>Feature sequence01 562 1659 gene locus_tag LOCUS_00010 562 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1833 2480 gene locus_tag LOCUS_00020 1833 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2570 3502 gene locus_tag LOCUS_00030 gene pfkB 2570 3502 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_00030 3508 4764 gene locus_tag LOCUS_00040 gene rmuC 3508 4764 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_00040 4844 5587 gene locus_tag LOCUS_00050 4844 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5584 6030 gene locus_tag LOCUS_00060 gene tsaE 5584 6030 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_00060 6014 6661 gene locus_tag LOCUS_00070 6014 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7523 6888 gene locus_tag LOCUS_00080 gene yihA 7523 6888 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357155.1 protein_id gnl|my_center|LOCUS_00080 10001 7554 gene locus_tag LOCUS_00090 gene lon 10001 7554 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357593.1 protein_id gnl|my_center|LOCUS_00090 10725 10258 gene locus_tag LOCUS_00100 10725 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10945 10871 gene locus_tag LOCUS_t00010 10945 10871 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11841 11083 gene locus_tag LOCUS_00110 gene dapB 11841 11083 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_00110 12874 11984 gene locus_tag LOCUS_00120 gene dapA 12874 11984 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_00120 13292 12894 gene locus_tag LOCUS_00130 13292 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 13921 13313 gene locus_tag LOCUS_00140 13921 13313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 15052 13970 gene locus_tag LOCUS_00150 gene asd 15052 13970 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_00150 15163 15381 gene locus_tag LOCUS_00160 15163 15381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15703 17733 gene locus_tag LOCUS_00170 gene recJ 15703 17733 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_00170 17764 18198 gene locus_tag LOCUS_00180 gene rpiB 17764 18198 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_00180 18249 20168 gene locus_tag LOCUS_00190 18249 20168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20256 21080 gene locus_tag LOCUS_00200 20256 21080 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_00200 21269 21586 gene locus_tag LOCUS_00210 gene rplU 21269 21586 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_00210 21619 21945 gene locus_tag LOCUS_00220 21619 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21988 22272 gene locus_tag LOCUS_00230 gene rpmA 21988 22272 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222623.1 protein_id gnl|my_center|LOCUS_00230 22431 23696 gene locus_tag LOCUS_00240 gene obgE 22431 23696 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_00240 23680 24153 gene locus_tag LOCUS_00250 23680 24153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24171 24908 gene locus_tag LOCUS_00260 24171 24908 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_00260 26447 24969 gene locus_tag LOCUS_00270 26447 24969 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_00270 27085 26444 gene locus_tag LOCUS_00280 27085 26444 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_00280 29343 27139 gene locus_tag LOCUS_00290 29343 27139 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_00290 30143 29523 gene locus_tag LOCUS_00300 30143 29523 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_00300 31003 30140 gene locus_tag LOCUS_00310 gene rsgA 31003 30140 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902190.1 protein_id gnl|my_center|LOCUS_00310 33292 31019 gene locus_tag LOCUS_00320 gene pknB 33292 31019 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_00320 34205 33474 gene locus_tag LOCUS_00330 34205 33474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 35312 34251 gene locus_tag LOCUS_00340 gene rlmN 35312 34251 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_00340 36652 35330 gene locus_tag LOCUS_00350 gene rsmB 36652 35330 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_00350 37668 36715 gene locus_tag LOCUS_00360 gene fmt 37668 36715 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_00360 38129 37665 gene locus_tag LOCUS_00370 gene def 38129 37665 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_00370 39084 38158 gene locus_tag LOCUS_00380 39084 38158 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_00380 41622 39142 gene locus_tag LOCUS_00390 gene priA 41622 39142 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 protein_id gnl|my_center|LOCUS_00390 41878 41669 gene locus_tag LOCUS_00400 41878 41669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42474 41872 gene locus_tag LOCUS_00410 gene gmk 42474 41872 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774981.1 protein_id gnl|my_center|LOCUS_00410 42737 42471 gene locus_tag LOCUS_00420 gene remA 42737 42471 CDS product extracellular matrix/biofilm regulator RemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154355.1 protein_id gnl|my_center|LOCUS_00420 43646 42768 gene locus_tag LOCUS_00430 43646 42768 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_00430 46383 43825 gene locus_tag LOCUS_00440 46383 43825 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964229.1 protein_id gnl|my_center|LOCUS_00440 47039 48118 gene locus_tag LOCUS_00450 47039 48118 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00450 48118 48849 gene locus_tag LOCUS_00460 48118 48849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48929 50407 gene locus_tag LOCUS_00470 48929 50407 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_00470 50404 51816 gene locus_tag LOCUS_00480 50404 51816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51909 53072 gene locus_tag LOCUS_00490 51909 53072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53208 53522 gene locus_tag LOCUS_00500 gene spoIIID 53208 53522 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_00500 53985 54866 gene locus_tag LOCUS_00510 gene rfbA 53985 54866 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_00510 54863 55990 gene locus_tag LOCUS_00520 gene rfbB 54863 55990 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_00520 55998 56657 gene locus_tag LOCUS_00530 55998 56657 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_00530 56677 57780 gene locus_tag LOCUS_00540 56677 57780 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762980.1 protein_id gnl|my_center|LOCUS_00540 57843 59054 gene locus_tag LOCUS_00550 57843 59054 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_00550 59111 60061 gene locus_tag LOCUS_00560 59111 60061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 60105 60947 gene locus_tag LOCUS_00570 60105 60947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 61026 62288 gene locus_tag LOCUS_00580 61026 62288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 62296 63447 gene locus_tag LOCUS_00590 62296 63447 CDS product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 protein_id gnl|my_center|LOCUS_00590 63494 64924 gene locus_tag LOCUS_00600 63494 64924 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_00600 64973 66160 gene locus_tag LOCUS_00610 64973 66160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 66187 67050 gene locus_tag LOCUS_00620 66187 67050 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_00620 67055 67771 gene locus_tag LOCUS_00630 67055 67771 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765262.1 protein_id gnl|my_center|LOCUS_00630 67756 68835 gene locus_tag LOCUS_00640 67756 68835 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383751.1 protein_id gnl|my_center|LOCUS_00640 68840 69538 gene locus_tag LOCUS_00650 68840 69538 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095307.1 protein_id gnl|my_center|LOCUS_00650 69632 70942 gene locus_tag LOCUS_00660 69632 70942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 70973 71947 gene locus_tag LOCUS_00670 70973 71947 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_00670 71981 73132 gene locus_tag LOCUS_00680 71981 73132 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_00680 73330 74604 gene locus_tag LOCUS_00690 73330 74604 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003838864.1 protein_id gnl|my_center|LOCUS_00690 74629 75918 gene locus_tag LOCUS_00700 74629 75918 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766018.1 protein_id gnl|my_center|LOCUS_00700 76078 77661 gene locus_tag LOCUS_00710 76078 77661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 77877 79517 gene locus_tag LOCUS_00720 77877 79517 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_00720 79541 80197 gene locus_tag LOCUS_00730 gene pyrE 79541 80197 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_00730 80401 80916 gene locus_tag LOCUS_00740 80401 80916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 80956 82071 gene locus_tag LOCUS_00750 80956 82071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00750 82107 82391 gene locus_tag LOCUS_00760 82107 82391 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_00760 82384 82707 gene locus_tag LOCUS_00770 82384 82707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 82777 85653 gene locus_tag LOCUS_00780 82777 85653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 85742 85984 gene locus_tag LOCUS_00790 85742 85984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 86029 86448 gene locus_tag LOCUS_00800 gene rbfA 86029 86448 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_00800 86534 87499 gene locus_tag LOCUS_00810 86534 87499 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_00810 87520 88398 gene locus_tag LOCUS_00820 gene truB 87520 88398 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_00820 88407 89303 gene locus_tag LOCUS_00830 gene ribF 88407 89303 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101639.1 protein_id gnl|my_center|LOCUS_00830 89403 90437 gene locus_tag LOCUS_00840 89403 90437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_00840 90437 91141 gene locus_tag LOCUS_00850 gene gldF 90437 91141 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_00850 91157 92854 gene locus_tag LOCUS_00860 91157 92854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92851 94365 gene locus_tag LOCUS_00870 92851 94365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94399 94677 gene locus_tag LOCUS_00880 94399 94677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 94789 95274 gene locus_tag LOCUS_00890 gene ybaK 94789 95274 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002404288.1 protein_id gnl|my_center|LOCUS_00890 95777 98125 gene locus_tag LOCUS_00900 95777 98125 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964231.1 protein_id gnl|my_center|LOCUS_00900 98881 98261 gene locus_tag LOCUS_00910 98881 98261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 100730 98970 gene locus_tag LOCUS_00920 100730 98970 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00920 102646 100748 gene locus_tag LOCUS_00930 gene nuoF 102646 100748 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_00930 103180 102677 gene locus_tag LOCUS_00940 gene nuoE 103180 102677 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00940 103760 104689 gene locus_tag LOCUS_00950 103760 104689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 105918 104764 gene locus_tag LOCUS_00960 105918 104764 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_00960 106298 105942 gene locus_tag LOCUS_00970 106298 105942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 106363 107436 gene locus_tag LOCUS_00980 106363 107436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_00980 107433 108368 gene locus_tag LOCUS_00990 107433 108368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 108274 108483 gene locus_tag LOCUS_01000 108274 108483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 108600 109955 gene locus_tag LOCUS_01010 108600 109955 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_01010 109986 110501 gene locus_tag LOCUS_01020 109986 110501 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_01020 110703 112088 gene locus_tag LOCUS_01030 110703 112088 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_01030 112236 112562 gene locus_tag LOCUS_01040 112236 112562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 113044 113667 gene locus_tag LOCUS_01050 113044 113667 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_01050 113917 114351 gene locus_tag LOCUS_01060 113917 114351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 114387 115598 gene locus_tag LOCUS_01070 114387 115598 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_01070 115706 118321 gene locus_tag LOCUS_01080 gene adhE 115706 118321 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_01080 118337 119092 gene locus_tag LOCUS_01090 118337 119092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 119714 119148 gene locus_tag LOCUS_01100 119714 119148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 120570 119704 gene locus_tag LOCUS_01110 gene mreC 120570 119704 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964556.1 protein_id gnl|my_center|LOCUS_01110 120843 121910 gene locus_tag LOCUS_01120 120843 121910 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_01120 121915 122142 gene locus_tag LOCUS_01130 121915 122142 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence02 356 895 gene locus_tag LOCUS_01140 gene rplE 356 895 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_01140 909 1094 gene locus_tag LOCUS_01150 909 1094 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_01150 1124 1522 gene locus_tag LOCUS_01160 gene rpsH 1124 1522 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245500.1 protein_id gnl|my_center|LOCUS_01160 1538 2086 gene locus_tag LOCUS_01170 gene rplF 1538 2086 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_01170 2105 2464 gene locus_tag LOCUS_01180 gene rplR 2105 2464 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357434.1 protein_id gnl|my_center|LOCUS_01180 2482 2985 gene locus_tag LOCUS_01190 gene rpsE 2482 2985 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_01190 3005 3181 gene locus_tag LOCUS_01200 gene rpmD 3005 3181 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_01200 3203 3646 gene locus_tag LOCUS_01210 gene rplO 3203 3646 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_01210 3648 4994 gene locus_tag LOCUS_01220 gene secY 3648 4994 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357569.1 protein_id gnl|my_center|LOCUS_01220 5017 5658 gene locus_tag LOCUS_01230 5017 5658 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01230 5680 6429 gene locus_tag LOCUS_01240 gene map 5680 6429 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_01240 6443 6760 gene locus_tag LOCUS_01250 6443 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6738 6956 gene locus_tag LOCUS_01260 gene infA 6738 6956 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_01260 7136 7504 gene locus_tag LOCUS_01270 gene rpsM 7136 7504 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_01270 7519 7920 gene locus_tag LOCUS_01280 gene rpsK 7519 7920 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_01280 7941 8582 gene locus_tag LOCUS_01290 gene rpsD 7941 8582 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_01290 8660 9622 gene locus_tag LOCUS_01300 8660 9622 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_01300 9676 10038 gene locus_tag LOCUS_01310 gene rplQ 9676 10038 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_01310 10206 13046 gene locus_tag LOCUS_01320 10206 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14388 13162 gene locus_tag LOCUS_01330 14388 13162 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_01330 14827 16179 gene locus_tag LOCUS_01340 gene gdhA 14827 16179 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_01340 17613 16327 gene locus_tag LOCUS_01350 17613 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 19562 18060 gene locus_tag LOCUS_01360 19562 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 20228 19680 gene locus_tag LOCUS_01370 20228 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 21609 20389 gene locus_tag LOCUS_01380 gene thiI 21609 20389 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_01380 22784 21648 gene locus_tag LOCUS_01390 22784 21648 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638992.1 protein_id gnl|my_center|LOCUS_01390 25135 22943 gene locus_tag LOCUS_01400 25135 22943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 25349 25660 gene locus_tag LOCUS_01410 25349 25660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 26117 27499 gene locus_tag LOCUS_01420 26117 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 28446 27604 gene locus_tag LOCUS_01430 28446 27604 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229020.1 protein_id gnl|my_center|LOCUS_01430 29426 28440 gene locus_tag LOCUS_01440 29426 28440 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229019.1 protein_id gnl|my_center|LOCUS_01440 30962 29532 gene locus_tag LOCUS_01450 30962 29532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 32358 31039 gene locus_tag LOCUS_01460 gene xylA 32358 31039 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_01460 34467 32389 gene locus_tag LOCUS_01470 34467 32389 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_01470 35384 34494 gene locus_tag LOCUS_01480 35384 34494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_01480 35659 36576 gene locus_tag LOCUS_01490 35659 36576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 41958 36715 gene locus_tag LOCUS_01500 41958 36715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 50486 41955 gene locus_tag LOCUS_01510 50486 41955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 50669 52471 gene locus_tag LOCUS_01520 gene lepA 50669 52471 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_01520 52492 52809 gene locus_tag LOCUS_01530 52492 52809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 52806 53888 gene locus_tag LOCUS_01540 gene hemW 52806 53888 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_01540 60144 53974 gene locus_tag LOCUS_01550 60144 53974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 60358 62919 gene locus_tag LOCUS_01560 60358 62919 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_01560 63201 62977 gene locus_tag LOCUS_01570 63201 62977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 63368 64189 gene locus_tag LOCUS_01580 63368 64189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 64210 64932 gene locus_tag LOCUS_01590 gene sigE 64210 64932 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_01590 65083 66900 gene locus_tag LOCUS_01600 65083 66900 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_01600 67163 69847 gene locus_tag LOCUS_01610 67163 69847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 70540 69914 gene locus_tag LOCUS_01620 70540 69914 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437747.1 protein_id gnl|my_center|LOCUS_01620 71049 70537 gene locus_tag LOCUS_01630 gene cobO 71049 70537 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546229.1 protein_id gnl|my_center|LOCUS_01630 71858 71106 gene locus_tag LOCUS_01640 71858 71106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 72859 71858 gene locus_tag LOCUS_01650 72859 71858 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_01650 74009 72870 gene locus_tag LOCUS_01660 74009 72870 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926854.1 protein_id gnl|my_center|LOCUS_01660 74430 73993 gene locus_tag LOCUS_01670 74430 73993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 76343 74859 gene locus_tag LOCUS_01680 76343 74859 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_01680 77371 76346 gene locus_tag LOCUS_01690 gene cobD 77371 76346 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_01690 78333 77368 gene locus_tag LOCUS_01700 gene cbiB 78333 77368 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943620.1 protein_id gnl|my_center|LOCUS_01700 78890 78330 gene locus_tag LOCUS_01710 78890 78330 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903719.1 protein_id gnl|my_center|LOCUS_01710 79273 78887 gene locus_tag LOCUS_01720 79273 78887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 80048 79278 gene locus_tag LOCUS_01730 80048 79278 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729695.1 protein_id gnl|my_center|LOCUS_01730 80563 80045 gene locus_tag LOCUS_01740 gene cobU 80563 80045 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_01740 81609 80560 gene locus_tag LOCUS_01750 gene cobT 81609 80560 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_01750 82927 81593 gene locus_tag LOCUS_01760 82927 81593 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_01760 84105 82924 gene locus_tag LOCUS_01770 84105 82924 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943626.1 protein_id gnl|my_center|LOCUS_01770 84833 84102 gene locus_tag LOCUS_01780 gene cobK 84833 84102 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 protein_id gnl|my_center|LOCUS_01780 85554 84826 gene locus_tag LOCUS_01790 gene cobJ 85554 84826 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_01790 86576 85551 gene locus_tag LOCUS_01800 gene cbiG 86576 85551 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948632.1 protein_id gnl|my_center|LOCUS_01800 87328 86573 gene locus_tag LOCUS_01810 87328 86573 CDS product cobalt-precorrin-4 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924853.1 protein_id gnl|my_center|LOCUS_01810 88460 87321 gene locus_tag LOCUS_01820 gene cbiD 88460 87321 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_01820 90140 88962 gene locus_tag LOCUS_01830 90140 88962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 91392 90433 gene locus_tag LOCUS_01840 91392 90433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 91688 92158 gene locus_tag LOCUS_01850 91688 92158 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_01850 92142 92864 gene locus_tag LOCUS_01860 92142 92864 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360701.1 protein_id gnl|my_center|LOCUS_01860 92878 93228 gene locus_tag LOCUS_01870 gene hisI 92878 93228 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_01870 93232 93570 gene locus_tag LOCUS_01880 gene hisE 93232 93570 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949117.1 protein_id gnl|my_center|LOCUS_01880 93682 94482 gene locus_tag LOCUS_01890 93682 94482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 94592 98023 gene locus_tag LOCUS_01900 94592 98023 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_01900 98043 100043 gene locus_tag LOCUS_01910 gene ligA 98043 100043 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_01910 100046 100471 gene locus_tag LOCUS_01920 100046 100471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 103410 100570 gene locus_tag LOCUS_01930 103410 100570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 104498 103668 gene locus_tag LOCUS_01940 104498 103668 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809790.1 protein_id gnl|my_center|LOCUS_01940 106158 104572 gene locus_tag LOCUS_01950 106158 104572 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_01950 106821 106243 gene locus_tag LOCUS_01960 106821 106243 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_01960 106977 108107 gene locus_tag LOCUS_01970 106977 108107 CDS product DUF4236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506898.1 protein_id gnl|my_center|LOCUS_01970 108557 108988 gene locus_tag LOCUS_01980 108557 108988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 109009 109785 gene locus_tag LOCUS_01990 109009 109785 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_01990 109932 110192 gene locus_tag LOCUS_02000 109932 110192 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362540.1 protein_id gnl|my_center|LOCUS_02000 111241 110243 gene locus_tag LOCUS_02010 gene add 111241 110243 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_02010 112810 111257 gene locus_tag LOCUS_02020 112810 111257 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_02020 113076 112831 gene locus_tag LOCUS_02030 113076 112831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 113560 114330 gene locus_tag LOCUS_02040 113560 114330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 114403 114558 gene locus_tag LOCUS_02050 114403 114558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 114925 116301 gene locus_tag LOCUS_02060 114925 116301 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_02060 116346 117671 gene locus_tag LOCUS_02070 116346 117671 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_02070 117684 118526 gene locus_tag LOCUS_02080 117684 118526 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860980.1 protein_id gnl|my_center|LOCUS_02080 118793 118593 gene locus_tag LOCUS_02090 gene rpmE 118793 118593 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_02090 120711 118987 gene locus_tag LOCUS_02100 120711 118987 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_02100 120943 122184 gene locus_tag LOCUS_02110 120943 122184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 >Feature sequence03 453 106 gene locus_tag LOCUS_tm00010 453 106 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 946 476 gene locus_tag LOCUS_02120 gene smpB 946 476 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_02120 971 1153 gene locus_tag LOCUS_02130 971 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1188 1826 gene locus_tag LOCUS_02140 1188 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 1861 4686 gene locus_tag LOCUS_02150 gene uvrA 1861 4686 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_02150 4998 4747 gene locus_tag LOCUS_02160 4998 4747 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_02160 5548 5024 gene locus_tag LOCUS_02170 5548 5024 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_02170 5738 7045 gene locus_tag LOCUS_02180 5738 7045 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_02180 8185 7100 gene