04830 51091 54768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 55041 55670 gene locus_tag LOCUS_04840 55041 55670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 55667 56029 gene locus_tag LOCUS_04850 55667 56029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 56108 57591 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtgaaaggacatctttttaaagactaatacaat 57847 58518 gene locus_tag LOCUS_04860 57847 58518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 58738 59430 gene locus_tag LOCUS_04870 58738 59430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 59595 59798 gene locus_tag LOCUS_04880 59595 59798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 60005 60565 gene locus_tag LOCUS_04890 60005 60565 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 protein_id gnl|my_center|LOCUS_04890 60583 61719 gene locus_tag LOCUS_04900 60583 61719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 61731 62465 gene locus_tag LOCUS_04910 61731 62465 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_04910 62465 63067 gene locus_tag LOCUS_04920 62465 63067 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202076.1 protein_id gnl|my_center|LOCUS_04920 63064 63588 gene locus_tag LOCUS_04930 63064 63588 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865361.1 protein_id gnl|my_center|LOCUS_04930 63585 64322 gene locus_tag LOCUS_04940 gene murI 63585 64322 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_04940 64319 64798 gene locus_tag LOCUS_04950 64319 64798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 64841 65413 gene locus_tag LOCUS_04960 gene folE 64841 65413 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768934.1 protein_id gnl|my_center|LOCUS_04960 65431 66255 gene locus_tag LOCUS_04970 65431 66255 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_04970 66328 67179 gene locus_tag LOCUS_04980 66328 67179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 67220 68092 gene locus_tag LOCUS_04990 67220 68092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 68094 69749 gene locus_tag LOCUS_05000 gene fadD13 68094 69749 CDS product long-chain-fatty-acid--CoA ligase FadD13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416081.1 protein_id gnl|my_center|LOCUS_05000 69759 71069 gene locus_tag LOCUS_05010 69759 71069 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence007 411 1241 gene locus_tag LOCUS_05020 411 1241 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_05020 1292 1675 gene locus_tag LOCUS_05030 1292 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1668 1913 gene locus_tag LOCUS_05040 1668 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2097 4706 gene locus_tag LOCUS_05050 2097 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5028 5240 gene locus_tag LOCUS_05060 5028 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5461 6588 gene locus_tag LOCUS_05070 5461 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 6703 6978 gene locus_tag LOCUS_05080 6703 6978 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_05080 7518 8324 gene locus_tag LOCUS_05090 7518 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 8373 9293 gene locus_tag LOCUS_05100 8373 9293 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119041.1 protein_id gnl|my_center|LOCUS_05100 9397 10083 gene locus_tag LOCUS_05110 9397 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 10115 11086 gene locus_tag LOCUS_05120 10115 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 11100 12464 gene locus_tag LOCUS_05130 11100 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 12490 14235 gene locus_tag LOCUS_05140 gene thrS 12490 14235 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881086.1 protein_id gnl|my_center|LOCUS_05140 14257 14892 gene locus_tag LOCUS_05150 gene tmk 14257 14892 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_05150 14865 15665 gene locus_tag LOCUS_05160 14865 15665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 15662 16606 gene locus_tag LOCUS_05170 15662 16606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 19278 16624 gene locus_tag LOCUS_05180 gene polA 19278 16624 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_05180 19706 19365 gene locus_tag LOCUS_05190 19706 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 20902 19718 gene locus_tag LOCUS_05200 gene nifS 20902 19718 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_05200 21898 20978 gene locus_tag LOCUS_05210 21898 20978 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546354.1 protein_id gnl|my_center|LOCUS_05210 22607 21987 gene locus_tag LOCUS_05220 22607 21987 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222893.1 protein_id gnl|my_center|LOCUS_05220 23464 22604 gene locus_tag LOCUS_05230 23464 22604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 24506 28051 gene locus_tag LOCUS_05240 24506 28051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 28140 29177 gene locus_tag LOCUS_05250 28140 29177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 29195 37087 gene locus_tag LOCUS_05260 29195 37087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 37193 41155 gene locus_tag LOCUS_05270 37193 41155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 41228 42601 gene locus_tag LOCUS_05280 41228 42601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 42726 44546 gene locus_tag LOCUS_05290 42726 44546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 44565 46658 gene locus_tag LOCUS_05300 44565 46658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 46672 48507 gene locus_tag LOCUS_05310 46672 48507 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695757.1 protein_id gnl|my_center|LOCUS_05310 48689 51511 gene locus_tag LOCUS_05320 48689 51511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 51533 53545 gene locus_tag LOCUS_05330 51533 53545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 53550 54257 gene locus_tag LOCUS_05340 53550 54257 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880335.1 protein_id gnl|my_center|LOCUS_05340 54301 56658 gene locus_tag LOCUS_05350 54301 56658 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108688.1 protein_id gnl|my_center|LOCUS_05350 56770 57705 gene locus_tag LOCUS_05360 56770 57705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 57729 58649 gene locus_tag LOCUS_05370 57729 58649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 58727 59839 gene locus_tag LOCUS_05380 58727 59839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 59974 60180 gene locus_tag LOCUS_05390 59974 60180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 60210 60479 gene locus_tag LOCUS_05400 60210 60479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 60883 64458 gene locus_tag LOCUS_05410 60883 64458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence008 1049 300 gene locus_tag LOCUS_05420 1049 300 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761172.1 protein_id gnl|my_center|LOCUS_05420 2353 1046 gene locus_tag LOCUS_05430 gene miaB 2353 1046 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950977.1 protein_id gnl|my_center|LOCUS_05430 4173 2356 gene locus_tag LOCUS_05440 4173 2356 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_05440 5183 4272 gene locus_tag LOCUS_05450 5183 4272 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_05450 7174 5450 gene locus_tag LOCUS_05460 7174 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10810 7310 gene locus_tag LOCUS_05470 10810 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 11149 10928 gene locus_tag LOCUS_05480 11149 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 11475 11819 gene locus_tag LOCUS_05490 11475 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 12154 11870 gene locus_tag LOCUS_05500 12154 11870 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922600.1 protein_id gnl|my_center|LOCUS_05500 12394 12158 gene locus_tag LOCUS_05510 12394 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 14087 12399 gene locus_tag LOCUS_05520 14087 12399 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332509.1 protein_id gnl|my_center|LOCUS_05520 15176 14091 gene locus_tag LOCUS_05530 15176 14091 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_05530 16904 15237 gene locus_tag LOCUS_05540 16904 15237 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_05540 19159 16937 gene locus_tag LOCUS_05550 19159 16937 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933069.1 protein_id gnl|my_center|LOCUS_05550 21048 19156 gene locus_tag LOCUS_05560 21048 19156 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109237.1 protein_id gnl|my_center|LOCUS_05560 23571 21061 gene locus_tag LOCUS_05570 23571 21061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 25035 23659 gene locus_tag LOCUS_05580 25035 23659 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938513.1 protein_id gnl|my_center|LOCUS_05580 26004 25054 gene locus_tag LOCUS_05590 26004 25054 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939854.1 protein_id gnl|my_center|LOCUS_05590 27045 26038 gene locus_tag LOCUS_05600 gene pheS 27045 26038 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_05600 27930 27055 gene locus_tag LOCUS_05610 gene dapA 27930 27055 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_05610 29060 27969 gene locus_tag LOCUS_05620 gene serC 29060 27969 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 protein_id gnl|my_center|LOCUS_05620 30461 29232 gene locus_tag LOCUS_05630 30461 29232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 31078 30476 gene locus_tag LOCUS_05640 31078 30476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 32397 31114 gene locus_tag LOCUS_05650 32397 31114 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_05650 33804 32542 gene locus_tag LOCUS_05660 33804 32542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 35029 33806 gene locus_tag LOCUS_05670 gene icd 35029 33806 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705337.1 protein_id gnl|my_center|LOCUS_05670 36851 35040 gene locus_tag LOCUS_05680 gene lepA 36851 35040 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_05680 37997 36855 gene locus_tag LOCUS_05690 37997 36855 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943878.1 protein_id gnl|my_center|LOCUS_05690 38825 37998 gene locus_tag LOCUS_05700 gene potC 38825 37998 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714192.1 protein_id gnl|my_center|LOCUS_05700 39463 38822 gene locus_tag LOCUS_05710 39463 38822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 39798 39475 gene locus_tag LOCUS_05720 39798 39475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 40910 39807 gene locus_tag LOCUS_05730 40910 39807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081574.1 protein_id gnl|my_center|LOCUS_05730 42715 40997 gene locus_tag LOCUS_05740 42715 40997 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_05740 42855 42781 gene locus_tag LOCUS_t00150 42855 42781 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 47331 42982 gene locus_tag LOCUS_05750 gene rpoC 47331 42982 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895278.1 protein_id gnl|my_center|LOCUS_05750 51286 47363 gene locus_tag LOCUS_05760 gene rpoB 51286 47363 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012263639.1 protein_id gnl|my_center|LOCUS_05760 51516 52538 gene locus_tag LOCUS_05770 gene rlmN 51516 52538 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028433.1 protein_id gnl|my_center|LOCUS_05770 53908 52565 gene locus_tag LOCUS_05780 53908 52565 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_05780 55339 53957 gene locus_tag LOCUS_05790 gene thrC 55339 53957 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177124.1 protein_id gnl|my_center|LOCUS_05790 56475 55354 gene locus_tag LOCUS_05800 gene ychF 56475 55354 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938722.1 protein_id gnl|my_center|LOCUS_05800 57416 56472 gene locus_tag LOCUS_05810 57416 56472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 60282 57466 gene locus_tag LOCUS_05820 60282 57466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 60839 60297 gene locus_tag LOCUS_05830 60839 60297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 62104 60839 gene locus_tag LOCUS_05840 62104 60839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 62565 62780 gene locus_tag LOCUS_05850 62565 62780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence009 413 153 gene locus_tag LOCUS_05860 413 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2420 483 gene locus_tag LOCUS_05870 2420 483 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393382.1 protein_id gnl|my_center|LOCUS_05870 3198 2467 gene locus_tag LOCUS_05880 3198 2467 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_05880 4514 3195 gene locus_tag LOCUS_05890 4514 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5890 4511 gene locus_tag LOCUS_05900 5890 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6817 5903 gene locus_tag LOCUS_05910 6817 5903 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_05910 8881 6839 gene locus_tag LOCUS_05920 gene metG 8881 6839 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262543.1 protein_id gnl|my_center|LOCUS_05920 11008 8921 gene locus_tag LOCUS_05930 11008 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 12421 11030 gene locus_tag LOCUS_05940 gene rsxC 12421 11030 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_05940 13832 12513 gene locus_tag LOCUS_05950 13832 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 15351 13843 gene locus_tag LOCUS_05960 15351 13843 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795907.1 protein_id gnl|my_center|LOCUS_05960 15521 16252 gene locus_tag LOCUS_05970 gene pnuC 15521 16252 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_05970 18969 16237 gene locus_tag LOCUS_05980 18969 16237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 20434 19016 gene locus_tag LOCUS_05990 20434 19016 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_05990 24079 20741 gene locus_tag LOCUS_06000 24079 20741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 24219 24488 gene locus_tag LOCUS_06010 24219 24488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 25725 24802 gene locus_tag LOCUS_06020 25725 24802 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695267.1 protein_id gnl|my_center|LOCUS_06020 27815 25842 gene locus_tag LOCUS_06030 27815 25842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 35843 27819 gene locus_tag LOCUS_06040 35843 27819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 37806 36247 gene locus_tag LOCUS_06050 37806 36247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_06050 40681 38060 gene locus_tag LOCUS_06060 40681 38060 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_06060 43370 40716 gene locus_tag LOCUS_06070 43370 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 44272 43559 gene locus_tag LOCUS_06080 44272 43559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 46405 44366 gene locus_tag LOCUS_06090 46405 44366 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_06090 46706 47446 gene locus_tag LOCUS_06100 46706 47446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 49109 47634 gene locus_tag LOCUS_06110 49109 47634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 51151 49136 gene locus_tag LOCUS_06120 51151 49136 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_06120 52315 51206 gene locus_tag LOCUS_06130 52315 51206 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249414.1 protein_id gnl|my_center|LOCUS_06130 54627 52504 gene locus_tag LOCUS_06140 54627 52504 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120263.1 protein_id gnl|my_center|LOCUS_06140 58203 54709 gene locus_tag LOCUS_06150 58203 54709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence010 6774 523 gene locus_tag LOCUS_06160 6774 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 7517 7086 gene locus_tag LOCUS_06170 gene nusB 7517 7086 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722486.1 protein_id gnl|my_center|LOCUS_06170 10844 7545 gene locus_tag LOCUS_06180 gene smc 10844 7545 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475846.1 protein_id gnl|my_center|LOCUS_06180 12146 11961 gene locus_tag LOCUS_06190 12146 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 12723 12136 gene locus_tag LOCUS_06200 12723 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 15104 12723 gene locus_tag LOCUS_06210 15104 12723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 15663 15076 gene locus_tag LOCUS_06220 15663 15076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 16522 15674 gene locus_tag LOCUS_06230 16522 15674 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938977.1 protein_id gnl|my_center|LOCUS_06230 17279 16509 gene locus_tag LOCUS_06240 17279 16509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 17396 18046 gene locus_tag LOCUS_06250 17396 18046 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_06250 18065 18763 gene locus_tag LOCUS_06260 gene queC 18065 18763 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710446.1 protein_id gnl|my_center|LOCUS_06260 19334 18732 gene locus_tag LOCUS_06270 19334 18732 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_06270 19542 19327 gene locus_tag LOCUS_06280 19542 19327 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_06280 21367 19733 gene locus_tag LOCUS_06290 gene groL 21367 19733 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_06290 21751 21464 gene locus_tag LOCUS_06300 gene groES 21751 21464 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_06300 23779 21869 gene locus_tag LOCUS_06310 gene dnaK 23779 21869 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_06310 24541 23954 gene locus_tag LOCUS_06320 24541 23954 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025456391.1 protein_id gnl|my_center|LOCUS_06320 25686 24538 gene locus_tag LOCUS_06330 gene pheA 25686 24538 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_06330 26740 25730 gene locus_tag LOCUS_06340 gene aroF 26740 25730 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_06340 27854 26913 gene locus_tag LOCUS_06350 27854 26913 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_06350 29137 27887 gene locus_tag LOCUS_06360 29137 27887 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_06360 29704 29201 gene locus_tag LOCUS_06370 29704 29201 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_06370 30498 29701 gene locus_tag LOCUS_06380 gene proC 30498 29701 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931771.1 protein_id gnl|my_center|LOCUS_06380 31494 30559 gene locus_tag LOCUS_06390 31494 30559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 31700 31491 gene locus_tag LOCUS_06400 31700 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 32636 31821 gene locus_tag LOCUS_06410 32636 31821 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786401.1 protein_id gnl|my_center|LOCUS_06410 33829 32618 gene locus_tag LOCUS_06420 gene hydF 33829 32618 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_06420 34295 33930 gene locus_tag LOCUS_06430 34295 33930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 35331 34366 gene locus_tag LOCUS_06440 35331 34366 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_06440 36969 35362 gene locus_tag LOCUS_06450 36969 35362 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390018.1 protein_id gnl|my_center|LOCUS_06450 37412 36981 gene locus_tag LOCUS_06460 37412 36981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 38221 37409 gene locus_tag LOCUS_06470 38221 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 38766 38296 gene locus_tag LOCUS_06480 38766 38296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 41506 38831 gene locus_tag LOCUS_06490 41506 38831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 42189 41503 gene locus_tag LOCUS_06500 42189 41503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 45185 42201 gene locus_tag LOCUS_06510 45185 42201 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962208.1 protein_id gnl|my_center|LOCUS_06510 47112 45202 gene locus_tag LOCUS_06520 47112 45202 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_06520 47354 47130 gene locus_tag LOCUS_06530 47354 47130 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870276.1 protein_id gnl|my_center|LOCUS_06530 48411 47482 gene locus_tag LOCUS_06540 48411 47482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 49274 48429 gene locus_tag LOCUS_06550 49274 48429 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583958.1 protein_id gnl|my_center|LOCUS_06550 50413 49271 gene locus_tag LOCUS_06560 50413 49271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 51425 50502 gene locus_tag LOCUS_06570 51425 50502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 52603 51419 gene locus_tag LOCUS_06580 52603 51419 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence011 3526 455 gene locus_tag LOCUS_06590 3526 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5634 3523 gene locus_tag LOCUS_06600 5634 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8062 5681 gene locus_tag LOCUS_06610 8062 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8189 9394 gene locus_tag LOCUS_06620 8189 9394 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_06620 10230 9454 gene locus_tag LOCUS_06630 10230 9454 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_06630 11263 10232 gene locus_tag LOCUS_06640 gene recA 11263 10232 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052644.1 protein_id gnl|my_center|LOCUS_06640 13498 11285 gene locus_tag LOCUS_06650 13498 11285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 14664 13624 gene locus_tag LOCUS_06660 gene purM 14664 13624 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 protein_id gnl|my_center|LOCUS_06660 15770 14775 gene locus_tag LOCUS_06670 15770 14775 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_06670 15954 16283 gene locus_tag LOCUS_06680 15954 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 16361 17602 gene locus_tag LOCUS_06690 16361 17602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 18638 20059 gene locus_tag LOCUS_06700 18638 20059 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_06700 20420 20067 gene locus_tag LOCUS_06710 20420 20067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 21942 20437 gene locus_tag LOCUS_06720 21942 20437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 22925 21954 gene locus_tag LOCUS_06730 22925 21954 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_06730 24405 22984 gene locus_tag LOCUS_06740 24405 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 27020 24402 gene locus_tag LOCUS_06750 27020 24402 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202335.1 protein_id gnl|my_center|LOCUS_06750 27787 27104 gene locus_tag LOCUS_06760 27787 27104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 29009 27798 gene locus_tag LOCUS_06770 29009 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 30589 30825 gene locus_tag