>Feature sequence001 423 1052 gene locus_tag LOCUS_00010 423 1052 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_00010 1049 1981 gene locus_tag LOCUS_00020 1049 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2141 3331 gene locus_tag LOCUS_00030 gene trpB 2141 3331 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_00030 3324 4979 gene locus_tag LOCUS_00040 3324 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5017 5106 gene locus_tag LOCUS_t00010 5017 5106 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6912 5263 gene locus_tag LOCUS_00050 6912 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964306.1 protein_id gnl|my_center|LOCUS_00050 8156 6936 gene locus_tag LOCUS_00060 8156 6936 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_00060 8386 8580 gene locus_tag LOCUS_00070 8386 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8573 9181 gene locus_tag LOCUS_00080 8573 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_00080 12154 9473 gene locus_tag LOCUS_00090 12154 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 13857 12538 gene locus_tag LOCUS_00100 13857 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14941 13886 gene locus_tag LOCUS_00110 14941 13886 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870969.1 protein_id gnl|my_center|LOCUS_00110 16530 14941 gene locus_tag LOCUS_00120 16530 14941 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545223.1 protein_id gnl|my_center|LOCUS_00120 17553 16549 gene locus_tag LOCUS_00130 gene hypE 17553 16549 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_00130 19066 17810 gene locus_tag LOCUS_00140 19066 17810 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123926043.1 protein_id gnl|my_center|LOCUS_00140 19289 19741 gene locus_tag LOCUS_00150 19289 19741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 19738 20727 gene locus_tag LOCUS_00160 gene holB 19738 20727 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_00160 20728 21837 gene locus_tag LOCUS_00170 20728 21837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21830 22678 gene locus_tag LOCUS_00180 gene rsmI 21830 22678 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989365.1 protein_id gnl|my_center|LOCUS_00180 22903 24435 gene locus_tag LOCUS_00190 gene metG 22903 24435 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_00190 24435 25211 gene locus_tag LOCUS_00200 24435 25211 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_00200 25375 26391 gene locus_tag LOCUS_00210 25375 26391 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120566.1 protein_id gnl|my_center|LOCUS_00210 26624 26388 gene locus_tag LOCUS_00220 26624 26388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27987 26749 gene locus_tag LOCUS_00230 27987 26749 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_00230 29342 28104 gene locus_tag LOCUS_00240 29342 28104 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_00240 29457 29942 gene locus_tag LOCUS_00250 29457 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00250 >Feature sequence002 948 586 gene locus_tag LOCUS_00260 948 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 1279 935 gene locus_tag LOCUS_00270 1279 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 1542 1351 gene locus_tag LOCUS_00280 1542 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 1819 1517 gene locus_tag LOCUS_00290 1819 1517 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_00290 2416 1823 gene locus_tag LOCUS_00300 2416 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 2622 2386 gene locus_tag LOCUS_00310 2622 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 2846 4087 gene locus_tag LOCUS_00320 2846 4087 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008363445.1 protein_id gnl|my_center|LOCUS_00320 4080 6317 gene locus_tag LOCUS_00330 4080 6317 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011167180.1 protein_id gnl|my_center|LOCUS_00330 6359 6565 gene locus_tag LOCUS_00340 6359 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 6959 7564 gene locus_tag LOCUS_00350 6959 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 7761 7997 gene locus_tag LOCUS_00360 7761 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 8127 9149 gene locus_tag LOCUS_00370 gene aroF 8127 9149 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363948.1 protein_id gnl|my_center|LOCUS_00370 11415 9142 gene locus_tag LOCUS_00380 11415 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 11644 14157 gene locus_tag LOCUS_00390 11644 14157 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_00390 14828 14454 gene locus_tag LOCUS_00400 14828 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 15156 16661 gene locus_tag LOCUS_00410 15156 16661 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_00410 16694 17152 gene locus_tag LOCUS_00420 16694 17152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 17145 17915 gene locus_tag LOCUS_00430 17145 17915 CDS product DUF1829 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213043995.1 protein_id gnl|my_center|LOCUS_00430 17969 19060 gene locus_tag LOCUS_00440 17969 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 19100 19969 gene locus_tag LOCUS_00450 19100 19969 CDS product sce7726 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459264.1 protein_id gnl|my_center|LOCUS_00450 19971 20888 gene locus_tag LOCUS_00460 19971 20888 CDS product sce7725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295913.1 protein_id gnl|my_center|LOCUS_00460 20891 21946 gene locus_tag LOCUS_00470 20891 21946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 21996 22211 gene locus_tag LOCUS_00480 21996 22211 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814889.1 protein_id gnl|my_center|LOCUS_00480 22208 22651 gene locus_tag LOCUS_00490 22208 22651 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_00490 22707 22979 gene locus_tag LOCUS_00500 22707 22979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 23035 23184 gene locus_tag LOCUS_00510 23035 23184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence003 2892 1678 gene locus_tag LOCUS_00520 gene acrA 2892 1678 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295324.1 protein_id gnl|my_center|LOCUS_00520 4465 2885 gene locus_tag LOCUS_00530 4465 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5989 4532 gene locus_tag LOCUS_00540 5989 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 8437 6002 gene locus_tag LOCUS_00550 8437 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 10296 8611 gene locus_tag LOCUS_00560 10296 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 10655 10320 gene locus_tag LOCUS_00570 10655 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 11503 10913 gene locus_tag LOCUS_00580 11503 10913 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787224.1 protein_id gnl|my_center|LOCUS_00580 12247 11573 gene locus_tag LOCUS_00590 12247 11573 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965814.1 protein_id gnl|my_center|LOCUS_00590 12662 12396 gene locus_tag LOCUS_00600 12662 12396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 14748 12676 gene locus_tag LOCUS_00610 gene glgX 14748 12676 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_00610 16420 14762 gene locus_tag LOCUS_00620 16420 14762 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869775.1 protein_id gnl|my_center|LOCUS_00620 18086 16644 gene locus_tag LOCUS_00630 18086 16644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 18511 18104 gene locus_tag LOCUS_00640 18511 18104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 18836 18516 gene locus_tag LOCUS_00650 18836 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 20742 18928 gene locus_tag LOCUS_00660 20742 18928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 21366 21965 gene locus_tag LOCUS_00670 21366 21965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 21949 22071 gene locus_tag LOCUS_00680 21949 22071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 22418 22278 gene locus_tag LOCUS_00690 22418 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 22671 22426 gene locus_tag LOCUS_00700 22671 22426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00700 23014 22787 gene locus_tag LOCUS_00710 23014 22787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 23150 22992 gene locus_tag LOCUS_00720 23150 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence004 1774 419 gene locus_tag LOCUS_00730 1774 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3057 1771 gene locus_tag LOCUS_00740 3057 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 3645 3088 gene locus_tag LOCUS_00750 gene rfbC 3645 3088 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_00750 4559 3642 gene locus_tag LOCUS_00760 4559 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5713 4568 gene locus_tag LOCUS_00770 5713 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 6721 5714 gene locus_tag LOCUS_00780 6721 5714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_00780 7725 6718 gene locus_tag LOCUS_00790 7725 6718 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432947.1 protein_id gnl|my_center|LOCUS_00790 9073 7739 gene locus_tag LOCUS_00800 9073 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 10667 9048 gene locus_tag LOCUS_00810 10667 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 11463 10690 gene locus_tag LOCUS_00820 gene rfbF 11463 10690 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_00820 12683 11466 gene locus_tag LOCUS_00830 12683 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 13647 12706 gene locus_tag LOCUS_00840 13647 12706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 14909 13701 gene locus_tag LOCUS_00850 14909 13701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 16160 14928 gene locus_tag LOCUS_00860 16160 14928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 18452 16206 gene locus_tag LOCUS_00870 18452 16206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 19357 18695 gene locus_tag LOCUS_00880 19357 18695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 19610 19434 gene locus_tag LOCUS_00890 19610 19434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 <20703 19711 gene locus_tag LOCUS_00900 <20703 19711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965293.1:GTP 3',8-cyclase MoaA >Feature sequence005 3280 1871 gene locus_tag LOCUS_00910 3280 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 4624 3296 gene locus_tag LOCUS_00920 4624 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 5450 4650 gene locus_tag LOCUS_00930 gene scpB 5450 4650 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069498.1 protein_id gnl|my_center|LOCUS_00930 9248 5553 gene locus_tag LOCUS_00940 9248 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9604 9431 gene locus_tag LOCUS_00950 9604 9431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9855 9601 gene locus_tag LOCUS_00960 9855 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 11208 9952 gene locus_tag LOCUS_00970 11208 9952 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_00970 11821 11279 gene locus_tag LOCUS_00980 11821 11279 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965733.1 protein_id gnl|my_center|LOCUS_00980 12508 11963 gene locus_tag LOCUS_00990 12508 11963 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_00990 12818 12588 gene locus_tag LOCUS_01000 12818 12588 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_01000 13759 12812 gene locus_tag LOCUS_01010 gene trxB 13759 12812 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964187.1 protein_id gnl|my_center|LOCUS_01010 14521 13874 gene locus_tag LOCUS_01020 14521 13874 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_01020 14697 14521 gene locus_tag LOCUS_01030 14697 14521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 15082 14735 gene locus_tag LOCUS_01040 15082 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213024.1 protein_id gnl|my_center|LOCUS_01040 16109 15102 gene locus_tag LOCUS_01050 16109 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 16497 16168 gene locus_tag LOCUS_01060 16497 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 17162 16614 gene locus_tag LOCUS_01070 17162 16614 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946902.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence006 946 320 gene locus_tag LOCUS_01080 946 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1762 1211 gene locus_tag LOCUS_01090 1762 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 2381 2049 gene locus_tag LOCUS_01100 gene rplQ 2381 2049 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393907.1 protein_id gnl|my_center|LOCUS_01100 3364 2399 gene locus_tag LOCUS_01110 3364 2399 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_01110 4010 3417 gene locus_tag LOCUS_01120 gene rpsD 4010 3417 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_01120 4420 4028 gene locus_tag LOCUS_01130 gene rpsK 4420 4028 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_01130 4822 4451 gene locus_tag LOCUS_01140 gene rpsM 4822 4451 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_01140 5331 5113 gene locus_tag LOCUS_01150 gene infA 5331 5113 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029884.1 protein_id gnl|my_center|LOCUS_01150 5984 5343 gene locus_tag LOCUS_01160 5984 5343 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_01160 7253 5997 gene locus_tag LOCUS_01170 gene secY 7253 5997 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_01170 7728 7255 gene locus_tag LOCUS_01180 gene rplO 7728 7255 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_01180 7912 7733 gene locus_tag LOCUS_01190 gene rpmD 7912 7733 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_01190 8428 7925 gene locus_tag LOCUS_01200 gene rpsE 8428 7925 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003328273.1 protein_id gnl|my_center|LOCUS_01200 8804 8445 gene locus_tag LOCUS_01210 gene rplR 8804 8445 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_01210 9380 8826 gene locus_tag LOCUS_01220 gene rplF 9380 8826 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_01220 9791 9393 gene locus_tag LOCUS_01230 gene rpsH 9791 9393 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371522.1 protein_id gnl|my_center|LOCUS_01230 10003 9818 gene locus_tag LOCUS_01240 10003 9818 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_01240 10558 10019 gene locus_tag LOCUS_01250 gene rplE 10558 10019 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_01250 10911 10579 gene locus_tag LOCUS_01260 gene rplX 10911 10579 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356212.1 protein_id gnl|my_center|LOCUS_01260 11295 10927 gene locus_tag LOCUS_01270 gene rplN 11295 10927 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_01270 11565 11308 gene locus_tag LOCUS_01280 gene rpsQ 11565 11308 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_01280 11795 11604 gene locus_tag LOCUS_01290 gene rpmC 11795 11604 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_01290 12222 11782 gene locus_tag LOCUS_01300 gene rplP 12222 11782 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_01300 12896 12222 gene locus_tag LOCUS_01310 gene rpsC 12896 12222 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_01310 13243 12911 gene locus_tag LOCUS_01320 gene rplV 13243 12911 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_01320 13537 13256 gene locus_tag LOCUS_01330 gene rpsS 13537 13256 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_01330 14383 13556 gene locus_tag LOCUS_01340 gene rplB 14383 13556 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_01340 14677 14396 gene locus_tag LOCUS_01350 14677 14396 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810158.1 protein_id gnl|my_center|LOCUS_01350 15300 14677 gene locus_tag LOCUS_01360 gene rplD 15300 14677 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_01360 15963 15319 gene locus_tag LOCUS_01370 gene rplC 15963 15319 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_01370 16293 15982 gene locus_tag LOCUS_01380 gene rpsJ 16293 15982 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_01380 <17260 16606 gene locus_tag LOCUS_01390 <17260 16606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393939.1:elongation factor Tu >Feature sequence007 470 213 gene locus_tag LOCUS_01400 470 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 1633 491 gene locus_tag LOCUS_01410 gene hemW 1633 491 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964591.1 protein_id gnl|my_center|LOCUS_01410 3429 1630 gene locus_tag LOCUS_01420 gene lepA 3429 1630 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_01420 5293 3566 gene locus_tag LOCUS_01430 5293 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6429 5605 gene locus_tag LOCUS_01440 6429 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 7308 6628 gene locus_tag LOCUS_01450 7308 6628 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651524.1 protein_id gnl|my_center|LOCUS_01450 7895 7473 gene locus_tag LOCUS_01460 7895 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8029 8688 gene locus_tag LOCUS_01470 gene bioD 8029 8688 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_01470 9170 9084 gene locus_tag LOCUS_t00020 9170 9084 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10484 9303 gene locus_tag LOCUS_01480 10484 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11872 10607 gene locus_tag LOCUS_01490 11872 10607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 13182 11908 gene locus_tag LOCUS_01500 13182 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 13737 13979 gene locus_tag LOCUS_01510 13737 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 13979 14395 gene locus_tag LOCUS_01520 13979 14395 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_01520 14670 15740 gene locus_tag LOCUS_01530 14670 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 15831 16889 gene locus_tag LOCUS_01540 15831 16889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 16907 17134 gene locus_tag LOCUS_01550 16907 17134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence008 694 395 gene locus_tag LOCUS_01560 694 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 1137 796 gene locus_tag LOCUS_01570 1137 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3189 1513 gene locus_tag LOCUS_01580 3189 1513 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_01580 3992 4138 gene locus_tag LOCUS_01590 3992 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 4307 5626 gene locus_tag LOCUS_01600 4307 5626 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890592.1 protein_id gnl|my_center|LOCUS_01600 5623 6159 gene locus_tag LOCUS_01610 5623 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9241 6170 gene locus_tag LOCUS_01620 9241 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 9587 9264 gene locus_tag LOCUS_01630 9587 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 9864 9580 gene locus_tag LOCUS_01640 9864 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 10383 11726 gene locus_tag LOCUS_01650 10383 11726 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074061.1 protein_id gnl|my_center|LOCUS_01650 11825 11640 gene locus_tag LOCUS_01660 11825 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 12013 12504 gene locus_tag LOCUS_01670 12013 12504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 12692 12922 gene locus_tag LOCUS_01680 12692 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 14401 12923 gene locus_tag LOCUS_01690 gene panF 14401 12923 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_01690 14649 14398 gene locus_tag LOCUS_01700 14649 14398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 15934 14852 gene locus_tag LOCUS_01710 15934 14852 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261742.1 protein_id gnl|my_center|LOCUS_01710 16274 16411 gene locus_tag LOCUS_01720 16274 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence009 <1 1536 gene locus_tag LOCUS_01730 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039328.1:SpoIIE family protein phosphatase 1617 2258 gene locus_tag LOCUS_01740 gene ccmA 1617 2258 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_01740 2215 2895 gene locus_tag LOCUS_01750 2215 2895 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956994.1 protein_id gnl|my_center|LOCUS_01750 5100 3058 gene locus_tag LOCUS_01760 5100 3058 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_01760 6033 5116 gene locus_tag LOCUS_01770 6033 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6522 7178 gene locus_tag LOCUS_01780 6522 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7198 7683 gene locus_tag LOCUS_01790 7198 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7676 8995 gene locus_tag LOCUS_01800 7676 8995 CDS product ammonia-forming cytochrome c nitrite reductase subunit c552 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937928.1 protein_id gnl|my_center|LOCUS_01800 9197 9469 gene locus_tag LOCUS_01810 9197 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 9823 12300 gene locus_tag LOCUS_01820 gene leuS 9823 12300 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_01820 12303 13022 gene locus_tag LOCUS_01830 12303 13022 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_01830 13019 13327 gene locus_tag LOCUS_01840 13019 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 13337 14260 gene locus_tag LOCUS_01850 13337 14260 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814023.1 protein_id gnl|my_center|LOCUS_01850 14511 16148 gene locus_tag LOCUS_01860 14511 16148 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence010 212 631 gene locus_tag LOCUS_01870 212 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 637 1236 gene locus_tag LOCUS_01880 637 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1341 1718 gene locus_tag LOCUS_01890 1341 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 1746 2783 gene locus_tag LOCUS_01900 1746 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 2770 3396 gene locus_tag LOCUS_01910 2770 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 3453 4166 gene locus_tag LOCUS_01920 3453 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4367 4978 gene locus_tag LOCUS_01930 4367 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4992 5519 gene locus_tag LOCUS_01940 4992 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5516 6577 gene locus_tag LOCUS_01950 5516 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6732 7019 gene locus_tag LOCUS_01960 6732 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 7034 8536 gene locus_tag LOCUS_01970 7034 8536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8533 9036 gene locus_tag LOCUS_01980 8533 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 9047 9727 gene locus_tag LOCUS_01990 9047 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 9741 11228 gene locus_tag LOCUS_02000 9741 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11228 12838 gene locus_tag LOCUS_02010 gene pilB 11228 12838 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479695.1 protein_id gnl|my_center|LOCUS_02010 12855 13916 gene locus_tag LOCUS_02020 12855 13916 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_02020 13918 14322 gene locus_tag LOCUS_02030 13918 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 14334 14810 gene locus_tag LOCUS_02040 14334 14810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 14876 15589 gene locus_tag LOCUS_02050 14876 15589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence011 509 138 gene locus_tag LOCUS_02060 509 138 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964329.1 protein_id gnl|my_center|LOCUS_02060 989 525 gene locus_tag LOCUS_02070 989 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 1516 1232 gene locus_tag LOCUS_02080 1516 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 1874 1503 gene locus_tag LOCUS_02090 1874 1503 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_02090 4461 1888 gene locus_tag LOCUS_02100 gene secA 4461 1888 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_02100 5253 4717 gene locus_tag LOCUS_02110 gene raiA 5253 4717 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_02110 6448 5399 gene locus_tag LOCUS_02120 6448 5399 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545887.1 protein_id gnl|my_center|LOCUS_02120 6728 8830 gene locus_tag LOCUS_02130 6728 8830 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_02130 8982 10376 gene locus_tag LOCUS_02140 8982 10376 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_02140 11180 12229 gene locus_tag LOCUS_02150 gene mexJ 11180 12229 CDS product multidrug efflux RND transporter periplasmic adaptor subunit MexJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113855.1 protein_id gnl|my_center|LOCUS_02150 12226 15255 gene locus_tag LOCUS_02160 12226 15255 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024698545.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence012 54 815 gene locus_tag LOCUS_02170 54 815 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102108.1 protein_id gnl|my_center|LOCUS_02170 859 1539 gene locus_tag LOCUS_02180 859 1539 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401597.1 protein_id gnl|my_center|LOCUS_02180 1540 2202 gene locus_tag LOCUS_02190 1540 2202 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356718.1 protein_id gnl|my_center|LOCUS_02190 2314 2808 gene locus_tag LOCUS_02200 2314 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2824 3213 gene locus_tag LOCUS_02210 2824 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 3295 4734 gene locus_tag LOCUS_02220 3295 4734 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356603.1 protein_id gnl|my_center|LOCUS_02220 4715 5548 gene locus_tag LOCUS_02230 4715 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 5609 5682 gene locus_tag LOCUS_t00030 5609 5682 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5685 5773 gene locus_tag LOCUS_t00040 5685 5773 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5782 5865 gene locus_tag LOCUS_t00050 5782 5865 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5872 5957 gene locus_tag LOCUS_t00060 5872 5957 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5992 6077 gene locus_tag LOCUS_t00070 5992 6077 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7479 6214 gene locus_tag LOCUS_02240 gene murA 7479 6214 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_02240 9448 7481 gene locus_tag LOCUS_02250 9448 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 11067 9646 gene locus_tag LOCUS_02260 11067 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11184 11930 gene locus_tag LOCUS_02270 11184 11930 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529927.1 protein_id gnl|my_center|LOCUS_02270 12042 13376 gene locus_tag LOCUS_02280 12042 13376 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_02280 14799 13492 gene locus_tag LOCUS_02290 gene thiC 14799 13492 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_02290 15658 15023 gene locus_tag LOCUS_02300 15658 15023 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476619.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence013 1151 96 gene locus_tag LOCUS_02310 gene waaC 1151 96 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_02310 1311 3014 gene locus_tag LOCUS_02320 1311 3014 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461506.1 protein_id gnl|my_center|LOCUS_02320 3199 4389 gene locus_tag LOCUS_02330 3199 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4430 4891 gene locus_tag LOCUS_02340 4430 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4911 5321 gene locus_tag LOCUS_02350 4911 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5390 6379 gene locus_tag LOCUS_02360 5390 6379 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389640.1 protein_id gnl|my_center|LOCUS_02360 6380 7696 gene locus_tag LOCUS_02370 6380 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7669 7971 gene locus_tag LOCUS_02380 7669 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 7975 8715 gene locus_tag LOCUS_02390 7975 8715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8722 9219 gene locus_tag LOCUS_02400 8722 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 9411 10187 gene locus_tag LOCUS_02410 gene ftsZ 9411 10187 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_02410 11144 10581 gene locus_tag LOCUS_02420 11144 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 11268 11597 gene locus_tag LOCUS_02430 11268 11597 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420359.1 protein_id gnl|my_center|LOCUS_02430 11590 12696 gene locus_tag LOCUS_02440 11590 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 13077 12733 gene locus_tag LOCUS_02450 13077 12733 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435954.1 protein_id gnl|my_center|LOCUS_02450 13212 13652 gene locus_tag LOCUS_02460 13212 13652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 13663 14556 gene locus_tag LOCUS_02470 13663 14556 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101364.1 protein_id gnl|my_center|LOCUS_02470 14562 14933 gene locus_tag LOCUS_02480 14562 14933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101365.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence014 1078 494 gene locus_tag LOCUS_02490 1078 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1709 1068 gene locus_tag LOCUS_02500 1709 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3313 1652 gene locus_tag LOCUS_02510 3313 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4202 3432 gene locus_tag LOCUS_02520 4202 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5649 4585 gene locus_tag LOCUS_02530 5649 4585 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002789842.1 protein_id gnl|my_center|LOCUS_02530 5875 5639 gene locus_tag LOCUS_02540 5875 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6128 5895 gene locus_tag LOCUS_02550 6128 5895 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_02550 6287 7138 gene locus_tag LOCUS_02560 6287 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8843 7212 gene locus_tag LOCUS_02570 8843 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 10339 9005 gene locus_tag LOCUS_02580 10339 9005 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259605.1 protein_id gnl|my_center|LOCUS_02580 11048 10341 gene locus_tag LOCUS_02590 11048 10341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_02590 11340 11050 gene locus_tag LOCUS_02600 11340 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 12162 11362 gene locus_tag LOCUS_02610 12162 11362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 14074 12548 gene locus_tag LOCUS_02620 14074 12548 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_02620 <15251 14089 gene locus_tag LOCUS_02630 <15251 14089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858032.1:AMP-binding protein >Feature sequence015 1277 2557 gene locus_tag LOCUS_02640 1277 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2582 3520 gene locus_tag LOCUS_02650 2582 3520 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_02650 3546 4850 gene locus_tag LOCUS_02660 3546 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4889 6157 gene locus_tag LOCUS_02670 4889 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6173 6565 gene locus_tag LOCUS_02680 6173 6565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 6606 7067 gene locus_tag LOCUS_02690 6606 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 7064 8269 gene locus_tag LOCUS_02700 7064 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 9187 8354 gene locus_tag LOCUS_02710 9187 8354 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679949.1 protein_id gnl|my_center|LOCUS_02710 9270 9656 gene locus_tag LOCUS_02720 9270 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9617 10417 gene locus_tag LOCUS_02730 9617 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 10435 11853 gene locus_tag LOCUS_02740 10435 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence016 284 463 gene locus_tag LOCUS_02750 284 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 480 860 gene locus_tag LOCUS_02760 480 860 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_02760 875 1885 gene locus_tag LOCUS_02770 875 1885 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_02770 5290 1946 gene locus_tag LOCUS_02780 5290 1946 CDS product bifunctional glycogen debranching protein GlgX/4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460009.1 protein_id gnl|my_center|LOCUS_02780 5748 5287 gene locus_tag LOCUS_02790 5748 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5978 5745 gene locus_tag LOCUS_02800 5978 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 8023 6104 gene locus_tag LOCUS_02810 8023 6104 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_02810 9133 8189 gene locus_tag LOCUS_02820 9133 8189 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_02820 9412 9537 gene locus_tag LOCUS_02830 9412 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 9559 9897 gene locus_tag LOCUS_02840 gene cutA 9559 9897 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160791.1 protein_id gnl|my_center|LOCUS_02840 10144 10455 gene locus_tag LOCUS_02850 10144 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 10448 10879 gene locus_tag LOCUS_02860 10448 10879 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903015.1 protein_id gnl|my_center|LOCUS_02860 10872 11234 gene locus_tag LOCUS_02870 10872 11234 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_02870 11277 11903 gene locus_tag LOCUS_02880 11277 11903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12422 12012 gene locus_tag LOCUS_02890 12422 12012 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_02890 12622 12443 gene locus_tag LOCUS_02900 12622 12443 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389492.1 protein_id gnl|my_center|LOCUS_02900 13490 12738 gene locus_tag LOCUS_02910 gene sdhB 13490 12738 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229569.1 protein_id gnl|my_center|LOCUS_02910 14318 13506 gene locus_tag LOCUS_02920 14318 13506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence017 82 984 gene locus_tag LOCUS_02930 82 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 1115 1693 gene locus_tag LOCUS_02940 1115 1693 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_02940 1718 2128 gene locus_tag LOCUS_02950 1718 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2460 2200 gene locus_tag LOCUS_02960 2460 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2948 2463 gene locus_tag LOCUS_02970 2948 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 3196 3804 gene locus_tag LOCUS_02980 3196 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3885 8681 gene locus_tag LOCUS_02990 3885 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8835 9821 gene locus_tag LOCUS_03000 gene xerC 8835 9821 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015601.1 protein_id gnl|my_center|LOCUS_03000 9942 10910 gene locus_tag LOCUS_03010 9942 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 11023 11958 gene locus_tag LOCUS_03020 gene metA 11023 11958 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_03020 11961 12587 gene locus_tag LOCUS_03030 11961 12587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12577 13623 gene locus_tag LOCUS_03040 gene hydE 12577 13623 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence018 434 15 gene locus_tag LOCUS_03050 434 15 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723740.1 protein_id gnl|my_center|LOCUS_03050 749 459 gene locus_tag LOCUS_03060 749 459 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359350.1 protein_id gnl|my_center|LOCUS_03060 1220 765 gene locus_tag LOCUS_03070 1220 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2465 1347 gene locus_tag LOCUS_03080 2465 1347 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_03080 