locus_tag LOCUS_02190 gene rpoD 8185 7100 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_02190 10017 8263 gene locus_tag LOCUS_02200 gene dnaG 10017 8263 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_02200 11031 10039 gene locus_tag LOCUS_02210 11031 10039 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_02210 11775 11227 gene locus_tag LOCUS_02220 11775 11227 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 protein_id gnl|my_center|LOCUS_02220 12088 13023 gene locus_tag LOCUS_02230 12088 13023 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058142.1 protein_id gnl|my_center|LOCUS_02230 13013 14356 gene locus_tag LOCUS_02240 13013 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 14353 15774 gene locus_tag LOCUS_02250 14353 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 15923 16813 gene locus_tag LOCUS_02260 15923 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 19616 16926 gene locus_tag LOCUS_02270 19616 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 22221 19873 gene locus_tag LOCUS_02280 22221 19873 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_02280 23518 22355 gene locus_tag LOCUS_02290 23518 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 24557 23724 gene locus_tag LOCUS_02300 24557 23724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 24702 24541 gene locus_tag LOCUS_02310 24702 24541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 25830 24724 gene locus_tag LOCUS_02320 25830 24724 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_02320 26198 27235 gene locus_tag LOCUS_02330 gene mnmA 26198 27235 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681913.1 protein_id gnl|my_center|LOCUS_02330 27232 29277 gene locus_tag LOCUS_02340 gene recG 27232 29277 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_02340 29440 29514 gene locus_tag LOCUS_t00020 29440 29514 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 29533 29608 gene locus_tag LOCUS_t00030 29533 29608 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 29612 29687 gene locus_tag LOCUS_t00040 29612 29687 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30050 29817 gene locus_tag LOCUS_02350 30050 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 31418 30225 gene locus_tag LOCUS_02360 gene hydF 31418 30225 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_02360 32875 31427 gene locus_tag LOCUS_02370 gene hydG 32875 31427 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_02370 33977 32916 gene locus_tag LOCUS_02380 gene hydE 33977 32916 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_02380 34270 35331 gene locus_tag LOCUS_02390 34270 35331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 35713 35324 gene locus_tag LOCUS_02400 35713 35324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 35814 37295 gene locus_tag LOCUS_02410 gene malQ 35814 37295 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_02410 37319 39682 gene locus_tag LOCUS_02420 gene malP 37319 39682 CDS product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 protein_id gnl|my_center|LOCUS_02420 39837 40211 gene locus_tag LOCUS_02430 39837 40211 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198795.1 protein_id gnl|my_center|LOCUS_02430 40309 40384 gene locus_tag LOCUS_t00050 40309 40384 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 41229 40549 gene locus_tag LOCUS_02440 41229 40549 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_02440 41655 41377 gene locus_tag LOCUS_02450 41655 41377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 43654 41729 gene locus_tag LOCUS_02460 43654 41729 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_02460 45220 43763 gene locus_tag LOCUS_02470 45220 43763 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680081.1 protein_id gnl|my_center|LOCUS_02470 45569 46444 gene locus_tag LOCUS_02480 45569 46444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 46843 49278 gene locus_tag LOCUS_02490 46843 49278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 49492 50922 gene locus_tag LOCUS_02500 gene glnA 49492 50922 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_02500 51335 52525 gene locus_tag LOCUS_02510 gene trpB 51335 52525 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_02510 52518 53300 gene locus_tag LOCUS_02520 gene trpA 52518 53300 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_02520 53501 54937 gene locus_tag LOCUS_02530 53501 54937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 55253 56134 gene locus_tag LOCUS_02540 55253 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 56110 56997 gene locus_tag LOCUS_02550 56110 56997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 56999 58060 gene locus_tag LOCUS_02560 56999 58060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023522.1 protein_id gnl|my_center|LOCUS_02560 58317 58556 gene locus_tag LOCUS_02570 58317 58556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 58553 61075 gene locus_tag LOCUS_02580 58553 61075 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964119.1 protein_id gnl|my_center|LOCUS_02580 61068 62147 gene locus_tag LOCUS_02590 61068 62147 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328967.1 protein_id gnl|my_center|LOCUS_02590 62140 63579 gene locus_tag LOCUS_02600 62140 63579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 63573 65009 gene locus_tag LOCUS_02610 63573 65009 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_02610 65527 65078 gene locus_tag LOCUS_02620 gene rimI 65527 65078 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_02620 68060 65511 gene locus_tag LOCUS_02630 gene polA 68060 65511 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_02630 68255 70945 gene locus_tag LOCUS_02640 68255 70945 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963882.1 protein_id gnl|my_center|LOCUS_02640 71112 76061 gene locus_tag LOCUS_02650 71112 76061 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227523.1 protein_id gnl|my_center|LOCUS_02650 76242 76919 gene locus_tag LOCUS_02660 76242 76919 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_02660 76957 78858 gene locus_tag LOCUS_02670 76957 78858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 78953 80482 gene locus_tag LOCUS_02680 gene spoVB 78953 80482 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_02680 80844 80533 gene locus_tag LOCUS_02690 80844 80533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 81527 80841 gene locus_tag LOCUS_02700 81527 80841 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_02700 81720 82001 gene locus_tag LOCUS_02710 81720 82001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 82869 83117 gene locus_tag LOCUS_02720 82869 83117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 83412 83552 gene locus_tag LOCUS_02730 83412 83552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 84714 83617 gene locus_tag LOCUS_02740 84714 83617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 85189 84764 gene locus_tag LOCUS_02750 85189 84764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 85430 86176 gene locus_tag LOCUS_02760 85430 86176 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405006.1 protein_id gnl|my_center|LOCUS_02760 86422 87777 gene locus_tag LOCUS_02770 gene trkA 86422 87777 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_02770 87793 89229 gene locus_tag LOCUS_02780 87793 89229 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_02780 89248 90096 gene locus_tag LOCUS_02790 89248 90096 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_02790 91696 90158 gene locus_tag LOCUS_02800 91696 90158 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_02800 93397 91727 gene locus_tag LOCUS_02810 93397 91727 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_02810 93612 95690 gene locus_tag LOCUS_02820 93612 95690 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_02820 95706 97028 gene locus_tag LOCUS_02830 95706 97028 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02830 97280 97086 gene locus_tag LOCUS_02840 97280 97086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 98756 97296 gene locus_tag LOCUS_02850 98756 97296 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_02850 98929 100383 gene locus_tag LOCUS_02860 98929 100383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 101823 100432 gene locus_tag LOCUS_02870 101823 100432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 102644 101820 gene locus_tag LOCUS_02880 102644 101820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 103382 102651 gene locus_tag LOCUS_02890 103382 102651 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565310.1 protein_id gnl|my_center|LOCUS_02890 <104504 103375 gene locus_tag LOCUS_02900 <104504 103375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261021.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence04 760 248 gene locus_tag LOCUS_02910 760 248 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224406.1 protein_id gnl|my_center|LOCUS_02910 1630 800 gene locus_tag LOCUS_02920 1630 800 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_02920 2121 5204 gene locus_tag LOCUS_02930 2121 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6439 5306 gene locus_tag LOCUS_02940 gene prfB 6439 5306 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_02940 6720 8084 gene locus_tag LOCUS_02950 gene glmU 6720 8084 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226732.1 protein_id gnl|my_center|LOCUS_02950 8138 8812 gene locus_tag LOCUS_02960 gene pth 8138 8812 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_02960 8846 12298 gene locus_tag LOCUS_02970 gene mfd 8846 12298 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_02970 12427 13287 gene locus_tag LOCUS_02980 12427 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 13412 13633 gene locus_tag LOCUS_02990 13412 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14260 13637 gene locus_tag LOCUS_03000 14260 13637 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458832.1 protein_id gnl|my_center|LOCUS_03000 14970 14257 gene locus_tag LOCUS_03010 14970 14257 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759617.1 protein_id gnl|my_center|LOCUS_03010 15543 16190 gene locus_tag LOCUS_03020 15543 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16490 17230 gene locus_tag LOCUS_03030 gene minD 16490 17230 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_03030 17324 17728 gene locus_tag LOCUS_03040 gene mgsA 17324 17728 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_03040 17821 19125 gene locus_tag LOCUS_03050 gene hisS 17821 19125 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_03050 19180 21201 gene locus_tag LOCUS_03060 19180 21201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 21213 21698 gene locus_tag LOCUS_03070 gene ilvN 21213 21698 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061054.1 protein_id gnl|my_center|LOCUS_03070 21720 22064 gene locus_tag LOCUS_03080 21720 22064 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_03080 23740 22160 gene locus_tag LOCUS_03090 23740 22160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 24105 24677 gene locus_tag LOCUS_03100 24105 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 24670 25398 gene locus_tag LOCUS_03110 gene ispD 24670 25398 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_03110 25400 25930 gene locus_tag LOCUS_03120 gene ispF 25400 25930 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_03120 25955 26359 gene locus_tag LOCUS_03130 25955 26359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_03130 27719 26424 gene locus_tag LOCUS_03140 gene lysA 27719 26424 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_03140 28899 27745 gene locus_tag LOCUS_03150 28899 27745 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_03150 31415 28905 gene locus_tag LOCUS_03160 31415 28905 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860956.1 protein_id gnl|my_center|LOCUS_03160 31624 32037 gene locus_tag LOCUS_03170 31624 32037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 32034 32834 gene locus_tag LOCUS_03180 32034 32834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 33805 32897 gene locus_tag LOCUS_03190 gene argF 33805 32897 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_03190 34327 33860 gene locus_tag LOCUS_03200 34327 33860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 35520 34354 gene locus_tag LOCUS_03210 35520 34354 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_03210 36541 35654 gene locus_tag LOCUS_03220 gene argB 36541 35654 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_03220 37912 36608 gene locus_tag LOCUS_03230 gene argJ 37912 36608 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03230 38920 37967 gene locus_tag LOCUS_03240 gene argC 38920 37967 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_03240 39125 38895 gene locus_tag LOCUS_03250 39125 38895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 40507 39122 gene locus_tag LOCUS_03260 gene argH 40507 39122 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_03260 41823 40591 gene locus_tag LOCUS_03270 41823 40591 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_03270 43176 42016 gene locus_tag LOCUS_03280 43176 42016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 44519 43290 gene locus_tag LOCUS_03290 44519 43290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 45138 44569 gene locus_tag LOCUS_03300 gene hpt 45138 44569 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_03300 47851 45353 gene locus_tag LOCUS_03310 47851 45353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 48741 48001 gene locus_tag LOCUS_03320 48741 48001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 48926 50671 gene locus_tag LOCUS_03330 48926 50671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 50954 53551 gene locus_tag LOCUS_03340 50954 53551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 55645 54206 gene locus_tag LOCUS_03350 gene gatB 55645 54206 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_03350 56854 55661 gene locus_tag LOCUS_03360 gene gatA 56854 55661 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143702.1 protein_id gnl|my_center|LOCUS_03360 57153 56872 gene locus_tag LOCUS_03370 57153 56872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 59151 57316 gene locus_tag LOCUS_03380 59151 57316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 60416 59328 gene locus_tag LOCUS_03390 60416 59328 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_03390 61484 60627 gene locus_tag LOCUS_03400 61484 60627 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_03400 61960 63024 gene locus_tag LOCUS_03410 61960 63024 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_03410 64854 63112 gene locus_tag LOCUS_03420 64854 63112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 66249 65107 gene locus_tag LOCUS_03430 66249 65107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 67416 66688 gene locus_tag LOCUS_03440 67416 66688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 67654 68496 gene locus_tag LOCUS_03450 67654 68496 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_03450 68493 69437 gene locus_tag LOCUS_03460 68493 69437 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_03460 70058 69528 gene locus_tag LOCUS_03470 70058 69528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 71125 70082 gene locus_tag LOCUS_03480 71125 70082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 72036 71287 gene locus_tag LOCUS_03490 72036 71287 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_03490 73153 72236 gene locus_tag LOCUS_03500 73153 72236 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_03500 73897 73172 gene locus_tag LOCUS_03510 73897 73172 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_03510 74241 73924 gene locus_tag LOCUS_03520 74241 73924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 74460 74263 gene locus_tag LOCUS_03530 74460 74263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 75161 74685 gene locus_tag LOCUS_03540 75161 74685 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_03540 76137 75232 gene locus_tag LOCUS_03550 76137 75232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 76882 76154 gene locus_tag LOCUS_03560 76882 76154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 77699 76875 gene locus_tag LOCUS_03570 77699 76875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 77928 77852 gene locus_tag LOCUS_t00060 77928 77852 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78274 80211 gene locus_tag LOCUS_03580 78274 80211 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_03580 80301 80510 gene locus_tag LOCUS_03590 80301 80510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 80595 80807 gene locus_tag LOCUS_03600 80595 80807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 80859 82070 gene locus_tag LOCUS_03610 80859 82070 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_03610 82095 82757 gene locus_tag LOCUS_03620 82095 82757 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_03620 82860 84782 gene locus_tag LOCUS_03630 82860 84782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 85109 87058 gene locus_tag LOCUS_03640 85109 87058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 <88524 87140 gene locus_tag LOCUS_03650 <88524 87140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680980.1:LTA synthase family protein >Feature sequence05 480 3116 gene locus_tag LOCUS_03660 gene alaS 480 3116 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_03660 3163 3600 gene locus_tag LOCUS_03670 3163 3600 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296478.1 protein_id gnl|my_center|LOCUS_03670 3643 3993 gene locus_tag LOCUS_03680 3643 3993 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_03680 4083 6104 gene locus_tag LOCUS_03690 4083 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 6132 7214 gene locus_tag LOCUS_03700 6132 7214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 7219 7827 gene locus_tag LOCUS_03710 7219 7827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7829 9160 gene locus_tag LOCUS_03720 7829 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 9209 10021 gene locus_tag LOCUS_03730 9209 10021 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_03730 10063 11988 gene locus_tag LOCUS_03740 10063 11988 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379727.1 protein_id gnl|my_center|LOCUS_03740 13557 12070 gene locus_tag LOCUS_03750 13557 12070 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_03750 13808 14596 gene locus_tag LOCUS_03760 13808 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 14654 15343 gene locus_tag LOCUS_03770 14654 15343 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_03770 15330 16109 gene locus_tag LOCUS_03780 15330 16109 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640790.1 protein_id gnl|my_center|LOCUS_03780 16949 16152 gene locus_tag LOCUS_03790 16949 16152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 18738 17029 gene locus_tag LOCUS_03800 18738 17029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 19091 19018 gene locus_tag LOCUS_t00070 19091 19018 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 19291 20349 gene locus_tag LOCUS_03810 19291 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 20398 22728 gene locus_tag LOCUS_03820 20398 22728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 23262 22813 gene locus_tag LOCUS_03830 23262 22813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 23768 23259 gene locus_tag LOCUS_03840 23768 23259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 24464 23796 gene locus_tag LOCUS_03850 24464 23796 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_03850 26326 24461 gene locus_tag LOCUS_03860 26326 24461 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_03860 27611 26388 gene locus_tag LOCUS_03870 27611 26388 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_03870 29001 27604 gene locus_tag LOCUS_03880 29001 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 29578 28994 gene locus_tag LOCUS_03890 29578 28994 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206416.1 protein_id gnl|my_center|LOCUS_03890 30129 29584 gene locus_tag LOCUS_03900 30129 29584 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_03900 31194 30319 gene locus_tag LOCUS_03910 31194 30319 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_03910 31437 31249 gene locus_tag LOCUS_03920 31437 31249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 32306 31479 gene locus_tag LOCUS_03930 32306 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 32971 32333 gene locus_tag LOCUS_03940 gene scpB 32971 32333 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_03940 33805 33029 gene locus_tag LOCUS_03950 33805 33029 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_03950 34522 33812 gene locus_tag LOCUS_03960 34522 33812 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_03960 34721 34912 gene locus_tag LOCUS_03970 gene rpmB 34721 34912 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_03970 35303 37936 gene locus_tag LOCUS_03980 35303 37936 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566079.1 protein_id gnl|my_center|LOCUS_03980 39257 38004 gene locus_tag LOCUS_03990 gene hemW 39257 38004 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002410012.1 protein_id gnl|my_center|LOCUS_03990 40169 39267 gene locus_tag LOCUS_04000 40169 39267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 42673 40220 gene locus_tag LOCUS_04010 42673 40220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 43167 42676 gene locus_tag LOCUS_04020 43167 42676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 45597 43207 gene locus_tag LOCUS_04030 45597 43207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 46849 45629 gene locus_tag LOCUS_04040 46849 45629 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_04040 47599 46874 gene locus_tag LOCUS_04050 47599 46874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_04050 48643 47672 gene locus_tag LOCUS_04060 48643 47672 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_04060 49857 48670 gene locus_tag LOCUS_04070 49857 48670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 50145 50531 gene locus_tag LOCUS_04080 gene ytrA 50145 50531 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_04080 50528 51448 gene locus_tag LOCUS_04090 50528 51448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_04090 51417 53450 gene locus_tag LOCUS_04100 51417 53450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 53662 53589 gene locus_tag LOCUS_t00080 53662 53589 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54691 53702 gene locus_tag LOCUS_04110 54691 53702 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_04110 55017 54688 gene locus_tag LOCUS_04120 55017 54688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 55791 55039 gene locus_tag LOCUS_04130 55791 55039 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_04130 56957 55815 gene locus_tag LOCUS_04140 gene rodA 56957 55815 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_04140 58519 56996 gene locus_tag LOCUS_04150 58519 56996 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_04150 59554 58607 gene locus_tag LOCUS_04160 59554 58607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 60493 59588 gene locus_tag LOCUS_04170 60493 59588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 61236 60490 gene locus_tag LOCUS_04180 61236 60490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 61751 65710 gene locus_tag LOCUS_04190 gene rpoB 61751 65710 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_04190 65877 69671 gene locus_tag LOCUS_04200 gene rpoC 65877 69671 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_04200 69982 69779 gene locus_tag LOCUS_04210 69982 69779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence06 277 1989 gene locus_tag LOCUS_04220 277 1989 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957184.1 protein_id gnl|my_center|LOCUS_04220 2159 2455 gene locus_tag LOCUS_04230 2159 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4367 2511 gene locus_tag LOCUS_04240 4367 2511 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814508.1 protein_id gnl|my_center|LOCUS_04240 4597 5907 gene locus_tag LOCUS_04250 4597 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 6884 5949 gene locus_tag LOCUS_04260 6884 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 7571 6918 gene locus_tag LOCUS_04270 7571 6918 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_04270 8866 7577 gene locus_tag LOCUS_04280 8866 7577 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_04280 9143 9814 gene locus_tag LOCUS_04290 9143 9814 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_04290 9811 11517 gene locus_tag LOCUS_04300 9811 11517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_04300 11576 13324 gene locus_tag LOCUS_04310 11576 13324 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_04310 14123 13419 gene locus_tag LOCUS_04320 14123 13419 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_04320 14349 15257 gene locus_tag LOCUS_04330 14349 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 16093 15266 gene locus_tag LOCUS_04340 16093 15266 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_04340 16258 16767 gene locus_tag LOCUS_04350 16258 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 16824 18173 gene locus_tag LOCUS_04360 16824 18173 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_04360 19308 18247 gene locus_tag LOCUS_04370 gene leuB 19308 18247 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_04370 19798 19301 gene locus_tag LOCUS_04380 gene leuD 19798 19301 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_04380 21061 19802 gene locus_tag LOCUS_04390 gene leuC 21061 19802 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_04390 22739 21066 gene locus_tag LOCUS_04400 22739 21066 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_04400 22926 22723 gene locus_tag LOCUS_04410 22926 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 24039 23161 gene