LOCUS_06780 30589 30825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 32302 31076 gene locus_tag LOCUS_06790 32302 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 34954 33155 gene locus_tag LOCUS_06800 34954 33155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 36680 35016 gene locus_tag LOCUS_06810 36680 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 36936 36727 gene locus_tag LOCUS_06820 36936 36727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 37348 37620 gene locus_tag LOCUS_06830 37348 37620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 38491 37679 gene locus_tag LOCUS_06840 38491 37679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 40946 39951 gene locus_tag LOCUS_06850 40946 39951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 43232 40959 gene locus_tag LOCUS_06860 43232 40959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 44052 43297 gene locus_tag LOCUS_06870 44052 43297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 44672 44046 gene locus_tag LOCUS_06880 44672 44046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 49469 45867 gene locus_tag LOCUS_06890 gene nifJ 49469 45867 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940774.1 protein_id gnl|my_center|LOCUS_06890 51010 49574 gene locus_tag LOCUS_06900 51010 49574 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964201.1 protein_id gnl|my_center|LOCUS_06900 51702 51010 gene locus_tag LOCUS_06910 51702 51010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 52481 51726 gene locus_tag LOCUS_06920 gene tpiA 52481 51726 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_06920 53004 52513 gene locus_tag LOCUS_06930 53004 52513 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_06930 53317 53206 gene locus_tag LOCUS_r00010 53317 53206 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence012 227 303 gene locus_tag LOCUS_t00160 227 303 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 744 325 gene locus_tag LOCUS_06940 744 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1506 763 gene locus_tag LOCUS_06950 gene kdsB 1506 763 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_06950 3568 1478 gene locus_tag LOCUS_06960 3568 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 5222 3555 gene locus_tag LOCUS_06970 5222 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6052 5243 gene locus_tag LOCUS_06980 6052 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7100 6060 gene locus_tag LOCUS_06990 7100 6060 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_06990 8006 7128 gene locus_tag LOCUS_07000 8006 7128 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_07000 9214 8108 gene locus_tag LOCUS_07010 9214 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 9914 9279 gene locus_tag LOCUS_07020 9914 9279 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_07020 11535 9922 gene locus_tag LOCUS_07030 gene pgi 11535 9922 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_07030 12073 11861 gene locus_tag LOCUS_07040 12073 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 13707 12559 gene locus_tag LOCUS_07050 gene tsaD 13707 12559 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_07050 14558 13707 gene locus_tag LOCUS_07060 14558 13707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 15394 14555 gene locus_tag LOCUS_07070 15394 14555 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_07070 16905 15391 gene locus_tag LOCUS_07080 16905 15391 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244055.1 protein_id gnl|my_center|LOCUS_07080 17581 17006 gene locus_tag LOCUS_07090 gene pth 17581 17006 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_07090 18541 17582 gene locus_tag LOCUS_07100 18541 17582 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_07100 21490 18662 gene locus_tag LOCUS_07110 21490 18662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 23671 21503 gene locus_tag LOCUS_07120 gene priA 23671 21503 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_07120 24379 23675 gene locus_tag LOCUS_07130 24379 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 25105 24479 gene locus_tag LOCUS_07140 25105 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 25467 25102 gene locus_tag LOCUS_07150 25467 25102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 25918 25571 gene locus_tag LOCUS_07160 gene rplT 25918 25571 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_07160 26128 25934 gene locus_tag LOCUS_07170 gene rpmI 26128 25934 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_07170 27420 26371 gene locus_tag LOCUS_07180 27420 26371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 28565 27417 gene locus_tag LOCUS_07190 28565 27417 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470668.1 protein_id gnl|my_center|LOCUS_07190 29329 28562 gene locus_tag LOCUS_07200 29329 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 31622 29442 gene locus_tag LOCUS_07210 31622 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 34718 31629 gene locus_tag LOCUS_07220 34718 31629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 36655 34715 gene locus_tag LOCUS_07230 36655 34715 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_07230 39664 36665 gene locus_tag LOCUS_07240 39664 36665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 42003 39685 gene locus_tag LOCUS_07250 42003 39685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 43125 42031 gene locus_tag LOCUS_07260 43125 42031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 43572 43709 gene locus_tag LOCUS_07270 43572 43709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 44370 43732 gene locus_tag LOCUS_07280 44370 43732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 45620 44367 gene locus_tag LOCUS_07290 45620 44367 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990055.1 protein_id gnl|my_center|LOCUS_07290 47162 45663 gene locus_tag LOCUS_07300 47162 45663 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765644.1 protein_id gnl|my_center|LOCUS_07300 49330 47246 gene locus_tag LOCUS_07310 gene clpB 49330 47246 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_07310 51945 49453 gene locus_tag LOCUS_07320 51945 49453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence013 259 1560 gene locus_tag LOCUS_07330 259 1560 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669361.1 protein_id gnl|my_center|LOCUS_07330 1597 3660 gene locus_tag LOCUS_07340 gene ftsH 1597 3660 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_07340 3661 4494 gene locus_tag LOCUS_07350 gene cdaA 3661 4494 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389035.1 protein_id gnl|my_center|LOCUS_07350 4491 4778 gene locus_tag LOCUS_07360 4491 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4775 7381 gene locus_tag LOCUS_07370 4775 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 7378 8352 gene locus_tag LOCUS_07380 7378 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8375 8611 gene locus_tag LOCUS_07390 8375 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 8621 9667 gene locus_tag LOCUS_07400 8621 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 10920 9691 gene locus_tag LOCUS_07410 10920 9691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_07410 11663 10917 gene locus_tag LOCUS_07420 11663 10917 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_07420 12961 11663 gene locus_tag LOCUS_07430 12961 11663 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_07430 14388 12958 gene locus_tag LOCUS_07440 14388 12958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 14550 15890 gene locus_tag LOCUS_07450 14550 15890 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023751.1 protein_id gnl|my_center|LOCUS_07450 15892 16284 gene locus_tag LOCUS_07460 15892 16284 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_07460 16291 17349 gene locus_tag LOCUS_07470 16291 17349 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679701.1 protein_id gnl|my_center|LOCUS_07470 17352 18755 gene locus_tag LOCUS_07480 17352 18755 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_07480 18752 19537 gene locus_tag LOCUS_07490 18752 19537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 19549 20451 gene locus_tag LOCUS_07500 19549 20451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20448 21029 gene locus_tag LOCUS_07510 20448 21029 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582959.1 protein_id gnl|my_center|LOCUS_07510 21026 21709 gene locus_tag LOCUS_07520 21026 21709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 21723 23015 gene locus_tag LOCUS_07530 21723 23015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 23043 24179 gene locus_tag LOCUS_07540 23043 24179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 25610 24198 gene locus_tag LOCUS_07550 gene rpoN 25610 24198 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_07550 27301 25610 gene locus_tag LOCUS_07560 27301 25610 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615922.1 protein_id gnl|my_center|LOCUS_07560 28473 27343 gene locus_tag LOCUS_07570 28473 27343 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_07570 29522 28488 gene locus_tag LOCUS_07580 gene hisC 29522 28488 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088965.1 protein_id gnl|my_center|LOCUS_07580 29898 29527 gene locus_tag LOCUS_07590 29898 29527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 30329 29895 gene locus_tag LOCUS_07600 30329 29895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 30901 30431 gene locus_tag LOCUS_07610 gene rplI 30901 30431 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_07610 31149 30919 gene locus_tag LOCUS_07620 31149 30919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 31602 31186 gene locus_tag LOCUS_07630 31602 31186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 32006 31620 gene locus_tag LOCUS_07640 32006 31620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 32635 32006 gene locus_tag LOCUS_07650 32635 32006 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243443.1 protein_id gnl|my_center|LOCUS_07650 34687 32885 gene locus_tag LOCUS_07660 gene fucI 34687 32885 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_07660 36130 34760 gene locus_tag LOCUS_07670 36130 34760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 36165 36359 gene locus_tag LOCUS_07680 36165 36359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 38772 36349 gene locus_tag LOCUS_07690 38772 36349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 41791 38786 gene locus_tag LOCUS_07700 41791 38786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 43856 41874 gene locus_tag LOCUS_07710 43856 41874 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015947.1 protein_id gnl|my_center|LOCUS_07710 44689 44006 gene locus_tag LOCUS_07720 gene rsmI 44689 44006 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_07720 45111 44689 gene locus_tag LOCUS_07730 45111 44689 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403547.1 protein_id gnl|my_center|LOCUS_07730 46559 45111 gene locus_tag LOCUS_07740 46559 45111 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_07740 47642 46650 gene locus_tag LOCUS_07750 47642 46650 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_07750 48768 48142 gene locus_tag LOCUS_07760 48768 48142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 49841 48789 gene locus_tag LOCUS_07770 49841 48789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence014 <1 612 gene locus_tag LOCUS_07780 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196835716.1:adenine-specific methyltransferase EcoRI family protein 593 844 gene locus_tag LOCUS_07790 593 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 872 3577 gene locus_tag LOCUS_07800 872 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 3593 4354 gene locus_tag LOCUS_07810 3593 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 4351 4884 gene locus_tag LOCUS_07820 4351 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 7302 4990 gene locus_tag LOCUS_07830 7302 4990 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_07830 7516 8268 gene locus_tag LOCUS_07840 7516 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8986 8366 gene locus_tag LOCUS_07850 8986 8366 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227223.1 protein_id gnl|my_center|LOCUS_07850 10782 8983 gene locus_tag LOCUS_07860 10782 8983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 10887 11489 gene locus_tag LOCUS_07870 10887 11489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 11504 13219 gene locus_tag LOCUS_07880 11504 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 13246 15345 gene locus_tag LOCUS_07890 13246 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 15407 17098 gene locus_tag LOCUS_07900 15407 17098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 17539 19167 gene locus_tag LOCUS_07910 17539 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19201 19551 gene locus_tag LOCUS_07920 19201 19551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 19653 22328 gene locus_tag LOCUS_07930 19653 22328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 22348 23820 gene locus_tag LOCUS_07940 22348 23820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 23890 25029 gene locus_tag LOCUS_07950 23890 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 25197 26621 gene locus_tag LOCUS_07960 gene ibeA 25197 26621 CDS product putative intracellular survival FAD-dependent oxidoreductase IbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397942.1 protein_id gnl|my_center|LOCUS_07960 26967 28625 gene locus_tag LOCUS_07970 26967 28625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 28821 30185 gene locus_tag LOCUS_07980 28821 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 30366 31190 gene locus_tag LOCUS_07990 30366 31190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 31287 32585 gene locus_tag LOCUS_08000 31287 32585 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_08000 32607 33971 gene locus_tag LOCUS_08010 32607 33971 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966541.1 protein_id gnl|my_center|LOCUS_08010 33975 34334 gene locus_tag LOCUS_08020 33975 34334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329952.1 protein_id gnl|my_center|LOCUS_08020 34334 35215 gene locus_tag LOCUS_08030 gene rsgA 34334 35215 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_08030 35316 36326 gene locus_tag LOCUS_08040 35316 36326 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392580.1 protein_id gnl|my_center|LOCUS_08040 36389 37000 gene locus_tag LOCUS_08050 36389 37000 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_08050 37005 39518 gene locus_tag LOCUS_08060 37005 39518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 39505 40197 gene locus_tag LOCUS_08070 39505 40197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 40235 40657 gene locus_tag LOCUS_08080 gene gspG 40235 40657 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202879.1 protein_id gnl|my_center|LOCUS_08080 40682 41515 gene locus_tag LOCUS_08090 40682 41515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 41512 41961 gene locus_tag LOCUS_08100 41512 41961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 41958 42788 gene locus_tag LOCUS_08110 41958 42788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 42785 44047 gene locus_tag LOCUS_08120 42785 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 44049 44945 gene locus_tag LOCUS_08130 44049 44945 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_08130 47134 44963 gene locus_tag LOCUS_08140 47134 44963 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203279.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence015 3351 169 gene locus_tag LOCUS_08150 3351 169 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120396.1 protein_id gnl|my_center|LOCUS_08150 6307 3344 gene locus_tag LOCUS_08160 6307 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 6692 6372 gene locus_tag LOCUS_08170 6692 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8296 7163 gene locus_tag LOCUS_08180 8296 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9349 8846 gene locus_tag LOCUS_08190 9349 8846 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_08190 9650 10030 gene locus_tag LOCUS_08200 9650 10030 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_08200 11381 10101 gene locus_tag LOCUS_08210 11381 10101 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_08210 12297 11407 gene locus_tag LOCUS_08220 12297 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 14139 12319 gene locus_tag LOCUS_08230 14139 12319 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_08230 14634 14239 gene locus_tag LOCUS_08240 14634 14239 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053330.1 protein_id gnl|my_center|LOCUS_08240 15044 14847 gene locus_tag LOCUS_08250 15044 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16778 15285 gene locus_tag LOCUS_08260 16778 15285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 17507 16881 gene locus_tag LOCUS_08270 17507 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 18665 17955 gene locus_tag LOCUS_08280 18665 17955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 20409 18868 gene locus_tag LOCUS_08290 20409 18868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 21345 20566 gene locus_tag LOCUS_08300 21345 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 21492 21875 gene locus_tag LOCUS_08310 21492 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 21983 25096 gene locus_tag LOCUS_08320 21983 25096 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803351.1 protein_id gnl|my_center|LOCUS_08320 25096 26355 gene locus_tag LOCUS_08330 25096 26355 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146571912.1 protein_id gnl|my_center|LOCUS_08330 26371 27567 gene locus_tag LOCUS_08340 26371 27567 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657461.1 protein_id gnl|my_center|LOCUS_08340 28033 27578 gene locus_tag LOCUS_08350 28033 27578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 28990 28397 gene locus_tag LOCUS_08360 28990 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 29933 28998 gene locus_tag LOCUS_08370 gene gluQRS 29933 28998 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922628.1 protein_id gnl|my_center|LOCUS_08370 31333 29918 gene locus_tag LOCUS_08380 31333 29918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 32408 31335 gene locus_tag LOCUS_08390 32408 31335 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942544.1 protein_id gnl|my_center|LOCUS_08390 33148 32405 gene locus_tag LOCUS_08400 33148 32405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433117.1 protein_id gnl|my_center|LOCUS_08400 33981 33163 gene locus_tag LOCUS_08410 33981 33163 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147518.1 protein_id gnl|my_center|LOCUS_08410 34766 33978 gene locus_tag LOCUS_08420 34766 33978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 35965 34763 gene locus_tag LOCUS_08430 35965 34763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 38181 36076 gene locus_tag LOCUS_08440 gene pnp 38181 36076 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_08440 38485 38225 gene locus_tag LOCUS_08450 gene rpsO 38485 38225 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_08450 39912 38770 gene locus_tag LOCUS_08460 39912 38770 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267808.1 protein_id gnl|my_center|LOCUS_08460 42385 39923 gene locus_tag LOCUS_08470 42385 39923 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897132.1 protein_id gnl|my_center|LOCUS_08470 43251 42382 gene locus_tag LOCUS_08480 43251 42382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 47811 43429 gene locus_tag LOCUS_08490 47811 43429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence016 683 1090 gene locus_tag LOCUS_08500 683 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 1100 1756 gene locus_tag LOCUS_08510 1100 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5949 1834 gene locus_tag LOCUS_08520 5949 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10506 5983 gene locus_tag LOCUS_08530 10506 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11582 10503 gene locus_tag LOCUS_08540 11582 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 12447 11662 gene locus_tag LOCUS_08550 12447 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 15123 12799 gene locus_tag LOCUS_08560 15123 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 16322 15132 gene locus_tag LOCUS_08570 gene murC 16322 15132 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080384.1 protein_id gnl|my_center|LOCUS_08570 18118 16322 gene locus_tag LOCUS_08580 18118 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19362 18115 gene locus_tag LOCUS_08590 19362 18115 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_08590 20037 19369 gene locus_tag LOCUS_08600 20037 19369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 22052 20283 gene locus_tag LOCUS_08610 22052 20283 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669362.1 protein_id gnl|my_center|LOCUS_08610 22540 22073 gene locus_tag LOCUS_08620 22540 22073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 23106 22537 gene locus_tag LOCUS_08630 23106 22537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 24114 23170 gene locus_tag LOCUS_08640 24114 23170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 25430 24111 gene locus_tag LOCUS_08650 gene gltX 25430 24111 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021625.1 protein_id gnl|my_center|LOCUS_08650 26873 25503 gene locus_tag LOCUS_08660 26873 25503 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986562.1 protein_id gnl|my_center|LOCUS_08660 26966 27835 gene locus_tag LOCUS_08670 gene pdxS 26966 27835 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053677.1 protein_id gnl|my_center|LOCUS_08670 29858 27924 gene locus_tag LOCUS_08680 29858 27924 CDS product glycoside hydrolase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776819.1 protein_id gnl|my_center|LOCUS_08680 30616 30080 gene locus_tag LOCUS_08690 30616 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 31043 30708 gene locus_tag LOCUS_08700 31043 30708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 31570 31178 gene locus_tag LOCUS_08710 31570 31178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 37507 31580 gene locus_tag LOCUS_08720 37507 31580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 38105 37668 gene locus_tag LOCUS_08730 gene rplO 38105 37668 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393918.1 protein_id gnl|my_center|LOCUS_08730 38620 38126 gene locus_tag LOCUS_08740 gene rpsE 38620 38126 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871876.1 protein_id gnl|my_center|LOCUS_08740 38985 38623 gene locus_tag LOCUS_08750 gene rplR 38985 38623 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129924.1 protein_id gnl|my_center|LOCUS_08750 39546 39010 gene locus_tag LOCUS_08760 gene rplF 39546 39010 