3199 2462 gene locus_tag LOCUS_03090 3199 2462 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_03090 4655 3351 gene locus_tag LOCUS_03100 4655 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 7719 4825 gene locus_tag LOCUS_03110 7719 4825 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_03110 7824 8270 gene locus_tag LOCUS_03120 7824 8270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 8272 9561 gene locus_tag LOCUS_03130 8272 9561 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568213.1 protein_id gnl|my_center|LOCUS_03130 9558 10655 gene locus_tag LOCUS_03140 9558 10655 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_03140 10645 13287 gene locus_tag LOCUS_03150 10645 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence019 198 1259 gene locus_tag LOCUS_03160 198 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1491 1252 gene locus_tag LOCUS_03170 1491 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 1415 2329 gene locus_tag LOCUS_03180 1415 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4465 2408 gene locus_tag LOCUS_03190 gene fusA 4465 2408 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_03190 4671 4982 gene locus_tag LOCUS_03200 gene rplU 4671 4982 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_03200 4992 5300 gene locus_tag LOCUS_03210 4992 5300 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166742.1 protein_id gnl|my_center|LOCUS_03210 5399 5677 gene locus_tag LOCUS_03220 gene rpmA 5399 5677 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_03220 5732 5953 gene locus_tag LOCUS_03230 5732 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8242 6053 gene locus_tag LOCUS_03240 8242 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 8658 8239 gene locus_tag LOCUS_03250 8658 8239 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883308.1 protein_id gnl|my_center|LOCUS_03250 9168 8833 gene locus_tag LOCUS_03260 9168 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9872 9201 gene locus_tag LOCUS_03270 9872 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 10152 9781 gene locus_tag LOCUS_03280 10152 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 10544 10822 gene locus_tag LOCUS_03290 10544 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10825 11466 gene locus_tag LOCUS_03300 10825 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 11476 12135 gene locus_tag LOCUS_03310 11476 12135 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence020 165 374 gene locus_tag LOCUS_03320 165 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 443 826 gene locus_tag LOCUS_03330 443 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 834 1094 gene locus_tag LOCUS_03340 834 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1151 2185 gene locus_tag LOCUS_03350 1151 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2163 4604 gene locus_tag LOCUS_03360 gene trbE 2163 4604 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368411.1 protein_id gnl|my_center|LOCUS_03360 4628 7129 gene locus_tag LOCUS_03370 4628 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7141 7683 gene locus_tag LOCUS_03380 7141 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7698 8300 gene locus_tag LOCUS_03390 7698 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8328 8576 gene locus_tag LOCUS_03400 8328 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 8616 10220 gene locus_tag LOCUS_03410 8616 10220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 10332 12113 gene locus_tag LOCUS_03420 10332 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence021 146 475 gene locus_tag LOCUS_03430 146 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 580 1572 gene locus_tag LOCUS_03440 gene nirJ2 580 1572 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_03440 1578 2381 gene locus_tag LOCUS_03450 1578 2381 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_03450 2385 3233 gene locus_tag LOCUS_03460 2385 3233 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_03460 3337 4302 gene locus_tag LOCUS_03470 3337 4302 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067432.1 protein_id gnl|my_center|LOCUS_03470 4322 5284 gene locus_tag LOCUS_03480 4322 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5281 6465 gene locus_tag LOCUS_03490 5281 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 6546 7295 gene locus_tag LOCUS_03500 6546 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 7382 7984 gene locus_tag LOCUS_03510 7382 7984 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 protein_id gnl|my_center|LOCUS_03510 8266 8493 gene locus_tag LOCUS_03520 8266 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8530 9558 gene locus_tag LOCUS_03530 8530 9558 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_03530 9616 10530 gene locus_tag LOCUS_03540 9616 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 10436 12235 gene locus_tag LOCUS_03550 10436 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence022 570 1919 gene locus_tag LOCUS_03560 gene glmM 570 1919 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461863.1 protein_id gnl|my_center|LOCUS_03560 2485 2003 gene locus_tag LOCUS_03570 gene ybaK 2485 2003 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815307.1 protein_id gnl|my_center|LOCUS_03570 3805 2648 gene locus_tag LOCUS_03580 3805 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4531 3998 gene locus_tag LOCUS_03590 4531 3998 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289378.1 protein_id gnl|my_center|LOCUS_03590 4857 4531 gene locus_tag LOCUS_03600 gene eetA 4857 4531 CDS product flavin-based extracellular electron transfer system protein EetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733042.1 protein_id gnl|my_center|LOCUS_03600 6098 4863 gene locus_tag LOCUS_03610 6098 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6529 6101 gene locus_tag LOCUS_03620 6529 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6743 6516 gene locus_tag LOCUS_03630 6743 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6970 8004 gene locus_tag LOCUS_03640 gene hypD 6970 8004 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_03640 10903 8009 gene locus_tag LOCUS_03650 10903 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11106 11330 gene locus_tag LOCUS_03660 11106 11330 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence023 1548 1087 gene locus_tag LOCUS_03670 gene rfaE2 1548 1087 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_03670 2540 1545 gene locus_tag LOCUS_03680 gene rfaE1 2540 1545 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_03680 4101 2545 gene locus_tag LOCUS_03690 4101 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 5138 4218 gene locus_tag LOCUS_03700 5138 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869991.1 protein_id gnl|my_center|LOCUS_03700 6086 5205 gene locus_tag LOCUS_03710 6086 5205 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964409.1 protein_id gnl|my_center|LOCUS_03710 6472 6083 gene locus_tag LOCUS_03720 6472 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7641 6643 gene locus_tag LOCUS_03730 gene hypE 7641 6643 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_03730 8956 7877 gene locus_tag LOCUS_03740 gene hypD 8956 7877 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_03740 9510 9274 gene locus_tag LOCUS_03750 9510 9274 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810715.1 protein_id gnl|my_center|LOCUS_03750 9781 10974 gene locus_tag LOCUS_03760 gene sucC 9781 10974 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020801.1 protein_id gnl|my_center|LOCUS_03760 10995 11918 gene locus_tag LOCUS_03770 gene sucD 10995 11918 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence024 2140 1679 gene locus_tag LOCUS_03780 gene nrdR 2140 1679 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_03780 4037 2226 gene locus_tag LOCUS_03790 4037 2226 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_03790 4934 4098 gene locus_tag LOCUS_03800 4934 4098 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392587.1 protein_id gnl|my_center|LOCUS_03800 6003 5008 gene locus_tag LOCUS_03810 gene rfbB 6003 5008 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_03810 6191 6000 gene locus_tag LOCUS_03820 6191 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 7265 6264 gene locus_tag LOCUS_03830 7265 6264 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393843.1 protein_id gnl|my_center|LOCUS_03830 7565 8389 gene locus_tag LOCUS_03840 7565 8389 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_03840 8412 9239 gene locus_tag LOCUS_03850 8412 9239 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_03850 9399 10640 gene locus_tag LOCUS_03860 9399 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 10645 10776 gene locus_tag LOCUS_03870 10645 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 10887 11054 gene locus_tag LOCUS_03880 10887 11054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence025 3440 1998 gene locus_tag LOCUS_03890 gene gatB 3440 1998 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_03890 4900 3440 gene locus_tag LOCUS_03900 gene gatA 4900 3440 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_03900 5182 4913 gene locus_tag LOCUS_03910 gene gatC 5182 4913 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_03910 5875 5501 gene locus_tag LOCUS_03920 5875 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6367 6035 gene locus_tag LOCUS_03930 6367 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7461 6481 gene locus_tag LOCUS_03940 7461 6481 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272791.1 protein_id gnl|my_center|LOCUS_03940 8300 7458 gene locus_tag LOCUS_03950 gene prmC 8300 7458 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_03950 8868 11006 gene locus_tag LOCUS_03960 8868 11006 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence026 100 1164 gene locus_tag LOCUS_03970 gene argC 100 1164 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965686.1 protein_id gnl|my_center|LOCUS_03970 1178 2389 gene locus_tag LOCUS_03980 gene argJ 1178 2389 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_03980 2409 3293 gene locus_tag LOCUS_03990 gene argB 2409 3293 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_03990 3306 4502 gene locus_tag LOCUS_04000 3306 4502 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_04000 4571 4822 gene locus_tag LOCUS_04010 4571 4822 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225903.1 protein_id gnl|my_center|LOCUS_04010 4819 5250 gene locus_tag LOCUS_04020 gene ruvX 4819 5250 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_04020 5256 5591 gene locus_tag LOCUS_04030 5256 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5649 6746 gene locus_tag LOCUS_04040 gene mltG 5649 6746 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_04040 6746 7966 gene locus_tag LOCUS_04050 6746 7966 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_04050 7963 8409 gene locus_tag LOCUS_04060 gene aroQ 7963 8409 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016972.1 protein_id gnl|my_center|LOCUS_04060 8402 9484 gene locus_tag LOCUS_04070 8402 9484 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 protein_id gnl|my_center|LOCUS_04070 9486 10043 gene locus_tag LOCUS_04080 gene efp 9486 10043 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_04080 10431 11525 gene locus_tag LOCUS_04090 10431 11525 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483085.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence027 1233 511 gene locus_tag LOCUS_04100 1233 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 2188 1235 gene locus_tag LOCUS_04110 gene queA 2188 1235 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261907.1 protein_id gnl|my_center|LOCUS_04110 2937 2392 gene locus_tag LOCUS_04120 gene cobU 2937 2392 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891982.1 protein_id gnl|my_center|LOCUS_04120 4302 2941 gene locus_tag LOCUS_04130 4302 2941 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_04130 4439 4278 gene locus_tag LOCUS_04140 4439 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4676 4473 gene locus_tag LOCUS_04150 4676 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4971 4666 gene locus_tag LOCUS_04160 4971 4666 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_04160 5640 5020 gene locus_tag LOCUS_04170 5640 5020 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812307.1 protein_id gnl|my_center|LOCUS_04170 6512 5739 gene locus_tag LOCUS_04180 gene cobK 6512 5739 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_04180 7261 6509 gene locus_tag LOCUS_04190 7261 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 8301 7243 gene locus_tag LOCUS_04200 gene cbiG 8301 7243 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437735.1 protein_id gnl|my_center|LOCUS_04200 9053 8298 gene locus_tag LOCUS_04210 gene cobM 9053 8298 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_04210 10582 9170 gene locus_tag LOCUS_04220 10582 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 11506 10634 gene locus_tag LOCUS_04230 11506 10634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence028 2886 331 gene locus_tag LOCUS_04240 2886 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4683 2908 gene locus_tag LOCUS_04250 4683 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5377 4913 gene locus_tag LOCUS_04260 5377 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 5872 5390 gene locus_tag LOCUS_04270 5872 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6163 5876 gene locus_tag LOCUS_04280 6163 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 6789 6358 gene locus_tag LOCUS_04290 6789 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6977 7156 gene locus_tag LOCUS_04300 6977 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7691 10192 gene locus_tag LOCUS_04310 7691 10192 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_04310 10435 10232 gene locus_tag LOCUS_04320 gene cspC 10435 10232 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_04320 10657 10442 gene locus_tag LOCUS_04330 10657 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 11414 10689 gene locus_tag LOCUS_04340 11414 10689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence029 79 555 gene locus_tag LOCUS_04350 79 555 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576052.1 protein_id gnl|my_center|LOCUS_04350 824 4603 gene locus_tag LOCUS_04360 824 4603 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272602.1 protein_id gnl|my_center|LOCUS_04360 4606 5946 gene locus_tag LOCUS_04370 4606 5946 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665388.1 protein_id gnl|my_center|LOCUS_04370 6081 6269 gene locus_tag LOCUS_04380 6081 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04380 6302 7135 gene locus_tag LOCUS_04390 6302 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 7222 9432 gene locus_tag LOCUS_04400 7222 9432 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810772.1 protein_id gnl|my_center|LOCUS_04400 9447 9905 gene locus_tag LOCUS_04410 9447 9905 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392661.1 protein_id gnl|my_center|LOCUS_04410 9892 11361 gene locus_tag LOCUS_04420 9892 11361 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048077.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence030 178 1296 gene locus_tag LOCUS_04430 178 1296 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_04430 1558 3990 gene locus_tag LOCUS_04440 1558 3990 CDS product cell division FtsA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214035.1 protein_id gnl|my_center|LOCUS_04440 3980 4171 gene locus_tag LOCUS_04450 3980 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 5167 4145 gene locus_tag LOCUS_04460 5167 4145 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_04460 5952 5263 gene locus_tag LOCUS_04470 5952 5263 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_04470 6375 7196 gene locus_tag LOCUS_04480 6375 7196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 7283 9703 gene locus_tag LOCUS_04490 gene priA 7283 9703 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_04490 10096 11175 gene locus_tag LOCUS_04500 10096 11175 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966912.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence031 714 133 gene locus_tag LOCUS_04510 714 133 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941551.1 protein_id gnl|my_center|LOCUS_04510 886 704 gene locus_tag LOCUS_04520 886 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1927 899 gene locus_tag LOCUS_04530 1927 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2696 1929 gene locus_tag LOCUS_04540 2696 1929 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_04540 3365 3225 gene locus_tag LOCUS_04550 3365 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3560 5110 gene locus_tag LOCUS_04560 3560 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5258 5641 gene locus_tag LOCUS_04570 5258 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 5957 5715 gene locus_tag LOCUS_04580 5957 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 6099 6542 gene locus_tag LOCUS_04590 6099 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6637 7041 gene locus_tag LOCUS_04600 6637 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence032 1125 373 gene locus_tag LOCUS_04610 1125 373 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_04610 2069 1167 gene locus_tag LOCUS_04620 2069 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2304 2122 gene locus_tag LOCUS_04630 2304 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3084 2326 gene locus_tag LOCUS_04640 3084 2326 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_04640 3307 3089 gene locus_tag LOCUS_04650 3307 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4470 3358 gene locus_tag LOCUS_04660 4470 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5554 4496 gene locus_tag LOCUS_04670 5554 4496 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_04670 6336 5566 gene locus_tag LOCUS_04680 6336 5566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_04680 6588 6370 gene locus_tag LOCUS_04690 6588 6370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 7207 6659 gene locus_tag LOCUS_04700 gene pseH 7207 6659 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265718.1 protein_id gnl|my_center|LOCUS_04700 8260 7232 gene locus_tag LOCUS_04710 gene pseI 8260 7232 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920708.1 protein_id gnl|my_center|LOCUS_04710 9342 8266 gene locus_tag LOCUS_04720 gene pseG 9342 8266 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_04720 9652 9377 gene locus_tag LOCUS_04730 9652 9377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04730 9871 9659 gene locus_tag LOCUS_04740 9871 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04740 <10950 9947 gene locus_tag LOCUS_04750 <10950 9947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730935.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence033 121 987 gene locus_tag LOCUS_04760 121 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1160 10129 gene locus_tag LOCUS_04770 1160 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 10247 10867 gene locus_tag LOCUS_04780 10247 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 >Feature sequence034 200 433 gene locus_tag LOCUS_04790 200 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 433 837 gene locus_tag LOCUS_04800 gene vapC 433 837 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_04800 857 1648 gene locus_tag LOCUS_04810 857 1648 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261879.1 protein_id gnl|my_center|LOCUS_04810 1996 2652 gene locus_tag LOCUS_04820 1996 2652 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_04820 2658 2864 gene locus_tag LOCUS_04830 2658 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2968 3498 gene locus_tag LOCUS_04840 gene rnmV 2968 3498 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437901.1 protein_id gnl|my_center|LOCUS_04840 3524 3841 gene locus_tag LOCUS_04850 3524 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3831 4022 gene locus_tag LOCUS_04860 3831 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3985 4263 gene locus_tag LOCUS_04870 3985 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4334 5188 gene locus_tag LOCUS_04880 gene rsmA 4334 5188 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966268.1 protein_id gnl|my_center|LOCUS_04880 5640 5185 gene locus_tag LOCUS_04890 5640 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6836 5640 gene locus_tag LOCUS_04900 gene recA 6836 5640 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_04900 7578 6829 gene locus_tag LOCUS_04910 gene rlmB 7578 6829 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_04910 8000 7629 gene locus_tag LOCUS_04920 8000 7629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 8107 8394 gene locus_tag LOCUS_04930 8107 8394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 9602 8514 gene locus_tag LOCUS_04940 gene serC 9602 8514 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233234.1 protein_id gnl|my_center|LOCUS_04940 10004 10537 gene locus_tag LOCUS_04950 gene ilvN 10004 10537 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence035 949 233 gene locus_tag LOCUS_04960 949 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1991 1080 gene locus_tag LOCUS_04970 1991 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3236 2007 gene locus_tag LOCUS_04980 3236 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 4483 3272 gene locus_tag LOCUS_04990 4483 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 5416 4769 gene locus_tag LOCUS_05000 5416 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 6393 5536 gene locus_tag LOCUS_05010 6393 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7188 6403 gene locus_tag LOCUS_05020 7188 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 7994 7188 gene locus_tag LOCUS_05030 7994 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 8789 7995 gene locus_tag LOCUS_05040 8789 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 9922 8810 gene locus_tag LOCUS_05050 9922 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence036 <1 907 gene locus_tag LOCUS_05060 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986728.1:biotin synthase BioB 1060 1713 gene locus_tag LOCUS_05070 gene trmB 1060 1713 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 protein_id gnl|my_center|LOCUS_05070 1981 3159 gene locus_tag LOCUS_05080 gene ftsW 1981 3159 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_05080 3171 3641 gene locus_tag LOCUS_05090 3171 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4816 3857 gene locus_tag LOCUS_05100 4816 3857 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928612.1 protein_id gnl|my_center|LOCUS_05100 6877 5018 gene locus_tag LOCUS_05110 6877 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 7245 8381 gene locus_tag LOCUS_05120 7245 8381 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157892.1 protein_id gnl|my_center|LOCUS_05120 8378 9391 gene locus_tag LOCUS_05130 8378 9391 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817462.1 protein_id gnl|my_center|LOCUS_05130 9388 10047 gene locus_tag LOCUS_05140 9388 10047 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467994.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence037 98 412 gene locus_tag LOCUS_05150 98 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 564 2216 gene locus_tag LOCUS_05160 564 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2276 2494 gene locus_tag LOCUS_05170 2276 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2491 3663 gene locus_tag LOCUS_05180 2491 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3824 4264 gene locus_tag LOCUS_05190 3824 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4227 4967 gene locus_tag LOCUS_05200 4227 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4973 5695 gene locus_tag LOCUS_05210 gene trbF 4973 5695 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533264.1 protein_id gnl|my_center|LOCUS_05210 5721 6869 gene locus_tag LOCUS_05220 5721 6869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6881 8290 gene locus_tag LOCUS_05230 6881 8290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence038 211 741 gene locus_tag LOCUS_05240 211 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 894 1862 gene locus_tag LOCUS_05250 894 1862 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532439.1 protein_id gnl|my_center|LOCUS_05250 2710 1982 gene locus_tag LOCUS_05260 2710 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4696 2807 gene locus_tag LOCUS_05270 4696 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 4936 5412 gene locus_tag LOCUS_05280 4936 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5405 5728 gene locus_tag LOCUS_05290 5405 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 6314 5997 gene locus_tag LOCUS_05300 6314 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6948 8261 gene locus_tag LOCUS_05310 6948 8261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 8723 8313 gene locus_tag LOCUS_05320 gene vapC 8723 8313 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770950.1 protein_id gnl|my_center|LOCUS_05320 8935 8735 gene locus_tag LOCUS_05330 8935 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence039 38 1624 gene locus_tag LOCUS_05340 38 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1608 2003 gene locus_tag LOCUS_05350 1608 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2278 2844 gene locus_tag LOCUS_05360 gene infC 2278 2844 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_05360 2822 3019 gene locus_tag LOCUS_05370 gene rpmI 2822 3019 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_05370 3035 3388 gene locus_tag LOCUS_05380 gene rplT 3035 3388 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_05380 3697 4485 gene locus_tag LOCUS_05390 3697 4485 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_05390 4504 5646 gene locus_tag LOCUS_05400 4504 5646 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_05400 5668 8037 gene locus_tag LOCUS_05410 5668 8037 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_05410 <9865 8103 gene locus_tag LOCUS_05420 <9865 8103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258561.1:Swt1 family HEPN domain-containing protein >Feature sequence040 2585 2145 gene locus_tag LOCUS_05430 gene rplI 2585 2145 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966977.1 protein_id gnl|my_center|LOCUS_05430 4709 2730 gene locus_tag LOCUS_05440 4709 2730 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_05440 5650 4727 gene locus_tag LOCUS_05450 5650 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 6724 7707 gene locus_tag LOCUS_05460 gene pseB 6724 7707 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_05460 7786 8052 gene locus_tag LOCUS_05470 7786 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 8066 9223 gene locus_tag LOCUS_05480 gene pseC 8066 9223 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence041 376 1554 gene locus_tag LOCUS_05490 376 1554 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764888.1 protein_id gnl|my_center|LOCUS_05490 1569 2687 gene locus_tag LOCUS_05500 1569 2687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_05500 3068 4870 gene locus_tag LOCUS_05510 gene dnaK 3068 4870 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_05510 4867 5976 gene locus_tag LOCUS_05520 4867 5976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6117 8309 gene locus_tag LOCUS_05530 6117 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 8460 8960 gene locus_tag LOCUS_05540 8460 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8980 9408 gene locus_tag LOCUS_05550 8980 9408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence042 <1 853 gene locus_tag LOCUS_05560 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390482.1:tetratricopeptide repeat protein 978 1970 gene locus_tag LOCUS_05570 gene fba 978 1970 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_05570 2380 2192 gene locus_tag LOCUS_05580 2380 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 3980 2535 gene locus_tag LOCUS_05590 3980 2535 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_05590 4217 4492 gene locus_tag LOCUS_05600 4217 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 4524 4958 gene locus_tag LOCUS_05610 4524 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5251 5550 gene locus_tag LOCUS_05620 5251 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 5688 6740 gene locus_tag LOCUS_05630 5688 6740 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_05630 6761 7924 gene locus_tag LOCUS_05640 gene wecB 6761 7924 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187374459.1 protein_id gnl|my_center|LOCUS_05640 7924 8142 gene locus_tag LOCUS_05650 7924 8142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 8208 8531 gene locus_tag LOCUS_05660 8208 8531 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence043 <1 900 gene locus_tag LOCUS_05670 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020424.1:DUF362 domain-containing protein 1370 1185 gene locus_tag LOCUS_05680 1370 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2519 1599 gene locus_tag LOCUS_05690 2519 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3194 2775 gene locus_tag LOCUS_05700 3194 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3490 3191 gene locus_tag LOCUS_05710 3490 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 4462 3674 gene locus_tag LOCUS_05720 gene truA 4462 3674 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430279.1 protein_id gnl|my_center|LOCUS_05720 5220 4684 gene locus_tag LOCUS_05730 5220 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 6000 5305 gene locus_tag LOCUS_05740 6000 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 7027 6092 gene locus_tag LOCUS_05750 gene whiA 7027 6092 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462177.1 protein_id gnl|my_center|LOCUS_05750 8340 7036 gene locus_tag LOCUS_05760 8340 7036 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_05760 9223 8342 gene locus_tag LOCUS_05770 gene rapZ 9223 8342 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_05770 9459 9223 gene locus_tag LOCUS_05780 9459 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence044 1017 2213 gene locus_tag LOCUS_05790 1017 2213 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642434.1 protein_id gnl|my_center|LOCUS_05790 2248 2997 gene locus_tag LOCUS_05800 2248 2997 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224329.1 protein_id gnl|my_center|LOCUS_05800 3018 6554 gene locus_tag LOCUS_05810 3018 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6722 7978 gene locus_tag LOCUS_05820 6722 7978 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_05820 8109 8594 gene locus_tag LOCUS_05830 gene queF 8109 8594 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_05830 8591 9412 gene locus_tag LOCUS_05840 8591 9412 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence045 975 799 gene locus_tag LOCUS_05850 975 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1904 969 gene locus_tag LOCUS_05860 1904 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2813 2034 gene locus_tag LOCUS_05870 2813 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2995 2798 gene locus_tag LOCUS_05880 2995 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3724 3155 gene locus_tag LOCUS_05890 3724 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3896 3729 gene locus_tag LOCUS_05900 3896 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4774 4118 gene locus_tag LOCUS_05910 4774 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5316 4771 gene locus_tag LOCUS_05920 5316 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5610 5449 gene locus_tag LOCUS_05930 5610 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6517 5696 gene locus_tag LOCUS_05940 6517 5696 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246628.1 protein_id gnl|my_center|LOCUS_05940 7024 6815 gene locus_tag LOCUS_05950 7024 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 8054 7248 gene locus_tag LOCUS_05960 8054 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 8896 8075 gene locus_tag LOCUS_05970 8896 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9191 8880 gene locus_tag LOCUS_05980 9191 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence046 2833 4020 gene locus_tag LOCUS_05990 2833 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4156 4299 gene locus_tag LOCUS_06000 4156 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4425 4628 gene locus_tag LOCUS_06010 4425 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5260 4940 gene locus_tag LOCUS_06020 5260 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 5382 5597 gene locus_tag LOCUS_06030 5382 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 5607 6599 gene locus_tag LOCUS_06040 5607 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 6580 7341 gene locus_tag LOCUS_06050 6580 7341 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_06050 7457 8485 gene locus_tag LOCUS_06060 7457 8485 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 protein_id gnl|my_center|LOCUS_06060 8826 9146 gene locus_tag LOCUS_06070 8826 9146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence047 117 767 gene locus_tag LOCUS_06080 117 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 841 916 gene locus_tag LOCUS_t00080 841 916 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1008 1424 gene locus_tag LOCUS_06090 gene paaI 1008 1424 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423284.1 protein_id gnl|my_center|LOCUS_06090 2453 1506 gene locus_tag LOCUS_06100 2453 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3738 2413 gene locus_tag LOCUS_06110 3738 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5960 3738 gene locus_tag LOCUS_06120 5960 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 7264 5957 gene locus_tag LOCUS_06130 7264 5957 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965471.1 protein_id gnl|my_center|LOCUS_06130 8466 7261 gene locus_tag LOCUS_06140 8466 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence048 481 41 gene locus_tag LOCUS_06150 gene rplM 481 41 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260793.1 protein_id gnl|my_center|LOCUS_06150 1522 593 gene locus_tag LOCUS_06160 gene galU 1522 593 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_06160 4368 2050 gene locus_tag LOCUS_06170 4368 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 5194 4529 gene locus_tag LOCUS_06180 5194 4529 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460781.1 protein_id gnl|my_center|LOCUS_06180 6099 5212 gene locus_tag LOCUS_06190 6099 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 6826 6116 gene locus_tag LOCUS_06200 6826 6116 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_06200 8089 6842 gene locus_tag LOCUS_06210 8089 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence049 1599 238 gene locus_tag LOCUS_06220 1599 238 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_06220 1882 1613 gene locus_tag LOCUS_06230 1882 1613 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_06230 2157 1891 gene locus_tag LOCUS_06240 2157 1891 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393250.1 protein_id gnl|my_center|LOCUS_06240 4608 2176 gene locus_tag LOCUS_06250 gene pheT 4608 2176 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_06250 5743 4718 gene locus_tag LOCUS_06260 gene pheS 5743 4718 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_06260 5966 6529 gene locus_tag LOCUS_06270 5966 6529 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_06270 6646 7077 gene locus_tag LOCUS_06280 6646 7077 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_06280 8456 7146 gene locus_tag LOCUS_06290 8456 7146 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355306.1 protein_id gnl|my_center|LOCUS_06290 8966 8466 gene locus_tag LOCUS_06300 8966 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence050 598 206 gene locus_tag LOCUS_06310 598 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2667 619 gene locus_tag LOCUS_06320 2667 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3465 2722 gene locus_tag LOCUS_06330 3465 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4175 3465 gene locus_tag LOCUS_06340 4175 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5658 4192 gene locus_tag LOCUS_06350 5658 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5895 5731 gene locus_tag LOCUS_06360 5895 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 6358 6011 gene locus_tag LOCUS_06370 6358 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 7925 6540 gene locus_tag LOCUS_06380 7925 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8084 8512 gene locus_tag LOCUS_06390 8084 8512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8949 8803 gene locus_tag LOCUS_06400 8949 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence051 266 1996 gene locus_tag LOCUS_06410 266 1996 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_06410 1993 5298 gene locus_tag LOCUS_06420 gene mfd 1993 5298 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_06420 5298 5963 gene locus_tag LOCUS_06430 5298 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6163 6438 gene locus_tag LOCUS_06440 6163 6438 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 protein_id gnl|my_center|LOCUS_06440 7382 6588 gene locus_tag LOCUS_06450 gene lgt 7382 6588 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_06450 8249 7386 gene locus_tag LOCUS_06460 8249 7386 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 protein_id gnl|my_center|LOCUS_06460 <9053 8251 gene locus_tag LOCUS_06470 <9053 8251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942906.