locus_tag LOCUS_04420 gene aguB 24039 23161 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_04420 25157 24036 gene locus_tag LOCUS_04430 gene aguA 25157 24036 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 protein_id gnl|my_center|LOCUS_04430 26331 25159 gene locus_tag LOCUS_04440 gene nspC 26331 25159 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_04440 28068 26815 gene locus_tag LOCUS_04450 28068 26815 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_04450 28962 28096 gene locus_tag LOCUS_04460 gene speE 28962 28096 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_04460 30422 28968 gene locus_tag LOCUS_04470 30422 28968 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_04470 31412 30783 gene locus_tag LOCUS_04480 31412 30783 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812798.1 protein_id gnl|my_center|LOCUS_04480 32477 31425 gene locus_tag LOCUS_04490 32477 31425 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_04490 33676 32678 gene locus_tag LOCUS_04500 33676 32678 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_04500 34383 33691 gene locus_tag LOCUS_04510 34383 33691 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_04510 35917 34646 gene locus_tag LOCUS_04520 35917 34646 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_04520 36663 35950 gene locus_tag LOCUS_04530 36663 35950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 36979 36728 gene locus_tag LOCUS_04540 36979 36728 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_04540 38193 37012 gene locus_tag LOCUS_04550 38193 37012 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_04550 39057 38227 gene locus_tag LOCUS_04560 39057 38227 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_04560 39267 40424 gene locus_tag LOCUS_04570 39267 40424 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147894.1 protein_id gnl|my_center|LOCUS_04570 41711 40470 gene locus_tag LOCUS_04580 gene hflX 41711 40470 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030461.1 protein_id gnl|my_center|LOCUS_04580 42187 41735 gene locus_tag LOCUS_04590 42187 41735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 42826 42191 gene locus_tag LOCUS_04600 42826 42191 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545248.1 protein_id gnl|my_center|LOCUS_04600 43032 43745 gene locus_tag LOCUS_04610 43032 43745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 43879 44793 gene locus_tag LOCUS_04620 43879 44793 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_04620 44790 45170 gene locus_tag LOCUS_04630 44790 45170 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272275.1 protein_id gnl|my_center|LOCUS_04630 45197 45715 gene locus_tag LOCUS_04640 45197 45715 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354743.1 protein_id gnl|my_center|LOCUS_04640 45712 47013 gene locus_tag LOCUS_04650 gene rsxC 45712 47013 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_04650 47010 47936 gene locus_tag LOCUS_04660 47010 47936 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_04660 47929 48456 gene locus_tag LOCUS_04670 47929 48456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 48440 49117 gene locus_tag LOCUS_04680 48440 49117 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869098.1 protein_id gnl|my_center|LOCUS_04680 49114 49707 gene locus_tag LOCUS_04690 gene rsxA 49114 49707 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_04690 49723 50526 gene locus_tag LOCUS_04700 49723 50526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 50683 51300 gene locus_tag LOCUS_04710 50683 51300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 51312 52130 gene locus_tag LOCUS_04720 51312 52130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 52737 52186 gene locus_tag LOCUS_04730 52737 52186 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_04730 53054 53917 gene locus_tag LOCUS_04740 53054 53917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 53901 54824 gene locus_tag LOCUS_04750 53901 54824 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 protein_id gnl|my_center|LOCUS_04750 54877 55545 gene locus_tag LOCUS_04760 54877 55545 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_04760 55654 58905 gene locus_tag LOCUS_04770 55654 58905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 60573 58948 gene locus_tag LOCUS_04780 60573 58948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 61360 60656 gene locus_tag LOCUS_04790 gene sigK 61360 60656 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964996.1 protein_id gnl|my_center|LOCUS_04790 62294 61428 gene locus_tag LOCUS_04800 62294 61428 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_04800 63475 62300 gene locus_tag LOCUS_04810 63475 62300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 64740 63580 gene locus_tag LOCUS_04820 64740 63580 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_04820 65348 64818 gene locus_tag LOCUS_04830 65348 64818 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_04830 65698 65558 gene locus_tag LOCUS_04840 65698 65558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 66937 65882 gene locus_tag LOCUS_04850 66937 65882 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435617.1 protein_id gnl|my_center|LOCUS_04850 67129 67204 gene locus_tag LOCUS_t00090 67129 67204 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 1081 311 gene locus_tag LOCUS_04860 1081 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2561 1083 gene locus_tag LOCUS_04870 2561 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3977 2574 gene locus_tag LOCUS_04880 3977 2574 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_04880 4698 3985 gene locus_tag LOCUS_04890 4698 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6614 4716 gene locus_tag LOCUS_04900 6614 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 9125 6771 gene locus_tag LOCUS_04910 9125 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 10889 9216 gene locus_tag LOCUS_04920 10889 9216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 11960 11172 gene locus_tag LOCUS_04930 11960 11172 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_04930 12645 11971 gene locus_tag LOCUS_04940 12645 11971 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047989.1 protein_id gnl|my_center|LOCUS_04940 12950 14293 gene locus_tag LOCUS_04950 gene murD 12950 14293 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_04950 14444 17188 gene locus_tag LOCUS_04960 gene secA 14444 17188 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_04960 17451 20084 gene locus_tag LOCUS_04970 17451 20084 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_04970 20144 21313 gene locus_tag LOCUS_04980 20144 21313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 21379 22662 gene locus_tag LOCUS_04990 21379 22662 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_04990 23611 22628 gene locus_tag LOCUS_05000 23611 22628 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_05000 24521 23676 gene locus_tag LOCUS_05010 24521 23676 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_05010 24729 25718 gene locus_tag LOCUS_05020 24729 25718 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_05020 25900 26181 gene locus_tag LOCUS_05030 25900 26181 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_05030 26213 26617 gene locus_tag LOCUS_05040 26213 26617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 26709 27842 gene locus_tag LOCUS_05050 26709 27842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 28495 27947 gene locus_tag LOCUS_05060 28495 27947 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880223.1 protein_id gnl|my_center|LOCUS_05060 28568 29221 gene locus_tag LOCUS_05070 gene nth 28568 29221 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_05070 29226 29636 gene locus_tag LOCUS_05080 29226 29636 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052499.1 protein_id gnl|my_center|LOCUS_05080 30013 32358 gene locus_tag LOCUS_05090 30013 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 32979 32434 gene locus_tag LOCUS_05100 gene yfcE 32979 32434 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_05100 33174 35027 gene locus_tag LOCUS_05110 33174 35027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 35133 35978 gene locus_tag LOCUS_05120 35133 35978 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_05120 35991 36458 gene locus_tag LOCUS_05130 35991 36458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 36620 39136 gene locus_tag LOCUS_05140 36620 39136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 39263 39802 gene locus_tag LOCUS_05150 39263 39802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 39817 40731 gene locus_tag LOCUS_05160 39817 40731 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_05160 40728 41546 gene locus_tag LOCUS_05170 40728 41546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 42929 41595 gene locus_tag LOCUS_05180 42929 41595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 45019 43175 gene locus_tag LOCUS_05190 45019 43175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 45317 47572 gene locus_tag LOCUS_05200 45317 47572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 48290 47634 gene locus_tag LOCUS_05210 48290 47634 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_05210 48560 50086 gene locus_tag LOCUS_05220 48560 50086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 50110 50304 gene locus_tag LOCUS_05230 50110 50304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 51208 50387 gene locus_tag LOCUS_05240 gene thiD 51208 50387 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_05240 51824 51195 gene locus_tag LOCUS_05250 gene thiE 51824 51195 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714091.1 protein_id gnl|my_center|LOCUS_05250 53085 51832 gene locus_tag LOCUS_05260 gene thiH 53085 51832 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_05260 53861 53094 gene locus_tag LOCUS_05270 53861 53094 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_05270 54501 53875 gene locus_tag LOCUS_05280 54501 53875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 54697 54503 gene locus_tag LOCUS_05290 gene thiS 54697 54503 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807812.1 protein_id gnl|my_center|LOCUS_05290 56005 54707 gene locus_tag LOCUS_05300 gene thiC 56005 54707 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047970.1 protein_id gnl|my_center|LOCUS_05300 56837 57133 gene locus_tag LOCUS_05310 56837 57133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 57130 58176 gene locus_tag LOCUS_05320 57130 58176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 58207 59382 gene locus_tag LOCUS_05330 58207 59382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 60544 59672 gene locus_tag LOCUS_05340 60544 59672 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_05340 60737 61927 gene locus_tag LOCUS_05350 60737 61927 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_05350 63344 62382 gene locus_tag LOCUS_05360 63344 62382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 63494 64111 gene locus_tag LOCUS_05370 63494 64111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 64468 64157 gene locus_tag LOCUS_05380 64468 64157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence08 51 239 gene locus_tag LOCUS_05390 51 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 414 2786 gene locus_tag LOCUS_05400 414 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 6431 2862 gene locus_tag LOCUS_05410 gene addA 6431 2862 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_05410 9802 6428 gene locus_tag LOCUS_05420 gene addB 9802 6428 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_05420 11154 9832 gene locus_tag LOCUS_05430 11154 9832 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957111.1 protein_id gnl|my_center|LOCUS_05430 11479 11291 gene locus_tag LOCUS_05440 11479 11291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 12170 11631 gene locus_tag LOCUS_05450 12170 11631 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_05450 12744 14483 gene locus_tag LOCUS_05460 gene aspS 12744 14483 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_05460 14653 15492 gene locus_tag LOCUS_05470 14653 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 15489 15629 gene locus_tag LOCUS_05480 15489 15629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 15622 16404 gene locus_tag LOCUS_05490 15622 16404 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295798.1 protein_id gnl|my_center|LOCUS_05490 16515 17822 gene locus_tag LOCUS_05500 16515 17822 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_05500 17908 18690 gene locus_tag LOCUS_05510 17908 18690 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_05510 18690 19160 gene locus_tag LOCUS_05520 gene rlmH 18690 19160 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_05520 19568 20623 gene locus_tag LOCUS_05530 19568 20623 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_05530 20862 22052 gene locus_tag LOCUS_05540 20862 22052 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837690.1 protein_id gnl|my_center|LOCUS_05540 22165 23847 gene locus_tag LOCUS_05550 22165 23847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 23844 24755 gene locus_tag LOCUS_05560 23844 24755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 24834 27791 gene locus_tag LOCUS_05570 24834 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 27806 28699 gene locus_tag LOCUS_05580 27806 28699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 28720 29742 gene locus_tag LOCUS_05590 28720 29742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 30711 29809 gene locus_tag LOCUS_05600 30711 29809 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_05600 30793 32451 gene locus_tag LOCUS_05610 30793 32451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 32488 33597 gene locus_tag LOCUS_05620 32488 33597 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_05620 34056 34535 gene locus_tag LOCUS_05630 34056 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 34644 35180 gene locus_tag LOCUS_05640 34644 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 37369 35252 gene locus_tag LOCUS_05650 37369 35252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 39463 37490 gene locus_tag LOCUS_05660 39463 37490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 40498 39590 gene locus_tag LOCUS_05670 40498 39590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 40749 41213 gene locus_tag LOCUS_05680 40749 41213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 41217 41876 gene locus_tag LOCUS_05690 41217 41876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 44006 41943 gene locus_tag LOCUS_05700 44006 41943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 45796 44033 gene locus_tag LOCUS_05710 gene nuoF 45796 44033 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_05710 46293 45793 gene locus_tag LOCUS_05720 gene nuoE 46293 45793 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_05720 46830 48065 gene locus_tag LOCUS_05730 46830 48065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 48183 48995 gene locus_tag LOCUS_05740 48183 48995 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_05740 49862 50224 gene locus_tag LOCUS_05750 49862 50224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 50788 51342 gene locus_tag LOCUS_05760 50788 51342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 51284 52561 gene locus_tag LOCUS_05770 51284 52561 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_05770 52578 53774 gene locus_tag LOCUS_05780 52578 53774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 53791 54759 gene locus_tag LOCUS_05790 53791 54759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 54872 55810 gene locus_tag LOCUS_05800 54872 55810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 55807 56160 gene locus_tag LOCUS_05810 55807 56160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 56207 56641 gene locus_tag LOCUS_05820 56207 56641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 56638 57024 gene locus_tag LOCUS_05830 56638 57024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 57021 57956 gene locus_tag LOCUS_05840 57021 57956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 58156 59037 gene locus_tag LOCUS_05850 58156 59037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 59852 59211 gene locus_tag LOCUS_05860 59852 59211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 60922 59882 gene locus_tag LOCUS_05870 60922 59882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 62732 60960 gene locus_tag LOCUS_05880 gene aspS 62732 60960 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_05880 63411 62836 gene locus_tag LOCUS_05890 63411 62836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence09 517 278 gene locus_tag LOCUS_05900 517 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1488 514 gene locus_tag LOCUS_05910 1488 514 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_05910 2013 1561 gene locus_tag LOCUS_05920 2013 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2399 2578 gene locus_tag LOCUS_05930 2399 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2758 3003 gene locus_tag LOCUS_05940 2758 3003 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_05940 3231 4085 gene locus_tag LOCUS_05950 3231 4085 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_05950 4180 4884 gene locus_tag LOCUS_05960 4180 4884 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120401.1 protein_id gnl|my_center|LOCUS_05960 4900 5661 gene locus_tag LOCUS_05970 4900 5661 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724134.1 protein_id gnl|my_center|LOCUS_05970 5899 6648 gene locus_tag LOCUS_05980 gene rpsB 5899 6648 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_05980 6708 7631 gene locus_tag LOCUS_05990 gene tsf 6708 7631 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_05990 9167 7776 gene locus_tag LOCUS_06000 9167 7776 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_06000 9864 9307 gene locus_tag LOCUS_06010 9864 9307 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_06010 10245 9958 gene locus_tag LOCUS_06020 10245 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10558 10259 gene locus_tag LOCUS_06030 10558 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 10956 10573 gene locus_tag LOCUS_06040 10956 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 11231 10986 gene locus_tag LOCUS_06050 11231 10986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 11327 11821 gene locus_tag LOCUS_06060 11327 11821 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989714.1 protein_id gnl|my_center|LOCUS_06060 14348 12195 gene locus_tag LOCUS_06070 14348 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 14729 17599 gene locus_tag LOCUS_06080 14729 17599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 17812 18162 gene locus_tag LOCUS_06090 17812 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 20792 18630 gene locus_tag LOCUS_06100 20792 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 21816 21025 gene locus_tag LOCUS_06110 21816 21025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 23125 21851 gene locus_tag LOCUS_06120 23125 21851 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_06120 23926 23129 gene locus_tag LOCUS_06130 23926 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 24962 23916 gene locus_tag LOCUS_06140 24962 23916 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_06140 25993 24959 gene locus_tag LOCUS_06150 25993 24959 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257568.1 protein_id gnl|my_center|LOCUS_06150 26280 26654 gene locus_tag LOCUS_06160 26280 26654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 28270 26750 gene locus_tag LOCUS_06170 28270 26750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 31219 28598 gene locus_tag LOCUS_06180 31219 28598 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_06180 34817 31704 gene locus_tag LOCUS_06190 gene ileS 34817 31704 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111258.1 protein_id gnl|my_center|LOCUS_06190 35064 36050 gene locus_tag LOCUS_06200 35064 36050 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135810.1 protein_id gnl|my_center|LOCUS_06200 36044 37252 gene locus_tag LOCUS_06210 36044 37252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 37246 39795 gene locus_tag LOCUS_06220 37246 39795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 41104 39914 gene locus_tag LOCUS_06230 41104 39914 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129606.1 protein_id gnl|my_center|LOCUS_06230 41288 41452 gene locus_tag LOCUS_06240 41288 41452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 41624 42658 gene locus_tag LOCUS_06250 41624 42658 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_06250 42680 42982 gene locus_tag LOCUS_06260 42680 42982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 43215 43084 gene locus_tag LOCUS_06270 43215 43084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 43348 45540 gene locus_tag LOCUS_06280 43348 45540 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_06280 45547 46761 gene locus_tag LOCUS_06290 45547 46761 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_06290 47758 46844 gene locus_tag LOCUS_06300 47758 46844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 48328 47762 gene locus_tag LOCUS_06310 48328 47762 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_06310 49266 48325 gene locus_tag LOCUS_06320 49266 48325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 50276 49284 gene locus_tag LOCUS_06330 50276 49284 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_06330 51379 50297 gene locus_tag LOCUS_06340 51379 50297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 53721 51478 gene locus_tag LOCUS_06350 gene rnr 53721 51478 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_06350 54071 53814 gene locus_tag LOCUS_06360 54071 53814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 54407 55285 gene locus_tag LOCUS_06370 54407 55285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 55460 56536 gene locus_tag LOCUS_06380 55460 56536 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016893.1 protein_id gnl|my_center|LOCUS_06380 56575 57798 gene locus_tag LOCUS_06390 56575 57798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 57824 58291 gene locus_tag LOCUS_06400 57824 58291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 58514 59923 gene locus_tag LOCUS_06410 58514 59923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 60180 61604 gene locus_tag LOCUS_06420 60180 61604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence10 204 410 gene locus_tag LOCUS_06430 204 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1433 453 gene locus_tag LOCUS_06440 1433 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1585 2043 gene locus_tag LOCUS_06450 1585 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2117 2341 gene locus_tag LOCUS_06460 2117 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2627 3064 gene locus_tag LOCUS_06470 2627 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3085 4830 gene locus_tag LOCUS_06480 3085 4830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389612.1 protein_id gnl|my_center|LOCUS_06480 4820 6745 gene locus_tag LOCUS_06490 4820 6745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_06490 7848 6811 gene locus_tag LOCUS_06500 7848 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 8337 7897 gene locus_tag LOCUS_06510 8337 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8511 9263 gene locus_tag LOCUS_06520 8511 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 9580 9332 gene locus_tag LOCUS_06530 9580 9332 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_06530 11512 9605 gene locus_tag LOCUS_06540 11512 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12943 11531 gene locus_tag LOCUS_06550 12943 11531 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_06550 14677 13214 gene locus_tag LOCUS_06560 14677 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 14991 16448 gene locus_tag LOCUS_06570 14991 16448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 16464 17624 gene locus_tag LOCUS_06580 16464 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17991 19019 gene locus_tag LOCUS_06590 17991 19019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 19067 20410 gene locus_tag LOCUS_06600 19067 20410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 20460 21272 gene locus_tag LOCUS_06610 20460 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 21309 22220 gene locus_tag LOCUS_06620 21309 22220 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173287.1 protein_id gnl|my_center|LOCUS_06620 22273 23490 gene locus_tag LOCUS_06630 22273 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 23608 24138 gene locus_tag LOCUS_06640 23608 24138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 24178 24330 gene locus_tag LOCUS_06650 24178 24330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 26423 24735 gene locus_tag LOCUS_06660 26423 24735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 27531 26464 gene locus_tag LOCUS_06670 27531 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 27512 27700 gene locus_tag LOCUS_06680 27512 27700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 27994 29268 gene locus_tag LOCUS_06690 27994 29268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 29415 30674 gene locus_tag LOCUS_06700 29415 30674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 30909 31484 gene locus_tag LOCUS_06710 30909 31484 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861641.1 protein_id gnl|my_center|LOCUS_06710 31579 33054 gene locus_tag LOCUS_06720 31579 33054 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965086.1 protein_id gnl|my_center|LOCUS_06720 33069 33953 gene locus_tag LOCUS_06730 33069 33953 CDS product pyridoxal phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816800.1 protein_id gnl|my_center|LOCUS_06730 33935 34552 gene locus_tag LOCUS_06740 33935 