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125847.1 protein_id gnl|my_center|LOCUS_08760 39957 39565 gene locus_tag LOCUS_08770 gene rpsH 39957 39565 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093700.1 protein_id gnl|my_center|LOCUS_08770 40167 39982 gene locus_tag LOCUS_08780 40167 39982 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723684.1 protein_id gnl|my_center|LOCUS_08780 40706 40170 gene locus_tag LOCUS_08790 gene rplE 40706 40170 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_08790 41036 40725 gene locus_tag LOCUS_08800 gene rplX 41036 40725 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156486.1 protein_id gnl|my_center|LOCUS_08800 41419 41054 gene locus_tag LOCUS_08810 gene rplN 41419 41054 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205457.1 protein_id gnl|my_center|LOCUS_08810 41683 41432 gene locus_tag LOCUS_08820 gene rpsQ 41683 41432 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770213.1 protein_id gnl|my_center|LOCUS_08820 42105 41683 gene locus_tag LOCUS_08830 gene rplP 42105 41683 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_08830 42804 42109 gene locus_tag LOCUS_08840 gene rpsC 42804 42109 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_08840 43154 42804 gene locus_tag LOCUS_08850 gene rplV 43154 42804 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555485.1 protein_id gnl|my_center|LOCUS_08850 43442 43167 gene locus_tag LOCUS_08860 gene rpsS 43442 43167 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_08860 44270 43446 gene locus_tag LOCUS_08870 gene rplB 44270 43446 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_08870 44563 44282 gene locus_tag LOCUS_08880 gene rplW 44563 44282 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_08880 45169 44576 gene locus_tag LOCUS_08890 gene rplD 45169 44576 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_08890 45834 45172 gene locus_tag LOCUS_08900 gene rplC 45834 45172 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869928.1 protein_id gnl|my_center|LOCUS_08900 46153 45845 gene locus_tag LOCUS_08910 gene rpsJ 46153 45845 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence017 468 1871 gene locus_tag LOCUS_08920 468 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1868 5197 gene locus_tag LOCUS_08930 1868 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 5187 6065 gene locus_tag LOCUS_08940 5187 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6848 6069 gene locus_tag LOCUS_08950 6848 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 7506 11291 gene locus_tag LOCUS_08960 7506 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 11299 11829 gene locus_tag LOCUS_08970 11299 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 11826 12872 gene locus_tag LOCUS_08980 11826 12872 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029244.1 protein_id gnl|my_center|LOCUS_08980 12945 14129 gene locus_tag LOCUS_08990 gene tig 12945 14129 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_08990 14169 14744 gene locus_tag LOCUS_09000 gene clpP 14169 14744 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_09000 14741 15964 gene locus_tag LOCUS_09010 gene clpX 14741 15964 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_09010 15969 16295 gene locus_tag LOCUS_09020 15969 16295 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948189.1 protein_id gnl|my_center|LOCUS_09020 16295 17965 gene locus_tag LOCUS_09030 16295 17965 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_09030 18078 18488 gene locus_tag LOCUS_09040 18078 18488 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_09040 18485 18898 gene locus_tag LOCUS_09050 gene queD 18485 18898 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225595.1 protein_id gnl|my_center|LOCUS_09050 18895 19473 gene locus_tag LOCUS_09060 gene rsmD 18895 19473 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 protein_id gnl|my_center|LOCUS_09060 19454 19918 gene locus_tag LOCUS_09070 gene queF 19454 19918 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_09070 19897 21156 gene locus_tag LOCUS_09080 19897 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 21417 21914 gene locus_tag LOCUS_09090 21417 21914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 21951 22988 gene locus_tag LOCUS_09100 gene galE 21951 22988 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156530.1 protein_id gnl|my_center|LOCUS_09100 23021 23644 gene locus_tag LOCUS_09110 23021 23644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 23656 24438 gene locus_tag LOCUS_09120 23656 24438 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_09120 24467 25420 gene locus_tag LOCUS_09130 24467 25420 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_09130 25421 26689 gene locus_tag LOCUS_09140 25421 26689 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919039.1 protein_id gnl|my_center|LOCUS_09140 26659 27372 gene locus_tag LOCUS_09150 26659 27372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 27628 29085 gene locus_tag LOCUS_09160 27628 29085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 29198 32131 gene locus_tag LOCUS_09170 29198 32131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 32136 32717 gene locus_tag LOCUS_09180 32136 32717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 32763 33425 gene locus_tag LOCUS_09190 gene rnhB 32763 33425 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221870.1 protein_id gnl|my_center|LOCUS_09190 33450 34178 gene locus_tag LOCUS_09200 33450 34178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 34181 34630 gene locus_tag LOCUS_09210 34181 34630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 34627 35799 gene locus_tag LOCUS_09220 34627 35799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 35857 37473 gene locus_tag LOCUS_09230 35857 37473 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_09230 37491 37772 gene locus_tag LOCUS_09240 37491 37772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 37769 39082 gene locus_tag LOCUS_09250 37769 39082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 39160 39852 gene locus_tag LOCUS_09260 39160 39852 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_09260 39866 40927 gene locus_tag LOCUS_09270 39866 40927 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_09270 41837 40980 gene locus_tag LOCUS_09280 41837 40980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 41984 44203 gene locus_tag LOCUS_09290 41984 44203 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_09290 44323 44652 gene locus_tag LOCUS_09300 44323 44652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 44783 45070 gene locus_tag LOCUS_09310 44783 45070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 45060 45515 gene locus_tag LOCUS_09320 45060 45515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 45616 46074 gene locus_tag LOCUS_09330 45616 46074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 46218 47153 gene locus_tag LOCUS_09340 gene cysK 46218 47153 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_09340 47255 47330 gene locus_tag LOCUS_t00170 47255 47330 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 228 2780 gene locus_tag LOCUS_09350 228 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2855 3997 gene locus_tag LOCUS_09360 gene prfB 2855 3997 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 protein_id gnl|my_center|LOCUS_09360 3998 4330 gene locus_tag LOCUS_09370 3998 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4327 5829 gene locus_tag LOCUS_09380 4327 5829 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868765.1 protein_id gnl|my_center|LOCUS_09380 5826 6428 gene locus_tag LOCUS_09390 5826 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6470 7198 gene locus_tag LOCUS_09400 gene pyrH 6470 7198 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_09400 7274 7837 gene locus_tag LOCUS_09410 gene frr 7274 7837 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_09410 7884 8753 gene locus_tag LOCUS_09420 7884 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 8756 9715 gene locus_tag LOCUS_09430 8756 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9742 10497 gene locus_tag LOCUS_09440 9742 10497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325468.1 protein_id gnl|my_center|LOCUS_09440 10494 11744 gene locus_tag LOCUS_09450 10494 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11814 12983 gene locus_tag LOCUS_09460 gene uxuA 11814 12983 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438582.1 protein_id gnl|my_center|LOCUS_09460 12992 13720 gene locus_tag LOCUS_09470 12992 13720 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223081.1 protein_id gnl|my_center|LOCUS_09470 13912 14226 gene locus_tag LOCUS_09480 13912 14226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 14223 15599 gene locus_tag LOCUS_09490 14223 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 15725 16015 gene locus_tag LOCUS_09500 15725 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 16032 16214 gene locus_tag LOCUS_09510 16032 16214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 16211 16363 gene locus_tag LOCUS_09520 16211 16363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 17002 17466 gene locus_tag LOCUS_09530 17002 17466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 19510 19779 gene locus_tag LOCUS_09540 19510 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 19781 20509 gene locus_tag LOCUS_09550 19781 20509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 20952 22100 gene locus_tag LOCUS_09560 20952 22100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 22173 22793 gene locus_tag LOCUS_09570 22173 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 22778 23983 gene locus_tag LOCUS_09580 22778 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 23994 24644 gene locus_tag LOCUS_09590 23994 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 24644 25567 gene locus_tag LOCUS_09600 24644 25567 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_09600 25600 27273 gene locus_tag LOCUS_09610 25600 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 27287 29749 gene locus_tag LOCUS_09620 27287 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 30367 29885 gene locus_tag LOCUS_09630 30367 29885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 33326 30348 gene locus_tag LOCUS_09640 33326 30348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 33528 34319 gene locus_tag LOCUS_09650 33528 34319 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_09650 34352 35251 gene locus_tag LOCUS_09660 34352 35251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 35329 35946 gene locus_tag LOCUS_09670 35329 35946 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679385.1 protein_id gnl|my_center|LOCUS_09670 35943 37580 gene locus_tag LOCUS_09680 35943 37580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 37610 38068 gene locus_tag LOCUS_09690 37610 38068 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556692.1 protein_id gnl|my_center|LOCUS_09690 38069 39853 gene locus_tag LOCUS_09700 38069 39853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 39850 41412 gene locus_tag LOCUS_09710 39850 41412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 41446 42432 gene locus_tag LOCUS_09720 41446 42432 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_09720 42476 43000 gene locus_tag LOCUS_09730 42476 43000 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020708.1 protein_id gnl|my_center|LOCUS_09730 43002 43913 gene locus_tag LOCUS_09740 43002 43913 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925457.1 protein_id gnl|my_center|LOCUS_09740 43910 44737 gene locus_tag LOCUS_09750 43910 44737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 44814 45308 gene locus_tag LOCUS_09760 gene purE 44814 45308 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722253.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence019 1555 1256 gene locus_tag LOCUS_09770 1555 1256 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_09770 1827 1534 gene locus_tag LOCUS_09780 1827 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3669 2074 gene locus_tag LOCUS_09790 3669 2074 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229316.1 protein_id gnl|my_center|LOCUS_09790 7326 3817 gene locus_tag LOCUS_09800 7326 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10170 7603 gene locus_tag LOCUS_09810 10170 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11857 10505 gene locus_tag LOCUS_09820 11857 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 15033 12031 gene locus_tag LOCUS_09830 15033 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 18003 15085 gene locus_tag LOCUS_09840 18003 15085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 20180 18066 gene locus_tag LOCUS_09850 20180 18066 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_09850 20368 21570 gene locus_tag LOCUS_09860 20368 21570 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_09860 23860 21899 gene locus_tag LOCUS_09870 23860 21899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 25189 23969 gene locus_tag LOCUS_09880 25189 23969 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_09880 26817 25420 gene locus_tag LOCUS_09890 26817 25420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 27903 27064 gene locus_tag LOCUS_09900 27903 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 29508 28360 gene locus_tag LOCUS_09910 29508 28360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 32096 29856 gene locus_tag LOCUS_09920 32096 29856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 33667 32093 gene locus_tag LOCUS_09930 33667 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 34944 33718 gene locus_tag LOCUS_09940 34944 33718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 38254 35246 gene locus_tag LOCUS_09950 38254 35246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 39464 39243 gene locus_tag LOCUS_09960 39464 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 39775 39476 gene locus_tag LOCUS_09970 39775 39476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 40650 39937 gene locus_tag LOCUS_09980 40650 39937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 42222 40825 gene locus_tag LOCUS_09990 42222 40825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 43074 42517 gene locus_tag LOCUS_10000 43074 42517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 44038 43214 gene locus_tag LOCUS_10010 44038 43214 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 protein_id gnl|my_center|LOCUS_10010 44540 44010 gene locus_tag LOCUS_10020 44540 44010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence020 656 1663 gene locus_tag LOCUS_10030 656 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1660 2175 gene locus_tag LOCUS_10040 1660 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2185 2490 gene locus_tag LOCUS_10050 2185 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2518 3903 gene locus_tag LOCUS_10060 2518 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4026 3952 gene locus_tag LOCUS_t00180 4026 3952 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4087 5199 gene locus_tag LOCUS_10070 gene dprA 4087 5199 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_10070 5225 6505 gene locus_tag LOCUS_10080 5225 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 6522 7535 gene locus_tag LOCUS_10090 6522 7535 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006523900.1 protein_id gnl|my_center|LOCUS_10090 7540 8283 gene locus_tag LOCUS_10100 gene truA 7540 8283 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725204.1 protein_id gnl|my_center|LOCUS_10100 8368 9285 gene locus_tag LOCUS_10110 8368 9285 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_10110 9305 10357 gene locus_tag LOCUS_10120 9305 10357 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_10120 10386 11159 gene locus_tag LOCUS_10130 gene nagB 10386 11159 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_10130 11165 11299 gene locus_tag LOCUS_10140 11165 11299 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_10140 11444 13135 gene locus_tag LOCUS_10150 gene ilvD 11444 13135 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880508.1 protein_id gnl|my_center|LOCUS_10150 13157 13753 gene locus_tag LOCUS_10160 gene hisB 13157 13753 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_10160 13750 14475 gene locus_tag LOCUS_10170 gene hisA 13750 14475 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_10170 14479 15723 gene locus_tag LOCUS_10180 14479 15723 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_10180 15757 16764 gene locus_tag LOCUS_10190 gene ribD 15757 16764 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_10190 16847 17986 gene locus_tag LOCUS_10200 gene argE 16847 17986 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026614786.1 protein_id gnl|my_center|LOCUS_10200 18966 17992 gene locus_tag LOCUS_10210 18966 17992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 20283 19012 gene locus_tag LOCUS_10220 20283 19012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 21407 20280 gene locus_tag LOCUS_10230 21407 20280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 22612 21404 gene locus_tag LOCUS_10240 22612 21404 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_10240 23468 22632 gene locus_tag LOCUS_10250 23468 22632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 24388 23546 gene locus_tag LOCUS_10260 24388 23546 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_10260 26151 24385 gene locus_tag LOCUS_10270 26151 24385 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001970104.1 protein_id gnl|my_center|LOCUS_10270 27371 26148 gene locus_tag LOCUS_10280 27371 26148 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_10280 28924 27389 gene locus_tag LOCUS_10290 28924 27389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 29978 28905 gene locus_tag LOCUS_10300 gene ispG 29978 28905 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_10300 31185 29962 gene locus_tag LOCUS_10310 gene rseP 31185 29962 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_10310 32287 31199 gene locus_tag LOCUS_10320 32287 31199 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_10320 32385 33257 gene locus_tag LOCUS_10330 32385 33257 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861195.1 protein_id gnl|my_center|LOCUS_10330 34755 33259 gene locus_tag LOCUS_10340 34755 33259 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_10340 35575 34781 gene locus_tag LOCUS_10350 gene nhoA 35575 34781 CDS product N-hydroxyarylamine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187915.1 protein_id gnl|my_center|LOCUS_10350 36415 35618 gene locus_tag LOCUS_10360 36415 35618 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707193.1 protein_id gnl|my_center|LOCUS_10360 38013 36421 gene locus_tag LOCUS_10370 gene nadB 38013 36421 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_10370 39940 38078 gene locus_tag LOCUS_10380 39940 38078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 40740 39937 gene locus_tag LOCUS_10390 40740 39937 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_10390 41014 40769 gene locus_tag LOCUS_10400 41014 40769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 42754 41036 gene locus_tag LOCUS_10410 42754 41036 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence021 456 2042 gene locus_tag LOCUS_10420 gene gpmI 456 2042 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022631.1 protein_id gnl|my_center|LOCUS_10420 2042 3031 gene locus_tag LOCUS_10430 2042 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3010 3951 gene locus_tag LOCUS_10440 gene trxB 3010 3951 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510039.1 protein_id gnl|my_center|LOCUS_10440 3948 4256 gene locus_tag LOCUS_10450 gene trxA 3948 4256 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837519.1 protein_id gnl|my_center|LOCUS_10450 4273 5028 gene locus_tag LOCUS_10460 4273 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5025 5867 gene locus_tag LOCUS_10470 5025 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5864 6433 gene locus_tag LOCUS_10480 5864 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 6466 7866 gene locus_tag LOCUS_10490 6466 7866 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_10490 7897 9498 gene locus_tag LOCUS_10500 7897 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 9495 10715 gene locus_tag LOCUS_10510 9495 10715 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_10510 10721 10942 gene locus_tag LOCUS_10520 10721 10942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 10939 11574 gene locus_tag LOCUS_10530 gene vioB 10939 11574 CDS product dTDP-4-amino-4,6-dideoxy-D-glucose acetyltransferase VioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382700.1 protein_id gnl|my_center|LOCUS_10530 11606 13042 gene locus_tag LOCUS_10540 11606 13042 CDS product platelet-activating factor acetylhydrolase IB subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994067.1 protein_id gnl|my_center|LOCUS_10540 13116 14795 gene locus_tag LOCUS_10550 13116 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 14811 15743 gene locus_tag LOCUS_10560 gene era 14811 15743 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392137.1 protein_id gnl|my_center|LOCUS_10560 15745 17856 gene locus_tag LOCUS_10570 15745 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 17856 18491 gene locus_tag LOCUS_10580 17856 18491 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069550.1 protein_id gnl|my_center|LOCUS_10580 18488 19003 gene locus_tag LOCUS_10590 18488 19003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 19000 19470 gene locus_tag LOCUS_10600 19000 19470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 19484 20095 gene locus_tag LOCUS_10610 gene pyrE 19484 20095 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926797.1 protein_id gnl|my_center|LOCUS_10610 20121 21317 gene locus_tag LOCUS_10620 20121 21317 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_10620 21338 22324 gene locus_tag LOCUS_10630 21338 22324 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_10630 22324 23178 gene locus_tag LOCUS_10640 22324 23178 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_10640 23198 23728 gene locus_tag LOCUS_10650 gene apt 23198 23728 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_10650 23730 24275 gene locus_tag LOCUS_10660 23730 24275 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071102.1 protein_id gnl|my_center|LOCUS_10660 24312 25658 gene locus_tag LOCUS_10670 24312 25658 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_10670 25681 27297 gene locus_tag LOCUS_10680 25681 27297 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_10680 27321 27725 gene locus_tag LOCUS_10690 27321 27725 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016840.1 protein_id gnl|my_center|LOCUS_10690 27729 30026 gene locus_tag LOCUS_10700 27729 30026 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_10700 30023 31165 gene locus_tag LOCUS_10710 gene rsmB 30023 31165 