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence052 157 750 gene locus_tag LOCUS_06480 157 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06480 753 2939 gene locus_tag LOCUS_06490 753 2939 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_06490 3551 3096 gene locus_tag LOCUS_06500 gene nrdG 3551 3096 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963803.1 protein_id gnl|my_center|LOCUS_06500 3835 3548 gene locus_tag LOCUS_06510 3835 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4435 5976 gene locus_tag LOCUS_06520 gene rny 4435 5976 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_06520 6148 6657 gene locus_tag LOCUS_06530 6148 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6668 7447 gene locus_tag LOCUS_06540 6668 7447 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_06540 7665 8648 gene locus_tag LOCUS_06550 7665 8648 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence053 725 1246 gene locus_tag LOCUS_06560 725 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1230 1430 gene locus_tag LOCUS_06570 1230 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1688 1927 gene locus_tag LOCUS_06580 1688 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2121 2474 gene locus_tag LOCUS_06590 2121 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3554 2895 gene locus_tag LOCUS_06600 3554 2895 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_06600 4284 3565 gene locus_tag LOCUS_06610 4284 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 5249 4284 gene locus_tag LOCUS_06620 5249 4284 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931217.1 protein_id gnl|my_center|LOCUS_06620 5698 6651 gene locus_tag LOCUS_06630 5698 6651 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_06630 6635 7918 gene locus_tag LOCUS_06640 6635 7918 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence054 809 189 gene locus_tag LOCUS_06650 809 189 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_06650 1904 813 gene locus_tag LOCUS_06660 gene ribD 1904 813 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_06660 2248 2060 gene locus_tag LOCUS_06670 2248 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 2842 2321 gene locus_tag LOCUS_06680 gene lepB 2842 2321 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_06680 3257 2916 gene locus_tag LOCUS_06690 gene rplS 3257 2916 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_06690 4712 3414 gene locus_tag LOCUS_06700 4712 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 6847 5207 gene locus_tag LOCUS_06710 6847 5207 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582596.1 protein_id gnl|my_center|LOCUS_06710 7090 8232 gene locus_tag LOCUS_06720 7090 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence055 2486 765 gene locus_tag LOCUS_06730 2486 765 CDS product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225355332.1 protein_id gnl|my_center|LOCUS_06730 4144 2468 gene locus_tag LOCUS_06740 4144 2468 CDS product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225355332.1 protein_id gnl|my_center|LOCUS_06740 5811 4141 gene locus_tag LOCUS_06750 5811 4141 CDS product 6-pyruvoyl-tetrahydropterin synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225355332.1 protein_id gnl|my_center|LOCUS_06750 8710 5903 gene locus_tag LOCUS_06760 8710 5903 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_06760 >Feature sequence056 1085 126 gene locus_tag LOCUS_06770 gene pfkA 1085 126 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229420.1 protein_id gnl|my_center|LOCUS_06770 1514 1098 gene locus_tag LOCUS_06780 1514 1098 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721901.1 protein_id gnl|my_center|LOCUS_06780 2605 1646 gene locus_tag LOCUS_06790 2605 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2961 2602 gene locus_tag LOCUS_06800 gene folB 2961 2602 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242949.1 protein_id gnl|my_center|LOCUS_06800 3792 2968 gene locus_tag LOCUS_06810 gene folP 3792 2968 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_06810 4352 3789 gene locus_tag LOCUS_06820 gene folE 4352 3789 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017739.1 protein_id gnl|my_center|LOCUS_06820 6052 4349 gene locus_tag LOCUS_06830 gene ptsP 6052 4349 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183417.1 protein_id gnl|my_center|LOCUS_06830 6384 6112 gene locus_tag LOCUS_06840 6384 6112 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_06840 7943 6696 gene locus_tag LOCUS_06850 gene lysA 7943 6696 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_06850 8678 7950 gene locus_tag LOCUS_06860 8678 7950 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237711.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence057 790 113 gene locus_tag LOCUS_06870 gene queC 790 113 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272362.1 protein_id gnl|my_center|LOCUS_06870 1444 797 gene locus_tag LOCUS_06880 gene rpe 1444 797 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_06880 2283 1441 gene locus_tag LOCUS_06890 gene rsgA 2283 1441 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986840.1 protein_id gnl|my_center|LOCUS_06890 4058 2280 gene locus_tag LOCUS_06900 gene pknB 4058 2280 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_06900 5678 4287 gene locus_tag LOCUS_06910 5678 4287 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_06910 6945 5671 gene locus_tag LOCUS_06920 6945 5671 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963827.1 protein_id gnl|my_center|LOCUS_06920 7636 6938 gene locus_tag LOCUS_06930 7636 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 8311 7679 gene locus_tag LOCUS_06940 8311 7679 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence058 3 1649 gene locus_tag LOCUS_06950 3 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1662 2546 gene locus_tag LOCUS_06960 gene dapA 1662 2546 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_06960 2563 3129 gene locus_tag LOCUS_06970 2563 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 5000 3162 gene locus_tag LOCUS_06980 5000 3162 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_06980 6592 5003 gene locus_tag LOCUS_06990 gene serA 6592 5003 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_06990 8389 6764 gene locus_tag LOCUS_07000 8389 6764 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence059 1191 760 gene locus_tag LOCUS_07010 1191 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07010 1985 1290 gene locus_tag LOCUS_07020 1985 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07020 2813 2019 gene locus_tag LOCUS_07030 2813 2019 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_07030 4091 3024 gene locus_tag LOCUS_07040 gene prfA 4091 3024 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_07040 5001 4132 gene locus_tag LOCUS_07050 5001 4132 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_07050 5115 6497 gene locus_tag LOCUS_07060 gene clpX 5115 6497 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417105.1 protein_id gnl|my_center|LOCUS_07060 6649 7311 gene locus_tag LOCUS_07070 6649 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8121 7270 gene locus_tag LOCUS_07080 gene speB 8121 7270 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence060 501 959 gene locus_tag LOCUS_07090 501 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 990 1577 gene locus_tag LOCUS_07100 990 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1633 2592 gene locus_tag LOCUS_07110 1633 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2745 2900 gene locus_tag LOCUS_07120 2745 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2921 3325 gene locus_tag LOCUS_07130 2921 3325 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_07130 3469 4008 gene locus_tag LOCUS_07140 3469 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4035 5081 gene locus_tag LOCUS_07150 4035 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 5200 6126 gene locus_tag LOCUS_07160 5200 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 6298 6053 gene locus_tag LOCUS_07170 6298 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 8032 6398 gene locus_tag LOCUS_07180 8032 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence061 260 111 gene locus_tag LOCUS_07190 260 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 1207 257 gene locus_tag LOCUS_07200 1207 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2480 1167 gene locus_tag LOCUS_07210 2480 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 4873 2480 gene locus_tag LOCUS_07220 4873 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 5052 6728 gene locus_tag LOCUS_07230 5052 6728 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_07230 7872 6811 gene locus_tag LOCUS_07240 gene rfbG 7872 6811 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_07240 8417 7920 gene locus_tag LOCUS_07250 8417 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence062 2176 1871 gene locus_tag LOCUS_07260 2176 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3135 3548 gene locus_tag LOCUS_07270 3135 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3568 5568 gene locus_tag LOCUS_07280 3568 5568 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461760.1 protein_id gnl|my_center|LOCUS_07280 5571 5993 gene locus_tag LOCUS_07290 5571 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6022 7080 gene locus_tag LOCUS_07300 6022 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 7951 7460 gene locus_tag LOCUS_07310 7951 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence063 306 701 gene locus_tag LOCUS_07320 306 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 882 1265 gene locus_tag LOCUS_07330 882 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1237 1608 gene locus_tag LOCUS_07340 1237 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1736 3250 gene locus_tag LOCUS_07350 1736 3250 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_07350 3279 3452 gene locus_tag LOCUS_07360 3279 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3564 4010 gene locus_tag LOCUS_07370 gene rimP 3564 4010 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000359097.1 protein_id gnl|my_center|LOCUS_07370 4021 5145 gene locus_tag LOCUS_07380 gene nusA 4021 5145 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_07380 5150 5449 gene locus_tag LOCUS_07390 5150 5449 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722455.1 protein_id gnl|my_center|LOCUS_07390 5465 8158 gene locus_tag LOCUS_07400 5465 8158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence064 1255 398 gene locus_tag LOCUS_07410 gene ispE 1255 398 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391620.1 protein_id gnl|my_center|LOCUS_07410 1846 1265 gene locus_tag LOCUS_07420 1846 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2903 1863 gene locus_tag LOCUS_07430 2903 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 3103 2909 gene locus_tag LOCUS_07440 3103 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3690 3118 gene locus_tag LOCUS_07450 3690 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 4246 3815 gene locus_tag LOCUS_07460 4246 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4460 4233 gene locus_tag LOCUS_07470 4460 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4760 5851 gene locus_tag LOCUS_07480 4760 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5829 6413 gene locus_tag LOCUS_07490 5829 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6420 7079 gene locus_tag LOCUS_07500 6420 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7284 8285 gene locus_tag LOCUS_07510 7284 8285 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816343.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence065 39 1400 gene locus_tag LOCUS_07520 39 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1562 2392 gene locus_tag LOCUS_07530 1562 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2376 3176 gene locus_tag LOCUS_07540 2376 3176 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_07540 3173 3457 gene locus_tag LOCUS_07550 3173 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07550 3517 4131 gene locus_tag LOCUS_07560 3517 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 4368 5762 gene locus_tag LOCUS_07570 4368 5762 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_07570 5768 6685 gene locus_tag LOCUS_07580 5768 6685 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_07580 6696 7979 gene locus_tag LOCUS_07590 6696 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence066 <1 524 gene locus_tag LOCUS_07600 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258732.1:ABC transporter ATP-binding protein 866 3364 gene locus_tag LOCUS_07610 866 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 3361 4110 gene locus_tag LOCUS_07620 gene kdsB 3361 4110 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_07620 4107 4931 gene locus_tag LOCUS_07630 gene kdsA 4107 4931 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_07630 4931 5896 gene locus_tag LOCUS_07640 4931 5896 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_07640 5898 6452 gene locus_tag LOCUS_07650 gene kdsC 5898 6452 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_07650 6605 7513 gene locus_tag LOCUS_07660 6605 7513 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779466.1 protein_id gnl|my_center|LOCUS_07660 7510 8076 gene locus_tag LOCUS_07670 7510 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence067 248 1183 gene locus_tag LOCUS_07680 248 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1189 1533 gene locus_tag LOCUS_07690 gene rsfS 1189 1533 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880811.1 protein_id gnl|my_center|LOCUS_07690 1537 2394 gene locus_tag LOCUS_07700 1537 2394 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214046.1 protein_id gnl|my_center|LOCUS_07700 2694 3650 gene locus_tag LOCUS_07710 2694 3650 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 protein_id gnl|my_center|LOCUS_07710 3965 4654 gene locus_tag LOCUS_07720 3965 4654 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_07720 4651 6207 gene locus_tag LOCUS_07730 4651 6207 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 protein_id gnl|my_center|LOCUS_07730 6668 6743 gene locus_tag LOCUS_t00090 6668 6743 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6861 7793 gene locus_tag LOCUS_07740 gene prmA 6861 7793 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence068 1633 14 gene locus_tag LOCUS_07750 1633 14 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633861.1 protein_id gnl|my_center|LOCUS_07750 2527 1781 gene locus_tag LOCUS_07760 2527 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3264 2524 gene locus_tag LOCUS_07770 3264 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3263 3559 gene locus_tag LOCUS_07780 3263 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4985 3768 gene locus_tag LOCUS_07790 4985 3768 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461052.1 protein_id gnl|my_center|LOCUS_07790 6189 4987 gene locus_tag LOCUS_07800 6189 4987 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058301.1 protein_id gnl|my_center|LOCUS_07800 7931 6261 gene locus_tag LOCUS_07810 7931 6261 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence069 1148 180 gene locus_tag LOCUS_07820 1148 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07820 1890 1102 gene locus_tag LOCUS_07830 gene fliR 1890 1102 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_07830 2172 1903 gene locus_tag LOCUS_07840 gene fliQ 2172 1903 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_07840 2931 2182 gene locus_tag LOCUS_07850 gene fliP 2931 2182 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_07850 3464 2928 gene locus_tag LOCUS_07860 3464 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3918 3556 gene locus_tag LOCUS_07870 3918 3556 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_07870 5412 4156 gene locus_tag LOCUS_07880 5412 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6406 5405 gene locus_tag LOCUS_07890 gene fliM 6406 5405 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136083.1 protein_id gnl|my_center|LOCUS_07890 6953 6435 gene locus_tag LOCUS_07900 6953 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 7230 7030 gene locus_tag LOCUS_07910 7230 7030 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870069.1 protein_id gnl|my_center|LOCUS_07910 <7986 7442 gene locus_tag LOCUS_07920 <7986 7442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942366.1:7-carboxy-7-deazaguanine synthase QueE >Feature sequence070 662 2731 gene locus_tag LOCUS_07930 gene glgX 662 2731 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122228.1 protein_id gnl|my_center|LOCUS_07930 3236 3382 gene locus_tag LOCUS_07940 3236 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4180 3815 gene locus_tag LOCUS_07950 4180 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4976 4173 gene locus_tag LOCUS_07960 4976 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6070 5075 gene locus_tag LOCUS_07970 6070 5075 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262044.1 protein_id gnl|my_center|LOCUS_07970 6781 7386 gene locus_tag LOCUS_07980 6781 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7871 7413 gene locus_tag LOCUS_07990 7871 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence071 3023 705 gene locus_tag LOCUS_08000 3023 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 3394 3068 gene locus_tag LOCUS_08010 3394 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3605 3387 gene locus_tag LOCUS_08020 3605 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7578 3733 gene locus_tag LOCUS_08030 7578 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence072 1268 6 gene locus_tag LOCUS_08040 1268 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2173 1271 gene locus_tag LOCUS_08050 2173 1271 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476523.1 protein_id gnl|my_center|LOCUS_08050 3225 2170 gene locus_tag LOCUS_08060 3225 2170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722316.1 protein_id gnl|my_center|LOCUS_08060 4211 3225 gene locus_tag LOCUS_08070 4211 3225 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974106.1 protein_id gnl|my_center|LOCUS_08070 5155 4211 gene locus_tag LOCUS_08080 5155 4211 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534165.1 protein_id gnl|my_center|LOCUS_08080 6937 5279 gene locus_tag LOCUS_08090 6937 5279 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823455.1 protein_id gnl|my_center|LOCUS_08090 7840 7154 gene locus_tag LOCUS_08100 7840 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence073 82 1584 gene locus_tag LOCUS_08110 82 1584 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861532.1 protein_id gnl|my_center|LOCUS_08110 2077 4269 gene locus_tag LOCUS_08120 2077 4269 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_08120 4269 6461 gene locus_tag LOCUS_08130 gene scpA 4269 6461 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_08130 6537 6902 gene locus_tag LOCUS_08140 6537 6902 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_08140 6895 7200 gene locus_tag LOCUS_08150 6895 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence074 886 1323 gene locus_tag LOCUS_08160 gene rpiB 886 1323 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141687.1 protein_id gnl|my_center|LOCUS_08160 1570 2385 gene locus_tag LOCUS_08170 1570 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2382 3038 gene locus_tag LOCUS_08180 2382 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3457 3176 gene locus_tag LOCUS_08190 3457 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 4909 3740 gene locus_tag LOCUS_08200 4909 3740 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860970.1 protein_id gnl|my_center|LOCUS_08200 5397 5011 gene locus_tag LOCUS_08210 5397 5011 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_08210 5698 5390 gene locus_tag LOCUS_08220 5698 5390 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944683.1 protein_id gnl|my_center|LOCUS_08220 5939 6901 gene locus_tag LOCUS_08230 gene pfkA 5939 6901 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_08230 6917 7678 gene locus_tag LOCUS_08240 6917 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence075 168 635 gene locus_tag LOCUS_08250 168 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 731 1360 gene locus_tag LOCUS_08260 731 1360 CDS product DUF1819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459228.1 protein_id gnl|my_center|LOCUS_08260 1379 1936 gene locus_tag LOCUS_08270 1379 1936 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272229.1 protein_id gnl|my_center|LOCUS_08270 1951 5484 gene locus_tag LOCUS_08280 gene brxC 1951 5484 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459229.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence076 1300 290 gene locus_tag LOCUS_08290 1300 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_08290 1756 3300 gene locus_tag LOCUS_08300 1756 3300 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_08300 3495 4874 gene locus_tag LOCUS_08310 3495 4874 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451023.1 protein_id gnl|my_center|LOCUS_08310 5704 4898 gene locus_tag LOCUS_08320 5704 4898 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228670.1 protein_id gnl|my_center|LOCUS_08320 5821 5735 gene locus_tag LOCUS_t00100 5821 5735 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7449 6169 gene locus_tag LOCUS_08330 gene agp 7449 6169 CDS product bifunctional glucose-1-phosphatase/inositol phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704989.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence077 859 206 gene locus_tag LOCUS_08340 859 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4062 892 gene locus_tag LOCUS_08350 4062 892 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_08350 5265 4075 gene locus_tag LOCUS_08360 5265 4075 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_08360 5534 6136 gene locus_tag LOCUS_08370 5534 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 6129 7388 gene locus_tag LOCUS_08380 6129 7388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence078 192 506 gene locus_tag LOCUS_08390 192 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 507 1274 gene locus_tag LOCUS_08400 507 1274 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966014.1 protein_id gnl|my_center|LOCUS_08400 1570 1385 gene locus_tag LOCUS_08410 1570 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2085 1588 gene locus_tag LOCUS_08420 2085 1588 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_08420 6407 2811 gene locus_tag LOCUS_08430 6407 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence079 514 275 gene locus_tag LOCUS_08440 514 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 605 408 gene locus_tag LOCUS_08450 605 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 1067 813 gene locus_tag LOCUS_08460 1067 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1395 1081 gene locus_tag LOCUS_08470 1395 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1878 1582 gene locus_tag LOCUS_08480 1878 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2085 2273 gene locus_tag LOCUS_08490 2085 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2736 2590 gene locus_tag LOCUS_08500 2736 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 3027 5945 gene locus_tag LOCUS_08510 3027 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5957 7072 gene locus_tag LOCUS_08520 5957 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence080 706 1449 gene locus_tag LOCUS_08530 706 1449 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461208.1 protein_id gnl|my_center|LOCUS_08530 1544 2824 gene locus_tag LOCUS_08540 1544 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2821 3864 gene locus_tag LOCUS_08550 2821 3864 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_08550 3857 6169 gene locus_tag LOCUS_08560 gene hypF 3857 6169 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_08560 6277 6456 gene locus_tag LOCUS_08570 6277 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence081 512 3577 gene locus_tag LOCUS_08580 512 3577 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166660.1 protein_id gnl|my_center|LOCUS_08580 3594 4529 gene locus_tag LOCUS_08590 gene ftsY 3594 4529 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_08590 4522 5388 gene locus_tag LOCUS_08600 gene ylqF 4522 5388 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_08600 5522 6298 gene locus_tag LOCUS_08610 5522 6298 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence082 62 1087 gene locus_tag LOCUS_08620 62 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1101 1484 gene locus_tag LOCUS_08630 1101 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1481 2422 gene locus_tag LOCUS_08640 1481 2422 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391645.1 protein_id gnl|my_center|LOCUS_08640 2433 3170 gene locus_tag LOCUS_08650 2433 3170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944147.1 protein_id gnl|my_center|LOCUS_08650 3167 3913 gene locus_tag LOCUS_08660 3167 3913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285593.1 protein_id gnl|my_center|LOCUS_08660 3889 4110 gene locus_tag LOCUS_08670 3889 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4043 4855 gene locus_tag LOCUS_08680 4043 4855 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_08680 4953 5816 gene locus_tag LOCUS_08690 4953 5816 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence083 1989 2930 gene locus_tag LOCUS_08700 gene fabK 1989 2930 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_08700 2927 3820 gene locus_tag LOCUS_08710 2927 3820 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837068.1 protein_id gnl|my_center|LOCUS_08710 4731 3886 gene locus_tag LOCUS_08720 4731 3886 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963758.1 protein_id gnl|my_center|LOCUS_08720 5046 5510 gene locus_tag LOCUS_08730 5046 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6011 6889 gene locus_tag LOCUS_08740 gene rfbA 6011 6889 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857536.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence084 1141 2535 gene locus_tag LOCUS_08750 gene dnaA 1141 2535 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_08750 3175 4284 gene locus_tag LOCUS_08760 gene dnaN 3175 4284 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242509.1 protein_id gnl|my_center|LOCUS_08760 4375 5385 gene locus_tag LOCUS_08770 gene recF 4375 5385 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 protein_id gnl|my_center|LOCUS_08770 5382 6242 gene locus_tag LOCUS_08780 5382 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 6724 6930 gene locus_tag LOCUS_08790 6724 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6950 7159 gene locus_tag LOCUS_08800 gene yidD 6950 7159 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081754.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence085 321 2114 gene locus_tag LOCUS_08810 321 2114 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458911.1 protein_id gnl|my_center|LOCUS_08810 2190 5312 gene locus_tag LOCUS_08820 gene ileS 2190 5312 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_08820 5775 5380 gene locus_tag LOCUS_08830 5775 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 7090 6041 gene locus_tag LOCUS_08840 7090 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence086 536 709 gene locus_tag LOCUS_08850 536 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 720 941 gene locus_tag LOCUS_08860 720 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 934 1242 gene locus_tag LOCUS_08870 934 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 1356 1523 gene locus_tag LOCUS_08880 1356 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1536 1787 gene locus_tag LOCUS_08890 1536 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1800 2114 gene locus_tag LOCUS_08900 1800 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2135 2377 gene locus_tag LOCUS_08910 2135 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2390 2629 gene locus_tag LOCUS_08920 2390 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 2626 2946 gene locus_tag LOCUS_08930 2626 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3058 3294 gene locus_tag LOCUS_08940 3058 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3291 3605 gene locus_tag LOCUS_08950 3291 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3623 4063 gene locus_tag LOCUS_08960 3623 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 4136 4342 gene locus_tag LOCUS_08970 4136 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4359 4667 gene locus_tag LOCUS_08980 4359 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4899 5981 gene locus_tag LOCUS_08990 4899 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence087 1579 839 gene locus_tag LOCUS_09000 1579 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 1839 1648 gene locus_tag LOCUS_09010 1839 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2597 1836 gene locus_tag LOCUS_09020 2597 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2672 2747 gene locus_tag LOCUS_t00110 2672 2747 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2956 2807 gene locus_tag LOCUS_09030 2956 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3023 3343 gene locus_tag LOCUS_09040 3023 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3930 3364 gene locus_tag LOCUS_09050 3930 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6271 3938 gene locus_tag LOCUS_09060 6271 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6428 6309 gene locus_tag LOCUS_09070 6428 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 6891 6966 gene locus_tag LOCUS_t00120 6891 6966 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6968 7043 gene locus_tag LOCUS_t00130 6968 7043 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7045 7121 gene locus_tag LOCUS_t00140 7045 7121 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 90 272 gene locus_tag LOCUS_09080 90 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 702 965 gene locus_tag LOCUS_09090 702 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 958 1170 gene locus_tag LOCUS_09100 958 1170 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813975.1 protein_id gnl|my_center|LOCUS_09100 1293 1481 gene locus_tag LOCUS_09110 1293 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1478 2095 gene locus_tag LOCUS_09120 1478 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_09120 2340 3926 gene locus_tag LOCUS_09130 2340 3926 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760930.1 protein_id gnl|my_center|LOCUS_09130 3984 5738 gene locus_tag LOCUS_09140 3984 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence089 1248 91 gene locus_tag LOCUS_09150 1248 91 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031604.1 protein_id gnl|my_center|LOCUS_09150 2112 1405 gene locus_tag LOCUS_09160 gene hisIE 2112 1405 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_09160 2867 2112 gene locus_tag LOCUS_09170 gene hisF 2867 2112 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_09170 3601 2867 gene locus_tag LOCUS_09180 gene hisA 3601 2867 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_09180 4213 3605 gene locus_tag LOCUS_09190 gene hisH 4213 3605 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_09190 4797 4213 gene locus_tag LOCUS_09200 gene hisB 4797 4213 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949112.1 protein_id gnl|my_center|LOCUS_09200 5856 4798 gene locus_tag LOCUS_09210 gene hisC 5856 4798 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_09210 6122 5925 gene locus_tag LOCUS_09220 6122 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 6742 6380 gene locus_tag LOCUS_09230 6742 6380 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668012.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence090 1051 975 gene locus_tag LOCUS_t00150 1051 975 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5103 1138 gene locus_tag LOCUS_09240 5103 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6983 5124 gene locus_tag LOCUS_09250 6983 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence091 186 1550 gene locus_tag LOCUS_09260 186 1550 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393585.1 protein_id gnl|my_center|LOCUS_09260 1550 2560 gene locus_tag LOCUS_09270 gene cydB 1550 2560 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461541.1 protein_id gnl|my_center|LOCUS_09270 2557 4188 gene locus_tag LOCUS_09280 2557 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4270 6876 gene locus_tag LOCUS_09290 4270 6876 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387314.