34552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 34599 36326 gene locus_tag LOCUS_06750 gene iorA 34599 36326 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_06750 36348 36584 gene locus_tag LOCUS_06760 36348 36584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 36682 37257 gene locus_tag LOCUS_06770 36682 37257 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_06770 37258 38565 gene locus_tag LOCUS_06780 37258 38565 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_06780 38581 39015 gene locus_tag LOCUS_06790 38581 39015 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_06790 39254 39694 gene locus_tag LOCUS_06800 39254 39694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 39834 40751 gene locus_tag LOCUS_06810 gene spoIIIAA 39834 40751 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230226.1 protein_id gnl|my_center|LOCUS_06810 40748 41242 gene locus_tag LOCUS_06820 40748 41242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 41264 41461 gene locus_tag LOCUS_06830 gene spoIIIAC 41264 41461 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_06830 41455 41856 gene locus_tag LOCUS_06840 41455 41856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 41841 42983 gene locus_tag LOCUS_06850 41841 42983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 43003 43464 gene locus_tag LOCUS_06860 43003 43464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 43461 44006 gene locus_tag LOCUS_06870 43461 44006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 44023 44640 gene locus_tag LOCUS_06880 44023 44640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 44886 45227 gene locus_tag LOCUS_06890 44886 45227 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419170.1 protein_id gnl|my_center|LOCUS_06890 45253 45675 gene locus_tag LOCUS_06900 gene nusB 45253 45675 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_06900 45672 46631 gene locus_tag LOCUS_06910 45672 46631 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393029.1 protein_id gnl|my_center|LOCUS_06910 46619 47839 gene locus_tag LOCUS_06920 gene xseA 46619 47839 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_06920 47829 48017 gene locus_tag LOCUS_06930 47829 48017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 48025 48918 gene locus_tag LOCUS_06940 48025 48918 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_06940 48946 50826 gene locus_tag LOCUS_06950 gene dxs 48946 50826 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_06950 50819 51544 gene locus_tag LOCUS_06960 50819 51544 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041048.1 protein_id gnl|my_center|LOCUS_06960 51651 52523 gene locus_tag LOCUS_06970 51651 52523 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_06970 52544 52978 gene locus_tag LOCUS_06980 52544 52978 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_06980 53003 54676 gene locus_tag LOCUS_06990 gene recN 53003 54676 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880915.1 protein_id gnl|my_center|LOCUS_06990 54673 55518 gene locus_tag LOCUS_07000 54673 55518 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016086425.1 protein_id gnl|my_center|LOCUS_07000 55505 55945 gene locus_tag LOCUS_07010 55505 55945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 56155 56577 gene locus_tag LOCUS_07020 gene rpsL 56155 56577 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_07020 56758 57228 gene locus_tag LOCUS_07030 gene rpsG 56758 57228 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137491.1 protein_id gnl|my_center|LOCUS_07030 57326 59410 gene locus_tag LOCUS_07040 gene fusA 57326 59410 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence11 195 119 gene locus_tag LOCUS_t00100 195 119 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 326 808 gene locus_tag LOCUS_07050 326 808 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_07050 790 1950 gene locus_tag LOCUS_07060 790 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3331 2006 gene locus_tag LOCUS_07070 3331 2006 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356656.1 protein_id gnl|my_center|LOCUS_07070 6278 3540 gene locus_tag LOCUS_07080 6278 3540 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_07080 6602 12100 gene locus_tag LOCUS_07090 6602 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12060 12218 gene locus_tag LOCUS_07100 12060 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 12376 13560 gene locus_tag LOCUS_07110 12376 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 13737 15134 gene locus_tag LOCUS_07120 13737 15134 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_07120 15938 15201 gene locus_tag LOCUS_07130 gene nadE 15938 15201 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808614.1 protein_id gnl|my_center|LOCUS_07130 17120 15945 gene locus_tag LOCUS_07140 17120 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 19530 17137 gene locus_tag LOCUS_07150 19530 17137 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_07150 20304 19543 gene locus_tag LOCUS_07160 gene recO 20304 19543 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460852.1 protein_id gnl|my_center|LOCUS_07160 21429 20500 gene locus_tag LOCUS_07170 gene era 21429 20500 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_07170 21942 21433 gene locus_tag LOCUS_07180 gene ybeY 21942 21433 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_07180 22927 21935 gene locus_tag LOCUS_07190 22927 21935 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_07190 24205 23048 gene locus_tag LOCUS_07200 24205 23048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 24460 24221 gene locus_tag LOCUS_07210 24460 24221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 24560 25579 gene locus_tag LOCUS_07220 24560 25579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 25704 26201 gene locus_tag LOCUS_07230 25704 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 26876 26370 gene locus_tag LOCUS_07240 26876 26370 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_07240 27676 26915 gene locus_tag LOCUS_07250 gene spo0A 27676 26915 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_07250 28138 29358 gene locus_tag LOCUS_07260 gene spoIVB 28138 29358 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_07260 29704 29432 gene locus_tag LOCUS_07270 29704 29432 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_07270 30810 30115 gene locus_tag LOCUS_07280 gene trmD 30810 30115 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_07280 31315 30800 gene locus_tag LOCUS_07290 gene rimM 31315 30800 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_07290 31730 31329 gene locus_tag LOCUS_07300 31730 31329 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_07300 35839 32036 gene locus_tag LOCUS_07310 35839 32036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 36125 38314 gene locus_tag LOCUS_07320 36125 38314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 38405 40045 gene locus_tag LOCUS_07330 38405 40045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 40060 41241 gene locus_tag LOCUS_07340 40060 41241 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_07340 41278 42102 gene locus_tag LOCUS_07350 gene rlmA 41278 42102 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170523.1 protein_id gnl|my_center|LOCUS_07350 42231 43475 gene locus_tag LOCUS_07360 42231 43475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 43606 44220 gene locus_tag LOCUS_07370 43606 44220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 45183 44275 gene locus_tag LOCUS_07380 gene whiA 45183 44275 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_07380 46102 45227 gene locus_tag LOCUS_07390 gene rapZ 46102 45227 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_07390 46708 46127 gene locus_tag LOCUS_07400 46708 46127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 47619 46705 gene locus_tag LOCUS_07410 gene murB 47619 46705 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_07410 48387 47647 gene locus_tag LOCUS_07420 48387 47647 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048308.1 protein_id gnl|my_center|LOCUS_07420 49371 48403 gene locus_tag LOCUS_07430 gene hprK 49371 48403 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_07430 49555 50208 gene locus_tag LOCUS_07440 49555 50208 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_07440 50205 50876 gene locus_tag LOCUS_07450 gene tsaA 50205 50876 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_07450 52534 50942 gene locus_tag LOCUS_07460 52534 50942 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_07460 53158 56052 gene locus_tag LOCUS_07470 53158 56052 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963882.1 protein_id gnl|my_center|LOCUS_07470 56756 56124 gene locus_tag LOCUS_07480 56756 56124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 <57399 56831 gene locus_tag LOCUS_07490 <57399 56831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393655.1:NAD(P)H-hydrate dehydratase >Feature sequence12 1807 2835 gene locus_tag LOCUS_07500 1807 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 3568 2942 gene locus_tag LOCUS_07510 gene thrH 3568 2942 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_07510 3747 9968 gene locus_tag LOCUS_07520 3747 9968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11705 10038 gene locus_tag LOCUS_07530 11705 10038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 13072 11705 gene locus_tag LOCUS_07540 13072 11705 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393008.1 protein_id gnl|my_center|LOCUS_07540 13280 14266 gene locus_tag LOCUS_07550 13280 14266 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_07550 14388 14954 gene locus_tag LOCUS_07560 14388 14954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 14951 15760 gene locus_tag LOCUS_07570 14951 15760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 15826 16044 gene locus_tag LOCUS_07580 15826 16044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 16057 17151 gene locus_tag LOCUS_07590 16057 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 17295 19457 gene locus_tag LOCUS_07600 17295 19457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 19659 20660 gene locus_tag LOCUS_07610 19659 20660 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_07610 20657 21460 gene locus_tag LOCUS_07620 20657 21460 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921986.1 protein_id gnl|my_center|LOCUS_07620 21465 22268 gene locus_tag LOCUS_07630 21465 22268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760733.1 protein_id gnl|my_center|LOCUS_07630 22319 22762 gene locus_tag LOCUS_07640 22319 22762 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358219.1 protein_id gnl|my_center|LOCUS_07640 23349 22825 gene locus_tag LOCUS_07650 23349 22825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 23503 23976 gene locus_tag LOCUS_07660 23503 23976 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294657.1 protein_id gnl|my_center|LOCUS_07660 25259 24156 gene locus_tag LOCUS_07670 25259 24156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 26688 25279 gene locus_tag LOCUS_07680 26688 25279 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_07680 27437 26727 gene locus_tag LOCUS_07690 27437 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 27864 30206 gene locus_tag LOCUS_07700 27864 30206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 30419 30334 gene locus_tag LOCUS_t00110 30419 30334 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32468 30534 gene locus_tag LOCUS_07710 gene thrS 32468 30534 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786086.1 protein_id gnl|my_center|LOCUS_07710 35089 32852 gene locus_tag LOCUS_07720 35089 32852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 36203 35274 gene locus_tag LOCUS_07730 36203 35274 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_07730 37692 36511 gene locus_tag LOCUS_07740 37692 36511 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_07740 37880 38512 gene locus_tag LOCUS_07750 37880 38512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 38527 41139 gene locus_tag LOCUS_07760 gene clpB 38527 41139 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_07760 41665 41207 gene locus_tag LOCUS_07770 41665 41207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42260 43288 gene locus_tag LOCUS_07780 42260 43288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 43336 44418 gene locus_tag LOCUS_07790 gene prfA 43336 44418 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114692.1 protein_id gnl|my_center|LOCUS_07790 44424 45440 gene locus_tag LOCUS_07800 44424 45440 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_07800 45437 46102 gene locus_tag LOCUS_07810 gene coaE 45437 46102 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480887.1 protein_id gnl|my_center|LOCUS_07810 46121 47542 gene locus_tag LOCUS_07820 46121 47542 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_07820 47919 47608 gene locus_tag LOCUS_07830 47919 47608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 48578 47916 gene locus_tag LOCUS_07840 48578 47916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 48804 50654 gene locus_tag LOCUS_07850 48804 50654 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_07850 50743 51333 gene locus_tag LOCUS_07860 50743 51333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 53513 51378 gene locus_tag LOCUS_07870 53513 51378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 54235 53765 gene locus_tag LOCUS_07880 gene rnhA 54235 53765 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937992.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence13 945 208 gene locus_tag LOCUS_07890 945 208 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_07890 2272 998 gene locus_tag LOCUS_07900 2272 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2486 3523 gene locus_tag LOCUS_07910 gene queA 2486 3523 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_07910 3555 4982 gene locus_tag LOCUS_07920 gene pyk 3555 4982 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_07920 5092 5478 gene locus_tag LOCUS_07930 5092 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 5523 6284 gene locus_tag LOCUS_07940 gene atpB 5523 6284 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_07940 6390 6641 gene locus_tag LOCUS_07950 6390 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6683 7180 gene locus_tag LOCUS_07960 gene atpF 6683 7180 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142624.1 protein_id gnl|my_center|LOCUS_07960 7177 7713 gene locus_tag LOCUS_07970 7177 7713 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732515.1 protein_id gnl|my_center|LOCUS_07970 7754 9259 gene locus_tag LOCUS_07980 gene atpA 7754 9259 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_07980 9279 10145 gene locus_tag LOCUS_07990 gene atpG 9279 10145 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_07990 10219 11646 gene locus_tag LOCUS_08000 gene atpD 10219 11646 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_08000 11643 12050 gene locus_tag LOCUS_08010 11643 12050 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_08010 12087 12773 gene locus_tag LOCUS_08020 12087 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 12829 14904 gene locus_tag LOCUS_08030 12829 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 14923 15195 gene locus_tag LOCUS_08040 14923 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15374 15673 gene locus_tag LOCUS_08050 15374 15673 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_08050 15677 16117 gene locus_tag LOCUS_08060 15677 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 16433 16942 gene locus_tag LOCUS_08070 gene rplJ 16433 16942 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_08070 17004 17375 gene locus_tag LOCUS_08080 gene rplL 17004 17375 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476232.1 protein_id gnl|my_center|LOCUS_08080 18681 17440 gene locus_tag LOCUS_08090 18681 17440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 18931 19006 gene locus_tag LOCUS_t00120 18931 19006 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19071 19529 gene locus_tag LOCUS_08100 19071 19529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 19560 19985 gene locus_tag LOCUS_08110 19560 19985 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816710.1 protein_id gnl|my_center|LOCUS_08110 20040 20513 gene locus_tag LOCUS_08120 20040 20513 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_08120 22504 20810 gene locus_tag LOCUS_08130 22504 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 23114 22545 gene locus_tag LOCUS_08140 23114 22545 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840007.1 protein_id gnl|my_center|LOCUS_08140 23846 23256 gene locus_tag LOCUS_08150 23846 23256 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_08150 24173 24589 gene locus_tag LOCUS_08160 24173 24589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 24625 25041 gene locus_tag LOCUS_08170 24625 25041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 25242 25152 gene locus_tag LOCUS_t00130 25242 25152 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25459 28056 gene locus_tag LOCUS_08180 25459 28056 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_08180 28135 29190 gene locus_tag LOCUS_08190 28135 29190 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_08190 29256 31013 gene locus_tag LOCUS_08200 29256 31013 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_08200 32280 31111 gene locus_tag LOCUS_08210 32280 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 32627 32430 gene locus_tag LOCUS_08220 32627 32430 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_08220 33009 32731 gene locus_tag LOCUS_08230 33009 32731 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_08230 33848 33249 gene locus_tag LOCUS_08240 33848 33249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 34618 34055 gene locus_tag LOCUS_08250 34618 34055 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_08250 36054 34615 gene locus_tag LOCUS_08260 36054 34615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 36622 36428 gene locus_tag LOCUS_08270 36622 36428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 37899 36739 gene locus_tag LOCUS_08280 gene ftsZ 37899 36739 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_08280 38884 38042 gene locus_tag LOCUS_08290 38884 38042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 39043 38885 gene locus_tag LOCUS_08300 39043 38885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 40375 39110 gene locus_tag LOCUS_08310 gene murA 40375 39110 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_08310 41581 40451 gene locus_tag LOCUS_08320 gene murG 41581 40451 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_08320 42818 41616 gene locus_tag LOCUS_08330 gene spoVE 42818 41616 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_08330 43950 42904 gene locus_tag LOCUS_08340 gene mraY 43950 42904 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_08340 45413 43974 gene locus_tag LOCUS_08350 gene murE 45413 43974 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_08350 47854 45434 gene locus_tag LOCUS_08360 47854 45434 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_08360 48869 48072 gene locus_tag LOCUS_08370 48869 48072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 49978 49049 gene locus_tag LOCUS_08380 gene rsmH 49978 49049 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_08380 50411 49980 gene locus_tag LOCUS_08390 gene mraZ 50411 49980 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_08390 <52064 51128 gene locus_tag LOCUS_08400 <52064 51128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723640.1:elongation factor Tu >Feature sequence14 44 117 gene locus_tag LOCUS_t00140 44 117 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1170 169 gene locus_tag LOCUS_08410 1170 169 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963846.1 protein_id gnl|my_center|LOCUS_08410 1844 1170 gene locus_tag LOCUS_08420 1844 1170 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434895.1 protein_id gnl|my_center|LOCUS_08420 2028 2714 gene locus_tag LOCUS_08430 2028 2714 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_08430 2727 5009 gene locus_tag LOCUS_08440 2727 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5208 5687 gene locus_tag LOCUS_08450 5208 5687 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_08450 5770 6597 gene locus_tag LOCUS_08460 5770 6597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 6712 7182 gene locus_tag LOCUS_08470 6712 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 7323 7724 gene locus_tag LOCUS_08480 7323 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 7924 7835 gene locus_tag LOCUS_t00150 7924 7835 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8041 7953 gene locus_tag LOCUS_t00160 8041 7953 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9030 8167 gene locus_tag LOCUS_08490 gene fba 9030 8167 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_08490 9266 9958 gene locus_tag LOCUS_08500 gene spoIIR 9266 9958 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768304.1 protein_id gnl|my_center|LOCUS_08500 10121 10678 gene locus_tag LOCUS_08510 gene efp 10121 10678 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_08510 10743 11225 gene locus_tag LOCUS_08520 10743 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869788.1 protein_id gnl|my_center|LOCUS_08520 11463 12116 gene locus_tag LOCUS_08530 11463 12116 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081740.1 protein_id gnl|my_center|LOCUS_08530 12252 12521 gene locus_tag LOCUS_08540 12252 12521 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112985.1 protein_id gnl|my_center|LOCUS_08540 12537 13895 gene locus_tag LOCUS_08550 12537 13895 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_08550 14150 14470 gene locus_tag LOCUS_08560 14150 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 14476 15528 gene locus_tag LOCUS_08570 14476 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15547 17499 gene locus_tag LOCUS_08580 15547 17499 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_08580 17538 17990 gene locus_tag LOCUS_08590 17538 17990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 17997 18305 gene locus_tag LOCUS_08600 17997 18305 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_08600 18339 18932 gene locus_tag LOCUS_08610 18339 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 18929 20704 gene locus_tag LOCUS_08620 18929 20704 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_08620 20701 22119 gene locus_tag LOCUS_08630 20701 22119 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_08630 22112 22729 gene locus_tag LOCUS_08640 22112 22729 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_08640 23249 22806 gene locus_tag LOCUS_08650 23249 22806 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809726.1 protein_id gnl|my_center|LOCUS_08650 23607 23281 gene locus_tag LOCUS_08660 23607 23281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 24025 23705 gene locus_tag LOCUS_08670 24025 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 23924 24166 gene locus_tag LOCUS_08680 23924 24166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 24426 24139 gene locus_tag LOCUS_08690 24426 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 25266 24499 gene locus_tag LOCUS_08700 25266 24499 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_08700 26935 25268 gene locus_tag LOCUS_08710 26935 25268 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476525.1 protein_id gnl|my_center|LOCUS_08710 27440 26979 gene locus_tag LOCUS_08720 27440 26979 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_08720 28764 27565 gene locus_tag LOCUS_08730 28764 27565 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_08730 28977 30185 gene locus_tag LOCUS_08740 28977 30185 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_08740 30196 30828 gene locus_tag LOCUS_08750 30196 30828 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_08750 31042 31668 gene locus_tag LOCUS_08760 31042 31668 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_08760 32061 31723 gene locus_tag LOCUS_08770 gene spoVG 32061 31723 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421453.1 protein_id gnl|my_center|LOCUS_08770 32284 33702 gene locus_tag LOCUS_08780 gene murC 32284 33702 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_08780 33722 34309 gene locus_tag LOCUS_08790 gene lexA 33722 34309 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254404.1 protein_id gnl|my_center|LOCUS_08790 34328 34810 gene locus_tag LOCUS_08800 34328 34810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 34788 36887 gene locus_tag LOCUS_08810 34788 36887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 36901 37338 gene locus_tag LOCUS_08820 gene dut 36901 37338 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808844.1 protein_id gnl|my_center|LOCUS_08820 37389 37655 gene locus_tag LOCUS_08830 37389 37655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 37687 37896 gene locus_tag LOCUS_08840 37687 37896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 37970 38743 gene locus_tag LOCUS_08850 gene sigG 37970 38743 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967190.1 protein_id gnl|my_center|LOCUS_08850 38880 40100 gene locus_tag LOCUS_08860 gene alr 38880 40100 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_08860 40104 40778 gene locus_tag LOCUS_08870 40104 40778 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_08870 40794 41657 gene locus_tag LOCUS_08880 gene metF 40794 41657 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_08880 41642 42313 gene locus_tag LOCUS_08890 41642 42313 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_08890 42336 44690 gene locus_tag LOCUS_08900 42336 44690 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_08900 44693 45157 gene locus_tag LOCUS_08910 gene dtd 44693 45157 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583334.1 protein_id gnl|my_center|LOCUS_08910 45747 45202 gene locus_tag