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481161.1 protein_id gnl|my_center|LOCUS_10710 31188 32750 gene locus_tag LOCUS_10720 31188 32750 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_10720 32947 37923 gene locus_tag LOCUS_10730 32947 37923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 38106 40829 gene locus_tag LOCUS_10740 38106 40829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 40844 41605 gene locus_tag LOCUS_10750 40844 41605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence022 187 3060 gene locus_tag LOCUS_10760 187 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3247 4542 gene locus_tag LOCUS_10770 3247 4542 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896573.1 protein_id gnl|my_center|LOCUS_10770 4858 7665 gene locus_tag LOCUS_10780 4858 7665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8005 9075 gene locus_tag LOCUS_10790 8005 9075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 9116 10129 gene locus_tag LOCUS_10800 9116 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10582 11289 gene locus_tag LOCUS_10810 10582 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 11551 11363 gene locus_tag LOCUS_10820 11551 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 11604 15212 gene locus_tag LOCUS_10830 11604 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 15422 16588 gene locus_tag LOCUS_10840 15422 16588 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_10840 16622 17800 gene locus_tag LOCUS_10850 16622 17800 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_10850 17797 18729 gene locus_tag LOCUS_10860 17797 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 18731 19294 gene locus_tag LOCUS_10870 18731 19294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 19338 20636 gene locus_tag LOCUS_10880 19338 20636 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_10880 20665 21153 gene locus_tag LOCUS_10890 20665 21153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 21137 21559 gene locus_tag LOCUS_10900 21137 21559 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_10900 21556 23496 gene locus_tag LOCUS_10910 21556 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 23493 25163 gene locus_tag LOCUS_10920 23493 25163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 25211 27097 gene locus_tag LOCUS_10930 25211 27097 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_10930 27094 28311 gene locus_tag LOCUS_10940 27094 28311 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030522.1 protein_id gnl|my_center|LOCUS_10940 28364 28600 gene locus_tag LOCUS_10950 28364 28600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 28597 29640 gene locus_tag LOCUS_10960 28597 29640 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_10960 29690 30265 gene locus_tag LOCUS_10970 29690 30265 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_10970 30275 30940 gene locus_tag LOCUS_10980 30275 30940 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358516.1 protein_id gnl|my_center|LOCUS_10980 30940 31359 gene locus_tag LOCUS_10990 gene folK 30940 31359 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_10990 32329 31541 gene locus_tag LOCUS_11000 32329 31541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 32414 33910 gene locus_tag LOCUS_11010 32414 33910 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615422.1 protein_id gnl|my_center|LOCUS_11010 33910 35094 gene locus_tag LOCUS_11020 33910 35094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 35088 35870 gene locus_tag LOCUS_11030 35088 35870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 35922 37463 gene locus_tag LOCUS_11040 35922 37463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence023 2505 403 gene locus_tag LOCUS_11050 2505 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3176 3715 gene locus_tag LOCUS_11060 3176 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3897 4040 gene locus_tag LOCUS_11070 3897 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 4943 6190 gene locus_tag LOCUS_11080 4943 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6843 7316 gene locus_tag LOCUS_11090 6843 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8142 7378 gene locus_tag LOCUS_11100 8142 7378 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938651.1 protein_id gnl|my_center|LOCUS_11100 9510 8149 gene locus_tag LOCUS_11110 9510 8149 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544916.1 protein_id gnl|my_center|LOCUS_11110 10787 9507 gene locus_tag LOCUS_11120 gene serS 10787 9507 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130891.1 protein_id gnl|my_center|LOCUS_11120 13288 10820 gene locus_tag LOCUS_11130 13288 10820 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798121.1 protein_id gnl|my_center|LOCUS_11130 14087 13332 gene locus_tag LOCUS_11140 14087 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 14743 14102 gene locus_tag LOCUS_11150 14743 14102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 15591 14740 gene locus_tag LOCUS_11160 15591 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 18827 15753 gene locus_tag LOCUS_11170 18827 15753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 19517 18882 gene locus_tag LOCUS_11180 19517 18882 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_11180 20284 19508 gene locus_tag LOCUS_11190 gene ymdB 20284 19508 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_11190 21297 20293 gene locus_tag LOCUS_11200 21297 20293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 22679 21294 gene locus_tag LOCUS_11210 22679 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 23164 22676 gene locus_tag LOCUS_11220 23164 22676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 24381 23155 gene locus_tag LOCUS_11230 gene hisS 24381 23155 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222811.1 protein_id gnl|my_center|LOCUS_11230 26102 24399 gene locus_tag LOCUS_11240 26102 24399 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938640.1 protein_id gnl|my_center|LOCUS_11240 26675 26160 gene locus_tag LOCUS_11250 26675 26160 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_11250 27931 26693 gene locus_tag LOCUS_11260 27931 26693 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933548.1 protein_id gnl|my_center|LOCUS_11260 29535 27928 gene locus_tag LOCUS_11270 gene ettA 29535 27928 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258061.1 protein_id gnl|my_center|LOCUS_11270 31580 29577 gene locus_tag LOCUS_11280 31580 29577 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108653.1 protein_id gnl|my_center|LOCUS_11280 33072 31861 gene locus_tag LOCUS_11290 33072 31861 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027323.1 protein_id gnl|my_center|LOCUS_11290 34497 33157 gene locus_tag LOCUS_11300 34497 33157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 36341 34494 gene locus_tag LOCUS_11310 36341 34494 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681492.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence024 548 2701 gene locus_tag LOCUS_11320 548 2701 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583112.1 protein_id gnl|my_center|LOCUS_11320 2790 5246 gene locus_tag LOCUS_11330 2790 5246 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263007.1 protein_id gnl|my_center|LOCUS_11330 5447 7504 gene locus_tag LOCUS_11340 5447 7504 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871983.1 protein_id gnl|my_center|LOCUS_11340 7555 8013 gene locus_tag LOCUS_11350 7555 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 8029 8595 gene locus_tag LOCUS_11360 8029 8595 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_11360 8667 10664 gene locus_tag LOCUS_11370 8667 10664 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_11370 10683 11630 gene locus_tag LOCUS_11380 10683 11630 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_11380 11644 12468 gene locus_tag LOCUS_11390 11644 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 12576 12500 gene locus_tag LOCUS_t00190 12576 12500 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12756 13070 gene locus_tag LOCUS_11400 gene rplU 12756 13070 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_11400 13086 13322 gene locus_tag LOCUS_11410 gene rpmA 13086 13322 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583640.1 protein_id gnl|my_center|LOCUS_11410 13395 14558 gene locus_tag LOCUS_11420 gene obgE 13395 14558 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_11420 14575 15348 gene locus_tag LOCUS_11430 gene panB 14575 15348 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_11430 15429 15896 gene locus_tag LOCUS_11440 15429 15896 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957156.1 protein_id gnl|my_center|LOCUS_11440 15923 19561 gene locus_tag LOCUS_11450 15923 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 19573 20238 gene locus_tag LOCUS_11460 19573 20238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 20282 23347 gene locus_tag LOCUS_11470 20282 23347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 23755 24957 gene locus_tag LOCUS_11480 23755 24957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_11480 24954 25247 gene locus_tag LOCUS_11490 24954 25247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 25381 25719 gene locus_tag LOCUS_11500 25381 25719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 25737 27335 gene locus_tag LOCUS_11510 25737 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 27425 28927 gene locus_tag LOCUS_11520 27425 28927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 28938 29519 gene locus_tag LOCUS_11530 28938 29519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 29543 31150 gene locus_tag LOCUS_11540 29543 31150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 31174 32310 gene locus_tag LOCUS_11550 31174 32310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 32310 33272 gene locus_tag LOCUS_11560 32310 33272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 33226 33909 gene locus_tag LOCUS_11570 33226 33909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 33931 34797 gene locus_tag LOCUS_11580 33931 34797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 34815 35345 gene locus_tag LOCUS_11590 34815 35345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 35355 36431 gene locus_tag LOCUS_11600 35355 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 36431 38218 gene locus_tag LOCUS_11610 36431 38218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence025 315 746 gene locus_tag LOCUS_11620 gene rplM 315 746 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_11620 761 1162 gene locus_tag LOCUS_11630 gene rpsI 761 1162 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354786.1 protein_id gnl|my_center|LOCUS_11630 1293 3197 gene locus_tag LOCUS_11640 1293 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3221 4030 gene locus_tag LOCUS_11650 3221 4030 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_11650 4051 5739 gene locus_tag LOCUS_11660 4051 5739 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_11660 5751 6635 gene locus_tag LOCUS_11670 5751 6635 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_11670 6654 7355 gene locus_tag LOCUS_11680 6654 7355 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_11680 7357 8541 gene locus_tag LOCUS_11690 7357 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 8560 10089 gene locus_tag LOCUS_11700 8560 10089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 10394 11458 gene locus_tag LOCUS_11710 gene adeD 10394 11458 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AdeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207429.1 protein_id gnl|my_center|LOCUS_11710 11455 14610 gene locus_tag LOCUS_11720 11455 14610 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393549.1 protein_id gnl|my_center|LOCUS_11720 14613 15473 gene locus_tag LOCUS_11730 14613 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 15470 16921 gene locus_tag LOCUS_11740 15470 16921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 16918 18489 gene locus_tag LOCUS_11750 16918 18489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 18486 19433 gene locus_tag LOCUS_11760 gene dusB 18486 19433 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_11760 19467 21533 gene locus_tag LOCUS_11770 19467 21533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 21617 23056 gene locus_tag LOCUS_11780 21617 23056 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582902.1 protein_id gnl|my_center|LOCUS_11780 23060 24181 gene locus_tag LOCUS_11790 23060 24181 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461803.1 protein_id gnl|my_center|LOCUS_11790 24258 25808 gene locus_tag LOCUS_11800 24258 25808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 25813 27789 gene locus_tag LOCUS_11810 gene uvrB 25813 27789 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963824.1 protein_id gnl|my_center|LOCUS_11810 28470 27814 gene locus_tag LOCUS_11820 28470 27814 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_11820 28731 29027 gene locus_tag LOCUS_11830 28731 29027 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460614.1 protein_id gnl|my_center|LOCUS_11830 29024 29410 gene locus_tag LOCUS_11840 29024 29410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 29985 31256 gene locus_tag LOCUS_11850 29985 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 31410 31862 gene locus_tag LOCUS_11860 31410 31862 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680156.1 protein_id gnl|my_center|LOCUS_11860 32005 31823 gene locus_tag LOCUS_11870 32005 31823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 32862 33038 gene locus_tag LOCUS_11880 32862 33038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence026 2 256 gene locus_tag LOCUS_11890 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1114 2223 gene locus_tag LOCUS_11900 1114 2223 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456695.1 protein_id gnl|my_center|LOCUS_11900 2274 4223 gene locus_tag LOCUS_11910 2274 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4249 8526 gene locus_tag LOCUS_11920 4249 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 8664 10535 gene locus_tag LOCUS_11930 8664 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 10647 12431 gene locus_tag LOCUS_11940 10647 12431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 12515 14080 gene locus_tag LOCUS_11950 12515 14080 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_11950 14302 17334 gene locus_tag LOCUS_11960 14302 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 17362 19188 gene locus_tag LOCUS_11970 17362 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 19198 21849 gene locus_tag LOCUS_11980 19198 21849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 21846 23330 gene locus_tag LOCUS_11990 21846 23330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 23315 24658 gene locus_tag LOCUS_12000 23315 24658 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_12000 24957 27014 gene locus_tag LOCUS_12010 24957 27014 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_12010 27434 30484 gene locus_tag LOCUS_12020 27434 30484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 30512 31528 gene locus_tag LOCUS_12030 30512 31528 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_12030 31669 34119 gene locus_tag LOCUS_12040 31669 34119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 34124 34474 gene locus_tag LOCUS_12050 34124 34474 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_12050 34487 35332 gene locus_tag LOCUS_12060 34487 35332 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939227.1 protein_id gnl|my_center|LOCUS_12060 35349 36620 gene locus_tag LOCUS_12070 35349 36620 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596611.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence027 279 37 gene locus_tag LOCUS_12080 279 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 964 3348 gene locus_tag LOCUS_12090 gene bamA 964 3348 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_12090 3380 3928 gene locus_tag LOCUS_12100 3380 3928 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456715.1 protein_id gnl|my_center|LOCUS_12100 3931 4959 gene locus_tag LOCUS_12110 gene lpxD 3931 4959 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933028.1 protein_id gnl|my_center|LOCUS_12110 4956 5390 gene locus_tag LOCUS_12120 gene aroQ 4956 5390 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919748.1 protein_id gnl|my_center|LOCUS_12120 5392 5643 gene locus_tag LOCUS_12130 5392 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5656 6483 gene locus_tag LOCUS_12140 5656 6483 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_12140 6514 7218 gene locus_tag LOCUS_12150 gene pyrF 6514 7218 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_12150 7234 7704 gene locus_tag LOCUS_12160 7234 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 7725 10481 gene locus_tag LOCUS_12170 7725 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10492 11580 gene locus_tag LOCUS_12180 gene glf 10492 11580 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_12180 11616 12938 gene locus_tag LOCUS_12190 11616 12938 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_12190 12972 15860 gene locus_tag LOCUS_12200 12972 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 15956 17701 gene locus_tag LOCUS_12210 15956 17701 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_12210 17835 19322 gene locus_tag LOCUS_12220 17835 19322 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_12220 20435 19338 gene locus_tag LOCUS_12230 20435 19338 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224436.1 protein_id gnl|my_center|LOCUS_12230 20553 21464 gene locus_tag LOCUS_12240 gene rbsK 20553 21464 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_12240 21498 22517 gene locus_tag LOCUS_12250 21498 22517 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108492.1 protein_id gnl|my_center|LOCUS_12250 22540 23631 gene locus_tag LOCUS_12260 22540 23631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 23654 27877 gene locus_tag LOCUS_12270 23654 27877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 27974 28669 gene locus_tag LOCUS_12280 27974 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 28777 32004 gene locus_tag LOCUS_12290 28777 32004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 32060 34768 gene locus_tag LOCUS_12300 32060 34768 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_12300 34838 36136 gene locus_tag LOCUS_12310 34838 36136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence028 2719 1250 gene locus_tag LOCUS_12320 2719 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 5021 2733 gene locus_tag LOCUS_12330 5021 2733 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791960.1 protein_id gnl|my_center|LOCUS_12330 5192 5043 gene locus_tag LOCUS_12340 5192 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 6387 5218 gene locus_tag LOCUS_12350 6387 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 8783 6384 gene locus_tag LOCUS_12360 8783 6384 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_12360 9175 8780 gene locus_tag LOCUS_12370 9175 8780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 12345 9172 gene locus_tag LOCUS_12380 12345 9172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 14091 12352 gene locus_tag LOCUS_12390 14091 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 16073 14229 gene locus_tag LOCUS_12400 16073 14229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 16228 16070 gene locus_tag LOCUS_12410 16228 16070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 16414 17727 gene locus_tag LOCUS_12420 16414 17727 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_12420 18945 17788 gene locus_tag LOCUS_12430 18945 17788 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_12430 19075 19860 gene locus_tag LOCUS_12440 gene fabG 19075 19860 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898376.1 protein_id gnl|my_center|LOCUS_12440 19853 21118 gene locus_tag LOCUS_12450 19853 21118 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_12450 21145 22311 gene locus_tag LOCUS_12460 21145 22311 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_12460 22315 23352 gene locus_tag LOCUS_12470 22315 23352 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_12470 24031 23429 gene locus_tag LOCUS_12480 gene ruvA 24031 23429 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_12480 24425 24048 gene locus_tag LOCUS_12490 24425 24048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 25266 24502 gene locus_tag LOCUS_12500 25266 24502 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668967.1 protein_id gnl|my_center|LOCUS_12500 25610 25320 gene locus_tag LOCUS_12510 gene infA 25610 25320 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942395.1 protein_id gnl|my_center|LOCUS_12510 26347 25622 gene locus_tag LOCUS_12520 26347 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 28723 26360 gene locus_tag LOCUS_12530 28723 26360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 29205 28720 gene locus_tag LOCUS_12540 29205 28720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 32596 29309 gene locus_tag LOCUS_12550 32596 29309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 34713 32593 gene locus_tag LOCUS_12560 34713 32593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 35702 35169 gene locus_tag LOCUS_12570 35702 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence029 2 256 gene locus_tag LOCUS_12580 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 699 2423 gene locus_tag LOCUS_12590 699 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3058 3510 gene locus_tag LOCUS_12600 3058 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3497 3952 gene locus_tag LOCUS_12610 3497 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3983 5245 gene locus_tag LOCUS_12620 3983 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 5262 6191 gene locus_tag LOCUS_12630 5262 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6207 7256 gene locus_tag LOCUS_12640 6207 7256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 7232 8590 gene locus_tag LOCUS_12650 7232 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 8605 9090 gene locus_tag LOCUS_12660 8605 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 9090 9647 gene locus_tag LOCUS_12670 9090 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 9719 10741 gene locus_tag LOCUS_12680 9719 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10904 11101 gene locus_tag LOCUS_12690 10904 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 12847 11798 gene locus_tag LOCUS_12700 12847 11798 CDS product IS30-like element ISSpn8 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155321.1 protein_id gnl|my_center|LOCUS_12700 13170 13883 gene locus_tag LOCUS_12710 13170 13883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 13956 14858 gene locus_tag LOCUS_12720 13956 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 14883 16271 gene locus_tag