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence092 1582 305 gene locus_tag LOCUS_09300 1582 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2381 1587 gene locus_tag LOCUS_09310 2381 1587 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_09310 3038 2442 gene locus_tag LOCUS_09320 3038 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3738 3136 gene locus_tag LOCUS_09330 3738 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4784 3735 gene locus_tag LOCUS_09340 4784 3735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5025 4816 gene locus_tag LOCUS_09350 5025 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5262 5077 gene locus_tag LOCUS_09360 5262 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5359 5234 gene locus_tag LOCUS_09370 5359 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5892 5560 gene locus_tag LOCUS_09380 5892 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 6451 6062 gene locus_tag LOCUS_09390 6451 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6630 6481 gene locus_tag LOCUS_09400 6630 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence093 63 350 gene locus_tag LOCUS_09410 63 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 810 2039 gene locus_tag LOCUS_09420 810 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2093 2338 gene locus_tag LOCUS_09430 2093 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2419 2982 gene locus_tag LOCUS_09440 2419 2982 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814921.1 protein_id gnl|my_center|LOCUS_09440 3022 3264 gene locus_tag LOCUS_09450 3022 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3230 3535 gene locus_tag LOCUS_09460 3230 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4051 3644 gene locus_tag LOCUS_09470 4051 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4420 4578 gene locus_tag LOCUS_09480 4420 4578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4575 4919 gene locus_tag LOCUS_09490 4575 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence094 2288 129 gene locus_tag LOCUS_09500 2288 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2550 2747 gene locus_tag LOCUS_09510 gene rpmE 2550 2747 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_09510 2789 3580 gene locus_tag LOCUS_09520 2789 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 3707 4612 gene locus_tag LOCUS_09530 3707 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4731 4806 gene locus_tag LOCUS_t00160 4731 4806 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4808 4883 gene locus_tag LOCUS_t00170 4808 4883 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4889 4965 gene locus_tag LOCUS_t00180 4889 4965 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5947 5069 gene locus_tag LOCUS_09540 5947 5069 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09540 6181 5948 gene locus_tag LOCUS_09550 6181 5948 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262107.1 protein_id gnl|my_center|LOCUS_09550 <6834 6200 gene locus_tag LOCUS_09560 <6834 6200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838345.1:exodeoxyribonuclease VII large subunit >Feature sequence095 307 723 gene locus_tag LOCUS_09570 307 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1013 1621 gene locus_tag LOCUS_09580 1013 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1879 1502 gene locus_tag LOCUS_09590 1879 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2143 1892 gene locus_tag LOCUS_09600 2143 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2909 3520 gene locus_tag LOCUS_09610 2909 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3621 5300 gene locus_tag LOCUS_09620 3621 5300 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence096 50 1207 gene locus_tag LOCUS_09630 gene glf 50 1207 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_09630 1204 2604 gene locus_tag LOCUS_09640 1204 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2621 3868 gene locus_tag LOCUS_09650 2621 3868 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_09650 3871 4923 gene locus_tag LOCUS_09660 3871 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4937 5134 gene locus_tag LOCUS_09670 4937 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 5167 5616 gene locus_tag LOCUS_09680 5167 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence097 2901 232 gene locus_tag LOCUS_09690 2901 232 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_09690 3682 3104 gene locus_tag LOCUS_09700 3682 3104 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_09700 3949 5565 gene locus_tag LOCUS_09710 3949 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5651 5989 gene locus_tag LOCUS_09720 5651 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence098 214 1293 gene locus_tag LOCUS_09730 214 1293 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061358.1 protein_id gnl|my_center|LOCUS_09730 1513 3195 gene locus_tag LOCUS_09740 1513 3195 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_09740 4145 3222 gene locus_tag LOCUS_09750 4145 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4993 4166 gene locus_tag LOCUS_09760 gene budA 4993 4166 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_09760 5452 5198 gene locus_tag LOCUS_09770 5452 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6608 5466 gene locus_tag LOCUS_09780 6608 5466 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence099 2666 411 gene locus_tag LOCUS_09790 2666 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4917 2680 gene locus_tag LOCUS_09800 4917 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 <6639 5008 gene locus_tag LOCUS_09810 <6639 5008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937372.1:efflux RND transporter permease subunit >Feature sequence100 2111 114 gene locus_tag LOCUS_09820 2111 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4001 2418 gene locus_tag LOCUS_09830 4001 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5600 4005 gene locus_tag LOCUS_09840 5600 4005 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795300.1 protein_id gnl|my_center|LOCUS_09840 5817 6410 gene locus_tag LOCUS_09850 5817 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence101 963 214 gene locus_tag LOCUS_09860 gene uppS 963 214 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_09860 1195 1025 gene locus_tag LOCUS_09870 1195 1025 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_09870 1412 1185 gene locus_tag LOCUS_09880 1412 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1966 1409 gene locus_tag LOCUS_09890 gene frr 1966 1409 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_09890 2703 1984 gene locus_tag LOCUS_09900 gene pyrH 2703 1984 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_09900 4494 2899 gene locus_tag LOCUS_09910 4494 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5074 4691 gene locus_tag LOCUS_09920 5074 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 <6620 5089 gene locus_tag LOCUS_09930 <6620 5089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence102 65 739 gene locus_tag LOCUS_09940 65 739 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_09940 873 2201 gene locus_tag LOCUS_09950 gene rsmB 873 2201 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_09950 2203 3246 gene locus_tag LOCUS_09960 gene rlmN 2203 3246 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_09960 3246 3986 gene locus_tag LOCUS_09970 3246 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3991 4149 gene locus_tag LOCUS_09980 3991 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4385 4191 gene locus_tag LOCUS_09990 4385 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence103 135 968 gene locus_tag LOCUS_10000 135 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1124 4798 gene locus_tag LOCUS_10010 1124 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence104 <1 635 gene locus_tag LOCUS_10020 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099360647.1:methylmalonyl Co-A mutase-associated GTPase MeaB 645 1205 gene locus_tag LOCUS_10030 gene msrA 645 1205 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510037.1 protein_id gnl|my_center|LOCUS_10030 1427 1275 gene locus_tag LOCUS_10040 1427 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1743 2651 gene locus_tag LOCUS_10050 1743 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2670 3053 gene locus_tag LOCUS_10060 2670 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3096 4130 gene locus_tag LOCUS_10070 3096 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4317 4649 gene locus_tag LOCUS_10080 4317 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4831 5220 gene locus_tag LOCUS_10090 4831 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5239 5709 gene locus_tag LOCUS_10100 5239 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence105 <1 1049 gene locus_tag LOCUS_10110 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073167773.1:tyrosine-type recombinase/integrase 2417 1545 gene locus_tag LOCUS_10120 2417 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2612 4150 gene locus_tag LOCUS_10130 2612 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 4153 4551 gene locus_tag LOCUS_10140 4153 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10140 4759 5550 gene locus_tag LOCUS_10150 4759 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence106 1143 154 gene locus_tag LOCUS_10160 1143 154 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964682.1 protein_id gnl|my_center|LOCUS_10160 2606 1488 gene locus_tag LOCUS_10170 2606 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3277 2609 gene locus_tag LOCUS_10180 3277 2609 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392641.1 protein_id gnl|my_center|LOCUS_10180 4198 3335 gene locus_tag LOCUS_10190 4198 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5845 4394 gene locus_tag LOCUS_10200 gene gltX 5845 4394 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_10200 6263 5949 gene locus_tag LOCUS_10210 gene sugE 6263 5949 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528463.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence107 <1 1095 gene locus_tag LOCUS_10220 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861463.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase 1192 2433 gene locus_tag LOCUS_10230 1192 2433 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_10230 3258 2494 gene locus_tag LOCUS_10240 3258 2494 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_10240 3577 4230 gene locus_tag LOCUS_10250 3577 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 5052 4324 gene locus_tag LOCUS_10260 5052 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence108 <1 789 gene locus_tag LOCUS_10270 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965895.1:gluconate 5-dehydrogenase 952 1596 gene locus_tag LOCUS_10280 952 1596 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906064.1 protein_id gnl|my_center|LOCUS_10280 1692 2909 gene locus_tag LOCUS_10290 1692 2909 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964082.1 protein_id gnl|my_center|LOCUS_10290 3299 4210 gene locus_tag LOCUS_10300 3299 4210 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661512.1 protein_id gnl|my_center|LOCUS_10300 4223 5953 gene locus_tag LOCUS_10310 4223 5953 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948958.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence109 357 91 gene locus_tag LOCUS_10320 357 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1036 389 gene locus_tag LOCUS_10330 gene hisG 1036 389 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_10330 1527 1045 gene locus_tag LOCUS_10340 1527 1045 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963337.1 protein_id gnl|my_center|LOCUS_10340 2702 1524 gene locus_tag LOCUS_10350 gene hisZ 2702 1524 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_10350 3015 2716 gene locus_tag LOCUS_10360 3015 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3421 4488 gene locus_tag LOCUS_10370 3421 4488 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156271991.1 protein_id gnl|my_center|LOCUS_10370 4743 5249 gene locus_tag LOCUS_10380 gene nuoE 4743 5249 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584034.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence110 91 2193 gene locus_tag LOCUS_10390 91 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2668 2303 gene locus_tag LOCUS_10400 gene folB 2668 2303 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861219.1 protein_id gnl|my_center|LOCUS_10400 4499 2982 gene locus_tag LOCUS_10410 4499 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 <6137 4837 gene locus_tag LOCUS_10420 <6137 4837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020062.1:sodium/proline symporter PutP >Feature sequence111 271 347 gene locus_tag LOCUS_t00190 271 347 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 537 1493 gene locus_tag LOCUS_10430 537 1493 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_10430 2554 1715 gene locus_tag LOCUS_10440 2554 1715 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903855.1 protein_id gnl|my_center|LOCUS_10440 3314 2538 gene locus_tag LOCUS_10450 3314 2538 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015842.1 protein_id gnl|my_center|LOCUS_10450 4830 3406 gene locus_tag LOCUS_10460 gene argH 4830 3406 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246018.1 protein_id gnl|my_center|LOCUS_10460 6035 4827 gene locus_tag LOCUS_10470 6035 4827 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence112 660 2024 gene locus_tag LOCUS_10480 660 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2050 3591 gene locus_tag LOCUS_10490 2050 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3560 3934 gene locus_tag LOCUS_10500 3560 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 3949 5601 gene locus_tag LOCUS_10510 3949 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6022 5666 gene locus_tag LOCUS_10520 6022 5666 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460091.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence113 268 987 gene locus_tag LOCUS_10530 268 987 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814415.1 protein_id gnl|my_center|LOCUS_10530 1067 1408 gene locus_tag LOCUS_10540 1067 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2129 1452 gene locus_tag LOCUS_10550 2129 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2662 2159 gene locus_tag LOCUS_10560 2662 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2995 3810 gene locus_tag LOCUS_10570 2995 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3919 4113 gene locus_tag LOCUS_10580 3919 4113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4464 4171 gene locus_tag LOCUS_10590 4464 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4667 4491 gene locus_tag LOCUS_10600 4667 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 <6067 4645 gene locus_tag LOCUS_10610 <6067 4645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775555.1:recombinase family protein >Feature sequence114 767 1150 gene locus_tag LOCUS_10620 767 1150 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_10620 1249 1914 gene locus_tag LOCUS_10630 1249 1914 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986772.1 protein_id gnl|my_center|LOCUS_10630 1911 3272 gene locus_tag LOCUS_10640 1911 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 3576 4715 gene locus_tag LOCUS_10650 3576 4715 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392489.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence115 <1 543 gene locus_tag LOCUS_10660 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020424.1:DUF362 domain-containing protein 560 1405 gene locus_tag LOCUS_10670 560 1405 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101946.1 protein_id gnl|my_center|LOCUS_10670 1423 2097 gene locus_tag LOCUS_10680 1423 2097 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_10680 2560 2198 gene locus_tag LOCUS_10690 2560 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 2897 2505 gene locus_tag LOCUS_10700 2897 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 3298 4089 gene locus_tag LOCUS_10710 3298 4089 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869221.1 protein_id gnl|my_center|LOCUS_10710 4217 5881 gene locus_tag LOCUS_10720 4217 5881 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence116 2 283 gene locus_tag LOCUS_10730 2 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 283 1530 gene locus_tag LOCUS_10740 gene ilvA 283 1530 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_10740 1620 1892 gene locus_tag LOCUS_10750 1620 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1904 2344 gene locus_tag LOCUS_10760 1904 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3242 2436 gene locus_tag LOCUS_10770 3242 2436 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_10770 3827 3252 gene locus_tag LOCUS_10780 gene rsxA 3827 3252 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_10780 4453 3827 gene locus_tag LOCUS_10790 4453 3827 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_10790 5015 4455 gene locus_tag LOCUS_10800 5015 4455 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_10800 5938 5012 gene locus_tag LOCUS_10810 5938 5012 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence117 <1 1152 gene locus_tag LOCUS_10820 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948198.1:helicase-exonuclease AddAB subunit AddA 1531 1812 gene locus_tag LOCUS_10830 1531 1812 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_10830 1882 2640 gene locus_tag LOCUS_10840 1882 2640 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_10840 2662 3450 gene locus_tag LOCUS_10850 2662 3450 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667016.1 protein_id gnl|my_center|LOCUS_10850 4005 3544 gene locus_tag LOCUS_10860 4005 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4542 4144 gene locus_tag LOCUS_10870 4542 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 4840 4529 gene locus_tag LOCUS_10880 4840 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 5882 4857 gene locus_tag LOCUS_10890 gene cpsG 5882 4857 CDS product phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208588.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence118 39 1442 gene locus_tag LOCUS_10900 39 1442 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_10900 1497 3122 gene locus_tag LOCUS_10910 1497 3122 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939722.1 protein_id gnl|my_center|LOCUS_10910 4957 3068 gene locus_tag LOCUS_10920 4957 3068 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_10920 5596 4988 gene locus_tag LOCUS_10930 5596 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence119 202 1485 gene locus_tag LOCUS_10940 gene trmFO 202 1485 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_10940 1485 2021 gene locus_tag LOCUS_10950 gene clpQ 1485 2021 CDS product ATP-dependent protease subunit ClpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238555.1 protein_id gnl|my_center|LOCUS_10950 2023 3399 gene locus_tag LOCUS_10960 gene hslU 2023 3399 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_10960 3984 3538 gene locus_tag LOCUS_10970 3984 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4217 3981 gene locus_tag LOCUS_10980 4217 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 5518 4310 gene locus_tag LOCUS_10990 5518 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence120 179 727 gene locus_tag LOCUS_11000 179 727 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018608.1 protein_id gnl|my_center|LOCUS_11000 838 2271 gene locus_tag LOCUS_11010 838 2271 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482957.1 protein_id gnl|my_center|LOCUS_11010 3919 2315 gene locus_tag LOCUS_11020 3919 2315 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_11020 4198 4461 gene locus_tag LOCUS_11030 4198 4461 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_11030 4464 4745 gene locus_tag LOCUS_11040 4464 4745 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_11040 5220 4837 gene locus_tag LOCUS_11050 5220 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence121 1444 251 gene locus_tag LOCUS_11060 1444 251 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272149.1 protein_id gnl|my_center|LOCUS_11060 2552 1509 gene locus_tag LOCUS_11070 gene gap 2552 1509 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_11070 3458 2844 gene locus_tag LOCUS_11080 gene lexA 3458 2844 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_11080 4135 3545 gene locus_tag LOCUS_11090 gene cbiT 4135 3545 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901667.1 protein_id gnl|my_center|LOCUS_11090 4739 4122 gene locus_tag LOCUS_11100 4739 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 5838 4732 gene locus_tag LOCUS_11110 gene cbiD 5838 4732 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392602.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence122 2214 148 gene locus_tag LOCUS_11120 gene rnr 2214 148 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964034.1 protein_id gnl|my_center|LOCUS_11120 2522 2208 gene locus_tag LOCUS_11130 2522 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2956 2498 gene locus_tag LOCUS_11140 2956 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11140 3244 3017 gene locus_tag LOCUS_11150 3244 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 4231 3722 gene locus_tag LOCUS_11160 gene ruvC 4231 3722 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_11160 4962 4201 gene locus_tag LOCUS_11170 4962 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 5695 4964 gene locus_tag LOCUS_11180 5695 4964 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460362.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence123 <1 578 gene locus_tag LOCUS_11190 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870466.1:diphosphate--fructose-6-phosphate 1-phosphotransferase 691 921 gene locus_tag LOCUS_11200 691 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 918 1340 gene locus_tag LOCUS_11210 918 1340 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_11210 2505 1384 gene locus_tag LOCUS_11220 2505 1384 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489051.1 protein_id gnl|my_center|LOCUS_11220 3583 2486 gene locus_tag LOCUS_11230 gene mdtN 3583 2486 CDS product multidrug transporter subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445824.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence124 261 2330 gene locus_tag LOCUS_11240 gene pnp 261 2330 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231897.1 protein_id gnl|my_center|LOCUS_11240 3328 2369 gene locus_tag LOCUS_11250 3328 2369 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058149.1 protein_id gnl|my_center|LOCUS_11250 4097 3681 gene locus_tag LOCUS_11260 4097 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5023 4094 gene locus_tag LOCUS_11270 5023 4094 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288197.1 protein_id gnl|my_center|LOCUS_11270 5292 5023 gene locus_tag LOCUS_11280 5292 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 5557 5303 gene locus_tag LOCUS_11290 5557 5303 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence125 250 1533 gene locus_tag LOCUS_11300 250 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1753 3387 gene locus_tag LOCUS_11310 1753 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3533 3901 gene locus_tag LOCUS_11320 3533 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3932 4603 gene locus_tag LOCUS_11330 gene atpB 3932 4603 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_11330 4696 4947 gene locus_tag LOCUS_11340 4696 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4987 5484 gene locus_tag LOCUS_11350 gene atpF 4987 5484 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732516.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence126 1404 742 gene locus_tag LOCUS_11360 1404 742 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886480.1 protein_id gnl|my_center|LOCUS_11360 1868 1416 gene locus_tag LOCUS_11370 1868 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3351 2038 gene locus_tag LOCUS_11380 gene fliI 3351 2038 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_11380 4139 3348 gene locus_tag LOCUS_11390 gene fliH 4139 3348 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096786.1 protein_id gnl|my_center|LOCUS_11390 5160 4132 gene locus_tag LOCUS_11400 gene fliG 5160 4132 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_11400 <5697 5163 gene locus_tag LOCUS_11410 <5697 5163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_178371729.1:flagellar basal-body MS-ring/collar protein FliF >Feature sequence127 435 1061 gene locus_tag LOCUS_11420 435 1061 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_11420 1065 1808 gene locus_tag LOCUS_11430 gene scpA 1065 1808 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246108.1 protein_id gnl|my_center|LOCUS_11430 1783 2349 gene locus_tag LOCUS_11440 gene scpB 1783 2349 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_11440 2377 2670 gene locus_tag LOCUS_11450 2377 2670 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_11450 2663 2935 gene locus_tag LOCUS_11460 2663 2935 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_11460 3009 3851 gene locus_tag LOCUS_11470 3009 3851 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_11470 3854 4438 gene locus_tag LOCUS_11480 gene pth 3854 4438 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379221.1 protein_id gnl|my_center|LOCUS_11480 4431 5657 gene locus_tag LOCUS_11490 4431 5657 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941550.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence128 1536 499 gene locus_tag LOCUS_11500 1536 499 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359145.1 protein_id gnl|my_center|LOCUS_11500 3241 1841 gene locus_tag LOCUS_11510 3241 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11510 3495 3127 gene locus_tag LOCUS_11520 3495 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4742 3729 gene locus_tag LOCUS_11530 4742 3729 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948239.1 protein_id gnl|my_center|LOCUS_11530 <5659 4855 gene locus_tag LOCUS_11540 <5659 4855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113542.1:amidohydrolase >Feature sequence129 2335 2018 gene locus_tag LOCUS_11550 2335 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence130 3208 1313 gene locus_tag LOCUS_11560 3208 1313 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_11560 3545 3907 gene locus_tag LOCUS_11570 3545 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4036 4311 gene locus_tag LOCUS_11580 4036 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4295 4717 gene locus_tag LOCUS_11590 4295 4717 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_11590 4850 5119 gene locus_tag LOCUS_11600 4850 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 5103 5534 gene locus_tag LOCUS_11610 5103 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence131 374 2053 gene locus_tag LOCUS_11620 374 2053 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11620 2386 2117 gene locus_tag LOCUS_11630 2386 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2696 4018 gene locus_tag LOCUS_11640 gene maeB 2696 4018 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_11640 4302 4126 gene locus_tag LOCUS_11650 4302 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence132 2796 643 gene locus_tag LOCUS_11660 2796 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2934 2797 gene locus_tag LOCUS_11670 2934 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3122 2931 gene locus_tag LOCUS_11680 3122 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5392 3089 gene locus_tag LOCUS_11690 gene trbE 5392 3089 CDS product conjugal transfer protein TrbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533267.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence133 1428 226 gene locus_tag LOCUS_11700 1428 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2290 1487 gene locus_tag LOCUS_11710 2290 1487 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_11710 2822 2295 gene locus_tag LOCUS_11720 2822 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 3480 3127 gene locus_tag LOCUS_11730 3480 3127 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135200.1 protein_id gnl|my_center|LOCUS_11730 4038 3610 gene locus_tag LOCUS_11740 4038 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4316 4035 gene locus_tag LOCUS_11750 4316 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 5376 4513 gene locus_tag LOCUS_11760 5376 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence134 753 932 gene locus_tag LOCUS_11770 753 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 932 1150 gene locus_tag LOCUS_11780 932 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2299 1484 gene locus_tag LOCUS_11790 2299 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2475 2684 gene locus_tag LOCUS_11800 2475 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3774 3541 gene locus_tag LOCUS_11810 3774 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4018 3875 gene locus_tag LOCUS_11820 4018 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 5299 4211 gene locus_tag LOCUS_11830 5299 4211 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence135 3269 567 gene locus_tag LOCUS_11840 3269 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5506 3266 gene locus_tag LOCUS_11850 5506 3266 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence136 929 492 gene locus_tag LOCUS_11860 929 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1504 926 gene locus_tag LOCUS_11870 1504 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1827 1435 gene locus_tag LOCUS_11880 1827 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2351 1824 gene locus_tag LOCUS_11890 2351 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2923 2348 gene locus_tag LOCUS_11900 2923 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3320 2907 gene locus_tag LOCUS_11910 3320 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4657 3419 gene locus_tag LOCUS_11920 gene larC 4657 3419 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_11920 5417 4662 gene locus_tag LOCUS_11930 gene larB 5417 4662 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence137 1862 207 gene locus_tag LOCUS_11940 gene argS 1862 207 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_11940 3000 1981 gene locus_tag LOCUS_11950 gene tsaD 3000 1981 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_11950 3683 3237 gene locus_tag LOCUS_11960 gene rimI 3683 3237 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_11960 4362 3676 gene locus_tag LOCUS_11970 gene tsaB 4362 3676 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_11970 4832 4365 gene locus_tag LOCUS_11980 gene tsaE 4832 4365 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence138 2115 1348 gene locus_tag LOCUS_11990 2115 1348 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11990 2722 2273 gene locus_tag LOCUS_12000 gene lspA 2722 2273 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_12000 3524 2736 gene locus_tag LOCUS_12010 3524 2736 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_12010 4015 3536 gene locus_tag LOCUS_12020 4015 3536 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_12020 4720 4028 gene locus_tag LOCUS_12030 4720 4028 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_12030 <5436 4730 gene locus_tag LOCUS_12040 <5436 4730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392375.1:peptidoglycan editing factor PgeF >Feature sequence139 1047 511 gene locus_tag LOCUS_12050 1047 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2085 1057 gene locus_tag LOCUS_12060 2085 1057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_12060 3040 2096 gene locus_tag LOCUS_12070 3040 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3467 3033 gene locus_tag LOCUS_12080 3467 3033 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870109.1 protein_id gnl|my_center|LOCUS_12080 3795 3442 gene locus_tag LOCUS_12090 3795 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4274 3873 gene locus_tag LOCUS_12100 4274 3873 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_12100 4501 4271 gene locus_tag LOCUS_12110 4501 4271 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_12110 4937 4671 gene locus_tag LOCUS_12120 4937 4671 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_12120 5151 4930 gene locus_tag LOCUS_12130 5151 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence140 <1 209 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcccccgcgaagggggcgac 639 349 gene locus_tag LOCUS_12140 gene cas2 639 349 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_12140 1677 646 gene locus_tag LOCUS_12150 gene cas1c 1677 646 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_12150 2340 1678 gene locus_tag LOCUS_12160 gene cas4 2340 1678 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_12160 3260 2337 gene locus_tag LOCUS_12170 gene cas7c 3260 2337 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_12170 5040 3253 gene locus_tag LOCUS_12180 gene cas8c 5040 3253 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence141 226 975 gene locus_tag LOCUS_12190 226 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 995 1294 gene locus_tag LOCUS_12200 995 1294 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_12200 1453 3159 gene locus_tag LOCUS_12210 1453 3159 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090269.1 protein_id gnl|my_center|LOCUS_12210 3247 4845 gene locus_tag LOCUS_12220 3247 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence142 1 231 gene locus_tag LOCUS_12230 1 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 438 1157 gene locus_tag LOCUS_12240 gene lptB 438 1157 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_12240 1167 2264 gene locus_tag LOCUS_12250 1167 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2278 3489 gene locus_tag LOCUS_12260 2278 3489 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583194.1 protein_id gnl|my_center|LOCUS_12260 3489 3905 gene locus_tag LOCUS_12270 gene ruvX 3489 3905 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_12270 3898 4356 gene locus_tag LOCUS_12280 3898 4356 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_12280 4370 5299 gene locus_tag LOCUS_12290 4370 5299 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703651.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence143 1369 524 gene locus_tag LOCUS_12300 gene rfbD 1369 524 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664653.1 protein_id gnl|my_center|LOCUS_12300 2158 1412 gene locus_tag LOCUS_12310 2158 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3269 2160 gene locus_tag LOCUS_12320 3269 2160 CDS product cysteine protease StiP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861280.1 protein_id gnl|my_center|LOCUS_12320 4249 3278 gene locus_tag LOCUS_12330 4249 3278 CDS product HpcH/HpaI aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028308.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence144 250 933 gene locus_tag LOCUS_12340 gene minC 250 933 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816782.1 protein_id gnl|my_center|LOCUS_12340 947 1756 gene locus_tag LOCUS_12350 gene minD 947 1756 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_12350 1773 2045 gene locus_tag LOCUS_12360 gene minE 1773 2045 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392080.1 protein_id gnl|my_center|LOCUS_12360 2045 3148 gene locus_tag LOCUS_12370 gene rodA 2045 3148 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence145 527 715 gene locus_tag LOCUS_12380 527 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 712 1308 gene locus_tag LOCUS_12390 712 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_12390 1328 1534 gene locus_tag LOCUS_12400 1328 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1531 2133 gene locus_tag LOCUS_12410 1531 2133 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943867.1 protein_id gnl|my_center|LOCUS_12410 2153 2380 gene locus_tag LOCUS_12420 2153 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2367 2789 gene locus_tag LOCUS_12430 2367 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2827 3012 gene locus_tag LOCUS_12440 2827 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3014 3622 gene locus_tag LOCUS_12450 3014 3622 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943867.1 protein_id gnl|my_center|LOCUS_12450 3909 3676 gene locus_tag LOCUS_12460 gene rpsR 3909 3676 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_12460 4380 3925 gene locus_tag LOCUS_12470 gene ssb 4380 3925 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_12470 4687 4400 gene locus_tag LOCUS_12480 gene rpsF 4687 4400 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_12480 5107 4916 gene locus_tag LOCUS_12490 gene rpmB 5107 4916 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence146 1297 266 gene locus_tag LOCUS_12500 1297 266 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_12500 2217 1426 gene locus_tag LOCUS_12510 gene dapB 2217 1426 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808837.1 protein_id gnl|my_center|LOCUS_12510 3481 2291 gene locus_tag LOCUS_12520 gene ftsZ 3481 2291 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_12520 3964 3581 gene locus_tag LOCUS_12530 3964 3581 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_12530 4640 3966 gene locus_tag LOCUS_12540 4640 3966 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393732.