LOCUS_08920 gene spoVT 45747 45202 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_08920 46205 46432 gene locus_tag LOCUS_08930 46205 46432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 46812 49697 gene locus_tag LOCUS_08940 46812 49697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence15 1453 368 gene locus_tag LOCUS_08950 1453 368 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_08950 1977 1543 gene locus_tag LOCUS_08960 gene aroQ 1977 1543 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_08960 3217 1925 gene locus_tag LOCUS_08970 3217 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4382 3237 gene locus_tag LOCUS_08980 gene pheA 4382 3237 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417818.1 protein_id gnl|my_center|LOCUS_08980 5507 4422 gene locus_tag LOCUS_08990 gene aroC 5507 4422 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_08990 6741 5488 gene locus_tag LOCUS_09000 gene aroA 6741 5488 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_09000 7817 6744 gene locus_tag LOCUS_09010 gene aroB 7817 6744 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002920829.1 protein_id gnl|my_center|LOCUS_09010 8677 7838 gene locus_tag LOCUS_09020 8677 7838 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_09020 9732 8707 gene locus_tag LOCUS_09030 gene aroF 9732 8707 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_09030 10245 11561 gene locus_tag LOCUS_09040 10245 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11757 12854 gene locus_tag LOCUS_09050 gene pyrB 11757 12854 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_09050 13748 13521 gene locus_tag LOCUS_09060 gene acpP 13748 13521 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_09060 14027 14110 gene locus_tag LOCUS_t00170 14027 14110 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14236 14424 gene locus_tag LOCUS_09070 14236 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14536 15924 gene locus_tag LOCUS_09080 gene radA 14536 15924 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_09080 16084 16632 gene locus_tag LOCUS_09090 16084 16632 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_09090 16622 18721 gene locus_tag LOCUS_09100 16622 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 19857 18898 gene locus_tag LOCUS_09110 gene glcK 19857 18898 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_09110 20869 19889 gene locus_tag LOCUS_09120 gene manA 20869 19889 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_09120 22773 20896 gene locus_tag LOCUS_09130 gene uvrC 22773 20896 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_09130 23657 22770 gene locus_tag LOCUS_09140 23657 22770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 24988 23708 gene locus_tag LOCUS_09150 gene purD 24988 23708 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_09150 26342 25158 gene locus_tag LOCUS_09160 26342 25158 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_09160 27115 26384 gene locus_tag LOCUS_09170 27115 26384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 27904 27188 gene locus_tag LOCUS_09180 gene purN 27904 27188 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_09180 28981 27938 gene locus_tag LOCUS_09190 gene purM 28981 27938 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_09190 30429 29026 gene locus_tag LOCUS_09200 30429 29026 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_09200 31215 30496 gene locus_tag LOCUS_09210 31215 30496 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_09210 31784 31287 gene locus_tag LOCUS_09220 gene purE 31784 31287 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_09220 32873 31881 gene locus_tag LOCUS_09230 32873 31881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 33482 32964 gene locus_tag LOCUS_09240 33482 32964 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869013.1 protein_id gnl|my_center|LOCUS_09240 34690 33557 gene locus_tag LOCUS_09250 34690 33557 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_09250 35912 34989 gene locus_tag LOCUS_09260 35912 34989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 36859 35909 gene locus_tag LOCUS_09270 36859 35909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 38333 36840 gene locus_tag LOCUS_09280 38333 36840 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_09280 38550 39815 gene locus_tag LOCUS_09290 38550 39815 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_09290 40322 41158 gene locus_tag LOCUS_09300 40322 41158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 41383 43428 gene locus_tag LOCUS_09310 41383 43428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence16 1416 811 gene locus_tag LOCUS_09320 1416 811 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_09320 1814 1443 gene locus_tag LOCUS_09330 1814 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2253 1861 gene locus_tag LOCUS_09340 2253 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2843 2277 gene locus_tag LOCUS_09350 2843 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5184 3028 gene locus_tag LOCUS_09360 gene pnp 5184 3028 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_09360 5667 5401 gene locus_tag LOCUS_09370 gene rpsO 5667 5401 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_09370 6046 7686 gene locus_tag LOCUS_09380 6046 7686 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_09380 9168 8008 gene locus_tag LOCUS_09390 gene metK 9168 8008 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_09390 9599 10525 gene locus_tag LOCUS_09400 gene cdaA 9599 10525 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_09400 10522 11955 gene locus_tag LOCUS_09410 10522 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 13622 12060 gene locus_tag LOCUS_09420 13622 12060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 14889 13669 gene locus_tag LOCUS_09430 gene tyrS 14889 13669 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963956.1 protein_id gnl|my_center|LOCUS_09430 15503 15033 gene locus_tag LOCUS_09440 15503 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16707 15496 gene locus_tag LOCUS_09450 16707 15496 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461367.1 protein_id gnl|my_center|LOCUS_09450 16872 17792 gene locus_tag LOCUS_09460 16872 17792 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_09460 17831 18139 gene locus_tag LOCUS_09470 17831 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 18132 18575 gene locus_tag LOCUS_09480 18132 18575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 18621 19616 gene locus_tag LOCUS_09490 18621 19616 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_09490 19613 20701 gene locus_tag LOCUS_09500 19613 20701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 22517 20814 gene locus_tag LOCUS_09510 gene ade 22517 20814 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_09510 24689 22671 gene locus_tag LOCUS_09520 24689 22671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 25499 24717 gene locus_tag LOCUS_09530 25499 24717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 26455 25535 gene locus_tag LOCUS_09540 26455 25535 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874373.1 protein_id gnl|my_center|LOCUS_09540 28057 26534 gene locus_tag LOCUS_09550 gene xylB 28057 26534 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_09550 29407 28214 gene locus_tag LOCUS_09560 29407 28214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 31831 29453 gene locus_tag LOCUS_09570 gene pcrA 31831 29453 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457083.1 protein_id gnl|my_center|LOCUS_09570 32154 32588 gene locus_tag LOCUS_09580 32154 32588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 32670 33512 gene locus_tag LOCUS_09590 32670 33512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09590 33509 34438 gene locus_tag LOCUS_09600 gene nadA 33509 34438 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870480.1 protein_id gnl|my_center|LOCUS_09600 34475 35317 gene locus_tag LOCUS_09610 34475 35317 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_09610 35324 36685 gene locus_tag LOCUS_09620 35324 36685 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_09620 36720 38411 gene locus_tag LOCUS_09630 36720 38411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 38580 38984 gene locus_tag LOCUS_09640 38580 38984 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_09640 39115 39888 gene locus_tag LOCUS_09650 39115 39888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 40259 40011 gene locus_tag LOCUS_09660 gene rpsR 40259 40011 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_09660 40813 40292 gene locus_tag LOCUS_09670 gene ssb 40813 40292 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100851.1 protein_id gnl|my_center|LOCUS_09670 41140 40847 gene locus_tag LOCUS_09680 gene rpsF 41140 40847 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_09680 41991 41344 gene locus_tag LOCUS_09690 41991 41344 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476288.1 protein_id gnl|my_center|LOCUS_09690 43340 42180 gene locus_tag LOCUS_09700 gene dnaJ 43340 42180 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_09700 45370 43532 gene locus_tag LOCUS_09710 gene dnaK 45370 43532 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_09710 46072 45458 gene locus_tag LOCUS_09720 gene grpE 46072 45458 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_09720 46509 46069 gene locus_tag LOCUS_09730 46509 46069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence17 1494 514 gene locus_tag LOCUS_09740 gene scfB 1494 514 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965577.1 protein_id gnl|my_center|LOCUS_09740 2540 1752 gene locus_tag LOCUS_09750 2540 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2732 2598 gene locus_tag LOCUS_09760 2732 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2782 5541 gene locus_tag LOCUS_09770 2782 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 5829 14387 gene locus_tag LOCUS_09780 5829 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 14384 19519 gene locus_tag LOCUS_09790 14384 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 19668 20276 gene locus_tag LOCUS_09800 19668 20276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 20325 20921 gene locus_tag LOCUS_09810 20325 20921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 20968 21570 gene locus_tag LOCUS_09820 20968 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 21636 21827 gene locus_tag LOCUS_09830 21636 21827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 22024 22893 gene locus_tag LOCUS_09840 22024 22893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 23104 23478 gene locus_tag LOCUS_09850 23104 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 23671 24147 gene locus_tag LOCUS_09860 23671 24147 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_09860 25323 24226 gene locus_tag LOCUS_09870 gene ychF 25323 24226 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_09870 25581 26339 gene locus_tag LOCUS_09880 25581 26339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 27296 26448 gene locus_tag LOCUS_09890 gene folD 27296 26448 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_09890 28462 27299 gene locus_tag LOCUS_09900 28462 27299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 29780 28485 gene locus_tag LOCUS_09910 29780 28485 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 protein_id gnl|my_center|LOCUS_09910 31072 29777 gene locus_tag LOCUS_09920 31072 29777 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_09920 31418 35137 gene locus_tag LOCUS_09930 31418 35137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 35134 35754 gene locus_tag LOCUS_09940 gene plsY 35134 35754 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531796.1 protein_id gnl|my_center|LOCUS_09940 36087 36296 gene locus_tag LOCUS_09950 36087 36296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 36481 36323 gene locus_tag LOCUS_09960 36481 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 36606 37415 gene locus_tag LOCUS_09970 36606 37415 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454000.1 protein_id gnl|my_center|LOCUS_09970 37425 38288 gene locus_tag LOCUS_09980 gene pstC 37425 38288 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_09980 38293 39159 gene locus_tag LOCUS_09990 gene pstA 38293 39159 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_09990 39156 39917 gene locus_tag LOCUS_10000 gene pstB 39156 39917 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_10000 39919 40563 gene locus_tag LOCUS_10010 gene phoU 39919 40563 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_10010 40577 41260 gene locus_tag LOCUS_10020 40577 41260 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_10020 41253 42908 gene locus_tag LOCUS_10030 41253 42908 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_10030 43209 42997 gene locus_tag LOCUS_10040 43209 42997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 44134 43367 gene locus_tag LOCUS_10050 44134 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 44582 44238 gene locus_tag LOCUS_10060 gene mobC 44582 44238 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368707.1 protein_id gnl|my_center|LOCUS_10060 44731 44579 gene locus_tag LOCUS_10070 44731 44579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence18 1645 266 gene locus_tag LOCUS_10080 gene rlmD 1645 266 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_10080 2016 1645 gene locus_tag LOCUS_10090 2016 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2632 2186 gene locus_tag LOCUS_10100 2632 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4172 2748 gene locus_tag LOCUS_10110 4172 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4515 4847 gene locus_tag LOCUS_10120 4515 4847 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722052.1 protein_id gnl|my_center|LOCUS_10120 4847 5824 gene locus_tag LOCUS_10130 4847 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5896 7422 gene locus_tag LOCUS_10140 5896 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 7558 8223 gene locus_tag LOCUS_10150 7558 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 8242 8832 gene locus_tag LOCUS_10160 8242 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 9258 8884 gene locus_tag LOCUS_10170 9258 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 9932 9255 gene locus_tag LOCUS_10180 9932 9255 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_10180 10319 10050 gene locus_tag LOCUS_10190 gene rpsT 10319 10050 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_10190 10574 11437 gene locus_tag LOCUS_10200 gene gpr 10574 11437 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_10200 11530 11712 gene locus_tag LOCUS_10210 11530 11712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 11900 12490 gene locus_tag LOCUS_10220 11900 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12665 13618 gene locus_tag LOCUS_10230 12665 13618 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_10230 13643 13867 gene locus_tag LOCUS_10240 gene acpP 13643 13867 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359433.1 protein_id gnl|my_center|LOCUS_10240 13864 14808 gene locus_tag LOCUS_10250 gene fabK 13864 14808 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_10250 14796 15728 gene locus_tag LOCUS_10260 gene fabD 14796 15728 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_10260 15715 16452 gene locus_tag LOCUS_10270 gene fabG 15715 16452 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_10270 16478 17707 gene locus_tag LOCUS_10280 gene fabF 16478 17707 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_10280 17718 18143 gene locus_tag LOCUS_10290 gene fabZ 17718 18143 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391761.1 protein_id gnl|my_center|LOCUS_10290 18150 19013 gene locus_tag LOCUS_10300 gene accD 18150 19013 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_10300 19010 19789 gene locus_tag LOCUS_10310 19010 19789 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048421.1 protein_id gnl|my_center|LOCUS_10310 20528 21028 gene locus_tag LOCUS_10320 20528 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 21174 22355 gene locus_tag LOCUS_10330 21174 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 22461 23012 gene locus_tag LOCUS_10340 22461 23012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 23293 25029 gene locus_tag LOCUS_10350 23293 25029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 25190 26800 gene locus_tag LOCUS_10360 25190 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 28097 26886 gene locus_tag LOCUS_10370 28097 26886 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_10370 28767 28090 gene locus_tag LOCUS_10380 28767 28090 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_10380 28945 29622 gene locus_tag LOCUS_10390 28945 29622 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_10390 29649 30320 gene locus_tag LOCUS_10400 29649 30320 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_10400 30330 32417 gene locus_tag LOCUS_10410 30330 32417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 32658 33749 gene locus_tag LOCUS_10420 32658 33749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 34781 33807 gene locus_tag LOCUS_10430 34781 33807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 35020 34736 gene locus_tag LOCUS_10440 35020 34736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 34988 35521 gene locus_tag LOCUS_10450 34988 35521 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877643.1 protein_id gnl|my_center|LOCUS_10450 36203 35598 gene locus_tag LOCUS_10460 36203 35598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 36387 37022 gene locus_tag LOCUS_10470 36387 37022 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_10470 37055 37948 gene locus_tag LOCUS_10480 37055 37948 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_10480 37995 38432 gene locus_tag LOCUS_10490 37995 38432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 38937 38506 gene locus_tag LOCUS_10500 38937 38506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 41081 39084 gene locus_tag LOCUS_10510 41081 39084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 41540 41196 gene locus_tag LOCUS_10520 41540 41196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 41779 41537 gene locus_tag LOCUS_10530 41779 41537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence19 178 249 gene locus_tag LOCUS_t00180 178 249 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 684 295 gene locus_tag LOCUS_10540 684 295 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214503.1 protein_id gnl|my_center|LOCUS_10540 1576 734 gene locus_tag LOCUS_10550 1576 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2156 2230 gene locus_tag LOCUS_t00190 2156 2230 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2436 4721 gene locus_tag LOCUS_10560 2436 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4928 11230 gene locus_tag LOCUS_10570 4928 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 11799 12182 gene locus_tag LOCUS_10580 11799 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 12179 12754 gene locus_tag LOCUS_10590 gene lepB 12179 12754 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774995.1 protein_id gnl|my_center|LOCUS_10590 12803 17893 gene locus_tag LOCUS_10600 12803 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 17965 19542 gene locus_tag LOCUS_10610 17965 19542 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_10610 19637 20503 gene locus_tag LOCUS_10620 19637 20503 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774996.1 protein_id gnl|my_center|LOCUS_10620 22079 20613 gene locus_tag LOCUS_10630 22079 20613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 23678 22584 gene locus_tag LOCUS_10640 23678 22584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 24221 23850 gene locus_tag LOCUS_10650 24221 23850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 24429 24992 gene locus_tag LOCUS_10660 24429 24992 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_10660 25055 26176 gene locus_tag LOCUS_10670 gene nspC 25055 26176 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_10670 26253 26615 gene locus_tag LOCUS_10680 26253 26615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 28247 26709 gene locus_tag LOCUS_10690 gene asnB 28247 26709 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860775.1 protein_id gnl|my_center|LOCUS_10690 28498 28328 gene locus_tag LOCUS_10700 28498 28328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 29199 28495 gene locus_tag LOCUS_10710 gene pflA 29199 28495 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_10710 30073 29222 gene locus_tag LOCUS_10720 gene nadC 30073 29222 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_10720 31533 30070 gene locus_tag LOCUS_10730 gene nadB 31533 30070 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094477.1 protein_id gnl|my_center|LOCUS_10730 33112 31802 gene locus_tag LOCUS_10740 33112 31802 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679691.1 protein_id gnl|my_center|LOCUS_10740 34454 33201 gene locus_tag LOCUS_10750 34454 33201 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_10750 35425 34622 gene locus_tag LOCUS_10760 35425 34622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 36017 38248 gene locus_tag LOCUS_10770 gene pflB 36017 38248 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964298.1 protein_id gnl|my_center|LOCUS_10770 38466 38539 gene locus_tag LOCUS_t00200 38466 38539 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 38545 38620 gene locus_tag LOCUS_t00210 38545 38620 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38660 38734 gene locus_tag LOCUS_t00220 38660 38734 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 39724 38861 gene locus_tag LOCUS_10780 39724 38861 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674381.1 protein_id gnl|my_center|LOCUS_10780 39952 40641 gene locus_tag LOCUS_10790 39952 40641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 41804 40647 gene locus_tag LOCUS_10800 41804 40647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence20 497 1939 gene locus_tag LOCUS_10810 gene purB 497 1939 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_10810 2137 3612 gene locus_tag LOCUS_10820 2137 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 3609 4577 gene locus_tag LOCUS_10830 3609 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10830 4828 5274 gene locus_tag LOCUS_10840 gene nrdR 4828 5274 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584044.1 protein_id gnl|my_center|LOCUS_10840 5700 5275 gene locus_tag LOCUS_10850 5700 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 5787 6566 gene locus_tag LOCUS_10860 5787 6566 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989966.1 protein_id gnl|my_center|LOCUS_10860 6776 7915 gene locus_tag LOCUS_10870 gene ugpC 6776 7915 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_10870 8003 9616 gene locus_tag LOCUS_10880 8003 9616 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_10880 9791 11131 gene locus_tag LOCUS_10890 gene mmdA 9791 11131 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_10890 11182 11568 gene locus_tag LOCUS_10900 11182 11568 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_10900 11587 12984 gene locus_tag LOCUS_10910 11587 12984 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_10910 13084 14031 gene locus_tag LOCUS_10920 gene metA 13084 14031 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_10920 14444 14037 gene locus_tag LOCUS_10930 14444 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 14567 15016 gene locus_tag LOCUS_10940 14567 15016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 15032 15250 gene locus_tag LOCUS_10950 15032 15250 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_10950 15253 16848 gene locus_tag LOCUS_10960 15253 16848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 16896 17267 gene locus_tag LOCUS_10970 16896 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 17271 17696 gene locus_tag LOCUS_10980 17271 17696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 19358 17928 gene locus_tag LOCUS_10990 19358 17928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 20016 19348 gene locus_tag LOCUS_11000 20016 19348 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_11000 20252 22540 gene locus_tag LOCUS_11010 20252 22540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 22734 23237 gene locus_tag LOCUS_11020 22734 23237 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_11020 23265 23495 gene locus_tag LOCUS_11030 gene pptA 23265 23495 CDS product tautomerase PptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120143.1 protein_id gnl|my_center|LOCUS_11030 23523 24536 gene locus_tag LOCUS_11040 23523 24536 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356149.1 protein_id gnl|my_center|LOCUS_11040 24553 25410 gene locus_tag LOCUS_11050 gene rsmA 24553 25410 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216839.1 protein_id gnl|my_center|LOCUS_11050 25456 25950 gene locus_tag LOCUS_11060 25456 25950 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_11060 26179 26385 gene locus_tag LOCUS_11070 26179 26385 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_11070 26406 27467 gene locus_tag LOCUS_11080 26406 27467 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_11080 27467 28036 gene locus_tag LOCUS_11090 27467 28036 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11090 28033 28251 gene locus_tag LOCUS_11100 28033 28251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11100 28248 28787 gene locus_tag LOCUS_11110 28248 28787 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_11110 28973 29959 gene locus_tag LOCUS_11120 28973 29959 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_11120 30078 32093 gene locus_tag LOCUS_11130 30078 32093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 32223 32146 gene locus_tag LOCUS_t00230 32223 32146 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32361 32963 gene locus_tag LOCUS_11140 