LOCUS_12730 14883 16271 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_12730 16306 16635 gene locus_tag LOCUS_12740 16306 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 17851 16640 gene locus_tag LOCUS_12750 17851 16640 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_12750 17984 19186 gene locus_tag LOCUS_12760 17984 19186 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_12760 19235 20602 gene locus_tag LOCUS_12770 19235 20602 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_12770 20637 21581 gene locus_tag LOCUS_12780 gene kduI 20637 21581 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_12780 21587 23563 gene locus_tag LOCUS_12790 21587 23563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 23618 24310 gene locus_tag LOCUS_12800 gene kduD 23618 24310 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338256.1 protein_id gnl|my_center|LOCUS_12800 24555 27314 gene locus_tag LOCUS_12810 24555 27314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 27720 28694 gene locus_tag LOCUS_12820 27720 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 28733 31663 gene locus_tag LOCUS_12830 28733 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 31665 34367 gene locus_tag LOCUS_12840 31665 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 34594 34379 gene locus_tag LOCUS_12850 34594 34379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence030 4436 3708 gene locus_tag LOCUS_12860 4436 3708 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_12860 5026 4433 gene locus_tag LOCUS_12870 5026 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 6388 5063 gene locus_tag LOCUS_12880 6388 5063 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_12880 8694 6409 gene locus_tag LOCUS_12890 8694 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9067 8994 gene locus_tag LOCUS_t00200 9067 8994 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9907 9053 gene locus_tag LOCUS_12900 gene ispE 9907 9053 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_12900 11345 9897 gene locus_tag LOCUS_12910 11345 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 12665 11388 gene locus_tag LOCUS_12920 12665 11388 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812135.1 protein_id gnl|my_center|LOCUS_12920 13768 12692 gene locus_tag LOCUS_12930 13768 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 14727 13801 gene locus_tag LOCUS_12940 gene argC 14727 13801 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_12940 17188 14750 gene locus_tag LOCUS_12950 17188 14750 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_12950 18430 17204 gene locus_tag LOCUS_12960 18430 17204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 19836 18562 gene locus_tag LOCUS_12970 19836 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 20835 19858 gene locus_tag LOCUS_12980 20835 19858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 21549 20863 gene locus_tag LOCUS_12990 21549 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 22000 21569 gene locus_tag LOCUS_13000 22000 21569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 22928 21984 gene locus_tag LOCUS_13010 22928 21984 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_13010 24553 22925 gene locus_tag LOCUS_13020 24553 22925 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_13020 25510 24821 gene locus_tag LOCUS_13030 25510 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 29236 25862 gene locus_tag LOCUS_13040 29236 25862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 30129 29953 gene locus_tag LOCUS_13050 30129 29953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <34148 30529 gene locus_tag LOCUS_13060 <34148 30529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence031 731 1717 gene locus_tag LOCUS_13070 731 1717 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782251.1 protein_id gnl|my_center|LOCUS_13070 1936 3036 gene locus_tag LOCUS_13080 1936 3036 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_13080 3042 3902 gene locus_tag LOCUS_13090 3042 3902 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615561.1 protein_id gnl|my_center|LOCUS_13090 3985 4848 gene locus_tag LOCUS_13100 3985 4848 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_13100 4933 5103 gene locus_tag LOCUS_13110 4933 5103 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_13110 5100 5981 gene locus_tag LOCUS_13120 5100 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5992 6987 gene locus_tag LOCUS_13130 5992 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6996 8540 gene locus_tag LOCUS_13140 6996 8540 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_13140 8564 9355 gene locus_tag LOCUS_13150 8564 9355 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_13150 9362 9994 gene locus_tag LOCUS_13160 9362 9994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 9975 10619 gene locus_tag LOCUS_13170 gene bioH 9975 10619 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817359.1 protein_id gnl|my_center|LOCUS_13170 10749 11699 gene locus_tag LOCUS_13180 10749 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 12180 12500 gene locus_tag LOCUS_13190 12180 12500 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282554.1 protein_id gnl|my_center|LOCUS_13190 12517 12843 gene locus_tag LOCUS_13200 12517 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 12872 13210 gene locus_tag LOCUS_13210 12872 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13288 13578 gene locus_tag LOCUS_13220 13288 13578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 14021 13934 gene locus_tag LOCUS_t00210 14021 13934 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14249 15751 gene locus_tag LOCUS_13230 14249 15751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 15809 19444 gene locus_tag LOCUS_13240 15809 19444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 21092 19452 gene locus_tag LOCUS_13250 21092 19452 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_13250 21289 23244 gene locus_tag LOCUS_13260 21289 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 23258 23752 gene locus_tag LOCUS_13270 gene ruvC 23258 23752 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_13270 23975 24262 gene locus_tag LOCUS_13280 23975 24262 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086649.1 protein_id gnl|my_center|LOCUS_13280 24262 24435 gene locus_tag LOCUS_13290 24262 24435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 24729 25931 gene locus_tag LOCUS_13300 24729 25931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 26169 26324 gene locus_tag LOCUS_13310 26169 26324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 26321 26485 gene locus_tag LOCUS_13320 26321 26485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 26602 27471 gene locus_tag LOCUS_13330 26602 27471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 27567 28202 gene locus_tag LOCUS_13340 27567 28202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 28406 29965 gene locus_tag LOCUS_13350 28406 29965 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence032 3261 148 gene locus_tag LOCUS_13360 gene mfd 3261 148 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427773.1 protein_id gnl|my_center|LOCUS_13360 3936 3286 gene locus_tag LOCUS_13370 3936 3286 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172637.1 protein_id gnl|my_center|LOCUS_13370 4015 4653 gene locus_tag LOCUS_13380 gene ung 4015 4653 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_13380 6848 4707 gene locus_tag LOCUS_13390 gene ligA 6848 4707 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957648.1 protein_id gnl|my_center|LOCUS_13390 7516 6866 gene locus_tag LOCUS_13400 7516 6866 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083329.1 protein_id gnl|my_center|LOCUS_13400 8226 7513 gene locus_tag LOCUS_13410 8226 7513 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329973.1 protein_id gnl|my_center|LOCUS_13410 9245 8223 gene locus_tag LOCUS_13420 9245 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 9753 9217 gene locus_tag LOCUS_13430 9753 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 9637 9954 gene locus_tag LOCUS_13440 9637 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 10693 10019 gene locus_tag LOCUS_13450 10693 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 11005 10706 gene locus_tag LOCUS_13460 11005 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 11131 11484 gene locus_tag LOCUS_13470 11131 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13470 12690 11569 gene locus_tag LOCUS_13480 12690 11569 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_13480 13265 12720 gene locus_tag LOCUS_13490 gene def 13265 12720 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460527.1 protein_id gnl|my_center|LOCUS_13490 13715 13287 gene locus_tag LOCUS_13500 gene dut 13715 13287 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_13500 15417 13756 gene locus_tag LOCUS_13510 15417 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 16590 15469 gene locus_tag LOCUS_13520 16590 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 17780 16608 gene locus_tag LOCUS_13530 17780 16608 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022331.1 protein_id gnl|my_center|LOCUS_13530 19083 17809 gene locus_tag LOCUS_13540 19083 17809 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786507.1 protein_id gnl|my_center|LOCUS_13540 19940 19212 gene locus_tag LOCUS_13550 19940 19212 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_13550 20779 19943 gene locus_tag LOCUS_13560 20779 19943 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_13560 22207 20783 gene locus_tag LOCUS_13570 gene xylB 22207 20783 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583285.1 protein_id gnl|my_center|LOCUS_13570 23604 22204 gene locus_tag LOCUS_13580 23604 22204 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_13580 24546 23644 gene locus_tag LOCUS_13590 24546 23644 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_13590 24782 25834 gene locus_tag LOCUS_13600 24782 25834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 26634 25837 gene locus_tag LOCUS_13610 26634 25837 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931779.1 protein_id gnl|my_center|LOCUS_13610 28092 26656 gene locus_tag LOCUS_13620 28092 26656 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066425.1 protein_id gnl|my_center|LOCUS_13620 29149 28094 gene locus_tag LOCUS_13630 29149 28094 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence033 392 1399 gene locus_tag LOCUS_13640 392 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1515 2249 gene locus_tag LOCUS_13650 1515 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2274 3194 gene locus_tag LOCUS_13660 gene fabD 2274 3194 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_13660 3232 3438 gene locus_tag LOCUS_13670 3232 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 3457 4929 gene locus_tag LOCUS_13680 3457 4929 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869758.1 protein_id gnl|my_center|LOCUS_13680 4932 5450 gene locus_tag LOCUS_13690 4932 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 5464 6846 gene locus_tag LOCUS_13700 5464 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 7810 6848 gene locus_tag LOCUS_13710 7810 6848 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201939.1 protein_id gnl|my_center|LOCUS_13710 7987 8715 gene locus_tag LOCUS_13720 7987 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8774 10492 gene locus_tag LOCUS_13730 8774 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 10513 12846 gene locus_tag LOCUS_13740 10513 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 12870 14303 gene locus_tag LOCUS_13750 12870 14303 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_13750 14405 14956 gene locus_tag LOCUS_13760 14405 14956 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_13760 14975 15508 gene locus_tag LOCUS_13770 14975 15508 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_13770 15528 16058 gene locus_tag LOCUS_13780 gene tadA 15528 16058 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_13780 16216 20526 gene locus_tag LOCUS_13790 16216 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 20545 23718 gene locus_tag LOCUS_13800 20545 23718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 23732 25201 gene locus_tag LOCUS_13810 23732 25201 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108456.1 protein_id gnl|my_center|LOCUS_13810 25343 26860 gene locus_tag LOCUS_13820 25343 26860 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence034 140 322 gene locus_tag LOCUS_13830 140 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 518 3385 gene locus_tag LOCUS_13840 518 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5494 3398 gene locus_tag LOCUS_13850 5494 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6824 5661 gene locus_tag LOCUS_13860 6824 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 7042 6821 gene locus_tag LOCUS_13870 7042 6821 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131346.1 protein_id gnl|my_center|LOCUS_13870 9511 7049 gene locus_tag LOCUS_13880 gene mutS 9511 7049 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_13880 10647 9517 gene locus_tag LOCUS_13890 10647 9517 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603891.1 protein_id gnl|my_center|LOCUS_13890 11706 10651 gene locus_tag LOCUS_13900 11706 10651 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020964298.1 protein_id gnl|my_center|LOCUS_13900 12460 11699 gene locus_tag LOCUS_13910 12460 11699 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_13910 12879 12457 gene locus_tag LOCUS_13920 12879 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 14312 12876 gene locus_tag LOCUS_13930 gene gatB 14312 12876 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_13930 16939 14396 gene locus_tag LOCUS_13940 16939 14396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 19531 16952 gene locus_tag LOCUS_13950 19531 16952 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_13950 20740 19547 gene locus_tag LOCUS_13960 20740 19547 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927646.1 protein_id gnl|my_center|LOCUS_13960 22520 20757 gene locus_tag LOCUS_13970 22520 20757 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_13970 24186 23152 gene locus_tag LOCUS_13980 24186 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 24604 24173 gene locus_tag LOCUS_13990 24604 24173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 26985 24889 gene locus_tag LOCUS_14000 26985 24889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 27500 27024 gene locus_tag LOCUS_14010 27500 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence035 631 3825 gene locus_tag LOCUS_14020 631 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3838 6168 gene locus_tag LOCUS_14030 3838 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 6168 6926 gene locus_tag LOCUS_14040 6168 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6945 7931 gene locus_tag LOCUS_14050 6945 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 9107 7935 gene locus_tag LOCUS_14060 9107 7935 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_14060 9239 9952 gene locus_tag LOCUS_14070 9239 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 9977 12295 gene locus_tag LOCUS_14080 9977 12295 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067209.1 protein_id gnl|my_center|LOCUS_14080 12299 13072 gene locus_tag LOCUS_14090 12299 13072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 13097 16252 gene locus_tag LOCUS_14100 13097 16252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 16254 18641 gene locus_tag LOCUS_14110 16254 18641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 18844 23559 gene locus_tag LOCUS_14120 18844 23559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 23754 25319 gene locus_tag LOCUS_14130 23754 25319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence036 725 1912 gene locus_tag LOCUS_14140 725 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 1946 3331 gene locus_tag LOCUS_14150 1946 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 3342 3902 gene locus_tag LOCUS_14160 3342 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3899 5110 gene locus_tag LOCUS_14170 3899 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 5624 6337 gene locus_tag LOCUS_14180 5624 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 6353 7588 gene locus_tag LOCUS_14190 6353 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 8013 8759 gene locus_tag LOCUS_14200 8013 8759 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266363.1 protein_id gnl|my_center|LOCUS_14200 8762 9766 gene locus_tag LOCUS_14210 gene argF 8762 9766 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_14210 9778 11664 gene locus_tag LOCUS_14220 9778 11664 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_14220 11716 13395 gene locus_tag LOCUS_14230 11716 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 13404 14420 gene locus_tag LOCUS_14240 13404 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 14459 15949 gene locus_tag LOCUS_14250 14459 15949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15924 17201 gene locus_tag LOCUS_14260 15924 17201 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_14260 17231 18568 gene locus_tag LOCUS_14270 17231 18568 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681491.1 protein_id gnl|my_center|LOCUS_14270 18590 21010 gene locus_tag LOCUS_14280 18590 21010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 21052 21639 gene locus_tag LOCUS_14290 gene rsxA 21052 21639 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096898.1 protein_id gnl|my_center|LOCUS_14290 21663 22472 gene locus_tag LOCUS_14300 21663 22472 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_14300 22495 23628 gene locus_tag LOCUS_14310 22495 23628 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126014666.1 protein_id gnl|my_center|LOCUS_14310 23751 25385 gene locus_tag LOCUS_14320 23751 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 25634 26134 gene locus_tag LOCUS_14330 25634 26134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 26131 26823 gene locus_tag LOCUS_14340 26131 26823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence037 1956 316 gene locus_tag LOCUS_14350 1956 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 2729 2025 gene locus_tag LOCUS_14360 gene trmD 2729 2025 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640384.1 protein_id gnl|my_center|LOCUS_14360 2872 2956 gene locus_tag LOCUS_t00220 2872 2956 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4986 3028 gene locus_tag LOCUS_14370 4986 3028 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388633.1 protein_id gnl|my_center|LOCUS_14370 5756 4980 gene locus_tag LOCUS_14380 5756 4980 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883514.1 protein_id gnl|my_center|LOCUS_14380 7051 5753 gene locus_tag LOCUS_14390 gene purD 7051 5753 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704786.1 protein_id gnl|my_center|LOCUS_14390 7578 7072 gene locus_tag LOCUS_14400 7578 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 7906 7640 gene locus_tag LOCUS_14410 7906 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 8957 7908 gene locus_tag LOCUS_14420 8957 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 9840 8947 gene locus_tag LOCUS_14430 9840 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 10633 9833 gene locus_tag LOCUS_14440 10633 9833 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_14440 11592 10633 gene locus_tag LOCUS_14450 gene trpS 11592 10633 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_14450 12369 11722 gene locus_tag LOCUS_14460 gene deoC 12369 11722 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_14460 12474 12386 gene locus_tag LOCUS_t00230 12474 12386 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14724 12532 gene locus_tag LOCUS_14470 14724 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 15706 14780 gene locus_tag LOCUS_14480 15706 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 16119 15721 gene locus_tag LOCUS_14490 16119 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 16636 16121 gene locus_tag LOCUS_14500 16636 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 17829 16636 gene locus_tag LOCUS_14510 17829 16636 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_14510 18417 17833 gene locus_tag LOCUS_14520 18417 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 18976 18482 gene locus_tag LOCUS_14530 18976 18482 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_14530 20382 18973 gene locus_tag LOCUS_14540 gene gatA 20382 18973 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_14540 20686 20396 gene locus_tag LOCUS_14550 gene gatC 20686 20396 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_14550 21866 20703 gene locus_tag LOCUS_14560 gene tolB 21866 20703 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_14560 23108 21879 gene locus_tag LOCUS_14570 gene argJ 23108 21879 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942692.1 protein_id gnl|my_center|LOCUS_14570 24288 23152 gene locus_tag LOCUS_14580 24288 23152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 25985 24315 gene locus_tag LOCUS_14590 gene recN 25985 24315 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393016.1 protein_id gnl|my_center|LOCUS_14590 26087 26014 gene locus_tag LOCUS_t00240 26087 26014 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 26193 26102 gene locus_tag LOCUS_t00250 26193 26102 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence038 374 754 gene locus_tag LOCUS_14600 374 754 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092226.1 protein_id gnl|my_center|LOCUS_14600 2001 793 gene locus_tag LOCUS_14610 2001 793 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_14610 2792 2013 gene locus_tag LOCUS_14620 2792 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5452 2834 gene locus_tag LOCUS_14630 5452 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 6562 5591 gene locus_tag LOCUS_14640 6562 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8452 6572 gene locus_tag LOCUS_14650 8452 6572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456914.1 protein_id gnl|my_center|LOCUS_14650 9122 8466 gene locus_tag LOCUS_14660 9122 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 9708 9214 gene locus_tag LOCUS_14670 9708 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 9801 9725 gene locus_tag LOCUS_t00260 9801 9725 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10110 9907 gene locus_tag LOCUS_14680 10110 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10496 10110 gene locus_tag LOCUS_14690 gene rplQ 10496 10110 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459109.1 protein_id gnl|my_center|LOCUS_14690 11529 10531 gene locus_tag LOCUS_14700 11529 10531 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_14700 12170 11571 gene locus_tag LOCUS_14710 gene rpsD 12170 11571 