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence147 375 136 gene locus_tag LOCUS_12550 375 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1850 477 gene locus_tag LOCUS_12560 gene mnmE 1850 477 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_12560 2479 1973 gene locus_tag LOCUS_12570 2479 1973 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_12570 3821 2568 gene locus_tag LOCUS_12580 gene thiH 3821 2568 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_12580 4117 3881 gene locus_tag LOCUS_12590 4117 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4930 4166 gene locus_tag LOCUS_12600 4930 4166 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_12600 5301 4942 gene locus_tag LOCUS_12610 5301 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence148 611 258 gene locus_tag LOCUS_12620 611 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 898 614 gene locus_tag LOCUS_12630 898 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3569 1083 gene locus_tag LOCUS_12640 3569 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3999 3571 gene locus_tag LOCUS_12650 3999 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4865 4068 gene locus_tag LOCUS_12660 4865 4068 CDS product phage antirepressor KilAC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148557.1 protein_id gnl|my_center|LOCUS_12660 5263 4901 gene locus_tag LOCUS_12670 5263 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence149 587 72 gene locus_tag LOCUS_12680 587 72 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_12680 2514 841 gene locus_tag LOCUS_12690 2514 841 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_12690 3372 2515 gene locus_tag LOCUS_12700 gene folD 3372 2515 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226720.1 protein_id gnl|my_center|LOCUS_12700 3658 3506 gene locus_tag LOCUS_12710 3658 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 4027 3776 gene locus_tag LOCUS_12720 4027 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4297 4028 gene locus_tag LOCUS_12730 4297 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence150 359 1249 gene locus_tag LOCUS_12740 gene spo0J 359 1249 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_12740 1289 1762 gene locus_tag LOCUS_12750 1289 1762 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815159.1 protein_id gnl|my_center|LOCUS_12750 1772 2710 gene locus_tag LOCUS_12760 1772 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3527 2826 gene locus_tag LOCUS_12770 gene rsmG 3527 2826 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_12770 <5267 3520 gene locus_tag LOCUS_12780 <5267 3520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966993.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG >Feature sequence151 172 552 gene locus_tag LOCUS_12790 172 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 556 1722 gene locus_tag LOCUS_12800 556 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 2095 1856 gene locus_tag LOCUS_12810 2095 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2287 3426 gene locus_tag LOCUS_12820 2287 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3727 3512 gene locus_tag LOCUS_12830 3727 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3977 3729 gene locus_tag LOCUS_12840 3977 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4808 4254 gene locus_tag LOCUS_12850 4808 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence152 372 1808 gene locus_tag LOCUS_12860 372 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1796 3643 gene locus_tag LOCUS_12870 1796 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3664 4368 gene locus_tag LOCUS_12880 3664 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4382 4792 gene locus_tag LOCUS_12890 4382 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence153 2299 287 gene locus_tag LOCUS_12900 2299 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 2577 2939 gene locus_tag LOCUS_12910 2577 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3402 3013 gene locus_tag LOCUS_12920 3402 3013 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_12920 3563 3429 gene locus_tag LOCUS_12930 3563 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 5112 3583 gene locus_tag LOCUS_12940 5112 3583 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869044.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence154 1281 1826 gene locus_tag LOCUS_12950 1281 1826 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_12950 1848 3197 gene locus_tag LOCUS_12960 gene bioA 1848 3197 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_12960 3194 3769 gene locus_tag LOCUS_12970 3194 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3780 5129 gene locus_tag LOCUS_12980 3780 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence155 1002 199 gene locus_tag LOCUS_12990 1002 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12990 1593 1006 gene locus_tag LOCUS_13000 1593 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13000 1951 3306 gene locus_tag LOCUS_13010 1951 3306 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_13010 3319 3690 gene locus_tag LOCUS_13020 3319 3690 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_13020 3878 5149 gene locus_tag LOCUS_13030 gene serS 3878 5149 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722107.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence156 332 1174 gene locus_tag LOCUS_13040 332 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1829 1476 gene locus_tag LOCUS_13050 1829 1476 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135200.1 protein_id gnl|my_center|LOCUS_13050 2357 1920 gene locus_tag LOCUS_13060 2357 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2662 2459 gene locus_tag LOCUS_13070 2662 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 3191 2826 gene locus_tag LOCUS_13080 3191 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 3562 3335 gene locus_tag LOCUS_13090 3562 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 4141 3977 gene locus_tag LOCUS_13100 4141 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4323 4583 gene locus_tag LOCUS_13110 4323 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence157 1717 236 gene locus_tag LOCUS_13120 gene murE 1717 236 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_13120 1959 1750 gene locus_tag LOCUS_13130 1959 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2284 1943 gene locus_tag LOCUS_13140 2284 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2900 2307 gene locus_tag LOCUS_13150 gene plsY 2900 2307 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_13150 3362 4201 gene locus_tag LOCUS_13160 3362 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 4297 4956 gene locus_tag LOCUS_13170 4297 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence158 530 1270 gene locus_tag LOCUS_13180 530 1270 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_13180 1294 1725 gene locus_tag LOCUS_13190 1294 1725 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_13190 1709 2263 gene locus_tag LOCUS_13200 1709 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 2375 3034 gene locus_tag LOCUS_13210 2375 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_13210 3034 3777 gene locus_tag LOCUS_13220 3034 3777 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246039.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence159 2109 1861 gene locus_tag LOCUS_13230 2109 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3989 2106 gene locus_tag LOCUS_13240 gene dxs 3989 2106 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_13240 <5146 4046 gene locus_tag LOCUS_13250 <5146 4046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392674.1:fibronectin type III domain-containing protein >Feature sequence160 1235 996 gene locus_tag LOCUS_13260 1235 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2280 1345 gene locus_tag LOCUS_13270 2280 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2695 2270 gene locus_tag LOCUS_13280 2695 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4652 2829 gene locus_tag LOCUS_13290 4652 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5029 4868 gene locus_tag LOCUS_13300 5029 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence161 1771 773 gene locus_tag LOCUS_13310 1771 773 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_13310 2632 1937 gene locus_tag LOCUS_13320 2632 1937 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_13320 3462 2803 gene locus_tag LOCUS_13330 3462 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13330 4353 3481 gene locus_tag LOCUS_13340 4353 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13340 <5037 4364 gene locus_tag LOCUS_13350 <5037 4364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964030.1:triose-phosphate isomerase >Feature sequence162 103 333 gene locus_tag LOCUS_13360 103 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 327 800 gene locus_tag LOCUS_13370 327 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2076 895 gene locus_tag LOCUS_13380 2076 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 3022 2249 gene locus_tag LOCUS_13390 3022 2249 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694490.1 protein_id gnl|my_center|LOCUS_13390 3900 3001 gene locus_tag LOCUS_13400 3900 3001 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242748.1 protein_id gnl|my_center|LOCUS_13400 4796 3897 gene locus_tag LOCUS_13410 4796 3897 CDS product VirK/YbjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069570.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence163 28 1053 gene locus_tag LOCUS_13420 28 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1166 1516 gene locus_tag LOCUS_13430 1166 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1533 2639 gene locus_tag LOCUS_13440 1533 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_13440 2627 4258 gene locus_tag LOCUS_13450 2627 4258 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence164 1726 485 gene locus_tag LOCUS_13460 gene sstT 1726 485 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811470.1 protein_id gnl|my_center|LOCUS_13460 2985 1849 gene locus_tag LOCUS_13470 2985 1849 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_13470 4132 3014 gene locus_tag LOCUS_13480 4132 3014 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_13480 <4987 4144 gene locus_tag LOCUS_13490 <4987 4144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357632.1:permease-like cell division protein FtsX >Feature sequence165 <1 823 gene locus_tag LOCUS_13500 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966253.1:pyridoxal phosphate-dependent aminotransferase 1108 848 gene locus_tag LOCUS_13510 1108 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1428 1126 gene locus_tag LOCUS_13520 1428 1126 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809515.1 protein_id gnl|my_center|LOCUS_13520 1569 2189 gene locus_tag LOCUS_13530 1569 2189 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_13530 2605 2210 gene locus_tag LOCUS_13540 2605 2210 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461063.1 protein_id gnl|my_center|LOCUS_13540 3266 2709 gene locus_tag LOCUS_13550 3266 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13550 3902 3300 gene locus_tag LOCUS_13560 3902 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13560 4331 3915 gene locus_tag LOCUS_13570 4331 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence166 1242 3233 gene locus_tag LOCUS_13580 gene tkt 1242 3233 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_13580 3250 3864 gene locus_tag LOCUS_13590 3250 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence167 393 1406 gene locus_tag LOCUS_13600 gene aroF 393 1406 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_13600 1403 2281 gene locus_tag LOCUS_13610 1403 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2336 2410 gene locus_tag LOCUS_t00200 2336 2410 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3011 2454 gene locus_tag LOCUS_13620 3011 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4776 3364 gene locus_tag LOCUS_13630 4776 3364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence168 329 1213 gene locus_tag LOCUS_13640 329 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546408.1 protein_id gnl|my_center|LOCUS_13640 1240 3048 gene locus_tag LOCUS_13650 1240 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3055 3879 gene locus_tag LOCUS_13660 3055 3879 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972415.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence169 1256 135 gene locus_tag LOCUS_13670 1256 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2376 1276 gene locus_tag LOCUS_13680 2376 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2595 2470 gene locus_tag LOCUS_13690 2595 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3054 2596 gene locus_tag LOCUS_13700 3054 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3293 3051 gene locus_tag LOCUS_13710 3293 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 3620 3369 gene locus_tag LOCUS_13720 3620 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4134 3700 gene locus_tag LOCUS_13730 4134 3700 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_13730 4461 4147 gene locus_tag LOCUS_13740 4461 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence170 731 474 gene locus_tag LOCUS_13750 731 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1023 718 gene locus_tag LOCUS_13760 1023 718 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679831.1 protein_id gnl|my_center|LOCUS_13760 1256 1134 gene locus_tag LOCUS_13770 1256 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1487 1864 gene locus_tag LOCUS_13780 gene rpsL 1487 1864 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_13780 2010 2480 gene locus_tag LOCUS_13790 gene rpsG 2010 2480 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290440.1 protein_id gnl|my_center|LOCUS_13790 2505 4583 gene locus_tag LOCUS_13800 gene fusA 2505 4583 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459098.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence171 595 1017 gene locus_tag LOCUS_13810 595 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1469 1098 gene locus_tag LOCUS_13820 1469 1098 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_13820 2353 1589 gene locus_tag LOCUS_13830 2353 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13830 3832 2405 gene locus_tag LOCUS_13840 3832 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13840 <4798 4031 gene locus_tag LOCUS_13850 <4798 4031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948176.1:ATP-dependent chaperone ClpB >Feature sequence172 <1 2672 gene locus_tag LOCUS_13860 <1 2672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase 3234 2848 gene locus_tag LOCUS_13870 3234 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4544 3366 gene locus_tag LOCUS_13880 4544 3366 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence173 104 2089 gene locus_tag LOCUS_13890 104 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2275 2685 gene locus_tag LOCUS_13900 2275 2685 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_13900 2698 3273 gene locus_tag LOCUS_13910 2698 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3286 3555 gene locus_tag LOCUS_13920 3286 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3698 4096 gene locus_tag LOCUS_13930 gene nusB 3698 4096 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830247.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence174 2276 3634 gene locus_tag LOCUS_13940 2276 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3935 3732 gene locus_tag LOCUS_13950 3935 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence175 453 286 gene locus_tag LOCUS_13960 453 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 837 511 gene locus_tag LOCUS_13970 837 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 980 1315 gene locus_tag LOCUS_13980 980 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3775 1634 gene locus_tag LOCUS_13990 3775 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3981 4130 gene locus_tag LOCUS_14000 3981 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence176 609 1418 gene locus_tag LOCUS_14010 609 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1497 2498 gene locus_tag LOCUS_14020 1497 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2482 3600 gene locus_tag LOCUS_14030 2482 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence177 776 117 gene locus_tag LOCUS_14040 776 117 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_14040 1358 912 gene locus_tag LOCUS_14050 1358 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1461 2318 gene locus_tag LOCUS_14060 1461 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2315 3211 gene locus_tag LOCUS_14070 2315 3211 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_14070 3802 3200 gene locus_tag LOCUS_14080 3802 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4540 3821 gene locus_tag LOCUS_14090 4540 3821 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence178 1914 2564 gene locus_tag LOCUS_14100 gene cobC 1914 2564 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_14100 3799 2609 gene locus_tag LOCUS_14110 gene metK 3799 2609 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence179 91 1212 gene locus_tag LOCUS_14120 91 1212 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963395.1 protein_id gnl|my_center|LOCUS_14120 2462 1293 gene locus_tag LOCUS_14130 gene dnaJ 2462 1293 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_14130 4532 2664 gene locus_tag LOCUS_14140 gene dnaK 4532 2664 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence180 1084 368 gene locus_tag LOCUS_14150 1084 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2295 1087 gene locus_tag LOCUS_14160 2295 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 3060 2305 gene locus_tag LOCUS_14170 3060 2305 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_14170 3202 3468 gene locus_tag LOCUS_14180 3202 3468 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301196.1 protein_id gnl|my_center|LOCUS_14180 3484 3753 gene locus_tag LOCUS_14190 3484 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 <4692 3841 gene locus_tag LOCUS_14200 <4692 3841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009937638.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence181 123 1061 gene locus_tag LOCUS_14210 123 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1200 2525 gene locus_tag LOCUS_14220 gene dnaB 1200 2525 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_14220 2540 2911 gene locus_tag LOCUS_14230 2540 2911 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_14230 2898 3191 gene locus_tag LOCUS_14240 2898 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence182 611 435 gene locus_tag LOCUS_14250 611 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1000 1971 gene locus_tag LOCUS_14260 1000 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 1916 2071 gene locus_tag LOCUS_14270 1916 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 3788 2112 gene locus_tag LOCUS_14280 3788 2112 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_14280 <4665 3954 gene locus_tag LOCUS_14290 <4665 3954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860275.1:dicarboxylate/amino acid:cation symporter >Feature sequence183 64 207 gene locus_tag LOCUS_14300 64 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 337 1587 gene locus_tag LOCUS_14310 gene leuC 337 1587 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_14310 1587 2075 gene locus_tag LOCUS_14320 gene leuD 1587 2075 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583553.1 protein_id gnl|my_center|LOCUS_14320 2085 3149 gene locus_tag LOCUS_14330 gene leuB 2085 3149 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence184 79 1992 gene locus_tag LOCUS_14340 79 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2120 3379 gene locus_tag LOCUS_14350 2120 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence185 460 5 gene locus_tag LOCUS_14360 gene flgC 460 5 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_14360 892 473 gene locus_tag LOCUS_14370 gene flgB 892 473 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_14370 1080 1223 gene locus_tag LOCUS_14380 1080 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2623 1340 gene locus_tag LOCUS_14390 2623 1340 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_14390 3065 2682 gene locus_tag LOCUS_14400 gene nifU 3065 2682 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_14400 3940 3371 gene locus_tag LOCUS_14410 3940 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence186 44 1525 gene locus_tag LOCUS_14420 44 1525 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_14420 1609 2295 gene locus_tag LOCUS_14430 1609 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2306 3067 gene locus_tag LOCUS_14440 2306 3067 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381054.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence187 161 4387 gene locus_tag LOCUS_14450 161 4387 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812165.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence188 2193 1699 gene locus_tag LOCUS_14460 2193 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3271 2186 gene locus_tag LOCUS_14470 3271 2186 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_14470 <4544 3290 gene locus_tag LOCUS_14480 <4544 3290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258558.1:DUF1156 domain-containing protein >Feature sequence189 1278 304 gene locus_tag LOCUS_14490 gene galE 1278 304 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929113.1 protein_id gnl|my_center|LOCUS_14490 2389 1295 gene locus_tag LOCUS_14500 2389 1295 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351385.1 protein_id gnl|my_center|LOCUS_14500 2507 3466 gene locus_tag LOCUS_14510 2507 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 <4539 3542 gene locus_tag LOCUS_14520 <4539 3542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021739.1:glycosyl transferase family 90 >Feature sequence190 1239 3434 gene locus_tag LOCUS_14530 1239 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence191 991 212 gene locus_tag LOCUS_14540 991 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2883 1018 gene locus_tag LOCUS_14550 2883 1018 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_14550 3034 4422 gene locus_tag LOCUS_14560 gene nagE 3034 4422 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195339.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence192 1314 769 gene locus_tag LOCUS_14570 1314 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1945 1319 gene locus_tag LOCUS_14580 1945 1319 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925428.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence193 <1 754 gene locus_tag LOCUS_14590 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110342.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase 768 2174 gene locus_tag LOCUS_14600 gene murC 768 2174 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_14600 2272 3210 gene locus_tag LOCUS_14610 2272 3210 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_14610 3215 3778 gene locus_tag LOCUS_14620 3215 3778 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733220.1 protein_id gnl|my_center|LOCUS_14620 3995 3849 gene locus_tag LOCUS_14630 3995 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence194 500 1036 gene locus_tag LOCUS_14640 gene thpR 500 1036 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082411.1 protein_id gnl|my_center|LOCUS_14640 1042 3402 gene locus_tag LOCUS_14650 1042 3402 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_14650 3841 3554 gene locus_tag LOCUS_14660 3841 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence195 451 248 gene locus_tag LOCUS_14670 451 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 984 559 gene locus_tag LOCUS_14680 984 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1970 999 gene locus_tag LOCUS_14690 1970 999 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392766.1 protein_id gnl|my_center|LOCUS_14690 2751 2089 gene locus_tag LOCUS_14700 2751 2089 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_14700 3478 4185 gene locus_tag LOCUS_14710 gene deoD 3478 4185 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723411.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence196 38 622 gene locus_tag LOCUS_14720 38 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 627 1526 gene locus_tag LOCUS_14730 gene murQ 627 1526 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261744.1 protein_id gnl|my_center|LOCUS_14730 1523 2590 gene locus_tag LOCUS_14740 1523 2590 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948951.1 protein_id gnl|my_center|LOCUS_14740 3916 2738 gene locus_tag LOCUS_14750 3916 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence197 974 2722 gene locus_tag LOCUS_14760 974 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3121 2795 gene locus_tag LOCUS_14770 3121 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4208 3150 gene locus_tag LOCUS_14780 4208 3150 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071540979.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence198 1394 2362 gene locus_tag LOCUS_14790 1394 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3519 2407 gene locus_tag LOCUS_14800 3519 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence199 2424 946 gene locus_tag LOCUS_14810 2424 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2634 2969 gene locus_tag LOCUS_14820 2634 2969 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_14820 2969 3562 gene locus_tag LOCUS_14830 gene recR 2969 3562 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_14830 3562 3804 gene locus_tag LOCUS_14840 3562 3804 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963456.1 protein_id gnl|my_center|LOCUS_14840 3895 4302 gene locus_tag LOCUS_14850 3895 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence200 402 1685 gene locus_tag LOCUS_14860 gene aroA 402 1685 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664630.1 protein_id gnl|my_center|LOCUS_14860 1774 3264 gene locus_tag LOCUS_14870 1774 3264 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228115.1 protein_id gnl|my_center|LOCUS_14870 3318 3980 gene locus_tag LOCUS_14880 gene cmk 3318 3980 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence201 26 436 gene locus_tag LOCUS_14890 26 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 651 1838 gene locus_tag LOCUS_14900 651 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1856 3745 gene locus_tag LOCUS_14910 1856 3745 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence202 194 42 gene locus_tag LOCUS_14920 194 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 634 191 gene locus_tag LOCUS_14930 gene mscL 634 191 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_14930 987 1955 gene locus_tag LOCUS_14940 987 1955 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989333.1 protein_id gnl|my_center|LOCUS_14940 2567 2067 gene locus_tag LOCUS_14950 gene ilvN 2567 2067 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_14950 4257 2572 gene locus_tag LOCUS_14960 gene ilvB 4257 2572 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944692.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence203 1610 1218 gene locus_tag LOCUS_14970 1610 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2178 2408 gene locus_tag LOCUS_14980 2178 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2679 2912 gene locus_tag LOCUS_14990 2679 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4298 3192 gene locus_tag LOCUS_15000 4298 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence204 2086 56 gene locus_tag LOCUS_15010 2086 56 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_15010 2768 2079 gene locus_tag LOCUS_15020 2768 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4137 3031 gene locus_tag LOCUS_15030 gene prfB 4137 3031 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence205 2392 1172 gene locus_tag LOCUS_15040 2392 1172 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_15040 3095 2382 gene locus_tag LOCUS_15050 3095 2382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_15050 4281 3085 gene locus_tag LOCUS_15060 4281 3085 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence206 149 697 gene locus_tag LOCUS_15070 149 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 716 1534 gene locus_tag LOCUS_15080 716 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1509 2159 gene locus_tag LOCUS_15090 1509 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2159 3472 gene locus_tag LOCUS_15100 2159 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence207 1113 1328 gene locus_tag LOCUS_15110 1113 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1524 1736 gene locus_tag LOCUS_15120 1524 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4208 1776 gene locus_tag LOCUS_15130 gene gyrA 4208 1776 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence208 252 1784 gene locus_tag LOCUS_15140 252 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1794 2885 gene locus_tag LOCUS_15150 1794 2885 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351385.1 protein_id gnl|my_center|LOCUS_15150 3135 2968 gene locus_tag LOCUS_15160 3135 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3255 3893 gene locus_tag LOCUS_15170 3255 3893 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460781.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence209 619 23 gene locus_tag LOCUS_15180 gene coaE 619 23 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516169.1 protein_id gnl|my_center|LOCUS_15180 3280 620 gene locus_tag LOCUS_15190 gene polA 3280 620 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_15190 <4312 3277 gene locus_tag LOCUS_15200 <4312 3277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001146547.1:L,D-transpeptidase >Feature sequence210 241 396 gene locus_tag LOCUS_15210 241 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 483 740 gene locus_tag LOCUS_15220 483 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 740 1078 gene locus_tag LOCUS_15230 740 1078 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140100.1 protein_id gnl|my_center|LOCUS_15230 3094 1145 gene locus_tag LOCUS_15240 gene htpG 3094 1145 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_15240 3458 4201 gene locus_tag LOCUS_15250 3458 4201 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887613.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence211 905 96 gene locus_tag LOCUS_15260 905 96 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458995.1 protein_id gnl|my_center|LOCUS_15260 1934 1236 gene locus_tag LOCUS_15270 gene rnc 1934 1236 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965055.1 protein_id gnl|my_center|LOCUS_15270 3229 1931 gene locus_tag LOCUS_15280 gene fabF 3229 1931 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392466.1 protein_id gnl|my_center|LOCUS_15280 <4273 3338 gene locus_tag LOCUS_15290 <4273 3338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813418.1:nitronate monooxygenase >Feature sequence212 796 1140 gene locus_tag LOCUS_15300 796 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1137 2510 gene locus_tag LOCUS_15310 1137 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence213 421 576 gene locus_tag LOCUS_15320 421 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 613 903 gene locus_tag LOCUS_15330 613 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 896 1225 gene locus_tag LOCUS_15340 896 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1339 1758 gene locus_tag LOCUS_15350 1339 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4157 1791 gene locus_tag LOCUS_15360 4157 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence214 87 863 gene locus_tag LOCUS_15370 87 863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_15370 856 1659 gene locus_tag LOCUS_15380 856 1659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_15380 2986 1757 gene locus_tag LOCUS_15390 2986 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence215 <1 2143 gene locus_tag LOCUS_15400 <1 2143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390482.1:tetratricopeptide repeat protein 2376 2660 gene locus_tag LOCUS_15410 2376 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2843 3304 gene locus_tag LOCUS_15420 2843 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 3315 4004 gene locus_tag LOCUS_15430 3315 4004 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583890.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence216 770 342 gene locus_tag LOCUS_15440 770 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1207 788 gene locus_tag LOCUS_15450 1207 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1388 1603 gene locus_tag LOCUS_15460 1388 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 1659 1895 gene locus_tag LOCUS_15470 1659 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 2576 1953 gene locus_tag LOCUS_15480 2576 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3198 2548 gene locus_tag LOCUS_15490 3198 2548 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_15490 <4189 3198 gene locus_tag LOCUS_15500 <4189 3198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003731982.1:cell division protein FtsZ >Feature sequence217 926 477 gene locus_tag LOCUS_15510 926 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1167 901 gene locus_tag LOCUS_15520 1167 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1929 1201 gene locus_tag LOCUS_15530 1929 1201 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_15530 2405 1932 gene locus_tag LOCUS_15540 2405 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence218 357 1568 gene locus_tag LOCUS_15550 357 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1641 2321 gene locus_tag LOCUS_15560 gene kdsB 1641 2321 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_15560 2362 3012 gene locus_tag LOCUS_15570 2362 3012 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence219 258 887 gene locus_tag LOCUS_15580 258 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 913 1431 gene locus_tag LOCUS_15590 913 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1463 2272 gene locus_tag LOCUS_15600 1463 2272 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679305.1 protein_id gnl|my_center|LOCUS_15600 2372 2560 gene locus_tag LOCUS_15610 2372 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2541 3077 gene locus_tag LOCUS_15620 2541 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3179 3772 gene locus_tag LOCUS_15630 gene purN 3179 3772 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393541.