32361 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812540.1 protein_id gnl|my_center|LOCUS_11140 33280 32909 gene locus_tag LOCUS_11150 33280 32909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 34446 33337 gene locus_tag LOCUS_11160 34446 33337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 34911 35510 gene locus_tag LOCUS_11170 34911 35510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 36008 36826 gene locus_tag LOCUS_11180 36008 36826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 37004 38944 gene locus_tag LOCUS_11190 37004 38944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 38987 40915 gene locus_tag LOCUS_11200 38987 40915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence21 145 70 gene locus_tag LOCUS_t00240 145 70 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1248 370 gene locus_tag LOCUS_11210 1248 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3355 1373 gene locus_tag LOCUS_11220 gene metG 3355 1373 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_11220 4171 3563 gene locus_tag LOCUS_11230 4171 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4288 4500 gene locus_tag LOCUS_11240 4288 4500 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_11240 6949 4556 gene locus_tag LOCUS_11250 6949 4556 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_11250 7347 7961 gene locus_tag LOCUS_11260 7347 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8001 8780 gene locus_tag LOCUS_11270 8001 8780 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_11270 9302 8808 gene locus_tag LOCUS_11280 9302 8808 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_11280 11672 9375 gene locus_tag LOCUS_11290 11672 9375 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_11290 12664 11753 gene locus_tag LOCUS_11300 12664 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 13996 12785 gene locus_tag LOCUS_11310 13996 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 14808 14023 gene locus_tag LOCUS_11320 gene truA 14808 14023 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_11320 15654 14848 gene locus_tag LOCUS_11330 15654 14848 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_11330 16514 15648 gene locus_tag LOCUS_11340 16514 15648 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_11340 17419 16562 gene locus_tag LOCUS_11350 17419 16562 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_11350 18284 17499 gene locus_tag LOCUS_11360 18284 17499 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_11360 19764 18373 gene locus_tag LOCUS_11370 gene glmM 19764 18373 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_11370 20306 19779 gene locus_tag LOCUS_11380 20306 19779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 21426 20335 gene locus_tag LOCUS_11390 gene ruvB 21426 20335 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_11390 22191 21466 gene locus_tag LOCUS_11400 22191 21466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 22882 22280 gene locus_tag LOCUS_11410 gene ruvA 22882 22280 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580359.1 protein_id gnl|my_center|LOCUS_11410 23391 22912 gene locus_tag LOCUS_11420 gene ruvC 23391 22912 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_11420 25824 23584 gene locus_tag LOCUS_11430 gene gyrA 25824 23584 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_11430 27836 25854 gene locus_tag LOCUS_11440 gene gyrB 27836 25854 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_11440 28334 28002 gene locus_tag LOCUS_11450 28334 28002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 28604 29518 gene locus_tag LOCUS_11460 28604 29518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 29522 30121 gene locus_tag LOCUS_11470 29522 30121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 30295 31965 gene locus_tag LOCUS_11480 30295 31965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 31991 33388 gene locus_tag LOCUS_11490 31991 33388 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_11490 33407 34534 gene locus_tag LOCUS_11500 33407 34534 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_11500 35797 34583 gene locus_tag LOCUS_11510 35797 34583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 36139 37605 gene locus_tag LOCUS_11520 36139 37605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 37625 38380 gene locus_tag LOCUS_11530 37625 38380 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_11530 38377 39705 gene locus_tag LOCUS_11540 38377 39705 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence22 2154 523 gene locus_tag LOCUS_11550 gene lysS 2154 523 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_11550 2663 2169 gene locus_tag LOCUS_11560 gene greA 2663 2169 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_11560 5983 2756 gene locus_tag LOCUS_11570 gene carB 5983 2756 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_11570 7476 6205 gene locus_tag LOCUS_11580 gene clpX 7476 6205 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_11580 8098 7508 gene locus_tag LOCUS_11590 gene clpP 8098 7508 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_11590 9562 8228 gene locus_tag LOCUS_11600 gene tig 9562 8228 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_11600 10384 9692 gene locus_tag LOCUS_11610 10384 9692 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_11610 11877 10381 gene locus_tag LOCUS_11620 gene thrC 11877 10381 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_11620 12333 11956 gene locus_tag LOCUS_11630 12333 11956 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_11630 12946 12317 gene locus_tag LOCUS_11640 gene rnhB 12946 12317 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_11640 13888 12950 gene locus_tag LOCUS_11650 gene ylqF 13888 12950 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_11650 15216 13924 gene locus_tag LOCUS_11660 15216 13924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 15920 15243 gene locus_tag LOCUS_11670 gene lepB 15920 15243 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_11670 16351 16007 gene locus_tag LOCUS_11680 gene rplS 16351 16007 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_11680 16529 16338 gene locus_tag LOCUS_11690 16529 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 16801 19461 gene locus_tag LOCUS_11700 16801 19461 CDS product dockerin type I domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964237.1 protein_id gnl|my_center|LOCUS_11700 19895 19590 gene locus_tag LOCUS_11710 19895 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 20103 20345 gene locus_tag LOCUS_11720 20103 20345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 20299 20586 gene locus_tag LOCUS_11730 20299 20586 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454698.1 protein_id gnl|my_center|LOCUS_11730 20589 21227 gene locus_tag LOCUS_11740 20589 21227 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392905.1 protein_id gnl|my_center|LOCUS_11740 23941 21461 gene locus_tag LOCUS_11750 23941 21461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 24640 25863 gene locus_tag LOCUS_11760 24640 25863 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_11760 25951 26853 gene locus_tag LOCUS_11770 25951 26853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 26926 27702 gene locus_tag LOCUS_11780 gene tpiA 26926 27702 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964030.1 protein_id gnl|my_center|LOCUS_11780 27695 28216 gene locus_tag LOCUS_11790 27695 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 28213 29730 gene locus_tag LOCUS_11800 gene gpmI 28213 29730 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_11800 29856 30035 gene locus_tag LOCUS_11810 29856 30035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 30282 31406 gene locus_tag LOCUS_11820 30282 31406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 31422 31904 gene locus_tag LOCUS_11830 gene tadA 31422 31904 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_11830 32102 33049 gene locus_tag LOCUS_11840 32102 33049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 33141 34481 gene locus_tag LOCUS_11850 33141 34481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 34664 36853 gene locus_tag LOCUS_11860 34664 36853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 36925 38001 gene locus_tag LOCUS_11870 36925 38001 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_11870 38003 39415 gene locus_tag LOCUS_11880 38003 39415 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965427.1 protein_id gnl|my_center|LOCUS_11880 39635 40048 gene locus_tag LOCUS_11890 39635 40048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 40053 40766 gene locus_tag LOCUS_11900 40053 40766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 41003 41078 gene locus_tag LOCUS_t00250 41003 41078 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 719 976 gene locus_tag LOCUS_11910 719 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 981 1562 gene locus_tag LOCUS_11920 gene lepB 981 1562 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_11920 2281 10020 gene locus_tag LOCUS_11930 2281 10020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 10118 11869 gene locus_tag LOCUS_11940 10118 11869 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390379.1 protein_id gnl|my_center|LOCUS_11940 11982 12839 gene locus_tag LOCUS_11950 11982 12839 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775508.1 protein_id gnl|my_center|LOCUS_11950 12857 13930 gene locus_tag LOCUS_11960 12857 13930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 13920 14561 gene locus_tag LOCUS_11970 13920 14561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 14741 15112 gene locus_tag LOCUS_11980 14741 15112 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830364.1 protein_id gnl|my_center|LOCUS_11980 15115 15999 gene locus_tag LOCUS_11990 15115 15999 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891289.1 protein_id gnl|my_center|LOCUS_11990 15968 16684 gene locus_tag LOCUS_12000 15968 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 16698 17495 gene locus_tag LOCUS_12010 16698 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 17512 19380 gene locus_tag LOCUS_12020 17512 19380 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836488.1 protein_id gnl|my_center|LOCUS_12020 20498 19458 gene locus_tag LOCUS_12030 20498 19458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 21277 21738 gene locus_tag LOCUS_12040 gene mscL 21277 21738 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209017.1 protein_id gnl|my_center|LOCUS_12040 22095 22787 gene locus_tag LOCUS_12050 22095 22787 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_12050 22873 25257 gene locus_tag LOCUS_12060 22873 25257 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_12060 26231 25323 gene locus_tag LOCUS_12070 gene trxB 26231 25323 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_12070 27445 26231 gene locus_tag LOCUS_12080 27445 26231 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948693.1 protein_id gnl|my_center|LOCUS_12080 27752 28711 gene locus_tag LOCUS_12090 gene pfkA 27752 28711 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_12090 28948 29562 gene locus_tag LOCUS_12100 28948 29562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 29593 30405 gene locus_tag LOCUS_12110 gene proC 29593 30405 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 protein_id gnl|my_center|LOCUS_12110 30511 31149 gene locus_tag LOCUS_12120 30511 31149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 31178 32089 gene locus_tag LOCUS_12130 31178 32089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 34538 32184 gene locus_tag LOCUS_12140 gene feoB 34538 32184 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_12140 34720 34535 gene locus_tag LOCUS_12150 34720 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 34857 36506 gene locus_tag LOCUS_12160 34857 36506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 37043 37795 gene locus_tag LOCUS_12170 37043 37795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence24 389 541 gene locus_tag LOCUS_12180 389 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 832 2271 gene locus_tag LOCUS_12190 832 2271 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068837.1 protein_id gnl|my_center|LOCUS_12190 2589 5858 gene locus_tag LOCUS_12200 2589 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6463 6696 gene locus_tag LOCUS_12210 6463 6696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6757 7050 gene locus_tag LOCUS_12220 6757 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 7122 7796 gene locus_tag LOCUS_12230 7122 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 7964 8143 gene locus_tag LOCUS_12240 7964 8143 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_12240 8956 8231 gene locus_tag LOCUS_12250 gene pnuC 8956 8231 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_12250 10410 9046 gene locus_tag LOCUS_12260 10410 9046 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_12260 11293 10496 gene locus_tag LOCUS_12270 11293 10496 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113611.1 protein_id gnl|my_center|LOCUS_12270 12448 11318 gene locus_tag LOCUS_12280 gene rlmD 12448 11318 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_12280 12641 12859 gene locus_tag LOCUS_12290 12641 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 12864 13037 gene locus_tag LOCUS_12300 12864 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 12971 13516 gene locus_tag LOCUS_12310 12971 13516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 13980 13717 gene locus_tag LOCUS_12320 13980 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14223 15413 gene locus_tag LOCUS_12330 gene mtaB 14223 15413 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_12330 15587 19294 gene locus_tag LOCUS_12340 15587 19294 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_12340 19447 20475 gene locus_tag LOCUS_12350 gene spoVAD 19447 20475 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_12350 20472 20825 gene locus_tag LOCUS_12360 gene spoVAE 20472 20825 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_12360 22826 21690 gene locus_tag LOCUS_12370 gene tgt 22826 21690 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_12370 24540 22861 gene locus_tag LOCUS_12380 24540 22861 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453879.1 protein_id gnl|my_center|LOCUS_12380 24976 24542 gene locus_tag LOCUS_12390 24976 24542 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_12390 25230 24973 gene locus_tag LOCUS_12400 25230 24973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 25753 25253 gene locus_tag LOCUS_12410 25753 25253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 26673 25921 gene locus_tag LOCUS_12420 26673 25921 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_12420 26808 27083 gene locus_tag LOCUS_12430 26808 27083 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_12430 27174 29336 gene locus_tag LOCUS_12440 27174 29336 CDS product RICIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031639.1 protein_id gnl|my_center|LOCUS_12440 29488 29697 gene locus_tag LOCUS_12450 29488 29697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 29685 30263 gene locus_tag LOCUS_12460 29685 30263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 30336 32996 gene locus_tag LOCUS_12470 30336 32996 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_12470 34474 33110 gene locus_tag LOCUS_12480 34474 33110 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_12480 37076 34647 gene locus_tag LOCUS_12490 gene pheT 37076 34647 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_12490 38190 37165 gene locus_tag LOCUS_12500 gene pheS 38190 37165 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence25 266 194 gene locus_tag LOCUS_t00260 266 194 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 503 1726 gene locus_tag LOCUS_12510 503 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3106 2213 gene locus_tag LOCUS_12520 3106 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3443 3577 gene locus_tag LOCUS_12530 3443 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3647 4072 gene locus_tag LOCUS_12540 3647 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4077 4496 gene locus_tag LOCUS_12550 4077 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 4484 5626 gene locus_tag LOCUS_12560 gene yidC 4484 5626 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114035.1 protein_id gnl|my_center|LOCUS_12560 5721 6728 gene locus_tag LOCUS_12570 5721 6728 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 protein_id gnl|my_center|LOCUS_12570 6750 8129 gene locus_tag LOCUS_12580 gene mnmE 6750 8129 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_12580 8204 10084 gene locus_tag LOCUS_12590 gene mnmG 8204 10084 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_12590 10077 10778 gene locus_tag LOCUS_12600 gene rsmG 10077 10778 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229055.1 protein_id gnl|my_center|LOCUS_12600 10979 12217 gene locus_tag LOCUS_12610 10979 12217 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_12610 12219 13454 gene locus_tag LOCUS_12620 12219 13454 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_12620 13570 14556 gene locus_tag LOCUS_12630 13570 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 15145 16704 gene locus_tag LOCUS_12640 15145 16704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 18189 16816 gene locus_tag LOCUS_12650 18189 16816 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_12650 19131 18325 gene locus_tag LOCUS_12660 19131 18325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 19671 23201 gene locus_tag LOCUS_12670 gene nifJ 19671 23201 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_12670 24242 23796 gene locus_tag LOCUS_12680 gene spoVAC 24242 23796 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_12680 25641 24307 gene locus_tag LOCUS_12690 25641 24307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 26138 25638 gene locus_tag LOCUS_12700 26138 25638 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439159.1 protein_id gnl|my_center|LOCUS_12700 27312 26296 gene locus_tag LOCUS_12710 27312 26296 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_12710 28969 27515 gene locus_tag LOCUS_12720 28969 27515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 29241 31700 gene locus_tag LOCUS_12730 29241 31700 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_12730 31786 32652 gene locus_tag LOCUS_12740 31786 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 32657 33835 gene locus_tag LOCUS_12750 32657 33835 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_12750 33837 34424 gene locus_tag LOCUS_12760 33837 34424 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence26 156 290 gene locus_tag LOCUS_12770 156 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 316 660 gene locus_tag LOCUS_12780 gene mobC 316 660 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426139.1 protein_id gnl|my_center|LOCUS_12780 851 1060 gene locus_tag LOCUS_12790 851 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1073 1252 gene locus_tag LOCUS_12800 1073 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1689 2663 gene locus_tag LOCUS_12810 1689 2663 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837134.1 protein_id gnl|my_center|LOCUS_12810 2656 4743 gene locus_tag LOCUS_12820 2656 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4760 5122 gene locus_tag LOCUS_12830 4760 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5115 6392 gene locus_tag LOCUS_12840 5115 6392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6389 8938 gene locus_tag LOCUS_12850 6389 8938 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_12850 8942 9364 gene locus_tag LOCUS_12860 8942 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 10733 9615 gene locus_tag LOCUS_12870 10733 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 11563 11006 gene locus_tag LOCUS_12880 11563 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12880 12039 11638 gene locus_tag LOCUS_12890 12039 11638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 12214 13512 gene locus_tag LOCUS_12900 12214 13512 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_12900 14328 13573 gene locus_tag LOCUS_12910 gene hisF 14328 13573 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_12910 15182 14454 gene locus_tag LOCUS_12920 gene hisA 15182 14454 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_12920 15787 15179 gene locus_tag LOCUS_12930 gene hisH 15787 15179 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_12930 16372 15791 gene locus_tag LOCUS_12940 gene hisB 16372 15791 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721360.1 protein_id gnl|my_center|LOCUS_12940 17453 16404 gene locus_tag LOCUS_12950 gene hisC 17453 16404 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_12950 18782 17499 gene locus_tag LOCUS_12960 gene hisD 18782 17499 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_12960 19446 18805 gene locus_tag LOCUS_12970 gene hisG 19446 18805 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_12970 20649 19465 gene locus_tag LOCUS_12980 20649 19465 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_12980 25212 20869 gene locus_tag LOCUS_12990 25212 20869 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_12990 26353 25316 gene locus_tag LOCUS_13000 gene ispG 26353 25316 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_13000 27421 26372 gene locus_tag LOCUS_13010 gene rseP 27421 26372 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_13010 28632 27484 gene locus_tag LOCUS_13020 gene dxr 28632 27484 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 protein_id gnl|my_center|LOCUS_13020 29616 28765 gene locus_tag LOCUS_13030 gene cdsA 29616 28765 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_13030 30386 29658 gene locus_tag LOCUS_13040 30386 29658 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_13040 31055 30489 gene locus_tag LOCUS_13050 gene frr 31055 30489 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293875.1 protein_id gnl|my_center|LOCUS_13050 31822 31103 gene locus_tag LOCUS_13060 gene pyrH 31822 31103 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence27 <1 869 gene locus_tag LOCUS_13070 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024166.1:leucine-rich repeat protein note possible pseudo, frameshifted 872 1339 gene locus_tag LOCUS_13080 872 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 2278 1445 gene locus_tag LOCUS_13090 2278 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2910 2317 gene locus_tag LOCUS_13100 2910 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4033 2933 gene locus_tag LOCUS_13110 4033 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 5691 4099 gene locus_tag LOCUS_13120 5691 4099 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_13120 5975 5691 gene locus_tag LOCUS_13130 5975 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 7473 5962 gene locus_tag LOCUS_13140 7473 5962 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858032.1 protein_id gnl|my_center|LOCUS_13140 8213 7476 gene locus_tag LOCUS_13150 8213 7476 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_13150 9747 8236 gene locus_tag LOCUS_13160 9747 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 10612 9992 gene locus_tag LOCUS_13170 gene cysE 10612 9992 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476494.1 protein_id gnl|my_center|LOCUS_13170 11223 10639 gene locus_tag LOCUS_13180 gene pgsA 11223 10639 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_13180 12553 11207 gene locus_tag LOCUS_13190 gene rimO 12553 11207 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_13190 13261 12608 gene locus_tag LOCUS_13200 13261 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 14452 13262 gene locus_tag LOCUS_13210 gene recA 14452 13262 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_13210 15267 14416 gene locus_tag LOCUS_13220 gene prmC 15267 14416 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_13220 16490 15261 gene locus_tag LOCUS_13230 16490 15261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 17928 16513 gene locus_tag LOCUS_13240 17928 16513 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_13240 18635 17934 gene locus_tag LOCUS_13250 18635 17934 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036073.1 protein_id gnl|my_center|LOCUS_13250 20028 18673 gene locus_tag LOCUS_13260 20028 18673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 21401 20034 gene locus_tag LOCUS_13270 21401 20034 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_13270 21547 22608 gene locus_tag LOCUS_13280 21547 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 24069 22696 gene locus_tag LOCUS_13290 24069 22696 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_13290 25158 24430 gene locus_tag LOCUS_13300 gene gntX 25158 24430 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420751.1 protein_id gnl|my_center|LOCUS_13300 27365 25155 gene locus_tag LOCUS_13310 27365 25155 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_13310 27563 27979 gene locus_tag LOCUS_13320 27563 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 27988 30615 gene locus_tag LOCUS_13330 gene mutS 27988 30615 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_13330 30657 31472 gene locus_tag LOCUS_13340 gene proB 30657 31472 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_13340 31488 32741 gene locus_tag LOCUS_13350 31488 32741 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287452.