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_14710 12623 12174 gene locus_tag LOCUS_14720 gene rpsK 12623 12174 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883265.1 protein_id gnl|my_center|LOCUS_14720 13018 12638 gene locus_tag LOCUS_14730 gene rpsM 13018 12638 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081785.1 protein_id gnl|my_center|LOCUS_14730 14832 13246 gene locus_tag LOCUS_14740 gene murJ 14832 13246 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_14740 15998 14829 gene locus_tag LOCUS_14750 gene lpxK 15998 14829 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626176.1 protein_id gnl|my_center|LOCUS_14750 18208 16004 gene locus_tag LOCUS_14760 18208 16004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 19824 18226 gene locus_tag LOCUS_14770 gene rng 19824 18226 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_14770 20990 19821 gene locus_tag LOCUS_14780 gene rodA 20990 19821 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_14780 22768 20987 gene locus_tag LOCUS_14790 gene mrdA 22768 20987 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_14790 23216 22758 gene locus_tag LOCUS_14800 23216 22758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 24004 23213 gene locus_tag LOCUS_14810 24004 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 25087 24044 gene locus_tag LOCUS_14820 25087 24044 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_14820 25299 25223 gene locus_tag LOCUS_t00270 25299 25223 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 3669 3058 gene locus_tag LOCUS_14830 3669 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 4025 3693 gene locus_tag LOCUS_14840 4025 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 5634 4393 gene locus_tag LOCUS_14850 5634 4393 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_14850 7488 5674 gene locus_tag LOCUS_14860 7488 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 10181 7485 gene locus_tag LOCUS_14870 10181 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 10903 10196 gene locus_tag LOCUS_14880 10903 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 12081 11449 gene locus_tag LOCUS_14890 12081 11449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 13523 12108 gene locus_tag LOCUS_14900 13523 12108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14932 13700 gene locus_tag LOCUS_14910 14932 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 15327 14944 gene locus_tag LOCUS_14920 15327 14944 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_14920 15557 15327 gene locus_tag LOCUS_14930 15557 15327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 16682 15861 gene locus_tag LOCUS_14940 16682 15861 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108351.1 protein_id gnl|my_center|LOCUS_14940 17241 16687 gene locus_tag LOCUS_14950 17241 16687 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_14950 18600 17395 gene locus_tag LOCUS_14960 18600 17395 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_14960 19906 18650 gene locus_tag LOCUS_14970 19906 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 20078 21046 gene locus_tag LOCUS_14980 20078 21046 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_14980 21879 21256 gene locus_tag LOCUS_14990 21879 21256 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_14990 22380 21922 gene locus_tag LOCUS_15000 gene ybaK 22380 21922 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809557.1 protein_id gnl|my_center|LOCUS_15000 22865 22413 gene locus_tag LOCUS_15010 22865 22413 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914217.1 protein_id gnl|my_center|LOCUS_15010 23992 22961 gene locus_tag LOCUS_15020 23992 22961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 >Feature sequence040 228 303 gene locus_tag LOCUS_t00280 228 303 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 332 1627 gene locus_tag LOCUS_15030 332 1627 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918720.1 protein_id gnl|my_center|LOCUS_15030 1736 1811 gene locus_tag LOCUS_t00290 1736 1811 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1833 1908 gene locus_tag LOCUS_t00300 1833 1908 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1926 2001 gene locus_tag LOCUS_t00310 1926 2001 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2060 3475 gene locus_tag LOCUS_15040 gene uxaC 2060 3475 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187445.1 protein_id gnl|my_center|LOCUS_15040 3518 4519 gene locus_tag LOCUS_15050 3518 4519 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_15050 4539 5486 gene locus_tag LOCUS_15060 4539 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5487 6662 gene locus_tag LOCUS_15070 5487 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6684 9134 gene locus_tag LOCUS_15080 6684 9134 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583217.1 protein_id gnl|my_center|LOCUS_15080 9348 10649 gene locus_tag LOCUS_15090 gene thiC 9348 10649 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902492.1 protein_id gnl|my_center|LOCUS_15090 10646 11443 gene locus_tag LOCUS_15100 gene thiD 10646 11443 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392386.1 protein_id gnl|my_center|LOCUS_15100 11634 14411 gene locus_tag LOCUS_15110 11634 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 14430 15830 gene locus_tag LOCUS_15120 14430 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 16004 17149 gene locus_tag LOCUS_15130 16004 17149 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767191.1 protein_id gnl|my_center|LOCUS_15130 17403 18398 gene locus_tag LOCUS_15140 17403 18398 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_15140 18400 19413 gene locus_tag LOCUS_15150 18400 19413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 19410 20006 gene locus_tag LOCUS_15160 19410 20006 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123154.1 protein_id gnl|my_center|LOCUS_15160 20003 21079 gene locus_tag LOCUS_15170 20003 21079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 21258 22571 gene locus_tag LOCUS_15180 21258 22571 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_15180 22926 22702 gene locus_tag LOCUS_15190 22926 22702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 23007 23648 gene locus_tag LOCUS_15200 23007 23648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 23675 24250 gene locus_tag LOCUS_15210 23675 24250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence041 2454 3515 gene locus_tag LOCUS_15220 2454 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3575 4138 gene locus_tag LOCUS_15230 gene rfbC 3575 4138 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_15230 4142 5014 gene locus_tag LOCUS_15240 gene rfbA 4142 5014 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857518.1 protein_id gnl|my_center|LOCUS_15240 5004 6092 gene locus_tag LOCUS_15250 gene rfbB 5004 6092 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974014.1 protein_id gnl|my_center|LOCUS_15250 6121 7116 gene locus_tag LOCUS_15260 6121 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 7912 11364 gene locus_tag LOCUS_15270 7912 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 11748 12992 gene locus_tag LOCUS_15280 11748 12992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 13337 13987 gene locus_tag LOCUS_15290 13337 13987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 14005 15219 gene locus_tag LOCUS_15300 14005 15219 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211643.1 protein_id gnl|my_center|LOCUS_15300 15267 18488 gene locus_tag LOCUS_15310 15267 18488 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967876.1 protein_id gnl|my_center|LOCUS_15310 18485 19909 gene locus_tag LOCUS_15320 18485 19909 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924853.1 protein_id gnl|my_center|LOCUS_15320 19971 21062 gene locus_tag LOCUS_15330 19971 21062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 21847 21146 gene locus_tag LOCUS_15340 gene rph 21847 21146 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_15340 21958 22872 gene locus_tag LOCUS_15350 21958 22872 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365085.1 protein_id gnl|my_center|LOCUS_15350 23028 23405 gene locus_tag LOCUS_15360 23028 23405 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_15360 23650 23784 gene locus_tag LOCUS_15370 23650 23784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 23781 24179 gene locus_tag LOCUS_15380 23781 24179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence042 266 3490 gene locus_tag LOCUS_15390 266 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 3555 4577 gene locus_tag LOCUS_15400 3555 4577 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_15400 4609 5892 gene locus_tag LOCUS_15410 gene fabF 4609 5892 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673329.1 protein_id gnl|my_center|LOCUS_15410 5913 6380 gene locus_tag LOCUS_15420 gene fabZ 5913 6380 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670104.1 protein_id gnl|my_center|LOCUS_15420 6395 7669 gene locus_tag LOCUS_15430 gene hisD 6395 7669 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406995.1 protein_id gnl|my_center|LOCUS_15430 7674 8492 gene locus_tag LOCUS_15440 7674 8492 CDS product lauroyl/myristoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027687.1 protein_id gnl|my_center|LOCUS_15440 8485 9696 gene locus_tag LOCUS_15450 8485 9696 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964998.1 protein_id gnl|my_center|LOCUS_15450 9706 10494 gene locus_tag LOCUS_15460 9706 10494 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765911.1 protein_id gnl|my_center|LOCUS_15460 10508 11773 gene locus_tag LOCUS_15470 gene tyrS 10508 11773 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332625.1 protein_id gnl|my_center|LOCUS_15470 11770 12876 gene locus_tag LOCUS_15480 gene lptF 11770 12876 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_15480 12893 13672 gene locus_tag LOCUS_15490 gene lpxA 12893 13672 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880360.1 protein_id gnl|my_center|LOCUS_15490 13732 14787 gene locus_tag LOCUS_15500 13732 14787 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_15500 14864 16984 gene locus_tag LOCUS_15510 14864 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 17018 17752 gene locus_tag LOCUS_15520 17018 17752 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_15520 17768 18067 gene locus_tag LOCUS_15530 17768 18067 CDS product DUF167 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933492.1 protein_id gnl|my_center|LOCUS_15530 18068 18496 gene locus_tag LOCUS_15540 18068 18496 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_15540 18496 19059 gene locus_tag LOCUS_15550 18496 19059 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814862.1 protein_id gnl|my_center|LOCUS_15550 19073 20179 gene locus_tag LOCUS_15560 19073 20179 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202122.1 protein_id gnl|my_center|LOCUS_15560 20303 21793 gene locus_tag LOCUS_15570 20303 21793 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_15570 21903 23063 gene locus_tag LOCUS_15580 21903 23063 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_15580 23076 25169 gene locus_tag LOCUS_15590 23076 25169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence043 271 1605 gene locus_tag LOCUS_15600 gene mucD 271 1605 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_15600 1602 3824 gene locus_tag LOCUS_15610 1602 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 3859 7779 gene locus_tag LOCUS_15620 3859 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7881 8759 gene locus_tag LOCUS_15630 7881 8759 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_15630 8861 9718 gene locus_tag LOCUS_15640 8861 9718 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_15640 9723 10748 gene locus_tag LOCUS_15650 9723 10748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10745 11668 gene locus_tag LOCUS_15660 10745 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 11695 12624 gene locus_tag LOCUS_15670 11695 12624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 12632 13921 gene locus_tag LOCUS_15680 12632 13921 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_15680 13918 14556 gene locus_tag LOCUS_15690 13918 14556 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350459.1 protein_id gnl|my_center|LOCUS_15690 14642 15079 gene locus_tag LOCUS_15700 14642 15079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 15117 16013 gene locus_tag LOCUS_15710 gene nadA 15117 16013 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257284.1 protein_id gnl|my_center|LOCUS_15710 16219 21132 gene locus_tag LOCUS_15720 16219 21132 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074257047.1 protein_id gnl|my_center|LOCUS_15720 21150 22241 gene locus_tag LOCUS_15730 21150 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 22228 22953 gene locus_tag LOCUS_15740 22228 22953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 22950 24800 gene locus_tag LOCUS_15750 22950 24800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence044 271 693 gene locus_tag LOCUS_15760 271 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 725 2347 gene locus_tag LOCUS_15770 725 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 3263 2370 gene locus_tag LOCUS_15780 3263 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4435 3368 gene locus_tag LOCUS_15790 4435 3368 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_15790 4699 8460 gene locus_tag LOCUS_15800 gene hrpA 4699 8460 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139543.1 protein_id gnl|my_center|LOCUS_15800 9323 8466 gene locus_tag LOCUS_15810 9323 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 10066 9320 gene locus_tag LOCUS_15820 10066 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 11838 10063 gene locus_tag LOCUS_15830 11838 10063 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922133.1 protein_id gnl|my_center|LOCUS_15830 11971 12327 gene locus_tag LOCUS_15840 11971 12327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 12559 12918 gene locus_tag LOCUS_15850 12559 12918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 14295 12922 gene locus_tag LOCUS_15860 14295 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 15087 14296 gene locus_tag LOCUS_15870 15087 14296 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_15870 15692 15084 gene locus_tag LOCUS_15880 15692 15084 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_15880 17050 15773 gene locus_tag LOCUS_15890 17050 15773 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_15890 17960 17097 gene locus_tag LOCUS_15900 17960 17097 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870266.1 protein_id gnl|my_center|LOCUS_15900 18419 19342 gene locus_tag LOCUS_15910 18419 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 20418 19357 gene locus_tag LOCUS_15920 20418 19357 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887889.1 protein_id gnl|my_center|LOCUS_15920 21286 20423 gene locus_tag LOCUS_15930 gene metF 21286 20423 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_15930 22425 21289 gene locus_tag LOCUS_15940 gene alr 22425 21289 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_15940 23244 22429 gene locus_tag LOCUS_15950 gene hslO 23244 22429 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479663.1 protein_id gnl|my_center|LOCUS_15950 24104 23271 gene locus_tag LOCUS_15960 24104 23271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence045 294 2234 gene locus_tag LOCUS_15970 gene tkt 294 2234 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944033.1 protein_id gnl|my_center|LOCUS_15970 2253 3611 gene locus_tag LOCUS_15980 gene purB 2253 3611 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460028.1 protein_id gnl|my_center|LOCUS_15980 3633 4835 gene locus_tag LOCUS_15990 3633 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 5754 4840 gene locus_tag LOCUS_16000 5754 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 6645 5767 gene locus_tag LOCUS_16010 6645 5767 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786129.1 protein_id gnl|my_center|LOCUS_16010 6732 8498 gene locus_tag LOCUS_16020 6732 8498 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036446.1 protein_id gnl|my_center|LOCUS_16020 8594 9898 gene locus_tag LOCUS_16030 8594 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 9928 10743 gene locus_tag LOCUS_16040 9928 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 11419 10736 gene locus_tag LOCUS_16050 11419 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 11682 12581 gene locus_tag LOCUS_16060 11682 12581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 12690 13193 gene locus_tag LOCUS_16070 gene coaD 12690 13193 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_16070 13201 14370 gene locus_tag LOCUS_16080 13201 14370 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_16080 14386 15576 gene locus_tag LOCUS_16090 14386 15576 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_16090 15573 16154 gene locus_tag LOCUS_16100 15573 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 16170 16646 gene locus_tag LOCUS_16110 16170 16646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 16646 17131 gene locus_tag LOCUS_16120 16646 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 17141 18625 gene locus_tag LOCUS_16130 17141 18625 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649434.1 protein_id gnl|my_center|LOCUS_16130 18703 21915 gene locus_tag LOCUS_16140 gene carB 18703 21915 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_16140 21931 23361 gene locus_tag LOCUS_16150 21931 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence046 288 1211 gene locus_tag LOCUS_16160 gene cysK 288 1211 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_16160 2826 1549 gene locus_tag LOCUS_16170 2826 1549 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_16170 6306 3226 gene locus_tag LOCUS_16180 6306 3226 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034260979.1 protein_id gnl|my_center|LOCUS_16180 7982 6309 gene locus_tag LOCUS_16190 7982 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 9302 9466 gene locus_tag LOCUS_16200 9302 9466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 11197 9884 gene locus_tag LOCUS_16210 11197 9884 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_16210 11602 11315 gene locus_tag LOCUS_16220 gene rpsT 11602 11315 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274025.1 protein_id gnl|my_center|LOCUS_16220 14395 11753 gene locus_tag LOCUS_16230 gene ppdK 14395 11753 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_16230 15689 14559 gene locus_tag LOCUS_16240 15689 14559 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_16240 15784 16386 gene locus_tag LOCUS_16250 15784 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 16376 16696 gene locus_tag LOCUS_16260 16376 16696 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081319.1 protein_id gnl|my_center|LOCUS_16260 16971 16895 gene locus_tag LOCUS_t00320 16971 16895 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 18381 17035 gene locus_tag LOCUS_16270 18381 17035 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_16270 20204 18483 gene locus_tag LOCUS_16280 20204 18483 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_16280 20941 20201 gene locus_tag LOCUS_16290 20941 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 22959 20938 gene locus_tag LOCUS_16300 22959 20938 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099684.1 protein_id gnl|my_center|LOCUS_16300 24084 22975 gene locus_tag LOCUS_16310 gene ilvC 24084 22975 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence047 484 3066 gene locus_tag LOCUS_16320 484 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3072 3650 gene locus_tag LOCUS_16330 3072 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4965 3739 gene locus_tag LOCUS_16340 4965 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 7219 5009 gene locus_tag LOCUS_16350 7219 5009 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_16350 8586 7279 gene locus_tag LOCUS_16360 gene glpT 8586 7279 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_16360 10000 8597 gene locus_tag LOCUS_16370 10000 8597 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_16370 11978 10077 gene locus_tag LOCUS_16380 11978 10077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 13475 12006 gene locus_tag LOCUS_16390 13475 12006 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_16390 15295 13511 gene locus_tag LOCUS_16400 15295 13511 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_16400 20084 15357 gene locus_tag LOCUS_16410 20084 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 21502 20081 gene locus_tag LOCUS_16420 21502 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 22976 21609 gene locus_tag LOCUS_16430 22976 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 23092 22964 gene locus_tag LOCUS_16440 23092 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence048 567 1490 gene locus_tag LOCUS_16450 567 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1487 2056 gene locus_tag LOCUS_16460 1487 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3427 2264 gene locus_tag LOCUS_16470 3427 2264 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124078.1 protein_id gnl|my_center|LOCUS_16470 3576 5606 gene locus_tag LOCUS_16480 3576 5606 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_16480 5603 5734 gene locus_tag LOCUS_16490 5603 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 5731 6630 gene locus_tag LOCUS_16500 gene kduI 5731 6630 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_16500 6627 7889 gene locus_tag LOCUS_16510 6627 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 7918 8307 gene locus_tag LOCUS_16520 7918 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 8382 9782 gene locus_tag LOCUS_16530 8382 9782 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303131.1 protein_id gnl|my_center|LOCUS_16530 9859 10554 gene locus_tag LOCUS_16540 9859 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10566 14444 gene locus_tag LOCUS_16550 10566 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 14481 15764 gene locus_tag LOCUS_16560 14481 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 15781 17658 gene locus_tag LOCUS_16570 15781 17658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 17968 20055 gene locus_tag LOCUS_16580 17968 20055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence049 4309 3620 gene locus_tag LOCUS_16590 4309 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 5925 4393 gene locus_tag LOCUS_16600 gene hydG 5925 4393 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546878.1 protein_id gnl|my_center|LOCUS_16600 7345 6155 gene locus_tag LOCUS_16610 7345 6155 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966091.1 protein_id gnl|my_center|LOCUS_16610 7505 7853 gene locus_tag LOCUS_tm00010 7505 7853 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 8125 7943 gene locus_tag LOCUS_16620 