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence220 1170 472 gene locus_tag LOCUS_15640 gene pssA 1170 472 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_15640 1805 1167 gene locus_tag LOCUS_15650 1805 1167 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969055.1 protein_id gnl|my_center|LOCUS_15650 2801 2076 gene locus_tag LOCUS_15660 2801 2076 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_15660 3160 2819 gene locus_tag LOCUS_15670 3160 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence221 629 3415 gene locus_tag LOCUS_15680 629 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 <4100 3501 gene locus_tag LOCUS_15690 <4100 3501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020461.1:flavodoxin >Feature sequence222 1321 17 gene locus_tag LOCUS_15700 1321 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3116 1362 gene locus_tag LOCUS_15710 3116 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 <4089 3147 gene locus_tag LOCUS_15720 <4089 3147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964611.1:DNA primase >Feature sequence223 1685 1365 gene locus_tag LOCUS_15730 1685 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 1866 2258 gene locus_tag LOCUS_15740 1866 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2403 2762 gene locus_tag LOCUS_15750 2403 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2981 3262 gene locus_tag LOCUS_15760 2981 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence224 933 508 gene locus_tag LOCUS_15770 933 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 3170 1455 gene locus_tag LOCUS_15780 3170 1455 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815325.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence225 19 1350 gene locus_tag LOCUS_15790 gene uxaC 19 1350 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_15790 1560 3038 gene locus_tag LOCUS_15800 1560 3038 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210409.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence226 183 605 gene locus_tag LOCUS_15810 183 605 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227995.1 protein_id gnl|my_center|LOCUS_15810 661 1689 gene locus_tag LOCUS_15820 661 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1823 3469 gene locus_tag LOCUS_15830 1823 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3611 3492 gene locus_tag LOCUS_15840 3611 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence227 1192 35 gene locus_tag LOCUS_15850 1192 35 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_15850 3333 1387 gene locus_tag LOCUS_15860 3333 1387 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040347516.1 protein_id gnl|my_center|LOCUS_15860 <4037 3321 gene locus_tag LOCUS_15870 <4037 3321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942882.1:lipopolysaccharide heptosyltransferase I >Feature sequence228 115 1473 gene locus_tag LOCUS_15880 gene ffh 115 1473 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_15880 1497 1772 gene locus_tag LOCUS_15890 gene rpsP 1497 1772 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_15890 1782 2021 gene locus_tag LOCUS_15900 1782 2021 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_15900 2321 2743 gene locus_tag LOCUS_15910 2321 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2715 3233 gene locus_tag LOCUS_15920 gene rimM 2715 3233 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_15920 3233 3958 gene locus_tag LOCUS_15930 gene trmD 3233 3958 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686892.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence229 206 1555 gene locus_tag LOCUS_15940 206 1555 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272513.1 protein_id gnl|my_center|LOCUS_15940 1715 2347 gene locus_tag LOCUS_15950 1715 2347 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_15950 2579 3595 gene locus_tag LOCUS_15960 gene hrcA 2579 3595 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence230 182 961 gene locus_tag LOCUS_15970 182 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1084 2361 gene locus_tag LOCUS_15980 1084 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3707 2358 gene locus_tag LOCUS_15990 3707 2358 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986374.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence231 781 497 gene locus_tag LOCUS_16000 781 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1004 1414 gene locus_tag LOCUS_16010 1004 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1517 2824 gene locus_tag LOCUS_16020 1517 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2834 3037 gene locus_tag LOCUS_16030 2834 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 3213 3533 gene locus_tag LOCUS_16040 3213 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence232 <1 592 gene locus_tag LOCUS_16050 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529319.1:ABC transporter substrate-binding protein 604 2772 gene locus_tag LOCUS_16060 604 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 3389 2892 gene locus_tag LOCUS_16070 3389 2892 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_16070 <3990 3386 gene locus_tag LOCUS_16080 <3990 3386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964008.1:endonuclease III >Feature sequence233 731 312 gene locus_tag LOCUS_16090 731 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1651 746 gene locus_tag LOCUS_16100 1651 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2241 2717 gene locus_tag LOCUS_16110 2241 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 2726 3346 gene locus_tag LOCUS_16120 gene yihA 2726 3346 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_16120 3349 3762 gene locus_tag LOCUS_16130 3349 3762 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966079.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence234 1606 2955 gene locus_tag LOCUS_16140 1606 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3260 2976 gene locus_tag LOCUS_16150 3260 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence235 414 1121 gene locus_tag LOCUS_16160 414 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 1321 1827 gene locus_tag LOCUS_16170 1321 1827 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082879.1 protein_id gnl|my_center|LOCUS_16170 1847 2359 gene locus_tag LOCUS_16180 1847 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2356 3417 gene locus_tag LOCUS_16190 2356 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3414 3707 gene locus_tag LOCUS_16200 3414 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence236 984 1403 gene locus_tag LOCUS_16210 984 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1416 1844 gene locus_tag LOCUS_16220 1416 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2277 2002 gene locus_tag LOCUS_16230 2277 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16230 2307 3041 gene locus_tag LOCUS_16240 gene sigH 2307 3041 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_16240 3133 3372 gene locus_tag LOCUS_16250 3133 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 <3950 3420 gene locus_tag LOCUS_16260 <3950 3420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435270.1:methionine gamma-lyase family protein >Feature sequence237 <1 542 gene locus_tag LOCUS_16270 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459866.1:aminopeptidase 523 1170 gene locus_tag LOCUS_16280 523 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1175 1885 gene locus_tag LOCUS_16290 1175 1885 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107872.1 protein_id gnl|my_center|LOCUS_16290 1886 3142 gene locus_tag LOCUS_16300 1886 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 3164 3748 gene locus_tag LOCUS_16310 3164 3748 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141641.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence238 <1 524 gene locus_tag LOCUS_16320 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000346779.1:site-specific DNA-methyltransferase 526 816 gene locus_tag LOCUS_16330 526 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 1052 1234 gene locus_tag LOCUS_16340 1052 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1240 3453 gene locus_tag LOCUS_16350 1240 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence239 <1 849 gene locus_tag LOCUS_16360 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002379416.1:heavy metal translocating P-type ATPase 1010 1270 gene locus_tag LOCUS_16370 1010 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1284 1433 gene locus_tag LOCUS_16380 1284 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence240 545 1837 gene locus_tag LOCUS_16390 545 1837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865209.1 protein_id gnl|my_center|LOCUS_16390 1866 2243 gene locus_tag LOCUS_16400 1866 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2247 3749 gene locus_tag LOCUS_16410 2247 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence241 1575 286 gene locus_tag LOCUS_16420 1575 286 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434259.1 protein_id gnl|my_center|LOCUS_16420 2991 1699 gene locus_tag LOCUS_16430 gene purB 2991 1699 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393548.1 protein_id gnl|my_center|LOCUS_16430 3894 3337 gene locus_tag LOCUS_16440 3894 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence242 202 825 gene locus_tag LOCUS_16450 202 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 960 1319 gene locus_tag LOCUS_16460 960 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3017 1320 gene locus_tag LOCUS_16470 3017 1320 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_16470 3124 3309 gene locus_tag LOCUS_16480 3124 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3396 3557 gene locus_tag LOCUS_16490 3396 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence243 657 1952 gene locus_tag LOCUS_16500 657 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 2008 2169 gene locus_tag LOCUS_16510 2008 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2250 2855 gene locus_tag LOCUS_16520 2250 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2930 3790 gene locus_tag LOCUS_16530 2930 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence244 748 368 gene locus_tag LOCUS_16540 748 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 892 1527 gene locus_tag LOCUS_16550 892 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2412 1573 gene locus_tag LOCUS_16560 2412 1573 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972462.1 protein_id gnl|my_center|LOCUS_16560 2574 2810 gene locus_tag LOCUS_16570 2574 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence245 657 581 gene locus_tag LOCUS_t00210 657 581 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1937 741 gene locus_tag LOCUS_16580 gene hydF 1937 741 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence246 2073 967 gene locus_tag LOCUS_16590 2073 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2381 2205 gene locus_tag LOCUS_16600 2381 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 <3856 2444 gene locus_tag LOCUS_16610 <3856 2444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869422.1:flagellin >Feature sequence247 137 670 gene locus_tag LOCUS_16620 137 670 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_16620 731 1834 gene locus_tag LOCUS_16630 731 1834 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_16630 3605 1863 gene locus_tag LOCUS_16640 3605 1863 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence248 608 468 gene locus_tag LOCUS_16650 608 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1467 676 gene locus_tag LOCUS_16660 1467 676 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_16660 2144 1461 gene locus_tag LOCUS_16670 2144 1461 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917062.1 protein_id gnl|my_center|LOCUS_16670 3471 2254 gene locus_tag LOCUS_16680 3471 2254 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence249 578 177 gene locus_tag LOCUS_16690 578 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1990 575 gene locus_tag LOCUS_16700 1990 575 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_16700 2225 2737 gene locus_tag LOCUS_16710 2225 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3750 2785 gene locus_tag LOCUS_16720 gene mdh 3750 2785 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760830.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence250 608 1624 gene locus_tag LOCUS_16730 608 1624 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_16730 1694 2410 gene locus_tag LOCUS_16740 1694 2410 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_16740 2414 3277 gene locus_tag LOCUS_16750 2414 3277 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence251 <1 939 gene locus_tag LOCUS_16760 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964731.1:hemolysin family protein 939 2225 gene locus_tag LOCUS_16770 939 2225 CDS product hexokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680422.1 protein_id gnl|my_center|LOCUS_16770 <3818 2926 gene locus_tag LOCUS_16780 <3818 2926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970886.1:nodulation protein NolG >Feature sequence252 1255 164 gene locus_tag LOCUS_16790 1255 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2075 1389 gene locus_tag LOCUS_16800 2075 1389 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_16800 2932 2072 gene locus_tag LOCUS_16810 gene aroE 2932 2072 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_16810 <3810 2925 gene locus_tag LOCUS_16820 <3810 2925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965086.1:nicotinate phosphoribosyltransferase >Feature sequence253 352 101 gene locus_tag LOCUS_16830 352 101 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_16830 1364 345 gene locus_tag LOCUS_16840 gene gmd 1364 345 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965479.1 protein_id gnl|my_center|LOCUS_16840 2639 1716 gene locus_tag LOCUS_16850 2639 1716 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_16850 3382 2639 gene locus_tag LOCUS_16860 3382 2639 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_16860 3775 3688 gene locus_tag LOCUS_t00220 3775 3688 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence254 1408 2055 gene locus_tag LOCUS_16870 1408 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2067 3539 gene locus_tag LOCUS_16880 2067 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence255 2343 847 gene locus_tag LOCUS_16890 2343 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3188 2382 gene locus_tag LOCUS_16900 gene larE 3188 2382 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_16900 3748 3173 gene locus_tag LOCUS_16910 3748 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence256 747 316 gene locus_tag LOCUS_16920 gene mraZ 747 316 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_16920 1068 1226 gene locus_tag LOCUS_16930 1068 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 1186 3204 gene locus_tag LOCUS_16940 1186 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence257 795 637 gene locus_tag LOCUS_16950 795 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1283 1501 gene locus_tag LOCUS_16960 1283 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1498 1761 gene locus_tag LOCUS_16970 1498 1761 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_16970 2450 3046 gene locus_tag LOCUS_16980 gene nadD 2450 3046 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_16980 3043 3615 gene locus_tag LOCUS_16990 gene yqeK 3043 3615 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence258 <1 585 gene locus_tag LOCUS_17000 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815914.1:bifunctional glucose-1-phosphatase/inositol phosphatase 842 1174 gene locus_tag LOCUS_17010 842 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1187 2320 gene locus_tag LOCUS_17020 1187 2320 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_17020 2393 3160 gene locus_tag LOCUS_17030 2393 3160 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence259 837 1319 gene locus_tag LOCUS_17040 837 1319 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_17040 1680 2696 gene locus_tag LOCUS_17050 gene plsX 1680 2696 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_17050 2708 3655 gene locus_tag LOCUS_17060 gene fabK 2708 3655 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence260 280 1911 gene locus_tag LOCUS_17070 gene hcp 280 1911 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966698.1 protein_id gnl|my_center|LOCUS_17070 2132 2812 gene locus_tag LOCUS_17080 2132 2812 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence261 <1 1098 gene locus_tag LOCUS_17090 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268198.1:HlyD family type I secretion periplasmic adaptor subunit 1100 3226 gene locus_tag LOCUS_17100 1100 3226 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence262 177 953 gene locus_tag LOCUS_17110 gene speD 177 953 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_17110 954 2405 gene locus_tag LOCUS_17120 954 2405 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_17120 2982 2695 gene locus_tag LOCUS_17130 2982 2695 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869934.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence263 355 194 gene locus_tag LOCUS_17140 355 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1136 384 gene locus_tag LOCUS_17150 1136 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2469 1915 gene locus_tag LOCUS_17160 2469 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2891 2496 gene locus_tag LOCUS_17170 2891 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3555 3160 gene locus_tag LOCUS_17180 3555 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence264 404 1504 gene locus_tag LOCUS_17190 gene csaB 404 1504 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_17190 1501 2340 gene locus_tag LOCUS_17200 gene yqeB 1501 2340 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437839.1 protein_id gnl|my_center|LOCUS_17200 2297 2965 gene locus_tag LOCUS_17210 2297 2965 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_17210 3244 2984 gene locus_tag LOCUS_17220 3244 2984 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_17220 3449 3246 gene locus_tag LOCUS_17230 3449 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence265 672 199 gene locus_tag LOCUS_17240 672 199 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_17240 1441 644 gene locus_tag LOCUS_17250 gene miaA 1441 644 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129541.1 protein_id gnl|my_center|LOCUS_17250 2105 1410 gene locus_tag LOCUS_17260 2105 1410 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249096.1 protein_id gnl|my_center|LOCUS_17260 3350 2352 gene locus_tag LOCUS_17270 3350 2352 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816804.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence266 1703 804 gene locus_tag LOCUS_17280 1703 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2457 1708 gene locus_tag LOCUS_17290 2457 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 3376 2474 gene locus_tag LOCUS_17300 3376 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence267 1825 824 gene locus_tag LOCUS_17310 1825 824 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367304.1 protein_id gnl|my_center|LOCUS_17310 <3677 1843 gene locus_tag LOCUS_17320 <3677 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545775.1:TonB-dependent receptor >Feature sequence268 25 237 gene locus_tag LOCUS_17330 25 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 288 1280 gene locus_tag LOCUS_17340 288 1280 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_17340 1273 2079 gene locus_tag LOCUS_17350 1273 2079 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_17350 2093 3625 gene locus_tag LOCUS_17360 2093 3625 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence269 <1 1120 gene locus_tag LOCUS_17370 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000765153.1:exonuclease SbcCD subunit D 1133 1939 gene locus_tag LOCUS_17380 1133 1939 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679604.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence270 74 1024 gene locus_tag LOCUS_17390 74 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1564 1761 gene locus_tag LOCUS_17400 1564 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1906 2484 gene locus_tag LOCUS_17410 1906 2484 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_17410 2589 2714 gene locus_tag LOCUS_17420 2589 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2699 2923 gene locus_tag LOCUS_17430 2699 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence271 1043 777 gene locus_tag LOCUS_17440 1043 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1402 1220 gene locus_tag LOCUS_17450 1402 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2887 1526 gene locus_tag LOCUS_17460 gene murD 2887 1526 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_17460 3629 2892 gene locus_tag LOCUS_17470 3629 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence272 1360 569 gene locus_tag LOCUS_17480 1360 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 2649 1372 gene locus_tag LOCUS_17490 2649 1372 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942610.1 protein_id gnl|my_center|LOCUS_17490 3414 3025 gene locus_tag LOCUS_17500 gene rpsI 3414 3025 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence273 650 309 gene locus_tag LOCUS_17510 650 309 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_17510 735 1496 gene locus_tag LOCUS_17520 735 1496 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_17520 1499 2836 gene locus_tag LOCUS_17530 1499 2836 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence274 1 498 gene locus_tag LOCUS_17540 1 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 783 2303 gene locus_tag LOCUS_17550 gene flgE 783 2303 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986372.1 protein_id gnl|my_center|LOCUS_17550 3321 2425 gene locus_tag LOCUS_17560 3321 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence275 <1 1637 gene locus_tag LOCUS_17570 <1 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870396.1:[citrate (pro-3S)-lyase] ligase 1683 3017 gene locus_tag LOCUS_17580 gene rfbH 1683 3017 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_17580 3049 3366 gene locus_tag LOCUS_17590 3049 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence276 118 432 gene locus_tag LOCUS_17600 118 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2892 433 gene locus_tag LOCUS_17610 2892 433 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458989.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence277 2364 1048 gene locus_tag LOCUS_17620 2364 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence278 <1 1536 gene locus_tag LOCUS_17630 <1 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1530 2189 gene locus_tag LOCUS_17640 1530 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2182 3456 gene locus_tag LOCUS_17650 2182 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence279 2593 992 gene locus_tag LOCUS_17660 gene glpA 2593 992 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit GlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259132.1 protein_id gnl|my_center|LOCUS_17660 <3542 2612 gene locus_tag LOCUS_17670 <3542 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392746.1:NCS2 family permease >Feature sequence280 1 1176 gene locus_tag LOCUS_17680 1 1176 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936350.1 protein_id gnl|my_center|LOCUS_17680 1187 2317 gene locus_tag LOCUS_17690 1187 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2298 3416 gene locus_tag LOCUS_17700 2298 3416 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence281 349 167 gene locus_tag LOCUS_17710 349 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 560 363 gene locus_tag LOCUS_17720 560 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 918 781 gene locus_tag LOCUS_17730 918 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1297 899 gene locus_tag LOCUS_17740 1297 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1623 1964 gene locus_tag LOCUS_17750 1623 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 3180 2155 gene locus_tag LOCUS_17760 3180 2155 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence282 39 1217 gene locus_tag LOCUS_17770 39 1217 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_17770 1252 1965 gene locus_tag LOCUS_17780 1252 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 2705 2025 gene locus_tag LOCUS_17790 2705 2025 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896313.1 protein_id gnl|my_center|LOCUS_17790 2919 2686 gene locus_tag LOCUS_17800 2919 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3151 2906 gene locus_tag LOCUS_17810 3151 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 3179 3437 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcgtcccctttcggggattaagttttaaaac >Feature sequence283 1498 1157 gene locus_tag LOCUS_17820 1498 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2748 1624 gene locus_tag LOCUS_17830 2748 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3260 2790 gene locus_tag LOCUS_17840 3260 2790 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966078.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence284 382 1203 gene locus_tag LOCUS_17850 382 1203 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_17850 1465 1160 gene locus_tag LOCUS_17860 1465 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1908 1498 gene locus_tag LOCUS_17870 1908 1498 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957066.1 protein_id gnl|my_center|LOCUS_17870 2310 2038 gene locus_tag LOCUS_17880 2310 2038 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221875345.1 protein_id gnl|my_center|LOCUS_17880 >Feature sequence285 998 606 gene locus_tag LOCUS_17890 998 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 1463 1266 gene locus_tag LOCUS_17900 1463 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 <3462 1911 gene locus_tag LOCUS_17910 <3462 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000857598.1:amino acid ABC transporter ATP-binding/permease protein >Feature sequence286 921 247 gene locus_tag LOCUS_17920 921 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2570 1026 gene locus_tag LOCUS_17930 2570 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3267 2542 gene locus_tag LOCUS_17940 3267 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence287 631 428 gene locus_tag LOCUS_17950 631 428 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985621.1 protein_id gnl|my_center|LOCUS_17950 882 646 gene locus_tag LOCUS_17960 882 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 853 1587 gene locus_tag LOCUS_17970 853 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 1591 1806 gene locus_tag LOCUS_17980 1591 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 2109 2882 gene locus_tag LOCUS_17990 2109 2882 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_17990 2961 3242 gene locus_tag LOCUS_18000 2961 3242 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889719.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence288 1935 2864 gene locus_tag LOCUS_18010 1935 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence289 <1 753 gene locus_tag LOCUS_18020 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942733.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase 911 2326 gene locus_tag LOCUS_18030 911 2326 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113502.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence290 19 1278 gene locus_tag LOCUS_18040 gene miaB 19 1278 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence291 1002 658 gene locus_tag LOCUS_18050 1002 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 1428 1222 gene locus_tag LOCUS_18060 1428 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 2345 1452 gene locus_tag LOCUS_18070 2345 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2490 2350 gene locus_tag LOCUS_18080 2490 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3267 2557 gene locus_tag LOCUS_18090 3267 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence292 <3380 1383 gene locus_tag LOCUS_18100 <3380 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476570.1:AAA family ATPase >Feature sequence293 286 612 gene locus_tag LOCUS_18110 286 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 805 1962 gene locus_tag LOCUS_18120 gene aroC 805 1962 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_18120 1959 2480 gene locus_tag LOCUS_18130 1959 2480 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_18130 >Feature sequence294 934 2256 gene locus_tag LOCUS_18140 934 2256 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870215.1 protein_id gnl|my_center|LOCUS_18140 2145 2948 gene locus_tag LOCUS_18150 2145 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence295 <3371 701 gene locus_tag LOCUS_18160 <3371 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392401.1:carbamoyl-phosphate synthase large subunit >Feature sequence296 <1 1042 gene locus_tag LOCUS_18170 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005111066.1:amidohydrolase 1058 2785 gene locus_tag LOCUS_18180 1058 2785 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111066.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence297 32 358 gene locus_tag LOCUS_18190 32 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 358 1260 gene locus_tag LOCUS_18200 gene hslO 358 1260 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_18200 1291 2187 gene locus_tag LOCUS_18210 1291 2187 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_18210 2351 3292 gene locus_tag LOCUS_18220 2351 3292 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence298 1280 171 gene locus_tag LOCUS_18230 1280 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2014 1322 gene locus_tag LOCUS_18240 2014 1322 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836533.1 protein_id gnl|my_center|LOCUS_18240 2684 2025 gene locus_tag LOCUS_18250 2684 2025 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_18250 <3349 2697 gene locus_tag LOCUS_18260 <3349 2697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048307.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence299 1950 28 gene locus_tag LOCUS_18270 gene thrS 1950 28 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_18270 3261 2098 gene locus_tag LOCUS_18280 3261 2098 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence300 1212 754 gene locus_tag LOCUS_18290 1212 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 2701 1223 gene locus_tag LOCUS_18300 2701 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 <3335 2705 gene locus_tag LOCUS_18310 <3335 2705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081431.1:SDR family oxidoreductase >Feature sequence301 634 558 gene locus_tag LOCUS_t00230 634 558 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1802 933 gene locus_tag LOCUS_18320 gene tsf 1802 933 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_18320 2549 1833 gene locus_tag LOCUS_18330 gene rpsB 2549 1833 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence302 81 533 gene locus_tag LOCUS_18340 81 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 749 2077 gene locus_tag LOCUS_18350 gene scfB 749 2077 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_18350 <3321 2164 gene locus_tag LOCUS_18360 <3321 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870016.1:S-layer homology domain-containing protein >Feature sequence303 <1 1250 gene locus_tag LOCUS_18370 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003422928.1:histidine--tRNA ligase 1388 3178 gene locus_tag LOCUS_18380 gene aspS 1388 3178 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence304 236 149 gene locus_tag LOCUS_t00240 236 149 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 494 339 gene locus_tag LOCUS_18390 494 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 <3305 987 gene locus_tag LOCUS_18400 <3305 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016374.1:type III restriction-modification system endonuclease >Feature sequence305 169 711 gene locus_tag LOCUS_18410 169 711 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_18410 880 2148 gene locus_tag LOCUS_18420 880 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 2186 2533 gene locus_tag LOCUS_tm00010 2186 2533 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <3292 2568 gene locus_tag LOCUS_18430 <3292 2568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006996423.1:Na+/H+ antiporter NhaC family protein >Feature sequence306 622 1419 gene locus_tag LOCUS_18440 622 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 1540 2016 gene locus_tag LOCUS_18450 1540 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2087 3076 gene locus_tag LOCUS_18460 2087 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence307 166 573 gene locus_tag LOCUS_18470 gene ansR 166 573 CDS product HTH-type transcriptional regulator AnsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893556.1 protein_id gnl|my_center|LOCUS_18470 627 1832 gene locus_tag LOCUS_18480 627 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1890 3119 gene locus_tag LOCUS_18490 1890 3119 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288357.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence308 <1 1763 gene locus_tag LOCUS_18500 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211477748.1:methyl-accepting chemotaxis protein 1891 2088 gene locus_tag LOCUS_18510 1891 2088 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_18510 3276 2197 gene locus_tag LOCUS_18520 3276 2197 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461867.