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence28 1470 298 gene locus_tag LOCUS_13360 1470 298 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_13360 1943 1467 gene locus_tag LOCUS_13370 1943 1467 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_13370 3241 1940 gene locus_tag LOCUS_13380 3241 1940 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_13380 3504 3268 gene locus_tag LOCUS_13390 3504 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4219 3482 gene locus_tag LOCUS_13400 gene trmB 4219 3482 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_13400 4367 5446 gene locus_tag LOCUS_13410 gene papA 4367 5446 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_13410 6260 5583 gene locus_tag LOCUS_13420 6260 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6620 6450 gene locus_tag LOCUS_13430 6620 6450 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_13430 7715 6834 gene locus_tag LOCUS_13440 7715 6834 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812010.1 protein_id gnl|my_center|LOCUS_13440 7984 10932 gene locus_tag LOCUS_13450 7984 10932 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_13450 10958 11896 gene locus_tag LOCUS_13460 10958 11896 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_13460 11916 12788 gene locus_tag LOCUS_13470 11916 12788 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_13470 12812 14341 gene locus_tag LOCUS_13480 12812 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13480 14338 14967 gene locus_tag LOCUS_13490 14338 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13490 14983 17373 gene locus_tag LOCUS_13500 14983 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 17342 18310 gene locus_tag LOCUS_13510 17342 18310 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_13510 18326 19441 gene locus_tag LOCUS_13520 18326 19441 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_13520 21188 19725 gene locus_tag LOCUS_13530 21188 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 22028 21267 gene locus_tag LOCUS_13540 22028 21267 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_13540 22785 22021 gene locus_tag LOCUS_13550 22785 22021 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_13550 23752 22955 gene locus_tag LOCUS_13560 23752 22955 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782692.1 protein_id gnl|my_center|LOCUS_13560 24459 23833 gene locus_tag LOCUS_13570 24459 23833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 24776 25723 gene locus_tag LOCUS_13580 24776 25723 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_13580 25765 27027 gene locus_tag LOCUS_13590 25765 27027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 27077 29485 gene locus_tag LOCUS_13600 27077 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 29810 29959 gene locus_tag LOCUS_13610 gene rpmG 29810 29959 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393952.1 protein_id gnl|my_center|LOCUS_13610 30108 30365 gene locus_tag LOCUS_13620 30108 30365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 30432 30974 gene locus_tag LOCUS_13630 gene nusG 30432 30974 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_13630 31112 31537 gene locus_tag LOCUS_13640 gene rplK 31112 31537 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_13640 31702 32397 gene locus_tag LOCUS_13650 gene rplA 31702 32397 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_13650 32521 32595 gene locus_tag LOCUS_t00270 32521 32595 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence29 56 155 gene locus_tag LOCUS_r00010 56 155 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 180 255 gene locus_tag LOCUS_t00280 180 255 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 704 357 gene locus_tag LOCUS_13660 704 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 853 1296 gene locus_tag LOCUS_13670 853 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1476 1973 gene locus_tag LOCUS_13680 1476 1973 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_13680 1970 3136 gene locus_tag LOCUS_13690 1970 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3275 3847 gene locus_tag LOCUS_13700 3275 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 5974 4295 gene locus_tag LOCUS_13710 5974 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 7345 5993 gene locus_tag LOCUS_13720 7345 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 8049 7540 gene locus_tag LOCUS_13730 8049 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 9838 8816 gene locus_tag LOCUS_13740 9838 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 10801 9845 gene locus_tag LOCUS_13750 10801 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 11487 10801 gene locus_tag LOCUS_13760 11487 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 12436 11747 gene locus_tag LOCUS_13770 12436 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 13855 12449 gene locus_tag LOCUS_13780 13855 12449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 14088 14804 gene locus_tag LOCUS_13790 14088 14804 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_13790 14801 16135 gene locus_tag LOCUS_13800 14801 16135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 16128 17408 gene locus_tag LOCUS_13810 16128 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 17884 17480 gene locus_tag LOCUS_13820 17884 17480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 18150 21494 gene locus_tag LOCUS_13830 18150 21494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 21763 21566 gene locus_tag LOCUS_13840 21763 21566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 22972 22112 gene locus_tag LOCUS_13850 22972 22112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 24744 23227 gene locus_tag LOCUS_13860 24744 23227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 24908 24741 gene locus_tag LOCUS_13870 24908 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 26529 24850 gene locus_tag LOCUS_13880 26529 24850 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_13880 26821 27972 gene locus_tag LOCUS_13890 26821 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 28127 30256 gene locus_tag LOCUS_13900 28127 30256 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_13900 30320 31384 gene locus_tag LOCUS_13910 gene mutY 30320 31384 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132598.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence30 183 256 gene locus_tag LOCUS_t00290 183 256 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1150 296 gene locus_tag LOCUS_13920 1150 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1324 4758 gene locus_tag LOCUS_13930 1324 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8502 4918 gene locus_tag LOCUS_13940 8502 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10489 8738 gene locus_tag LOCUS_13950 10489 8738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_13950 12213 10486 gene locus_tag LOCUS_13960 12213 10486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_13960 12534 12713 gene locus_tag LOCUS_13970 12534 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 13927 12911 gene locus_tag LOCUS_13980 13927 12911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_13980 15130 13949 gene locus_tag LOCUS_13990 15130 13949 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_13990 15244 16110 gene locus_tag LOCUS_14000 15244 16110 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_14000 16207 16929 gene locus_tag LOCUS_14010 gene sigI 16207 16929 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181792.1 protein_id gnl|my_center|LOCUS_14010 16926 18050 gene locus_tag LOCUS_14020 16926 18050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 18284 19204 gene locus_tag LOCUS_14030 18284 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 20795 19410 gene locus_tag LOCUS_14040 20795 19410 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_14040 20905 21648 gene locus_tag LOCUS_14050 20905 21648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 22658 21795 gene locus_tag LOCUS_14060 22658 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 23918 22905 gene locus_tag LOCUS_14070 gene galE 23918 22905 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527590.1 protein_id gnl|my_center|LOCUS_14070 24455 23982 gene locus_tag LOCUS_14080 24455 23982 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_14080 25171 24440 gene locus_tag LOCUS_14090 25171 24440 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460575.1 protein_id gnl|my_center|LOCUS_14090 25492 26481 gene locus_tag LOCUS_14100 25492 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 26478 28076 gene locus_tag LOCUS_14110 26478 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 28155 28904 gene locus_tag LOCUS_14120 28155 28904 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263785.1 protein_id gnl|my_center|LOCUS_14120 <31162 29030 gene locus_tag LOCUS_14130 <31162 29030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949024.1:M4 family metallopeptidase >Feature sequence31 302 126 gene locus_tag LOCUS_14140 302 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 631 1401 gene locus_tag LOCUS_14150 631 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 1476 1961 gene locus_tag LOCUS_14160 1476 1961 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_14160 3058 4251 gene locus_tag LOCUS_14170 3058 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 4312 4911 gene locus_tag LOCUS_14180 4312 4911 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583290.1 protein_id gnl|my_center|LOCUS_14180 4922 5149 gene locus_tag LOCUS_14190 4922 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 5183 5857 gene locus_tag LOCUS_14200 5183 5857 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948733.1 protein_id gnl|my_center|LOCUS_14200 5922 6794 gene locus_tag LOCUS_14210 5922 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 7112 12568 gene locus_tag LOCUS_14220 7112 12568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 12879 13616 gene locus_tag LOCUS_14230 12879 13616 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141006.1 protein_id gnl|my_center|LOCUS_14230 13732 14487 gene locus_tag LOCUS_14240 13732 14487 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980255.1 protein_id gnl|my_center|LOCUS_14240 15406 14501 gene locus_tag LOCUS_14250 15406 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 15747 17321 gene locus_tag LOCUS_14260 15747 17321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 18194 17376 gene locus_tag LOCUS_14270 18194 17376 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_14270 19861 18317 gene locus_tag LOCUS_14280 19861 18317 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896230.1 protein_id gnl|my_center|LOCUS_14280 20395 21483 gene locus_tag LOCUS_14290 gene araR 20395 21483 CDS product arabinose utilization transcriptional regulator AraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243070.1 protein_id gnl|my_center|LOCUS_14290 21526 22227 gene locus_tag LOCUS_14300 21526 22227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 22391 23365 gene locus_tag LOCUS_14310 22391 23365 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226240.1 protein_id gnl|my_center|LOCUS_14310 23477 24991 gene locus_tag LOCUS_14320 23477 24991 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467107.1 protein_id gnl|my_center|LOCUS_14320 24988 26082 gene locus_tag LOCUS_14330 24988 26082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226242.1 protein_id gnl|my_center|LOCUS_14330 26121 27203 gene locus_tag LOCUS_14340 gene yjfF 26121 27203 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226243.1 protein_id gnl|my_center|LOCUS_14340 27207 28793 gene locus_tag LOCUS_14350 27207 28793 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_14350 28818 30251 gene locus_tag LOCUS_14360 gene araA 28818 30251 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964651.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence32 212 60 gene locus_tag LOCUS_14370 212 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1484 459 gene locus_tag LOCUS_14380 1484 459 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_14380 2456 1515 gene locus_tag LOCUS_14390 2456 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3369 2566 gene locus_tag LOCUS_14400 3369 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3719 5347 gene locus_tag LOCUS_14410 3719 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5424 5657 gene locus_tag LOCUS_14420 5424 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5924 5736 gene locus_tag LOCUS_14430 5924 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6175 7419 gene locus_tag LOCUS_14440 6175 7419 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14440 7438 7950 gene locus_tag LOCUS_14450 7438 7950 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566836.1 protein_id gnl|my_center|LOCUS_14450 10581 8029 gene locus_tag LOCUS_14460 10581 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 11413 10682 gene locus_tag LOCUS_14470 gene rlmB 11413 10682 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_14470 11792 11529 gene locus_tag LOCUS_14480 11792 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 13152 11908 gene locus_tag LOCUS_14490 13152 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 13695 13252 gene locus_tag LOCUS_14500 13695 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 14817 13951 gene locus_tag LOCUS_14510 14817 13951 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_14510 15593 14853 gene locus_tag LOCUS_14520 15593 14853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 16798 15731 gene locus_tag LOCUS_14530 16798 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 17358 16795 gene locus_tag LOCUS_14540 17358 16795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 18515 17421 gene locus_tag LOCUS_14550 18515 17421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 19173 18550 gene locus_tag LOCUS_14560 19173 18550 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_14560 19847 19170 gene locus_tag LOCUS_14570 gene cmk 19847 19170 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_14570 21092 19866 gene locus_tag LOCUS_14580 21092 19866 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_14580 21316 21089 gene locus_tag LOCUS_14590 21316 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 22302 21358 gene locus_tag LOCUS_14600 22302 21358 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_14600 24167 22212 gene locus_tag LOCUS_14610 24167 22212 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_14610 24653 24189 gene locus_tag LOCUS_14620 24653 24189 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565079.1 protein_id gnl|my_center|LOCUS_14620 27422 24660 gene locus_tag LOCUS_14630 27422 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 28306 27482 gene locus_tag LOCUS_14640 28306 27482 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence33 422 1798 gene locus_tag LOCUS_14650 gene murL 422 1798 CDS product UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_14650 1826 3928 gene locus_tag LOCUS_14660 gene mutL 1826 3928 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459784.1 protein_id gnl|my_center|LOCUS_14660 3952 4914 gene locus_tag LOCUS_14670 gene miaA 3952 4914 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_14670 5040 5282 gene locus_tag LOCUS_14680 gene hfq 5040 5282 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_14680 5286 6536 gene locus_tag LOCUS_14690 5286 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6526 7251 gene locus_tag LOCUS_14700 6526 7251 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_14700 7369 7890 gene locus_tag LOCUS_14710 7369 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7929 8735 gene locus_tag LOCUS_14720 7929 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 8834 9409 gene locus_tag LOCUS_14730 gene lspA 8834 9409 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_14730 9402 10319 gene locus_tag LOCUS_14740 9402 10319 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_14740 10322 11176 gene locus_tag LOCUS_14750 gene yidA 10322 11176 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200668.1 protein_id gnl|my_center|LOCUS_14750 11663 11241 gene locus_tag LOCUS_14760 11663 11241 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_14760 11812 13080 gene locus_tag LOCUS_14770 11812 13080 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_14770 15312 13300 gene locus_tag LOCUS_14780 gene ftsH 15312 13300 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_14780 16731 15319 gene locus_tag LOCUS_14790 16731 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 18107 16728 gene locus_tag LOCUS_14800 gene dnaB 18107 16728 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_14800 18555 18100 gene locus_tag LOCUS_14810 gene rplI 18555 18100 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_14810 20555 18570 gene locus_tag LOCUS_14820 20555 18570 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_14820 22470 20596 gene locus_tag LOCUS_14830 22470 20596 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_14830 22711 23244 gene locus_tag LOCUS_14840 22711 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 24379 23210 gene locus_tag LOCUS_14850 24379 23210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 24617 25942 gene locus_tag LOCUS_14860 24617 25942 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_14860 25957 27054 gene locus_tag LOCUS_14870 25957 27054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence34 7138 8271 gene locus_tag LOCUS_14880 gene dacF 7138 8271 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_14880 8461 9795 gene locus_tag LOCUS_14890 8461 9795 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_14890 9897 10316 gene locus_tag LOCUS_14900 9897 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_14900 10432 10929 gene locus_tag LOCUS_14910 10432 10929 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_14910 10986 11171 gene locus_tag LOCUS_14920 gene rpmF 10986 11171 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_14920 11272 12570 gene locus_tag LOCUS_14930 11272 12570 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_14930 12686 14023 gene locus_tag LOCUS_14940 gene der 12686 14023 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_14940 14048 14746 gene locus_tag LOCUS_14950 gene plsY 14048 14746 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404230.1 protein_id gnl|my_center|LOCUS_14950 14816 15814 gene locus_tag LOCUS_14960 14816 15814 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460199.1 protein_id gnl|my_center|LOCUS_14960 16076 16504 gene locus_tag LOCUS_14970 gene rplM 16076 16504 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_14970 16519 16935 gene locus_tag LOCUS_14980 gene rpsI 16519 16935 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_14980 17191 18369 gene locus_tag LOCUS_14990 17191 18369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 19829 18465 gene locus_tag LOCUS_15000 19829 18465 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_15000 21205 19826 gene locus_tag LOCUS_15010 gene scfB 21205 19826 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_15010 21435 21286 gene locus_tag LOCUS_15020 gene scfA 21435 21286 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_15020 21892 21722 gene locus_tag LOCUS_15030 21892 21722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 22369 22295 gene locus_tag LOCUS_t00300 22369 22295 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22576 23511 gene locus_tag LOCUS_15040 22576 23511 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_15040 23774 23520 gene locus_tag LOCUS_15050 23774 23520 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_15050 24537 23812 gene locus_tag LOCUS_15060 24537 23812 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679577.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence35 669 346 gene locus_tag LOCUS_15070 669 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1225 2664 gene locus_tag LOCUS_15080 1225 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2828 3883 gene locus_tag LOCUS_15090 2828 3883 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_15090 3880 4776 gene locus_tag LOCUS_15100 3880 4776 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_15100 4858 5622 gene locus_tag LOCUS_15110 4858 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 5777 6373 gene locus_tag LOCUS_15120 5777 6373 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_15120 6730 7944 gene locus_tag LOCUS_15130 6730 7944 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557280.1 protein_id gnl|my_center|LOCUS_15130 9011 8106 gene locus_tag LOCUS_15140 9011 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 9596 9045 gene locus_tag LOCUS_15150 gene trmL 9596 9045 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_15150 9733 9918 gene locus_tag LOCUS_15160 9733 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10358 9924 gene locus_tag LOCUS_15170 gene ruvX 10358 9924 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_15170 11053 10355 gene locus_tag LOCUS_15180 gene cobC 11053 10355 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_15180 11965 11054 gene locus_tag LOCUS_15190 11965 11054 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905897.1 protein_id gnl|my_center|LOCUS_15190 12753 11965 gene locus_tag LOCUS_15200 12753 11965 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_15200 13695 12772 gene locus_tag LOCUS_15210 gene pyrF 13695 12772 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 protein_id gnl|my_center|LOCUS_15210 13956 14387 gene locus_tag LOCUS_15220 13956 14387 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_15220 14423 15424 gene locus_tag LOCUS_15230 14423 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 15428 16195 gene locus_tag LOCUS_15240 15428 16195 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_15240 16188 17063 gene locus_tag LOCUS_15250 16188 17063 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_15250 17085 17891 gene locus_tag LOCUS_15260 17085 17891 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837604.1 protein_id gnl|my_center|LOCUS_15260 17951 18817 gene locus_tag LOCUS_15270 17951 18817 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_15270 18901 20328 gene locus_tag LOCUS_15280 18901 20328 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_15280 20325 21404 gene locus_tag LOCUS_15290 20325 21404 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_15290 21449 22486 gene locus_tag LOCUS_15300 gene gmd 21449 22486 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_15300 22483 23631 gene locus_tag LOCUS_15310 22483 23631 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence36 174 269 gene locus_tag LOCUS_t00310 174 269 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1633 1091 gene locus_tag LOCUS_15320 1633 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3144 1657 gene locus_tag LOCUS_15330 3144 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3552 4148 gene locus_tag LOCUS_15340 gene infC 3552 4148 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_15340 4245 4463 gene locus_tag LOCUS_15350 gene rpmI 4245 4463 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_15350 4536 4889 gene locus_tag LOCUS_15360 gene rplT 4536 4889 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_15360 5016 5813 gene locus_tag LOCUS_15370 5016 5813 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_15370 5826 7103 gene locus_tag LOCUS_15380 5826 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7164 9242 gene locus_tag LOCUS_15390 gene topA 7164 9242 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_15390 9242 10567 gene locus_tag LOCUS_15400 gene trmFO 9242 10567 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_15400 10581 11579 gene locus_tag LOCUS_15410 gene plsX 10581 11579 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047867.1 protein_id gnl|my_center|LOCUS_15410 11718 12410 gene locus_tag LOCUS_15420 gene rnc 11718 12410 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_15420 12454 16017 gene locus_tag LOCUS_15430 gene smc 12454 16017 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_15430 16049 17041 gene locus_tag LOCUS_15440 gene ftsY 16049 17041 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_15440 17010 17642 gene locus_tag LOCUS_15450 17010 17642 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_15450 17629 17922 gene locus_tag LOCUS_15460 gene yhbY 17629 17922 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955224.1 protein_id gnl|my_center|LOCUS_15460 17919 18545 gene locus_tag LOCUS_15470 gene nadD 17919 18545 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964574.1 protein_id gnl|my_center|LOCUS_15470 18649 19161 gene locus_tag LOCUS_15480 gene yqeK 18649 19161 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836603.1 protein_id gnl|my_center|LOCUS_15480 19195 20475 gene locus_tag LOCUS_15490 19195 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 20490 20846 gene locus_tag LOCUS_15500 gene rsfS 20490 20846 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_15500 20920 23325 gene locus_tag LOCUS_15510 gene leuS 20920 23325 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence37 217 747 gene locus_tag LOCUS_15520 217 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1559 942 gene locus_tag LOCUS_15530 1559 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2245 1565 gene locus_tag LOCUS_15540 2245 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2408 2151 gene locus_tag LOCUS_15550 2408 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4169 2514 gene locus_tag LOCUS_15560 gene ilvD 4169 2514 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15560 5206 4187 gene locus_tag LOCUS_15570 gene ilvC 5206 4187 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142651.1 protein_id gnl|my_center|LOCUS_15570 5732 5226 gene locus_tag LOCUS_15580 gene ilvN 5732 5226 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399096.1 protein_id gnl|my_center|LOCUS_15580 7402 5729 gene locus_tag LOCUS_15590 gene ilvB 7402 5729 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_15590 7869 7474 gene locus_tag LOCUS_15600 7869 7474 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_15600 9075 7885 gene locus_tag LOCUS_15610 gene ilvA 9075 7885 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 protein_id gnl|my_center|LOCUS_15610 9968 10363 gene locus_tag LOCUS_15620 9968 10363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 10356 10799 gene locus_tag LOCUS_15630 10356 10799 CDS product