8125 7943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9726 8173 gene locus_tag LOCUS_16630 9726 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 11500 9815 gene locus_tag LOCUS_16640 11500 9815 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_16640 12627 11542 gene locus_tag LOCUS_16650 12627 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 13601 12669 gene locus_tag LOCUS_16660 13601 12669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 14948 13644 gene locus_tag LOCUS_16670 14948 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 17712 14962 gene locus_tag LOCUS_16680 17712 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 20498 17709 gene locus_tag LOCUS_16690 20498 17709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence050 260 179 gene locus_tag LOCUS_t00330 260 179 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1449 268 gene locus_tag LOCUS_16700 gene dnaJ 1449 268 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_16700 2072 1467 gene locus_tag LOCUS_16710 2072 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3353 2121 gene locus_tag LOCUS_16720 gene argG 3353 2121 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694213.1 protein_id gnl|my_center|LOCUS_16720 5634 3517 gene locus_tag LOCUS_16730 5634 3517 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039125.1 protein_id gnl|my_center|LOCUS_16730 7807 5699 gene locus_tag LOCUS_16740 7807 5699 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120263.1 protein_id gnl|my_center|LOCUS_16740 9239 7821 gene locus_tag LOCUS_16750 9239 7821 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_16750 10474 9266 gene locus_tag LOCUS_16760 10474 9266 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317128.1 protein_id gnl|my_center|LOCUS_16760 11957 10566 gene locus_tag LOCUS_16770 11957 10566 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_16770 12863 12093 gene locus_tag LOCUS_16780 gene map 12863 12093 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036574.1 protein_id gnl|my_center|LOCUS_16780 13552 12920 gene locus_tag LOCUS_16790 13552 12920 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966391.1 protein_id gnl|my_center|LOCUS_16790 14914 13577 gene locus_tag LOCUS_16800 gene gdhA 14914 13577 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_16800 18714 15088 gene locus_tag LOCUS_16810 18714 15088 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109085.1 protein_id gnl|my_center|LOCUS_16810 19278 19141 gene locus_tag LOCUS_16820 19278 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 19645 19271 gene locus_tag LOCUS_16830 19645 19271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 19789 19670 gene locus_tag LOCUS_16840 19789 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence051 2109 913 gene locus_tag LOCUS_16850 2109 913 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_16850 2238 3563 gene locus_tag LOCUS_16860 gene araE 2238 3563 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243899.1 protein_id gnl|my_center|LOCUS_16860 3648 4676 gene locus_tag LOCUS_16870 3648 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 4693 5394 gene locus_tag LOCUS_16880 4693 5394 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_16880 5397 6221 gene locus_tag LOCUS_16890 gene rbsK 5397 6221 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020077610.1 protein_id gnl|my_center|LOCUS_16890 6246 7763 gene locus_tag LOCUS_16900 6246 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 7803 8555 gene locus_tag LOCUS_16910 7803 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 8582 9721 gene locus_tag LOCUS_16920 8582 9721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 9747 12278 gene locus_tag LOCUS_16930 9747 12278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 12743 12408 gene locus_tag LOCUS_16940 12743 12408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 13226 19132 gene locus_tag LOCUS_16950 13226 19132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 19466 19945 gene locus_tag LOCUS_16960 19466 19945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence052 1072 356 gene locus_tag LOCUS_16970 1072 356 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_16970 3246 1111 gene locus_tag LOCUS_16980 3246 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4256 3309 gene locus_tag LOCUS_16990 4256 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 5184 4270 gene locus_tag LOCUS_17000 5184 4270 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383884.1 protein_id gnl|my_center|LOCUS_17000 6152 5184 gene locus_tag LOCUS_17010 6152 5184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7708 6149 gene locus_tag LOCUS_17020 7708 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 9747 7759 gene locus_tag LOCUS_17030 9747 7759 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667646.1 protein_id gnl|my_center|LOCUS_17030 10709 9762 gene locus_tag LOCUS_17040 10709 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 11497 10799 gene locus_tag LOCUS_17050 11497 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 12453 11497 gene locus_tag LOCUS_17060 gene xerC 12453 11497 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_17060 15047 12450 gene locus_tag LOCUS_17070 15047 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 16505 15129 gene locus_tag LOCUS_17080 16505 15129 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038505.1 protein_id gnl|my_center|LOCUS_17080 17132 16518 gene locus_tag LOCUS_17090 gene purN 17132 16518 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_17090 17642 17232 gene locus_tag LOCUS_17100 17642 17232 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_17100 17902 17639 gene locus_tag LOCUS_17110 17902 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence053 9922 9554 gene locus_tag LOCUS_17120 9922 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10224 9934 gene locus_tag LOCUS_17130 gene rpsP 10224 9934 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023081.1 protein_id gnl|my_center|LOCUS_17130 10907 10383 gene locus_tag LOCUS_17140 gene rpsG 10907 10383 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_17140 11294 10911 gene locus_tag LOCUS_17150 gene rpsL 11294 10911 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118744.1 protein_id gnl|my_center|LOCUS_17150 11433 12920 gene locus_tag LOCUS_17160 11433 12920 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922252.1 protein_id gnl|my_center|LOCUS_17160 13811 12996 gene locus_tag LOCUS_17170 13811 12996 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_17170 16027 13826 gene locus_tag LOCUS_17180 16027 13826 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249244.1 protein_id gnl|my_center|LOCUS_17180 18574 16034 gene locus_tag LOCUS_17190 gene gyrA 18574 16034 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence054 150 1139 gene locus_tag LOCUS_17200 150 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1373 2569 gene locus_tag LOCUS_17210 1373 2569 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_17210 2679 2948 gene locus_tag LOCUS_17220 2679 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 3044 3340 gene locus_tag LOCUS_17230 3044 3340 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016687.1 protein_id gnl|my_center|LOCUS_17230 3411 4319 gene locus_tag LOCUS_17240 3411 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4431 5348 gene locus_tag LOCUS_17250 4431 5348 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_17250 5555 7051 gene locus_tag LOCUS_17260 gene guaB 5555 7051 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081543.1 protein_id gnl|my_center|LOCUS_17260 7055 8035 gene locus_tag LOCUS_17270 7055 8035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 8041 10860 gene locus_tag LOCUS_17280 8041 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 10862 12364 gene locus_tag LOCUS_17290 gene ilvA 10862 12364 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_17290 12361 13875 gene locus_tag LOCUS_17300 gene fucP 12361 13875 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764988.1 protein_id gnl|my_center|LOCUS_17300 13885 15138 gene locus_tag LOCUS_17310 gene rimO 13885 15138 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_17310 15135 16073 gene locus_tag LOCUS_17320 15135 16073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 17494 16070 gene locus_tag LOCUS_17330 gene gltA 17494 16070 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681438.1 protein_id gnl|my_center|LOCUS_17330 18351 17494 gene locus_tag LOCUS_17340 18351 17494 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence055 2353 1046 gene locus_tag LOCUS_17350 2353 1046 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250265.1 protein_id gnl|my_center|LOCUS_17350 2950 2507 gene locus_tag LOCUS_17360 2950 2507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 3756 3169 gene locus_tag LOCUS_17370 3756 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4090 3773 gene locus_tag LOCUS_17380 4090 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4467 4108 gene locus_tag LOCUS_17390 4467 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5882 4470 gene locus_tag LOCUS_17400 5882 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 7556 5886 gene locus_tag LOCUS_17410 gene argS 7556 5886 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_17410 7753 9564 gene locus_tag LOCUS_17420 gene aspS 7753 9564 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_17420 9570 10058 gene locus_tag LOCUS_17430 9570 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 10055 11275 gene locus_tag LOCUS_17440 gene mtaB 10055 11275 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545970.1 protein_id gnl|my_center|LOCUS_17440 11275 11937 gene locus_tag LOCUS_17450 11275 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 11960 13216 gene locus_tag LOCUS_17460 11960 13216 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_17460 13285 13440 gene locus_tag LOCUS_17470 13285 13440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 14069 14617 gene locus_tag LOCUS_17480 14069 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 14660 16030 gene locus_tag LOCUS_17490 gene gdhA 14660 16030 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094817.1 protein_id gnl|my_center|LOCUS_17490 16182 16988 gene locus_tag LOCUS_17500 16182 16988 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676763.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence056 1469 540 gene locus_tag LOCUS_17510 1469 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 3730 1964 gene locus_tag LOCUS_17520 3730 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3884 3666 gene locus_tag LOCUS_17530 3884 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 5485 3881 gene locus_tag LOCUS_17540 5485 3881 CDS product trehalase family glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671898.1 protein_id gnl|my_center|LOCUS_17540 6419 5496 gene locus_tag LOCUS_17550 6419 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7392 6421 gene locus_tag LOCUS_17560 7392 6421 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921651.1 protein_id gnl|my_center|LOCUS_17560 10176 7414 gene locus_tag LOCUS_17570 10176 7414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 11466 10189 gene locus_tag LOCUS_17580 11466 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 13310 11463 gene locus_tag LOCUS_17590 13310 11463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 15787 13559 gene locus_tag LOCUS_17600 gene galB 15787 13559 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_17600 16074 15790 gene locus_tag LOCUS_17610 16074 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 16999 16088 gene locus_tag LOCUS_17620 16999 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 17147 17016 gene locus_tag LOCUS_17630 17147 17016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence057 290 1186 gene locus_tag LOCUS_17640 290 1186 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814571.1 protein_id gnl|my_center|LOCUS_17640 1183 2076 gene locus_tag LOCUS_17650 1183 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 2073 3272 gene locus_tag LOCUS_17660 gene ftsA 2073 3272 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_17660 3269 4372 gene locus_tag LOCUS_17670 gene ftsZ 3269 4372 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080214.1 protein_id gnl|my_center|LOCUS_17670 4377 6227 gene locus_tag LOCUS_17680 gene mutL 4377 6227 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933683.1 protein_id gnl|my_center|LOCUS_17680 6486 6283 gene locus_tag LOCUS_17690 6486 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 7585 6656 gene locus_tag LOCUS_17700 7585 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 8324 7599 gene locus_tag LOCUS_17710 8324 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9298 8438 gene locus_tag LOCUS_17720 9298 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 10318 9380 gene locus_tag LOCUS_17730 10318 9380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 10857 10315 gene locus_tag LOCUS_17740 10857 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 13397 11106 gene locus_tag LOCUS_17750 13397 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 14268 13399 gene locus_tag LOCUS_17760 14268 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 15064 14384 gene locus_tag LOCUS_17770 15064 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 15259 15077 gene locus_tag LOCUS_17780 15259 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 16253 15639 gene locus_tag LOCUS_17790 16253 15639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 16849 16622 gene locus_tag LOCUS_17800 16849 16622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence058 1110 2225 gene locus_tag LOCUS_17810 1110 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2197 3435 gene locus_tag LOCUS_17820 2197 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3779 4165 gene locus_tag LOCUS_17830 3779 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4452 5372 gene locus_tag LOCUS_17840 4452 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 5378 5839 gene locus_tag LOCUS_17850 5378 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 7257 6109 gene locus_tag LOCUS_17860 7257 6109 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_17860 7472 7741 gene locus_tag LOCUS_17870 7472 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 8142 10175 gene locus_tag LOCUS_17880 8142 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 10198 14286 gene locus_tag LOCUS_17890 10198 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 14315 15100 gene locus_tag LOCUS_17900 gene fabG 14315 15100 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898376.1 protein_id gnl|my_center|LOCUS_17900 15097 16263 gene locus_tag LOCUS_17910 15097 16263 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028331.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence059 5948 3687 gene locus_tag LOCUS_17920 5948 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 8443 5960 gene locus_tag LOCUS_17930 gene galB 8443 5960 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202546.1 protein_id gnl|my_center|LOCUS_17930 10175 8457 gene locus_tag LOCUS_17940 10175 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 13339 10172 gene locus_tag LOCUS_17950 13339 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 14248 13793 gene locus_tag LOCUS_17960 14248 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 14555 14211 gene locus_tag LOCUS_17970 14555 14211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 14815 14570 gene locus_tag LOCUS_17980 14815 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 15598 14864 gene locus_tag LOCUS_17990 15598 14864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence060 1596 448 gene locus_tag LOCUS_18000 gene fucO 1596 448 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_18000 4035 1678 gene locus_tag LOCUS_18010 4035 1678 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119288.1 protein_id gnl|my_center|LOCUS_18010 5560 4058 gene locus_tag LOCUS_18020 5560 4058 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026468324.1 protein_id gnl|my_center|LOCUS_18020 6271 5651 gene locus_tag LOCUS_18030 6271 5651 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_18030 8438 6273 gene locus_tag LOCUS_18040 8438 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 10434 8545 gene locus_tag LOCUS_18050 gene htpG 10434 8545 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_18050 10807 10460 gene locus_tag LOCUS_18060 10807 10460 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933244.1 protein_id gnl|my_center|LOCUS_18060 11289 10987 gene locus_tag LOCUS_18070 11289 10987 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_18070 12214 11483 gene locus_tag LOCUS_18080 gene dapB 12214 11483 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_18080 13668 12295 gene locus_tag LOCUS_18090 gene cysS 13668 12295 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_18090 15252 13708 gene locus_tag LOCUS_18100 15252 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 15513 15402 gene locus_tag LOCUS_r00020 15513 15402 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence061 535 1725 gene locus_tag LOCUS_18110 535 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1874 3907 gene locus_tag LOCUS_18120 1874 3907 CDS product NPCBM/NEW2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767105.1 protein_id gnl|my_center|LOCUS_18120 3943 5730 gene locus_tag LOCUS_18130 3943 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5727 7013 gene locus_tag LOCUS_18140 5727 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7014 9629 gene locus_tag LOCUS_18150 7014 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9644 11212 gene locus_tag LOCUS_18160 9644 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 12699 12496 gene locus_tag LOCUS_18170 12699 12496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 12817 14304 gene locus_tag LOCUS_18180 12817 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence062 1353 751 gene locus_tag LOCUS_18190 gene recR 1353 751 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_18190 1699 1382 gene locus_tag LOCUS_18200 1699 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 2617 1721 gene locus_tag LOCUS_18210 2617 1721 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938096.1 protein_id gnl|my_center|LOCUS_18210 4332 2614 gene locus_tag LOCUS_18220 4332 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 6431 4329 gene locus_tag LOCUS_18230 6431 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7138 6428 gene locus_tag LOCUS_18240 7138 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 8328 7159 gene locus_tag LOCUS_18250 8328 7159 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905294.1 protein_id gnl|my_center|LOCUS_18250 9086 8325 gene locus_tag LOCUS_18260 gene djlA 9086 8325 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_18260 10024 9089 gene locus_tag LOCUS_18270 10024 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 11508 10033 gene locus_tag LOCUS_18280 11508 10033 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680943.1 protein_id gnl|my_center|LOCUS_18280 12962 11514 gene locus_tag LOCUS_18290 gene trkA 12962 11514 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676352.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence063 690 971 gene locus_tag LOCUS_18300 690 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1270 1007 gene locus_tag LOCUS_18310 1270 1007 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812614.1 protein_id gnl|my_center|LOCUS_18310 1547 1347 gene locus_tag LOCUS_18320 1547 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2760 1579 gene locus_tag LOCUS_18330 2760 1579 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_18330 4365 3319 gene locus_tag LOCUS_18340 4365 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5101 4352 gene locus_tag LOCUS_18350 gene galU 5101 4352 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_18350 6458 5265 gene locus_tag LOCUS_18360 6458 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 7677 6472 gene locus_tag LOCUS_18370 7677 6472 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966572.1 protein_id gnl|my_center|LOCUS_18370 8831 7851 gene locus_tag LOCUS_18380 8831 7851 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_18380 8959 8837 gene locus_tag LOCUS_18390 8959 8837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 9834 9298 gene locus_tag LOCUS_18400 9834 9298 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036618527.1 protein_id gnl|my_center|LOCUS_18400 11397 9958 gene locus_tag LOCUS_18410 11397 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 13106 11451 gene locus_tag LOCUS_18420 13106 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence064 639 148 gene locus_tag LOCUS_18430 gene nrdG 639 148 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_18430 2979 742 gene locus_tag LOCUS_18440 gene nrdD 2979 742 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_18440 4348 3323 gene locus_tag LOCUS_18450 gene ruvB 4348 3323 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_18450 5262 4345 gene locus_tag LOCUS_18460 5262 4345 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080622.1 protein_id gnl|my_center|LOCUS_18460 5983 5267 gene locus_tag LOCUS_18470 5983 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 7106 6006 gene locus_tag LOCUS_18480 gene queA 7106 6006 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_18480 10348 7163 gene locus_tag LOCUS_18490 gene ileS 10348 7163 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_18490 12188 10368 gene locus_tag LOCUS_18500 12188 10368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 12462 12181 gene locus_tag LOCUS_18510 gene yidD 12462 12181 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962760.1 protein_id gnl|my_center|LOCUS_18510 12764 12426 gene locus_tag LOCUS_18520 12764 12426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence065 2489 114 gene locus_tag LOCUS_18530 2489 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 2956 2486 gene locus_tag LOCUS_18540 2956 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 3721 3050 gene locus_tag LOCUS_18550 3721 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4183 3797 gene locus_tag LOCUS_18560 4183 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 4865 4188 gene locus_tag LOCUS_18570 4865 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 6274 4865 gene locus_tag LOCUS_18580 6274 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6453 6274 gene locus_tag LOCUS_18590 6453 6274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 7587 6454 gene locus_tag LOCUS_18600 7587 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 7756 7577 gene locus_tag LOCUS_18610 7756 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 9992 7836 gene locus_tag LOCUS_18620 9992 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 11016 10006 gene locus_tag LOCUS_18630 11016 10006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 11335 11075 gene locus_tag LOCUS_18640 11335 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 12109 11339 gene locus_tag LOCUS_18650 12109 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 12405 12172 gene locus_tag LOCUS_18660 12405 12172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence066 1572 178 gene locus_tag LOCUS_18670 1572 178 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269382.1 protein_id gnl|my_center|LOCUS_18670 2369 1602 gene locus_tag LOCUS_18680 gene hisF 2369 1602 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_18680 2548 2623 gene locus_tag LOCUS_t00340 2548 2623 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3451 2690 gene locus_tag LOCUS_18690 3451 2690 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_18690 4716 3451 gene locus_tag LOCUS_18700 4716 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 5406 4738 gene locus_tag LOCUS_18710 5406 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 5879 5403 gene locus_tag LOCUS_18720 5879 5403 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_18720 6694 5876 gene locus_tag LOCUS_18730 6694 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 7497 6700 gene locus_tag LOCUS_18740 gene rlmB 7497 6700 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_18740 8736 7501 gene locus_tag LOCUS_18750 gene rhaA 8736 7501 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_18750 9784 8762 gene locus_tag LOCUS_18760 gene rhaT 9784 8762 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_18760 11790 10030 gene locus_tag LOCUS_18770 11790 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence067 305 2086 gene locus_tag LOCUS_18780 305 2086 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_18780 2086 3129 gene locus_tag LOCUS_18790 2086 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 3280 3960 gene locus_tag LOCUS_18800 3280 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3987 5459 gene locus_tag LOCUS_18810 3987 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 5469 7346 gene locus_tag LOCUS_18820 5469 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 7386 10208 gene locus_tag LOCUS_18830 7386 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 10390 11166 gene locus_tag LOCUS_18840 10390 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence068 205 2781 gene locus_tag LOCUS_18850 205 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2797 3387 gene locus_tag LOCUS_18860 2797 3387 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986919.1 protein_id gnl|my_center|LOCUS_18860 4500 3415 gene locus_tag LOCUS_18870 gene pyrC 4500 3415 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108367.1 protein_id gnl|my_center|LOCUS_18870 6582 4516 gene locus_tag LOCUS_18880 6582 4516 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_18880 7197 6598 gene locus_tag LOCUS_18890 7197 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 9026 7410 gene locus_tag LOCUS_18900 9026 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 10351 9050 gene locus_tag LOCUS_18910 10351 9050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107160.