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence309 1350 70 gene locus_tag LOCUS_18530 1350 70 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_18530 1738 1382 gene locus_tag LOCUS_18540 1738 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 1901 1683 gene locus_tag LOCUS_18550 1901 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3275 2148 gene locus_tag LOCUS_18560 gene nagZ 3275 2148 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence310 496 173 gene locus_tag LOCUS_18570 496 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2424 493 gene locus_tag LOCUS_18580 2424 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2685 2840 gene locus_tag LOCUS_18590 2685 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence311 1515 577 gene locus_tag LOCUS_18600 1515 577 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_18600 1852 1541 gene locus_tag LOCUS_18610 1852 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2103 2252 gene locus_tag LOCUS_18620 2103 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2366 3013 gene locus_tag LOCUS_18630 2366 3013 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence312 852 694 gene locus_tag LOCUS_18640 852 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1342 854 gene locus_tag LOCUS_18650 1342 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 2034 1369 gene locus_tag LOCUS_18660 2034 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2807 2085 gene locus_tag LOCUS_18670 2807 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence313 2353 101 gene locus_tag LOCUS_18680 gene topA 2353 101 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_18680 2756 2358 gene locus_tag LOCUS_18690 2756 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence314 358 467 gene locus_tag LOCUS_r00010 358 467 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 638 1150 gene locus_tag LOCUS_18700 638 1150 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_18700 1532 1816 gene locus_tag LOCUS_18710 1532 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1800 2120 gene locus_tag LOCUS_18720 1800 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2175 2250 gene locus_tag LOCUS_t00250 2175 2250 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2252 2327 gene locus_tag LOCUS_t00260 2252 2327 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2591 2890 gene locus_tag LOCUS_18730 2591 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 3013 3204 gene locus_tag LOCUS_18740 3013 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence315 947 9 gene locus_tag LOCUS_18750 gene thrB 947 9 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_18750 2247 949 gene locus_tag LOCUS_18760 2247 949 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816736.1 protein_id gnl|my_center|LOCUS_18760 3190 2252 gene locus_tag LOCUS_18770 3190 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence316 2301 1534 gene locus_tag LOCUS_18780 2301 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2506 2303 gene locus_tag LOCUS_18790 2506 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2849 2646 gene locus_tag LOCUS_18800 2849 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence317 41 841 gene locus_tag LOCUS_18810 41 841 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679604.1 protein_id gnl|my_center|LOCUS_18810 871 1023 gene locus_tag LOCUS_18820 871 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1224 2759 gene locus_tag LOCUS_18830 1224 2759 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence318 <1 1055 gene locus_tag LOCUS_18840 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198645.1:chemotaxis response regulator protein-glutamate methylesterase 1145 1465 gene locus_tag LOCUS_18850 1145 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 1518 1727 gene locus_tag LOCUS_18860 1518 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1766 2278 gene locus_tag LOCUS_18870 1766 2278 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707815.1 protein_id gnl|my_center|LOCUS_18870 2275 2406 gene locus_tag LOCUS_18880 2275 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2637 3032 gene locus_tag LOCUS_18890 2637 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18890 3045 3215 gene locus_tag LOCUS_18900 3045 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 >Feature sequence319 360 1601 gene locus_tag LOCUS_18910 360 1601 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_18910 1713 2993 gene locus_tag LOCUS_18920 1713 2993 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence320 <1 672 gene locus_tag LOCUS_18930 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392618.1:threonine-phosphate decarboxylase CobD 862 946 gene locus_tag LOCUS_t00270 862 946 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1127 2938 gene locus_tag LOCUS_18940 gene uvrC 1127 2938 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_18940 3010 3171 gene locus_tag LOCUS_18950 3010 3171 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence321 222 10 gene locus_tag LOCUS_18960 222 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 345 683 gene locus_tag LOCUS_18970 345 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 1986 793 gene locus_tag LOCUS_18980 gene coaBC 1986 793 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_18980 2276 1983 gene locus_tag LOCUS_18990 2276 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2875 2273 gene locus_tag LOCUS_19000 gene gmk 2875 2273 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_19000 3141 2872 gene locus_tag LOCUS_19010 3141 2872 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583796.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence322 >Feature sequence323 <1 639 gene locus_tag LOCUS_19020 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259630.1:response regulator 675 1802 gene locus_tag LOCUS_19030 675 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1799 2770 gene locus_tag LOCUS_19040 1799 2770 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256415.1 protein_id gnl|my_center|LOCUS_19040 2792 2980 gene locus_tag LOCUS_19050 2792 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence324 1651 266 gene locus_tag LOCUS_19060 1651 266 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_19060 3116 1938 gene locus_tag LOCUS_19070 3116 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence325 1407 2165 gene locus_tag LOCUS_19080 1407 2165 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989482.1 protein_id gnl|my_center|LOCUS_19080 2286 2447 gene locus_tag LOCUS_19090 2286 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2533 2712 gene locus_tag LOCUS_19100 2533 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2658 2846 gene locus_tag LOCUS_19110 2658 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2864 3016 gene locus_tag LOCUS_19120 2864 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence326 872 2134 gene locus_tag LOCUS_19130 872 2134 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_19130 2277 3092 gene locus_tag LOCUS_19140 2277 3092 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458834.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence327 1379 366 gene locus_tag LOCUS_19150 1379 366 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166416.1 protein_id gnl|my_center|LOCUS_19150 2128 1445 gene locus_tag LOCUS_19160 2128 1445 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence328 902 507 gene locus_tag LOCUS_19170 902 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 1214 912 gene locus_tag LOCUS_19180 1214 912 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214787.1 protein_id gnl|my_center|LOCUS_19180 1760 1341 gene locus_tag LOCUS_19190 1760 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 2056 1757 gene locus_tag LOCUS_19200 2056 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence329 1621 113 gene locus_tag LOCUS_19210 1621 113 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_19210 3042 1624 gene locus_tag LOCUS_19220 3042 1624 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence330 158 760 gene locus_tag LOCUS_19230 158 760 CDS product IS607-like element ISTko2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250792.1 protein_id gnl|my_center|LOCUS_19230 744 2000 gene locus_tag LOCUS_19240 744 2000 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence331 63 833 gene locus_tag LOCUS_19250 63 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 845 1276 gene locus_tag LOCUS_19260 845 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1285 1920 gene locus_tag LOCUS_19270 1285 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2110 3096 gene locus_tag LOCUS_19280 gene manA 2110 3096 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence332 733 2013 gene locus_tag LOCUS_19290 733 2013 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_19290 <3135 2107 gene locus_tag LOCUS_19300 <3135 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence333 695 66 gene locus_tag LOCUS_19310 695 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19310 2331 841 gene locus_tag LOCUS_19320 gene pelB 2331 841 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_19320 <3127 2482 gene locus_tag LOCUS_19330 <3127 2482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964015.1:altronate dehydratase family protein >Feature sequence334 118 1248 gene locus_tag LOCUS_19340 gene tgt 118 1248 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944694.1 protein_id gnl|my_center|LOCUS_19340 1374 1664 gene locus_tag LOCUS_19350 gene yajC 1374 1664 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869962.1 protein_id gnl|my_center|LOCUS_19350 1661 2245 gene locus_tag LOCUS_19360 1661 2245 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence335 1 1548 gene locus_tag LOCUS_19370 1 1548 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158908668.1 protein_id gnl|my_center|LOCUS_19370 3074 1824 gene locus_tag LOCUS_19380 gene der 3074 1824 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_19380 >Feature sequence336 1093 149 gene locus_tag LOCUS_19390 1093 149 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854796.1 protein_id gnl|my_center|LOCUS_19390 2261 1209 gene locus_tag LOCUS_19400 2261 1209 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731552.1 protein_id gnl|my_center|LOCUS_19400 2894 2265 gene locus_tag LOCUS_19410 2894 2265 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_19410 >Feature sequence337 119 739 gene locus_tag LOCUS_19420 119 739 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_19420 739 2919 gene locus_tag LOCUS_19430 739 2919 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393788.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence338 <1 907 gene locus_tag LOCUS_19440 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000839094.1:LTA synthase family protein 1048 1317 gene locus_tag LOCUS_19450 1048 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1314 1775 gene locus_tag LOCUS_19460 1314 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence339 <1 1296 gene locus_tag LOCUS_19470 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084785566.1:amidophosphoribosyltransferase 1293 2342 gene locus_tag LOCUS_19480 gene purM 1293 2342 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_19480 2335 2946 gene locus_tag LOCUS_19490 gene purN 2335 2946 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence340 1936 446 gene locus_tag LOCUS_19500 1936 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 2410 2111 gene locus_tag LOCUS_19510 2410 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 >Feature sequence341 1570 812 gene locus_tag LOCUS_19520 gene rluB 1570 812 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_19520 3039 1783 gene locus_tag LOCUS_19530 3039 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence342 1107 2321 gene locus_tag LOCUS_19540 1107 2321 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_19540 <3068 2513 gene locus_tag LOCUS_19550 <3068 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869422.1:flagellin >Feature sequence343 245 928 gene locus_tag LOCUS_19560 245 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 929 2110 gene locus_tag LOCUS_19570 929 2110 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939356.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence344 1095 82 gene locus_tag LOCUS_19580 1095 82 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050371.1 protein_id gnl|my_center|LOCUS_19580 2199 1585 gene locus_tag LOCUS_19590 2199 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_19590 2387 2199 gene locus_tag LOCUS_19600 2387 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 2972 2526 gene locus_tag LOCUS_19610 2972 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence345 1407 205 gene locus_tag LOCUS_19620 1407 205 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222164.1 protein_id gnl|my_center|LOCUS_19620 2426 1404 gene locus_tag LOCUS_19630 2426 1404 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044860.1 protein_id gnl|my_center|LOCUS_19630 <3044 2474 gene locus_tag LOCUS_19640 <3044 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034284930.1:glucose 1-dehydrogenase >Feature sequence346 <1 548 gene locus_tag LOCUS_19650 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170291172.1:protein translocase subunit SecD 541 1440 gene locus_tag LOCUS_19660 gene secF 541 1440 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_19660 1455 2912 gene locus_tag LOCUS_19670 1455 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence347 1045 5 gene locus_tag LOCUS_19680 1045 5 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004270929.1 protein_id gnl|my_center|LOCUS_19680 1250 1128 gene locus_tag LOCUS_19690 1250 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 2008 1448 gene locus_tag LOCUS_19700 2008 1448 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764801.1 protein_id gnl|my_center|LOCUS_19700 2089 2892 gene locus_tag LOCUS_19710 2089 2892 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence348 1487 2107 gene locus_tag LOCUS_19720 1487 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 <3010 2264 gene locus_tag LOCUS_19730 <3010 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272214.1:methyl-accepting chemotaxis protein >Feature sequence349 1208 1825 gene locus_tag LOCUS_19740 1208 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence350 669 223 gene locus_tag LOCUS_19750 669 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 968 738 gene locus_tag LOCUS_19760 968 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1658 1185 gene locus_tag LOCUS_19770 1658 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1865 2725 gene locus_tag LOCUS_19780 1865 2725 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence351 394 1698 gene locus_tag LOCUS_19790 394 1698 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_19790 1685 2260 gene locus_tag LOCUS_19800 1685 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence352 430 1614 gene locus_tag LOCUS_19810 gene nifS 430 1614 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_19810 1792 2724 gene locus_tag LOCUS_19820 gene cysK 1792 2724 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence353 292 666 gene locus_tag LOCUS_19830 292 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1402 932 gene locus_tag LOCUS_19840 1402 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 1638 1399 gene locus_tag LOCUS_19850 1638 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 2286 1813 gene locus_tag LOCUS_19860 gene ribE 2286 1813 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 protein_id gnl|my_center|LOCUS_19860 <2971 2287 gene locus_tag LOCUS_19870 <2971 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392434.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence354 102 1121 gene locus_tag LOCUS_19880 102 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence355 364 519 gene locus_tag LOCUS_19890 364 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence356 496 329 gene locus_tag LOCUS_19900 496 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 846 511 gene locus_tag LOCUS_19910 846 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1635 859 gene locus_tag LOCUS_19920 1635 859 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_19920 2227 1781 gene locus_tag LOCUS_19930 2227 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 2438 2208 gene locus_tag LOCUS_19940 2438 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2667 2404 gene locus_tag LOCUS_19950 2667 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 >Feature sequence357 52 1338 gene locus_tag LOCUS_19960 52 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1353 2060 gene locus_tag LOCUS_19970 1353 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2103 2876 gene locus_tag LOCUS_19980 2103 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 >Feature sequence358 1766 228 gene locus_tag LOCUS_19990 1766 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 2752 1772 gene locus_tag LOCUS_20000 2752 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence359 2486 825 gene locus_tag LOCUS_20010 2486 825 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence360 862 224 gene locus_tag LOCUS_20020 862 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1455 967 gene locus_tag LOCUS_20030 gene coaD 1455 967 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_20030 2015 1452 gene locus_tag LOCUS_20040 gene rsmD 2015 1452 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_20040 <2890 2027 gene locus_tag LOCUS_20050 <2890 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861472.1:VanW family protein >Feature sequence361 169 1110 gene locus_tag LOCUS_20060 169 1110 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_20060 1110 1970 gene locus_tag LOCUS_20070 gene truB 1110 1970 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392567.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence362 2097 916 gene locus_tag LOCUS_20080 2097 916 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095131.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence363 1554 736 gene locus_tag LOCUS_20090 1554 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 <2838 1569 gene locus_tag LOCUS_20100 <2838 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868685.1:ribonuclease J >Feature sequence364 <1 2101 gene locus_tag LOCUS_20110 <1 2101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943552.1:homocysteine S-methyltransferase family protein >Feature sequence365 3 524 gene locus_tag LOCUS_20120 3 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 524 1111 gene locus_tag LOCUS_20130 524 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2220 1108 gene locus_tag LOCUS_20140 2220 1108 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359848.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence366 <1 1203 gene locus_tag LOCUS_20150 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546258.1:FAD-dependent oxidoreductase 2067 1351 gene locus_tag LOCUS_20160 2067 1351 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_20160 <2822 2107 gene locus_tag LOCUS_20170 <2822 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144351385.1:DUF4422 domain-containing protein >Feature sequence367 422 1669 gene locus_tag LOCUS_20180 gene glyA 422 1669 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence368 397 1530 gene locus_tag LOCUS_20190 397 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 >Feature sequence369 >Feature sequence370 <1 633 gene locus_tag LOCUS_20200 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081431.1:SDR family oxidoreductase 711 1232 gene locus_tag LOCUS_20210 711 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 1324 1767 gene locus_tag LOCUS_20220 gene dtd 1324 1767 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence371 1332 211 gene locus_tag LOCUS_20230 1332 211 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_20230 1875 1387 gene locus_tag LOCUS_20240 1875 1387 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_20240 2679 2095 gene locus_tag LOCUS_20250 2679 2095 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_20250 >Feature sequence372 1434 2729 gene locus_tag LOCUS_20260 gene tig 1434 2729 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105215.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence373 1307 498 gene locus_tag LOCUS_20270 1307 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 1858 1310 gene locus_tag LOCUS_20280 1858 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 2430 1876 gene locus_tag LOCUS_20290 2430 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence374 <1 2034 gene locus_tag LOCUS_20300 <1 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459232.1:BREX-1 system phosphatase PglZ type A 2049 2243 gene locus_tag LOCUS_20310 2049 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20310 >Feature sequence375 172 327 gene locus_tag LOCUS_20320 172 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 398 532 gene locus_tag LOCUS_20330 398 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 894 595 gene locus_tag LOCUS_20340 894 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 1550 924 gene locus_tag LOCUS_20350 1550 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 1784 1557 gene locus_tag LOCUS_20360 1784 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2436 2230 gene locus_tag LOCUS_20370 2436 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2693 2439 gene locus_tag LOCUS_20380 2693 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence376 <1 2625 gene locus_tag LOCUS_20390 <1 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence377 476 1354 gene locus_tag LOCUS_20400 476 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20400 >Feature sequence378 1040 2500 gene locus_tag LOCUS_20410 1040 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2502 2699 gene locus_tag LOCUS_20420 2502 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 >Feature sequence379 >Feature sequence380 492 1193 gene locus_tag LOCUS_20430 492 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1270 1473 gene locus_tag LOCUS_20440 1270 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence381 159 2696 gene locus_tag LOCUS_20450 159 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 >Feature sequence382 486 1202 gene locus_tag LOCUS_20460 gene pyrF 486 1202 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_20460 1199 1774 gene locus_tag LOCUS_20470 gene pyrE 1199 1774 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_20470 1901 2203 gene locus_tag LOCUS_20480 1901 2203 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290178.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence383 135 812 gene locus_tag LOCUS_20490 135 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2549 873 gene locus_tag LOCUS_20500 2549 873 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence384 1683 529 gene locus_tag LOCUS_20510 1683 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 2600 1773 gene locus_tag LOCUS_20520 2600 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence385 1804 365 gene locus_tag LOCUS_20530 1804 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2641 1898 gene locus_tag LOCUS_20540 2641 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence386 36 248 gene locus_tag LOCUS_20550 36 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 340 1206 gene locus_tag LOCUS_20560 340 1206 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966051.1 protein_id gnl|my_center|LOCUS_20560 1341 2609 gene locus_tag LOCUS_20570 1341 2609 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786117.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence387 373 1089 gene locus_tag LOCUS_20580 373 1089 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_20580 1079 2545 gene locus_tag LOCUS_20590 1079 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence388 2598 2026 gene locus_tag LOCUS_20600 2598 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence389 66 1664 gene locus_tag LOCUS_20610 66 1664 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_20610 1744 2514 gene locus_tag LOCUS_20620 1744 2514 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_20620 >Feature sequence390 2006 219 gene locus_tag LOCUS_20630 2006 219 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458911.1 protein_id gnl|my_center|LOCUS_20630 2357 2025 gene locus_tag LOCUS_20640 2357 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence391 2224 1361 gene locus_tag LOCUS_20650 2224 1361 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence392 1535 570 gene locus_tag LOCUS_20660 gene hemB 1535 570 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_20660 2620 1538 gene locus_tag LOCUS_20670 2620 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence393 <1 612 gene locus_tag LOCUS_20680 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392075.1:rod shape-determining protein MreC 609 1118 gene locus_tag LOCUS_20690 609 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence394 1982 675 gene locus_tag LOCUS_20700 gene hemA 1982 675 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_20700 2529 1951 gene locus_tag LOCUS_20710 2529 1951 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence395 688 191 gene locus_tag LOCUS_20720 688 191 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_20720 1095 691 gene locus_tag LOCUS_20730 gene ndk 1095 691 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_20730 1620 1096 gene locus_tag LOCUS_20740 1620 1096 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_20740 2348 1635 gene locus_tag LOCUS_20750 2348 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence396 >Feature sequence397 1433 1152 gene locus_tag LOCUS_20760 gene groES 1433 1152 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_20760 1796 2383 gene locus_tag LOCUS_20770 1796 2383 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence398 747 133 gene locus_tag LOCUS_20780 747 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1656 760 gene locus_tag LOCUS_20790 1656 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2306 1785 gene locus_tag LOCUS_20800 2306 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 >Feature sequence399 111 1064 gene locus_tag LOCUS_20810 111 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1081 2295 gene locus_tag LOCUS_20820 1081 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 >Feature sequence400 1806 145 gene locus_tag LOCUS_20830 1806 145 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_20830 2244 2558 gene locus_tag LOCUS_20840 2244 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence401 2 898 gene locus_tag LOCUS_20850 2 898 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256414.1 protein_id gnl|my_center|LOCUS_20850 1071 1415 gene locus_tag LOCUS_20860 1071 1415 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660457.1 protein_id gnl|my_center|LOCUS_20860 1412 1759 gene locus_tag LOCUS_20870 1412 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1735 1956 gene locus_tag LOCUS_20880 1735 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence402 220 936 gene locus_tag LOCUS_20890 220 936 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_20890 1561 974 gene locus_tag LOCUS_20900 1561 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 2203 1988 gene locus_tag LOCUS_20910 2203 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 2241 2486 gene locus_tag LOCUS_20920 2241 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence403 <2577 316 gene locus_tag LOCUS_20930 <2577 316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964971.1:glycogen/starch/alpha-glucan phosphorylase >Feature sequence404 18 809 gene locus_tag LOCUS_20940 18 809 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_20940 822 2012 gene locus_tag LOCUS_20950 822 2012 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948689.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence405 121 1245 gene locus_tag LOCUS_20960 gene glgC 121 1245 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_20960 1275 2381 gene locus_tag LOCUS_20970 gene glgD 1275 2381 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_20970 >Feature sequence406 1217 111 gene locus_tag LOCUS_20980 1217 111 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_20980 1904 1323 gene locus_tag LOCUS_20990 1904 1323 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869892.1 protein_id gnl|my_center|LOCUS_20990 <2555 1925 gene locus_tag LOCUS_21000 <2555 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930639.1:flagellar basal body P-ring formation chaperone FlgA >Feature sequence407 >Feature sequence408 57 2504 gene locus_tag LOCUS_21010 57 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21010 >Feature sequence409 424 2478 gene locus_tag LOCUS_21020 424 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence410 2249 1482 gene locus_tag LOCUS_21030 2249 1482 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434038.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence411 359 586 gene locus_tag LOCUS_21040 359 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 589 2313 gene locus_tag LOCUS_21050 589 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence412 <1 750 gene locus_tag LOCUS_21060 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870427.1:D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase 747 1715 gene locus_tag LOCUS_21070 gene rfaD 747 1715 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094908.1 protein_id gnl|my_center|LOCUS_21070 1708 2208 gene locus_tag LOCUS_21080 gene gmhB 1708 2208 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966334.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence413 2437 512 gene locus_tag LOCUS_21090 2437 512 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880393.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence414 524 150 gene locus_tag LOCUS_21100 gene rplL 524 150 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870240.1 protein_id gnl|my_center|LOCUS_21100 1123 569 gene locus_tag LOCUS_21110 gene rplJ 1123 569 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_21110 1981 1298 gene locus_tag LOCUS_21120 gene rplA 1981 1298 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_21120 2455 2030 gene locus_tag LOCUS_21130 gene rplK 2455 2030 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence415 992 540 gene locus_tag LOCUS_21140 992 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1179 1994 gene locus_tag LOCUS_21150 1179 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence416 194 799 gene locus_tag LOCUS_21160 gene clpP 194 799 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_21160 854 2134 gene locus_tag LOCUS_21170 gene clpX 854 2134 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence417 1269 1018 gene locus_tag LOCUS_21180 1269 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 2230 1382 gene locus_tag LOCUS_21190 2230 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 >Feature sequence418 747 172 gene locus_tag LOCUS_21200 747 172 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_21200 2479 749 gene locus_tag LOCUS_21210 gene iorA 2479 749 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence419 161 994 gene locus_tag LOCUS_21220 161 994 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_21220 1260 1631 gene locus_tag LOCUS_21230 1260 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 1682 1837 gene locus_tag LOCUS_21240 1682 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 >Feature sequence420 1027 464 gene locus_tag LOCUS_21250 1027 464 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_21250 2490 1024 gene locus_tag LOCUS_21260 gene trpE 2490 1024 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence421 300 1508 gene locus_tag LOCUS_21270 300 1508 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21270 1990 2196 gene locus_tag LOCUS_21280 1990 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 >Feature sequence422 462 2228 gene locus_tag LOCUS_21290 gene cas8c 462 2228 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602912.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence423 638 1003 gene locus_tag LOCUS_21300 638 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1206 1460 gene locus_tag LOCUS_21310 1206 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1460 1864 gene locus_tag LOCUS_21320 1460 1864 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence424 <1 524 gene locus_tag LOCUS_21330 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256415.1:type II secretion system F family protein 587 787 gene locus_tag LOCUS_21340 587 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 876 1295 gene locus_tag LOCUS_21350 876 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence425 332 1558 gene locus_tag LOCUS_21360 332 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1578 2141 gene locus_tag LOCUS_21370 1578 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence426 98 850 gene locus_tag LOCUS_21380 98 850 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_21380 860 1534 gene locus_tag LOCUS_21390 860 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 >Feature sequence427 <2466 294 gene locus_tag LOCUS_21400 <2466 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244988.1:helicase-exonuclease AddAB subunit AddB >Feature sequence428 537 49 gene locus_tag LOCUS_21410 537 49 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 protein_id gnl|my_center|LOCUS_21410 1934 522 gene locus_tag LOCUS_21420 gene cysS 1934 522 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence429 107 928 gene locus_tag LOCUS_21430 gene hag 107 928 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_21430 988 2172 gene locus_tag LOCUS_21440 988 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence430 <1 594 gene locus_tag LOCUS_21450 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048346.1:fumarate hydratase 610 1176 gene locus_tag LOCUS_21460 610 1176 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_21460 1273 1899 gene locus_tag LOCUS_21470 gene sdhC 1273 1899 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222512.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence431 >Feature sequence432 80 1378 gene locus_tag LOCUS_21480 80 1378 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_21480 1391 1816 gene locus_tag LOCUS_21490 1391 1816 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_21490 2199 1972 gene locus_tag LOCUS_21500 2199 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21500 >Feature sequence433 316 1356 gene locus_tag LOCUS_21510 gene ruvB 316 1356 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_21510 1364 1984 gene locus_tag LOCUS_21520 1364 1984 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence434 <2419 345 gene locus_tag LOCUS_21530 <2419 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231947.1:flagellar biosynthesis protein FlhA >Feature sequence435 1261 143 gene locus_tag LOCUS_21540 1261 143 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_21540 <2418 1408 gene locus_tag LOCUS_21550 <2418 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963679.1:MFS transporter >Feature sequence436 >Feature sequence437 755 1855 gene locus_tag LOCUS_21560 gene fliB 755 1855 CDS product flagellin lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096963.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence438 612 289 gene locus_tag LOCUS_21570 612 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 2256 631 gene locus_tag LOCUS_21580 2256 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence439 549 316 gene locus_tag LOCUS_21590 gene acpP 549 316 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_21590 1335 592 gene locus_tag LOCUS_21600 gene fabG 1335 592 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_21600 2281 1337 gene locus_tag LOCUS_21610 gene fabD 2281 1337 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence440 20 991 gene locus_tag LOCUS_21620 20 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence441 >Feature sequence442 1261 584 gene locus_tag LOCUS_21630 gene ispD 1261 584 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_21630 1533 2234 gene locus_tag LOCUS_21640 1533 2234 CDS product DUF2225 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963960.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence443 <1 520 gene locus_tag LOCUS_21650 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392140.1:glycine--tRNA ligase subunit alpha >Feature sequence444 <1 736 gene locus_tag LOCUS_21660 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence445 >Feature sequence446 955 719 gene locus_tag LOCUS_21670 955 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 1712 1047 gene locus_tag LOCUS_21680 1712 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence447 329 1633 gene locus_tag LOCUS_21690 329 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 2317 1799 gene locus_tag LOCUS_21700 2317 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence448 <1 1116 gene locus_tag LOCUS_21710 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861898.1:NAD-dependent DNA ligase LigA 1180 1866 gene locus_tag LOCUS_21720 1180 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence449 637 1872 gene locus_tag LOCUS_21730 637 1872 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence450 356 490 gene locus_tag LOCUS_21740 356 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 494 847 gene locus_tag LOCUS_21750 494 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 847 1260 gene locus_tag LOCUS_21760 847 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703702.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence451 <1 1225 gene locus_tag LOCUS_21770 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393063.1:GspE/PulE family protein 1215 2243 gene locus_tag LOCUS_21780 1215 2243 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404551.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence452 <2304 818 gene locus_tag LOCUS_21790 <2304 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368406.1:conjugal transfer protein TraG >Feature sequence453 1121 90 gene locus_tag LOCUS_21800 1121 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2133 1129 gene locus_tag LOCUS_21810 2133 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence454 943 521 gene locus_tag LOCUS_21820 943 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1278 946 gene locus_tag LOCUS_21830 1278 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence455 1191 388 gene locus_tag LOCUS_21840 gene lpxI 1191 388 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_21840 2019 1204 gene locus_tag LOCUS_21850 gene lpxA 2019 1204 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565963.