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence069 335 1735 gene locus_tag LOCUS_18920 335 1735 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_18920 1741 2643 gene locus_tag LOCUS_18930 1741 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 2755 2839 gene locus_tag LOCUS_t00350 2755 2839 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2890 3492 gene locus_tag LOCUS_18940 gene thrH 2890 3492 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_18940 3494 4444 gene locus_tag LOCUS_18950 3494 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 4478 4403 gene locus_tag LOCUS_t00360 4478 4403 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4526 5572 gene locus_tag LOCUS_18960 gene mnmA 4526 5572 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_18960 5618 6475 gene locus_tag LOCUS_18970 5618 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6499 7140 gene locus_tag LOCUS_18980 gene eda 6499 7140 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028260.1 protein_id gnl|my_center|LOCUS_18980 7162 8928 gene locus_tag LOCUS_18990 7162 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 8978 10321 gene locus_tag LOCUS_19000 8978 10321 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584098.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence070 544 293 gene locus_tag LOCUS_19010 gene acpP 544 293 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_19010 1391 627 gene locus_tag LOCUS_19020 gene fabG 1391 627 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_19020 2408 1458 gene locus_tag LOCUS_19030 2408 1458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_19030 4375 2420 gene locus_tag LOCUS_19040 4375 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 4714 4421 gene locus_tag LOCUS_19050 4714 4421 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092213181.1 protein_id gnl|my_center|LOCUS_19050 6528 4714 gene locus_tag LOCUS_19060 6528 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 7002 6637 gene locus_tag LOCUS_19070 gene rplL 7002 6637 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 protein_id gnl|my_center|LOCUS_19070 7613 7059 gene locus_tag LOCUS_19080 gene rplJ 7613 7059 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597181.1 protein_id gnl|my_center|LOCUS_19080 8324 7632 gene locus_tag LOCUS_19090 gene rplA 8324 7632 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989382.1 protein_id gnl|my_center|LOCUS_19090 8746 8321 gene locus_tag LOCUS_19100 gene rplK 8746 8321 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_19100 9429 8824 gene locus_tag LOCUS_19110 gene nusG 9429 8824 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225764.1 protein_id gnl|my_center|LOCUS_19110 9645 9451 gene locus_tag LOCUS_19120 gene secE 9645 9451 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_19120 9738 9665 gene locus_tag LOCUS_t00370 9738 9665 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 9907 9758 gene locus_tag LOCUS_19130 gene rpmG 9907 9758 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_19130 <10925 10017 gene locus_tag LOCUS_19140 <10925 10017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198356.1:elongation factor Tu >Feature sequence071 108 184 gene locus_tag LOCUS_t00380 108 184 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 215 291 gene locus_tag LOCUS_t00390 215 291 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 321 397 gene locus_tag LOCUS_t00400 321 397 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 489 562 gene locus_tag LOCUS_t00410 489 562 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 589 1149 gene locus_tag LOCUS_19150 589 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 1198 2619 gene locus_tag LOCUS_19160 gene rhaB 1198 2619 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924505.1 protein_id gnl|my_center|LOCUS_19160 2684 2759 gene locus_tag LOCUS_t00420 2684 2759 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2768 2844 gene locus_tag LOCUS_t00430 2768 2844 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2865 3596 gene locus_tag LOCUS_19170 2865 3596 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_19170 4021 4851 gene locus_tag LOCUS_19180 4021 4851 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_19180 4848 5672 gene locus_tag LOCUS_19190 gene panC 4848 5672 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_19190 5691 6995 gene locus_tag LOCUS_19200 5691 6995 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_19200 7007 9253 gene locus_tag LOCUS_19210 7007 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence072 265 3276 gene locus_tag LOCUS_19220 gene secA 265 3276 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_19220 3273 3941 gene locus_tag LOCUS_19230 gene ispD 3273 3941 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393964.1 protein_id gnl|my_center|LOCUS_19230 3943 4674 gene locus_tag LOCUS_19240 3943 4674 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_19240 4718 6916 gene locus_tag LOCUS_19250 4718 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 8808 6991 gene locus_tag LOCUS_19260 8808 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence073 263 2374 gene locus_tag LOCUS_19270 263 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2371 2646 gene locus_tag LOCUS_19280 2371 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2656 2844 gene locus_tag LOCUS_19290 2656 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2972 4525 gene locus_tag LOCUS_19300 2972 4525 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_19300 4563 5417 gene locus_tag LOCUS_19310 gene speE 4563 5417 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_19310 5512 6360 gene locus_tag LOCUS_19320 gene speB 5512 6360 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_19320 6396 7709 gene locus_tag LOCUS_19330 6396 7709 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_19330 7711 8844 gene locus_tag LOCUS_19340 gene nspC 7711 8844 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence074 1209 220 gene locus_tag LOCUS_19350 1209 220 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_19350 2062 1259 gene locus_tag LOCUS_19360 gene dapF 2062 1259 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_19360 4220 2082 gene locus_tag LOCUS_19370 4220 2082 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_19370 4894 4217 gene locus_tag LOCUS_19380 4894 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6644 4887 gene locus_tag LOCUS_19390 gene dxs 6644 4887 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942408.1 protein_id gnl|my_center|LOCUS_19390 8176 6641 gene locus_tag LOCUS_19400 8176 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence075 <1 673 gene locus_tag LOCUS_19410 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966512.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC 962 2455 gene locus_tag LOCUS_19420 962 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2474 4159 gene locus_tag LOCUS_19430 2474 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 4203 6503 gene locus_tag LOCUS_19440 4203 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 6522 7223 gene locus_tag LOCUS_19450 6522 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence076 475 1929 gene locus_tag LOCUS_19460 475 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 3931 1937 gene locus_tag LOCUS_19470 3931 1937 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_19470 5430 3988 gene locus_tag LOCUS_19480 5430 3988 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964015.1 protein_id gnl|my_center|LOCUS_19480 6855 5434 gene locus_tag LOCUS_19490 gene uxaB 6855 5434 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854646.1 protein_id gnl|my_center|LOCUS_19490 8062 6878 gene locus_tag LOCUS_19500 8062 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence077 1079 2788 gene locus_tag LOCUS_19510 1079 2788 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329982.1 protein_id gnl|my_center|LOCUS_19510 2809 3492 gene locus_tag LOCUS_19520 2809 3492 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_19520 5375 3555 gene locus_tag LOCUS_19530 5375 3555 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201936.1 protein_id gnl|my_center|LOCUS_19530 6250 5399 gene locus_tag LOCUS_19540 6250 5399 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583741.1 protein_id gnl|my_center|LOCUS_19540 7083 6253 gene locus_tag LOCUS_19550 gene accD 7083 6253 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_19550 7678 7115 gene locus_tag LOCUS_19560 7678 7115 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940325.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence078 1656 511 gene locus_tag LOCUS_19570 gene pgl 1656 511 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244689.1 protein_id gnl|my_center|LOCUS_19570 3028 1664 gene locus_tag LOCUS_19580 3028 1664 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_19580 3310 3038 gene locus_tag LOCUS_19590 3310 3038 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_19590 4536 3364 gene locus_tag LOCUS_19600 4536 3364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970271.1 protein_id gnl|my_center|LOCUS_19600 5160 4558 gene locus_tag LOCUS_19610 gene gmk 5160 4558 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222146.1 protein_id gnl|my_center|LOCUS_19610 6659 5307 gene locus_tag LOCUS_19620 6659 5307 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_19620 <7789 6815 gene locus_tag LOCUS_19630 <7789 6815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016159.1:ATP-binding protein >Feature sequence079 387 2966 gene locus_tag LOCUS_19640 387 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19640 2990 4363 gene locus_tag LOCUS_19650 2990 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19650 4388 5536 gene locus_tag LOCUS_19660 4388 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5635 5943 gene locus_tag LOCUS_19670 5635 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5943 7163 gene locus_tag LOCUS_19680 5943 7163 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence080 1792 2676 gene locus_tag LOCUS_19690 1792 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2733 5027 gene locus_tag LOCUS_19700 2733 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 5084 6418 gene locus_tag LOCUS_19710 5084 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence081 2876 807 gene locus_tag LOCUS_19720 2876 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 4296 2893 gene locus_tag LOCUS_19730 4296 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 5376 4300 gene locus_tag LOCUS_19740 5376 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6206 5367 gene locus_tag LOCUS_19750 6206 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 6811 6203 gene locus_tag LOCUS_19760 6811 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence082 504 2330 gene locus_tag LOCUS_19770 504 2330 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119344.1 protein_id gnl|my_center|LOCUS_19770 2395 2655 gene locus_tag LOCUS_19780 2395 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2894 3193 gene locus_tag LOCUS_19790 2894 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3227 4174 gene locus_tag LOCUS_19800 3227 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 4171 6219 gene locus_tag LOCUS_19810 4171 6219 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence083 <1 1073 gene locus_tag LOCUS_19820 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964971.1:glycogen/starch/alpha-glucan phosphorylase 1089 1421 gene locus_tag LOCUS_19830 1089 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1428 1646 gene locus_tag LOCUS_19840 1428 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1646 1918 gene locus_tag LOCUS_19850 1646 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1930 2493 gene locus_tag LOCUS_19860 1930 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2507 2749 gene locus_tag LOCUS_19870 2507 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2768 4066 gene locus_tag LOCUS_19880 2768 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4242 4961 gene locus_tag LOCUS_19890 4242 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence084 323 1192 gene locus_tag LOCUS_19900 gene hisG 323 1192 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_19900 1416 1766 gene locus_tag LOCUS_19910 1416 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1818 2174 gene locus_tag LOCUS_19920 1818 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2174 2920 gene locus_tag LOCUS_19930 2174 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2939 3652 gene locus_tag LOCUS_19940 2939 3652 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284384.1 protein_id gnl|my_center|LOCUS_19940 3664 6027 gene locus_tag LOCUS_19950 3664 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence085 5769 589 gene locus_tag LOCUS_19960 5769 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence086 974 228 gene locus_tag LOCUS_19970 974 228 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_19970 2516 978 gene locus_tag LOCUS_19980 2516 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3962 2559 gene locus_tag LOCUS_19990 3962 2559 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_19990 5066 3978 gene locus_tag LOCUS_20000 5066 3978 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_20000 5306 5133 gene locus_tag LOCUS_20010 5306 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence087 750 124 gene locus_tag LOCUS_20020 750 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1960 947 gene locus_tag LOCUS_20030 1960 947 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_20030 2969 1992 gene locus_tag LOCUS_20040 2969 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 5434 3128 gene locus_tag LOCUS_20050 gene feoB 5434 3128 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_20050 5676 5431 gene locus_tag LOCUS_20060 5676 5431 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722680.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence088 >Feature sequence089 <1 504 gene locus_tag LOCUS_20070 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203144.1:TIGR01777 family oxidoreductase 512 1540 gene locus_tag LOCUS_20080 512 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1616 2116 gene locus_tag LOCUS_20090 1616 2116 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657895.1 protein_id gnl|my_center|LOCUS_20090 2166 2744 gene locus_tag LOCUS_20100 2166 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2759 3586 gene locus_tag LOCUS_20110 2759 3586 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080828.1 protein_id gnl|my_center|LOCUS_20110 3647 4489 gene locus_tag LOCUS_20120 3647 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence090 >Feature sequence091 278 1489 gene locus_tag LOCUS_20130 278 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 1486 2391 gene locus_tag LOCUS_20140 1486 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2404 4173 gene locus_tag LOCUS_20150 2404 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4157 4828 gene locus_tag LOCUS_20160 4157 4828 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038720.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence092 2327 4717 gene locus_tag LOCUS_20170 2327 4717 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence093 <1 1930 gene locus_tag LOCUS_20180 <1 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123580.1:carbamoyl-phosphate synthase large subunit 2110 3597 gene locus_tag LOCUS_20190 2110 3597 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_20190 3597 4187 gene locus_tag LOCUS_20200 gene hisH 3597 4187 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207858.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence094 504 881 gene locus_tag LOCUS_20210 504 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 971 4693 gene locus_tag LOCUS_20220 971 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence095 568 1551 gene locus_tag LOCUS_20230 gene pqqE 568 1551 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269165.1 protein_id gnl|my_center|LOCUS_20230 2551 3375 gene locus_tag LOCUS_20240 2551 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence096 1132 233 gene locus_tag LOCUS_20250 gene xerD 1132 233 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_20250 1947 1129 gene locus_tag LOCUS_20260 1947 1129 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_20260 3328 1961 gene locus_tag LOCUS_20270 3328 1961 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence097 <1 1585 gene locus_tag LOCUS_20280 <1 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:Ig-like domain-containing protein 1601 3583 gene locus_tag LOCUS_20290 1601 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence098 524 808 gene locus_tag LOCUS_20300 524 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 805 933 gene locus_tag LOCUS_20310 805 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1146 1412 gene locus_tag LOCUS_20320 1146 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1409 1645 gene locus_tag LOCUS_20330 1409 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 1642 2178 gene locus_tag LOCUS_20340 1642 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2171 2338 gene locus_tag LOCUS_20350 2171 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3370 2381 gene locus_tag LOCUS_20360 3370 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence099 215 1378 gene locus_tag LOCUS_20370 215 1378 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_20370 1371 1937 gene locus_tag LOCUS_20380 1371 1937 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024831595.1 protein_id gnl|my_center|LOCUS_20380 1937 3148 gene locus_tag LOCUS_20390 1937 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 3145 3342 gene locus_tag LOCUS_20400 3145 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3339 3818 gene locus_tag LOCUS_20410 3339 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence100 108 1769 gene locus_tag LOCUS_20420 108 1769 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_20420 1753 2964 gene locus_tag LOCUS_20430 gene carA 1753 2964 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence101 133 456 gene locus_tag LOCUS_20440 133 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 1441 1920 gene locus_tag LOCUS_20450 1441 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1961 2290 gene locus_tag LOCUS_20460 1961 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 2382 2765 gene locus_tag LOCUS_20470 2382 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272744.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence102 >Feature sequence103 647 2089 gene locus_tag LOCUS_20480 647 2089 CDS product IS5-like element ISLca3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673997.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence104 500 628 gene locus_tag LOCUS_20490 500 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 658 2100 gene locus_tag LOCUS_20500 658 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence105 1840 1241 gene locus_tag LOCUS_20510 1840 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 >Feature sequence106 1409 162 gene locus_tag LOCUS_20520 1409 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence107 <1942 831 gene locus_tag LOCUS_20530 <1942 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763133.1:glutamate synthase subunit beta >Feature sequence108 <1836 474 gene locus_tag LOCUS_20540 <1836 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000561483.1:group II intron reverse transcriptase/maturase >Feature sequence109 956 417 gene locus_tag LOCUS_20550 gene pdxT 956 417 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_20550 1770 1072 gene locus_tag LOCUS_20560 gene pdxS 1770 1072 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053677.1 protein_id gnl|my_center|LOCUS_20560 >Feature sequence110 >Feature sequence111 >Feature sequence112 >Feature sequence113 >Feature sequence114 >Feature sequence115 >Feature sequence116