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence456 >Feature sequence457 <1 1848 gene locus_tag LOCUS_21860 <1 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787605.1:alpha amylase C-terminal domain-containing protein >Feature sequence458 218 811 gene locus_tag LOCUS_21870 218 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 811 2085 gene locus_tag LOCUS_21880 gene purD 811 2085 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence459 990 742 gene locus_tag LOCUS_21890 990 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2097 1129 gene locus_tag LOCUS_21900 2097 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence460 1558 401 gene locus_tag LOCUS_21910 1558 401 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266646.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence461 <1 933 gene locus_tag LOCUS_21920 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644128.1:DNA helicase PcrA >Feature sequence462 570 776 gene locus_tag LOCUS_21930 570 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 1555 839 gene locus_tag LOCUS_21940 1555 839 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002380521.1 protein_id gnl|my_center|LOCUS_21940 2206 1562 gene locus_tag LOCUS_21950 2206 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence463 >Feature sequence464 863 1327 gene locus_tag LOCUS_21960 863 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1972 1379 gene locus_tag LOCUS_21970 1972 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence465 <1 588 gene locus_tag LOCUS_21980 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044978750.1:Rpn family recombination-promoting nuclease/putative transposase 605 1270 gene locus_tag LOCUS_21990 gene hypB 605 1270 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_21990 1267 1809 gene locus_tag LOCUS_22000 1267 1809 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence466 1413 2240 gene locus_tag LOCUS_22010 gene lpxC 1413 2240 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940177.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence467 386 649 gene locus_tag LOCUS_22020 gene rpsT 386 649 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_22020 728 1237 gene locus_tag LOCUS_22030 728 1237 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence468 675 1058 gene locus_tag LOCUS_22040 675 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 2193 1255 gene locus_tag LOCUS_22050 2193 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence469 383 126 gene locus_tag LOCUS_22060 383 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22060 2140 593 gene locus_tag LOCUS_22070 2140 593 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence470 <1 1101 gene locus_tag LOCUS_22080 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1221 2138 gene locus_tag LOCUS_22090 1221 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence471 1273 89 gene locus_tag LOCUS_22100 1273 89 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_22100 1749 1270 gene locus_tag LOCUS_22110 1749 1270 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence472 >Feature sequence473 <1 1134 gene locus_tag LOCUS_22120 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963512.1:N-acetylglucosamine-6-phosphate deacetylase 1223 1372 gene locus_tag LOCUS_22130 gene rpmG 1223 1372 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_22130 1372 1584 gene locus_tag LOCUS_22140 1372 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1598 2125 gene locus_tag LOCUS_22150 gene nusG 1598 2125 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_22150 >Feature sequence474 107 886 gene locus_tag LOCUS_22160 gene motA 107 886 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458996.1 protein_id gnl|my_center|LOCUS_22160 890 1684 gene locus_tag LOCUS_22170 890 1684 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809827.1 protein_id gnl|my_center|LOCUS_22170 1730 2134 gene locus_tag LOCUS_22180 1730 2134 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_22180 >Feature sequence475 586 245 gene locus_tag LOCUS_22190 586 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 726 923 gene locus_tag LOCUS_22200 726 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 935 1114 gene locus_tag LOCUS_22210 935 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1129 1284 gene locus_tag LOCUS_22220 1129 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence476 245 1291 gene locus_tag LOCUS_22230 245 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 <2184 1333 gene locus_tag LOCUS_22240 <2184 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966243.1:UDP-glucose 4-epimerase GalE >Feature sequence477 <2174 324 gene locus_tag LOCUS_22250 <2174 324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263812.1:DUF87 domain-containing protein note possible pseudo, frameshifted >Feature sequence478 1319 498 gene locus_tag LOCUS_22260 1319 498 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_22260 2134 1370 gene locus_tag LOCUS_22270 2134 1370 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040604.1 protein_id gnl|my_center|LOCUS_22270 >Feature sequence479 1921 35 gene locus_tag LOCUS_22280 1921 35 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence480 1815 1240 gene locus_tag LOCUS_22290 gene cobO 1815 1240 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence481 >Feature sequence482 51 1256 gene locus_tag LOCUS_22300 gene csm6 51 1256 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904058.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence483 422 1330 gene locus_tag LOCUS_22310 422 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1357 2109 gene locus_tag LOCUS_22320 1357 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence484 1356 391 gene locus_tag LOCUS_22330 1356 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1978 1316 gene locus_tag LOCUS_22340 1978 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence485 33 950 gene locus_tag LOCUS_22350 33 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 952 2091 gene locus_tag LOCUS_22360 952 2091 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence486 683 507 gene locus_tag LOCUS_22370 683 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1044 697 gene locus_tag LOCUS_22380 1044 697 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_22380 <2147 1176 gene locus_tag LOCUS_22390 <2147 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454735.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence487 375 112 gene locus_tag LOCUS_22400 375 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 755 471 gene locus_tag LOCUS_22410 755 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1179 769 gene locus_tag LOCUS_22420 1179 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 1803 1264 gene locus_tag LOCUS_22430 1803 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence488 >Feature sequence489 <1 751 gene locus_tag LOCUS_22440 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948601.1:cobyric acid synthase 754 1704 gene locus_tag LOCUS_22450 gene cbiB 754 1704 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 protein_id gnl|my_center|LOCUS_22450 >Feature sequence490 1219 131 gene locus_tag LOCUS_22460 1219 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890729.1 protein_id gnl|my_center|LOCUS_22460 <2128 1351 gene locus_tag LOCUS_22470 <2128 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076053070.1:alpha/beta hydrolase >Feature sequence491 433 918 gene locus_tag LOCUS_22480 433 918 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816201.1 protein_id gnl|my_center|LOCUS_22480 945 1307 gene locus_tag LOCUS_22490 945 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1327 2076 gene locus_tag LOCUS_22500 gene whiG 1327 2076 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence492 <1 1463 gene locus_tag LOCUS_22510 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272214.1:methyl-accepting chemotaxis protein <2126 1558 gene locus_tag LOCUS_22520 <2126 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000986372.1:flagellar hook protein FlgE >Feature sequence493 <1 1035 gene locus_tag LOCUS_22530 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202936.1:DegT/DnrJ/EryC1/StrS family aminotransferase 998 2086 gene locus_tag LOCUS_22540 998 2086 CDS product acyl-protein synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707830.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence494 139 924 gene locus_tag LOCUS_22550 gene codY 139 924 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774472.1 protein_id gnl|my_center|LOCUS_22550 >Feature sequence495 852 1385 gene locus_tag LOCUS_22560 852 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1382 1510 gene locus_tag LOCUS_22570 1382 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence496 265 74 gene locus_tag LOCUS_22580 265 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 629 303 gene locus_tag LOCUS_22590 629 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1062 649 gene locus_tag LOCUS_22600 1062 649 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969926.1 protein_id gnl|my_center|LOCUS_22600 1255 1025 gene locus_tag LOCUS_22610 1255 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence497 1416 118 gene locus_tag LOCUS_22620 1416 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1937 1473 gene locus_tag LOCUS_22630 1937 1473 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963906.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence498 <1 628 gene locus_tag LOCUS_22640 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172625967.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence499 >Feature sequence500 215 517 gene locus_tag LOCUS_22650 215 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 588 800 gene locus_tag LOCUS_22660 588 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 >Feature sequence501 819 337 gene locus_tag LOCUS_22670 819 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence502 227 33 gene locus_tag LOCUS_22680 227 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 1021 230 gene locus_tag LOCUS_22690 gene flgG 1021 230 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869894.1 protein_id gnl|my_center|LOCUS_22690 <2085 1294 gene locus_tag LOCUS_22700 <2085 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937818.1:flagellar basal-body rod protein FlgF >Feature sequence503 >Feature sequence504 353 1780 gene locus_tag LOCUS_22710 353 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence505 <1 725 gene locus_tag LOCUS_22720 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679949.1:Rpn family recombination-promoting nuclease/putative transposase 1969 806 gene locus_tag LOCUS_22730 1969 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence506 133 546 gene locus_tag LOCUS_22740 133 546 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 protein_id gnl|my_center|LOCUS_22740 543 1280 gene locus_tag LOCUS_22750 543 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 >Feature sequence507 520 1608 gene locus_tag LOCUS_22760 520 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence508 1593 787 gene locus_tag LOCUS_22770 1593 787 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_22770 >Feature sequence509 <1 564 gene locus_tag LOCUS_22780 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082850.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence510 296 721 gene locus_tag LOCUS_22790 296 721 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968595.1 protein_id gnl|my_center|LOCUS_22790 723 1106 gene locus_tag LOCUS_22800 723 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1946 1113 gene locus_tag LOCUS_22810 1946 1113 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence511 1441 203 gene locus_tag LOCUS_22820 1441 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 >Feature sequence512 98 1861 gene locus_tag LOCUS_22830 98 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence513 457 717 gene locus_tag LOCUS_22840 457 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 729 1808 gene locus_tag LOCUS_22850 gene chvE 729 1808 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727839.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence514 1744 290 gene locus_tag LOCUS_22860 1744 290 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence515 279 1832 gene locus_tag LOCUS_22870 279 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence516 32 1360 gene locus_tag LOCUS_22880 gene tilS 32 1360 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_22880 1353 1901 gene locus_tag LOCUS_22890 gene hpt 1353 1901 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_22890 >Feature sequence517 <2018 429 gene locus_tag LOCUS_22900 <2018 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399936.1:SMC family ATPase >Feature sequence518 1604 1915 gene locus_tag LOCUS_22910 1604 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22910 >Feature sequence519 <2014 597 gene locus_tag LOCUS_22920 <2014 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933791.1:glycosyltransferase family 9 protein >Feature sequence520 586 768 gene locus_tag LOCUS_22930 586 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 769 1845 gene locus_tag LOCUS_22940 769 1845 CDS product autotransporter strand-loop-strand O-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205625.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22940 >Feature sequence521 1955 597 gene locus_tag LOCUS_22950 gene glmU 1955 597 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071041.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence522 52 906 gene locus_tag LOCUS_22960 gene htpX 52 906 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence523 1045 32 gene locus_tag LOCUS_22970 1045 32 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880498.1 protein_id gnl|my_center|LOCUS_22970 1829 1038 gene locus_tag LOCUS_22980 gene folE2 1829 1038 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence524 <2004 931 gene locus_tag LOCUS_22990 <2004 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000765275.1:DNA topoisomerase III >Feature sequence525 <2002 1066 gene locus_tag LOCUS_23000 <2002 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879167.1:phenylacetate--CoA ligase family protein >Feature sequence526 1737 49 gene locus_tag LOCUS_23010 gene tlpC 1737 49 CDS product methyl-accepting chemotaxis protein TlpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246498.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence527 791 552 gene locus_tag LOCUS_23020 791 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 1073 807 gene locus_tag LOCUS_23030 1073 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1278 1048 gene locus_tag LOCUS_23040 1278 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 1521 1369 gene locus_tag LOCUS_23050 1521 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence528 465 244 gene locus_tag LOCUS_23060 465 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1789 491 gene locus_tag LOCUS_23070 1789 491 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_23070 >Feature sequence529 1646 816 gene locus_tag LOCUS_23080 1646 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23080 >Feature sequence530 <1 1344 gene locus_tag LOCUS_23090 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922218.1:DEAD/DEAH box helicase family protein >Feature sequence531 665 1207 gene locus_tag LOCUS_23100 665 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 1194 1700 gene locus_tag LOCUS_23110 1194 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 1700 1933 gene locus_tag LOCUS_23120 1700 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681036.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence532 353 1261 gene locus_tag LOCUS_23130 353 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1289 1525 gene locus_tag LOCUS_23140 1289 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 1757 1458 gene locus_tag LOCUS_23150 1757 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 >Feature sequence533 127 903 gene locus_tag LOCUS_23160 gene murI 127 903 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229860.1 protein_id gnl|my_center|LOCUS_23160 <1975 1145 gene locus_tag LOCUS_23170 <1975 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399229.1:DNA helicase RecQ >Feature sequence534 569 204 gene locus_tag LOCUS_23180 569 204 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_23180 1435 632 gene locus_tag LOCUS_23190 1435 632 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence535 792 208 gene locus_tag LOCUS_23200 792 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 961 1584 gene locus_tag LOCUS_23210 961 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 1577 1939 gene locus_tag LOCUS_23220 1577 1939 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256827.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence536 <1 1492 gene locus_tag LOCUS_23230 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011787402.1:CRISPR-associated helicase/endonuclease Cas3 >Feature sequence537 1809 796 gene locus_tag LOCUS_23240 1809 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence538 486 172 gene locus_tag LOCUS_23250 486 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1367 774 gene locus_tag LOCUS_23260 1367 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence539 495 1241 gene locus_tag LOCUS_23270 495 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 1273 1467 gene locus_tag LOCUS_23280 1273 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1454 1777 gene locus_tag LOCUS_23290 1454 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence540 >Feature sequence541 99 968 gene locus_tag LOCUS_23300 99 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 1102 1776 gene locus_tag LOCUS_23310 1102 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence542 1516 584 gene locus_tag LOCUS_23320 1516 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1918 1661 gene locus_tag LOCUS_23330 1918 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence543 >Feature sequence544 1688 1813 gene locus_tag LOCUS_23340 1688 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence545 175 999 gene locus_tag LOCUS_23350 gene dapF 175 999 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_23350 999 1871 gene locus_tag LOCUS_23360 999 1871 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_23360 >Feature sequence546 1378 860 gene locus_tag LOCUS_23370 1378 860 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966468.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence547 418 1254 gene locus_tag LOCUS_23380 418 1254 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669815.1 protein_id gnl|my_center|LOCUS_23380 1324 1464 gene locus_tag LOCUS_23390 1324 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 >Feature sequence548 1148 225 gene locus_tag LOCUS_23400 1148 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1794 1555 gene locus_tag LOCUS_23410 1794 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence549 1342 623 gene locus_tag LOCUS_23420 1342 623 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073072.1 protein_id gnl|my_center|LOCUS_23420 1591 1358 gene locus_tag LOCUS_23430 1591 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23430 >Feature sequence550 599 847 gene locus_tag LOCUS_23440 599 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 1450 866 gene locus_tag LOCUS_23450 1450 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 >Feature sequence551 19 1800 gene locus_tag LOCUS_23460 gene iorA 19 1800 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021731.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence552 >Feature sequence553 1776 478 gene locus_tag LOCUS_23470 1776 478 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence554 419 156 gene locus_tag LOCUS_23480 419 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence555 >Feature sequence556 145 5 gene locus_tag LOCUS_23490 145 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1339 146 gene locus_tag LOCUS_23500 1339 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23500 1872 1336 gene locus_tag LOCUS_23510 1872 1336 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290973.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence557 416 1459 gene locus_tag LOCUS_23520 416 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence558 1148 207 gene locus_tag LOCUS_23530 1148 207 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497489.1 protein_id gnl|my_center|LOCUS_23530 >Feature sequence559 1 267 gene locus_tag LOCUS_23540 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 395 583 gene locus_tag LOCUS_23550 395 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence560 1841 1095 gene locus_tag LOCUS_23560 1841 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence561 30 683 gene locus_tag LOCUS_23570 30 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence562 1588 962 gene locus_tag LOCUS_23580 1588 962 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091831579.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence563 191 409 gene locus_tag LOCUS_23590 191 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 406 672 gene locus_tag LOCUS_23600 406 672 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964533.1 protein_id gnl|my_center|LOCUS_23600 <1844 712 gene locus_tag LOCUS_23610 <1844 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261026.1:flippase >Feature sequence564 >Feature sequence565 <1 1208 gene locus_tag LOCUS_23620 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385807.1:carboxylesterase family protein 1297 1743 gene locus_tag LOCUS_23630 1297 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence566 <1825 860 gene locus_tag LOCUS_23640 <1825 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680830.1:flagellar hook protein FlgE >Feature sequence567 1563 277 gene locus_tag LOCUS_23650 1563 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence568 >Feature sequence569 1695 1012 gene locus_tag LOCUS_23660 1695 1012 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_23660 >Feature sequence570 192 1628 gene locus_tag LOCUS_23670 gene glgA 192 1628 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence571 199 1479 gene locus_tag LOCUS_23680 199 1479 CDS product ISLre2-like element ISLca4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674077.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence572 <1 1557 gene locus_tag LOCUS_23690 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727541.1:DEAD/DEAH box helicase >Feature sequence573 186 1124 gene locus_tag LOCUS_23700 186 1124 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965621.1 protein_id gnl|my_center|LOCUS_23700 <1805 1173 gene locus_tag LOCUS_23710 <1805 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454621.1:phosphoglucomutase >Feature sequence574 >Feature sequence575 699 16 gene locus_tag LOCUS_23720 699 16 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_23720 1379 696 gene locus_tag LOCUS_23730 1379 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 1755 1453 gene locus_tag LOCUS_23740 1755 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence576 1372 569 gene locus_tag LOCUS_23750 1372 569 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence577 >Feature sequence578 75 1 gene locus_tag LOCUS_t00280 75 1 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 265 340 gene locus_tag LOCUS_t00290 265 340 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 430 786 gene locus_tag LOCUS_23760 430 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 779 970 gene locus_tag LOCUS_23770 779 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 1019 1735 gene locus_tag LOCUS_23780 1019 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 >Feature sequence579 1070 753 gene locus_tag LOCUS_23790 1070 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 <1798 1175 gene locus_tag LOCUS_23800 <1798 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009936861.1:terminase large subunit >Feature sequence580 1006 371 gene locus_tag LOCUS_23810 1006 371 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_23810 <1796 1034 gene locus_tag LOCUS_23820 <1796 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009930477.1:aldo/keto reductase >Feature sequence581 <1 1588 gene locus_tag LOCUS_23830 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence582 >Feature sequence583 235 1050 gene locus_tag LOCUS_23840 235 1050 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225833.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence584 >Feature sequence585 >Feature sequence586 683 159 gene locus_tag LOCUS_23850 683 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1418 816 gene locus_tag LOCUS_23860 1418 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence587 606 55 gene locus_tag LOCUS_23870 606 55 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_23870 <1778 603 gene locus_tag LOCUS_23880 <1778 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048268.1:peptide chain release factor 3 >Feature sequence588 1388 132 gene locus_tag LOCUS_23890 1388 132 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_23890 1756 1385 gene locus_tag LOCUS_23900 1756 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence589 <1 1722 gene locus_tag LOCUS_23910 <1 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925192.1:POTRA domain-containing protein >Feature sequence590 >Feature sequence591 >Feature sequence592 130 459 gene locus_tag LOCUS_23920 130 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence593 375 1457 gene locus_tag LOCUS_23930 375 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence594 1674 1207 gene locus_tag LOCUS_23940 gene greA 1674 1207 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence595 >Feature sequence596 36 617 gene locus_tag LOCUS_23950 36 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 773 1549 gene locus_tag LOCUS_23960 773 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence597 >Feature sequence598 442 1416 gene locus_tag LOCUS_23970 442 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence599 727 44 gene locus_tag LOCUS_23980 727 44 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_23980 1696 857 gene locus_tag LOCUS_23990 gene hpnK 1696 857 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941812.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence600 891 67 gene locus_tag LOCUS_24000 891 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence601 437 1393 gene locus_tag LOCUS_24010 gene fmt 437 1393 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_24010 >Feature sequence602 385 1368 gene locus_tag LOCUS_24020 385 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24020 >Feature sequence603 113 910 gene locus_tag LOCUS_24030 113 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 1039 1656 gene locus_tag LOCUS_24040 1039 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence604 205 516 gene locus_tag LOCUS_24050 gene fliE 205 516 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392291.1 protein_id gnl|my_center|LOCUS_24050 >Feature sequence605 <1 627 gene locus_tag LOCUS_24060 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064307.1:BMP family ABC transporter substrate-binding protein >Feature sequence606 <1 1519 gene locus_tag LOCUS_24070 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence607 3 638 gene locus_tag LOCUS_24080 3 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 635 1345 gene locus_tag LOCUS_24090 635 1345 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765262.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence608 52 1500 gene locus_tag LOCUS_24100 52 1500 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_24100 >Feature sequence609 1449 70 gene locus_tag LOCUS_24110 1449 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence610 >Feature sequence611 >Feature sequence612 <1 843 gene locus_tag LOCUS_24120 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938656.1:lipid-A-disaccharide synthase >Feature sequence613 <1 829 gene locus_tag LOCUS_24130 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256992.1:DUF4127 family protein >Feature sequence614 321 1046 gene locus_tag LOCUS_24140 321 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence615 638 1192 gene locus_tag LOCUS_24150 638 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1203 1436 gene locus_tag LOCUS_24160 1203 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence616 <1699 376 gene locus_tag LOCUS_24170 <1699 376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034859716.1:type II and III secretion system protein family protein >Feature sequence617 <1 1022 gene locus_tag LOCUS_24180 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393762.1:sodium:solute symporter >Feature sequence618 997 260 gene locus_tag LOCUS_24190 gene recO 997 260 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_24190 <1686 1001 gene locus_tag LOCUS_24200 <1686 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001080241.1:GTPase Era >Feature sequence619 20 328 gene locus_tag LOCUS_24210 20 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 349 510 gene locus_tag LOCUS_24220 349 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 >Feature sequence620 282 1427 gene locus_tag LOCUS_24230 282 1427 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence621 1455 922 gene locus_tag LOCUS_24240 1455 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence622 35 1063 gene locus_tag LOCUS_24250 gene rseP 35 1063 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence623 533 970 gene locus_tag LOCUS_24260 533 970 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence624 <1 1213 gene locus_tag LOCUS_24270 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393817.1:DUF4127 family protein >Feature sequence625 844 473 gene locus_tag LOCUS_24280 844 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 1030 860 gene locus_tag LOCUS_24290 1030 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1389 1048 gene locus_tag LOCUS_24300 1389 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence626 >Feature sequence627 >Feature sequence628 1618 248 gene locus_tag LOCUS_24310 1618 248 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence629 1417 317 gene locus_tag LOCUS_24320 1417 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence630 1298 66 gene locus_tag LOCUS_24330 1298 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence631 588 58 gene locus_tag LOCUS_24340 588 58 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869711.1 protein_id gnl|my_center|LOCUS_24340 1424 585 gene locus_tag LOCUS_24350 1424 585 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870041.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence632 >Feature sequence633 <1 683 gene locus_tag LOCUS_24360 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393857.1:F0F1 ATP synthase subunit alpha 696 1553 gene locus_tag LOCUS_24370 gene atpG 696 1553 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence634 277 675 gene locus_tag LOCUS_24380 277 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 662 1009 gene locus_tag LOCUS_24390 662 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 1006 1620 gene locus_tag LOCUS_24400 1006 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 >Feature sequence635 1309 1013 gene locus_tag LOCUS_24410 1309 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence636 1558 473 gene locus_tag LOCUS_24420 1558 473 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence637 304 95 gene locus_tag LOCUS_24430 304 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 564 295 gene locus_tag LOCUS_24440 564 295 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679319.1 protein_id gnl|my_center|LOCUS_24440 1023 676 gene locus_tag LOCUS_24450 1023 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 1405 1010 gene locus_tag LOCUS_24460 gene fliS 1405 1010 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243747.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence638 >Feature sequence639 >Feature sequence640 274 660 gene locus_tag LOCUS_24470 gene csm2 274 660 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414296.1 protein_id gnl|my_center|LOCUS_24470 673 1356 gene locus_tag LOCUS_24480 gene csm3 673 1356 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414292.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence641 <1 745 gene locus_tag LOCUS_24490 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246161.1:GTPase ObgE 750 1055 gene locus_tag LOCUS_24500 gene yhbY 750 1055 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460893.1 protein_id gnl|my_center|LOCUS_24500 1052 1195 gene locus_tag LOCUS_24510 1052 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1416 1504 gene locus_tag LOCUS_t00300 1416 1504 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence642 151 1362 gene locus_tag LOCUS_24520 151 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence643 <1 1368 gene locus_tag LOCUS_24530 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436250.1:pyruvate kinase >Feature sequence644 31 624 gene locus_tag LOCUS_24540 31 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 1350 646 gene locus_tag LOCUS_24550 1350 646 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence645 >Feature sequence646 <1 880 gene locus_tag LOCUS_24560 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084858.1:FkbM family methyltransferase >Feature sequence647 208 1269 gene locus_tag LOCUS_24570 208 1269 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence648 251 493 gene locus_tag LOCUS_24580 251 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 577 1488 gene locus_tag LOCUS_24590 577 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 >Feature sequence649 >Feature sequence650 1042 191 gene locus_tag LOCUS_24600 1042 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence651 1547 1173 gene locus_tag LOCUS_24610 1547 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence652 >Feature sequence653 801 139 gene locus_tag LOCUS_24620 801 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 1050 1328 gene locus_tag LOCUS_24630 1050 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 >Feature sequence654 >Feature sequence655 1453 1172 gene locus_tag LOCUS_24640 1453 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence656 239 1300 gene locus_tag LOCUS_24650 239 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence657 <1 613 gene locus_tag LOCUS_24660 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014665.1:S49 family peptidase 625 816 gene locus_tag LOCUS_24670 625 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1530 1057 gene locus_tag LOCUS_24680 1530 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence658 >Feature sequence659 269 1483 gene locus_tag LOCUS_24690 269 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence660 >Feature sequence661 >Feature sequence662 886 338 gene locus_tag LOCUS_24700 886 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1451 969 gene locus_tag LOCUS_24710 1451 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence663 >Feature sequence664 <1510 638 gene locus_tag LOCUS_24720 <1510 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388546.1:methionine ABC transporter ATP-binding protein >Feature sequence665 <1510 307 gene locus_tag LOCUS_24730 <1510 307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001045361.1:N-6 DNA methylase note possible pseudo, frameshifted >Feature sequence666 1406 387 gene locus_tag LOCUS_24740 1406 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 >Feature sequence667 >Feature sequence668 >Feature sequence669 >Feature sequence670 18 419 gene locus_tag LOCUS_24750 gene ispF 18 419 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_24750 435 1271 gene locus_tag LOCUS_24760 435 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760