DUF1893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761597.1 protein_id gnl|my_center|LOCUS_15630 10786 11913 gene locus_tag LOCUS_15640 10786 11913 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_15640 12139 12354 gene locus_tag LOCUS_15650 12139 12354 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263301.1 protein_id gnl|my_center|LOCUS_15650 12351 13730 gene locus_tag LOCUS_15660 12351 13730 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440033.1 protein_id gnl|my_center|LOCUS_15660 15889 13847 gene locus_tag LOCUS_15670 15889 13847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 16127 15882 gene locus_tag LOCUS_15680 16127 15882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 18716 16131 gene locus_tag LOCUS_15690 18716 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 20893 18860 gene locus_tag LOCUS_15700 20893 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 21959 21423 gene locus_tag LOCUS_15710 21959 21423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence38 1004 273 gene locus_tag LOCUS_15720 1004 273 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_15720 1445 1020 gene locus_tag LOCUS_15730 gene ytfJ 1445 1020 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_15730 2315 1461 gene locus_tag LOCUS_15740 2315 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 2509 2321 gene locus_tag LOCUS_15750 2509 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3386 2487 gene locus_tag LOCUS_15760 gene ispE 3386 2487 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_15760 4828 3392 gene locus_tag LOCUS_15770 gene glgA 4828 3392 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_15770 6017 4893 gene locus_tag LOCUS_15780 gene glgD 6017 4893 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_15780 7235 6033 gene locus_tag LOCUS_15790 gene glgC 7235 6033 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_15790 9261 7258 gene locus_tag LOCUS_15800 gene glgB 9261 7258 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_15800 11805 9559 gene locus_tag LOCUS_15810 11805 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 13052 11922 gene locus_tag LOCUS_15820 13052 11922 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_15820 13713 13201 gene locus_tag LOCUS_15830 13713 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 15139 13751 gene locus_tag LOCUS_15840 15139 13751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 15812 15162 gene locus_tag LOCUS_15850 15812 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 15948 16874 gene locus_tag LOCUS_15860 15948 16874 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259106.1 protein_id gnl|my_center|LOCUS_15860 17025 18959 gene locus_tag LOCUS_15870 17025 18959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 19034 19666 gene locus_tag LOCUS_15880 19034 19666 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_15880 19754 20770 gene locus_tag LOCUS_15890 19754 20770 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_15890 20897 21424 gene locus_tag LOCUS_15900 gene raiA 20897 21424 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence39 1381 374 gene locus_tag LOCUS_15910 1381 374 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964016.1 protein_id gnl|my_center|LOCUS_15910 1852 1643 gene locus_tag LOCUS_15920 1852 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2291 2058 gene locus_tag LOCUS_15930 2291 2058 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419342.1 protein_id gnl|my_center|LOCUS_15930 2587 2345 gene locus_tag LOCUS_15940 gene rpsP 2587 2345 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_15940 2864 2658 gene locus_tag LOCUS_15950 2864 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4263 2890 gene locus_tag LOCUS_15960 gene ffh 4263 2890 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_15960 4643 4305 gene locus_tag LOCUS_15970 4643 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5486 4830 gene locus_tag LOCUS_15980 5486 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7318 5510 gene locus_tag LOCUS_15990 7318 5510 CDS product HSP90 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018463.1 protein_id gnl|my_center|LOCUS_15990 7684 7863 gene locus_tag LOCUS_16000 7684 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 8999 7932 gene locus_tag LOCUS_16010 8999 7932 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_16010 9248 9123 gene locus_tag LOCUS_16020 9248 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 10131 9364 gene locus_tag LOCUS_16030 10131 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 10807 10133 gene locus_tag LOCUS_16040 10807 10133 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948496.1 protein_id gnl|my_center|LOCUS_16040 12403 10916 gene locus_tag LOCUS_16050 12403 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 13268 12567 gene locus_tag LOCUS_16060 13268 12567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_16060 15213 13945 gene locus_tag LOCUS_16070 15213 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 15791 15210 gene locus_tag LOCUS_16080 15791 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 17898 16024 gene locus_tag LOCUS_16090 17898 16024 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_16090 20430 18043 gene locus_tag LOCUS_16100 20430 18043 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_16100 20759 20905 gene locus_tag LOCUS_16110 20759 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 20860 21006 gene locus_tag LOCUS_16120 20860 21006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence40 310 235 gene locus_tag LOCUS_t00320 310 235 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 556 1515 gene locus_tag LOCUS_16130 556 1515 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_16130 1529 2215 gene locus_tag LOCUS_16140 1529 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3038 2280 gene locus_tag LOCUS_16150 gene spo0A 3038 2280 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_16150 3423 3181 gene locus_tag LOCUS_16160 3423 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4756 3365 gene locus_tag LOCUS_16170 4756 3365 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_16170 5622 4966 gene locus_tag LOCUS_16180 gene sigF 5622 4966 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230458.1 protein_id gnl|my_center|LOCUS_16180 6049 5597 gene locus_tag LOCUS_16190 gene spoIIAB 6049 5597 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_16190 6377 6033 gene locus_tag LOCUS_16200 gene spoIIAA 6377 6033 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_16200 6627 7151 gene locus_tag LOCUS_16210 6627 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 7177 8142 gene locus_tag LOCUS_16220 7177 8142 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964333.1 protein_id gnl|my_center|LOCUS_16220 8227 8907 gene locus_tag LOCUS_16230 gene radC 8227 8907 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971736.1 protein_id gnl|my_center|LOCUS_16230 8969 10933 gene locus_tag LOCUS_16240 gene uvrB 8969 10933 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_16240 13514 10992 gene locus_tag LOCUS_16250 13514 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 15237 13570 gene locus_tag LOCUS_16260 15237 13570 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784390.1 protein_id gnl|my_center|LOCUS_16260 15831 15286 gene locus_tag LOCUS_16270 15831 15286 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876339.1 protein_id gnl|my_center|LOCUS_16270 17150 16215 gene locus_tag LOCUS_16280 17150 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 17662 17192 gene locus_tag LOCUS_16290 17662 17192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 18567 17656 gene locus_tag LOCUS_16300 18567 17656 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence41 2350 464 gene locus_tag LOCUS_16310 2350 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2862 3905 gene locus_tag LOCUS_16320 2862 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3951 5066 gene locus_tag LOCUS_16330 3951 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 5088 7181 gene locus_tag LOCUS_16340 5088 7181 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_16340 7377 8192 gene locus_tag LOCUS_16350 7377 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 8245 9954 gene locus_tag LOCUS_16360 8245 9954 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022425.1 protein_id gnl|my_center|LOCUS_16360 10155 12044 gene locus_tag LOCUS_16370 gene htpG 10155 12044 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_16370 14574 12112 gene locus_tag LOCUS_16380 14574 12112 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964231.1 protein_id gnl|my_center|LOCUS_16380 15300 14791 gene locus_tag LOCUS_16390 15300 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 16105 15410 gene locus_tag LOCUS_16400 16105 15410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 17231 16125 gene locus_tag LOCUS_16410 gene aroC 17231 16125 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence42 230 373 gene locus_tag LOCUS_16420 230 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1307 450 gene locus_tag LOCUS_16430 1307 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1594 1304 gene locus_tag LOCUS_16440 1594 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 2205 1591 gene locus_tag LOCUS_16450 2205 1591 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225444.1 protein_id gnl|my_center|LOCUS_16450 2933 2223 gene locus_tag LOCUS_16460 2933 2223 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_16460 3162 4418 gene locus_tag LOCUS_16470 3162 4418 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_16470 4585 7530 gene locus_tag LOCUS_16480 4585 7530 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_16480 7590 8078 gene locus_tag LOCUS_16490 7590 8078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 8126 8620 gene locus_tag LOCUS_16500 8126 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 8646 9884 gene locus_tag LOCUS_16510 8646 9884 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_16510 10121 10891 gene locus_tag LOCUS_16520 10121 10891 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_16520 10894 11166 gene locus_tag LOCUS_16530 10894 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 11510 11277 gene locus_tag LOCUS_16540 11510 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 11658 11582 gene locus_tag LOCUS_t00330 11658 11582 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11801 12781 gene locus_tag LOCUS_16550 11801 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 13683 16271 gene locus_tag LOCUS_16560 13683 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 16772 16395 gene locus_tag LOCUS_16570 16772 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence43 452 3109 gene locus_tag LOCUS_16580 gene gyrA 452 3109 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_16580 3170 3391 gene locus_tag LOCUS_16590 3170 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3345 3632 gene locus_tag LOCUS_16600 3345 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3679 4320 gene locus_tag LOCUS_16610 gene deoC 3679 4320 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439345.1 protein_id gnl|my_center|LOCUS_16610 4449 4967 gene locus_tag LOCUS_16620 4449 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 5016 5786 gene locus_tag LOCUS_16630 5016 5786 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_16630 5941 7764 gene locus_tag LOCUS_16640 gene glmS 5941 7764 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_16640 7991 9247 gene locus_tag LOCUS_16650 7991 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 9276 10718 gene locus_tag LOCUS_16660 9276 10718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 10740 12398 gene locus_tag LOCUS_16670 10740 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 13487 13044 gene locus_tag LOCUS_16680 13487 13044 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_16680 13972 13523 gene locus_tag LOCUS_16690 13972 13523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140850.1 protein_id gnl|my_center|LOCUS_16690 14572 13976 gene locus_tag LOCUS_16700 gene coaD 14572 13976 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583503.1 protein_id gnl|my_center|LOCUS_16700 15177 14614 gene locus_tag LOCUS_16710 gene rsmD 15177 14614 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_16710 16655 15252 gene locus_tag LOCUS_16720 gene miaB 16655 15252 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence44 6396 5059 gene locus_tag LOCUS_16730 6396 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 8719 6548 gene locus_tag LOCUS_16740 8719 6548 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_16740 9137 10180 gene locus_tag LOCUS_16750 9137 10180 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234325.1 protein_id gnl|my_center|LOCUS_16750 10207 10659 gene locus_tag LOCUS_16760 10207 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 10717 12423 gene locus_tag LOCUS_16770 10717 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 12711 13799 gene locus_tag LOCUS_16780 12711 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 14052 14744 gene locus_tag LOCUS_16790 gene ftsE 14052 14744 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_16790 14731 15648 gene locus_tag LOCUS_16800 gene ftsX 14731 15648 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391789.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence45 1357 80 gene locus_tag LOCUS_16810 1357 80 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_16810 2157 1354 gene locus_tag LOCUS_16820 2157 1354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_16820 2982 2173 gene locus_tag LOCUS_16830 2982 2173 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_16830 4082 2979 gene locus_tag LOCUS_16840 4082 2979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_16840 6711 4342 gene locus_tag LOCUS_16850 6711 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 7019 7810 gene locus_tag LOCUS_16860 7019 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 7844 9571 gene locus_tag LOCUS_16870 7844 9571 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291950.1 protein_id gnl|my_center|LOCUS_16870 9721 10074 gene locus_tag LOCUS_16880 9721 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10155 10973 gene locus_tag LOCUS_16890 10155 10973 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_16890 10982 12016 gene locus_tag LOCUS_16900 gene tsaD 10982 12016 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_16900 12023 12955 gene locus_tag LOCUS_16910 gene cysK 12023 12955 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_16910 12984 14093 gene locus_tag LOCUS_16920 12984 14093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 14090 14815 gene locus_tag LOCUS_16930 14090 14815 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_16930 14812 15642 gene locus_tag LOCUS_16940 gene rsmI 14812 15642 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence46 116 331 gene locus_tag LOCUS_16950 116 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 615 2771 gene locus_tag LOCUS_16960 615 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2878 4326 gene locus_tag LOCUS_16970 2878 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 5130 4402 gene locus_tag LOCUS_16980 5130 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 5393 5827 gene locus_tag LOCUS_16990 5393 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 6224 6880 gene locus_tag LOCUS_17000 gene rpe 6224 6880 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_17000 7452 6886 gene locus_tag LOCUS_17010 7452 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 7504 8454 gene locus_tag LOCUS_17020 7504 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 8493 9050 gene locus_tag LOCUS_17030 8493 9050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 9031 9600 gene locus_tag LOCUS_17040 9031 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 9635 10858 gene locus_tag LOCUS_17050 9635 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 11898 10909 gene locus_tag LOCUS_17060 11898 10909 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_17060 13615 11981 gene locus_tag LOCUS_17070 13615 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 14981 13761 gene locus_tag LOCUS_17080 14981 13761 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_17080 15554 15030 gene locus_tag LOCUS_17090 15554 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence47 1186 308 gene locus_tag LOCUS_17100 1186 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3151 1202 gene locus_tag LOCUS_17110 gene gyrB 3151 1202 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_17110 3478 3221 gene locus_tag LOCUS_17120 3478 3221 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_17120 4637 3495 gene locus_tag LOCUS_17130 gene recF 4637 3495 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_17130 4892 4647 gene locus_tag LOCUS_17140 4892 4647 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140229.1 protein_id gnl|my_center|LOCUS_17140 5734 4943 gene locus_tag LOCUS_17150 5734 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6840 5731 gene locus_tag LOCUS_17160 gene dnaN 6840 5731 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_17160 8892 7534 gene locus_tag LOCUS_17170 gene dnaA 8892 7534 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_17170 9355 12462 gene locus_tag LOCUS_17180 9355 12462 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101465.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence48 267 1913 gene locus_tag LOCUS_17190 267 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2285 2710 gene locus_tag LOCUS_17200 2285 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2927 4279 gene locus_tag LOCUS_17210 2927 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 4470 5210 gene locus_tag LOCUS_17220 4470 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6794 5325 gene locus_tag LOCUS_17230 gene guaB 6794 5325 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264083.1 protein_id gnl|my_center|LOCUS_17230 7668 6820 gene locus_tag LOCUS_17240 7668 6820 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_17240 8586 7780 gene locus_tag LOCUS_17250 8586 7780 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_17250 9028 11124 gene locus_tag LOCUS_17260 gene fusA 9028 11124 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence49 16 210 gene locus_tag LOCUS_17270 16 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 2047 422 gene locus_tag LOCUS_17280 gene groL 2047 422 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_17280 2385 2101 gene locus_tag LOCUS_17290 2385 2101 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_17290 2816 3517 gene locus_tag LOCUS_17300 2816 3517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_17300 3551 5008 gene locus_tag LOCUS_17310 3551 5008 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048386.1 protein_id gnl|my_center|LOCUS_17310 5060 6568 gene locus_tag LOCUS_17320 5060 6568 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048385.1 protein_id gnl|my_center|LOCUS_17320 6593 7816 gene locus_tag LOCUS_17330 6593 7816 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_17330 8028 8891 gene locus_tag LOCUS_17340 8028 8891 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288251.1 protein_id gnl|my_center|LOCUS_17340 8894 9238 gene locus_tag LOCUS_17350 8894 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence50 1187 513 gene locus_tag LOCUS_17360 1187 513 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_17360 2250 1351 gene locus_tag LOCUS_17370 2250 1351 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_17370 2680 3315 gene locus_tag LOCUS_17380 2680 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17380 3433 4335 gene locus_tag LOCUS_17390 3433 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17390 4419 6011 gene locus_tag LOCUS_17400 4419 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6279 6959 gene locus_tag LOCUS_17410 6279 6959 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_17410 7522 6965 gene locus_tag LOCUS_17420 7522 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence51 3594 2566 gene locus_tag LOCUS_17430 3594 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17430 5243 3861 gene locus_tag LOCUS_17440 5243 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 5517 6239 gene locus_tag LOCUS_17450 5517 6239 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence52 260 15 gene locus_tag LOCUS_17460 260 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 369 298 gene locus_tag LOCUS_t00340 369 298 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 501 415 gene locus_tag LOCUS_t00350 501 415 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1853 684 gene locus_tag LOCUS_17470 1853 684 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_17470 2323 1871 gene locus_tag LOCUS_17480 2323 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3409 2324 gene locus_tag LOCUS_17490 gene serC 3409 2324 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_17490 4260 3595 gene locus_tag LOCUS_17500 4260 3595 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_17500 5981 4317 gene locus_tag LOCUS_17510 5981 4317 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_17510 6349 6002 gene locus_tag LOCUS_17520 6349 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 >Feature sequence53 1468 1001 gene locus_tag LOCUS_17530 1468 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2983 1739 gene locus_tag LOCUS_17540 gene serS 2983 1739 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_17540 4308 3028 gene locus_tag LOCUS_17550 4308 3028 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899653.1 protein_id gnl|my_center|LOCUS_17550 5032 4427 gene locus_tag LOCUS_17560 5032 4427 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_17560 >Feature sequence54 2109 1387 gene locus_tag LOCUS_17570 gene cas5c 2109 1387 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_17570 4374 2182 gene locus_tag LOCUS_17580 4374 2182 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence55 <1 699 gene locus_tag LOCUS_17590 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964991.1:translational GTPase TypA 751 954 gene locus_tag LOCUS_17600 751 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1170 2057 gene locus_tag LOCUS_17610 1170 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 2211 3053 gene locus_tag LOCUS_17620 2211 3053 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_17620 3050 4024 gene locus_tag LOCUS_17630 gene prmA 3050 4024 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence56 <1 590 gene locus_tag LOCUS_17640 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926986.1:type I-C CRISPR-associated protein Cas8c/Csd1 583 1467 gene locus_tag LOCUS_17650 gene cas7c 583 1467 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_17650 1464 2141 gene locus_tag LOCUS_17660 1464 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 2138 3160 gene locus_tag LOCUS_17670 gene cas1c 2138 3160 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009055.1 protein_id gnl|my_center|LOCUS_17670 3167 3457 gene locus_tag LOCUS_17680 gene cas2 3167 3457 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_17680 3604 4044 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgccccgcgaggggcgtgtgagttgaaat >Feature sequence57 448 1995 gene locus_tag LOCUS_17690 448 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2027 3499 gene locus_tag LOCUS_17700 gene spoIVA 2027 3499 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_17700 3611 3489 gene locus_tag LOCUS_17710 3611 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence58 258 725 gene locus_tag LOCUS_17720 258 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence59 <1 789 gene locus_tag LOCUS_17730 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048371.1:lysine--tRNA ligase 917 1870 gene locus_tag LOCUS_17740 917 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676624.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence60 286 732 gene locus_tag LOCUS_17750 286 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 925 2181 gene locus_tag LOCUS_17760 gene guaA 925 2181 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764094.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence61 227 138 gene locus_tag LOCUS_t00360 227 138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 358 276 gene locus_tag LOCUS_t00370 358 276 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1868 471 gene locus_tag LOCUS_17770 1868 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence62 686 1390 gene locus_tag LOCUS_17780 686 1390 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence63 1194 118 gene locus_tag LOCUS_17790 1194 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2089 1655 gene locus_tag LOCUS_17800 2089 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence64 908 195 gene locus_tag LOCUS_17810 908 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17810 1370 936 gene locus_tag LOCUS_17820 1370 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17820 <1935 1363 gene locus_tag LOCUS_17830 <1935 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003396717.1:[Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein >Feature sequence65 <1 1653 gene locus_tag LOCUS_17840 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016920.1:DUF2207 domain-containing protein >Feature sequence66 375 34 gene locus_tag LOCUS_17850 375 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 879 499 gene locus_tag LOCUS_17860 879 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 1092 880 gene locus_tag LOCUS_17870 1092 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1470 1342 gene locus_tag LOCUS_17880 1470 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1874 1485 gene locus_tag LOCUS_17890 1874 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence67 <1867 1338 gene locus_tag LOCUS_17900 <1867 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389655.1:BMP family ABC transporter substrate-binding protein >Feature sequence68 >Feature sequence69 <1 1590 gene locus_tag LOCUS_17910 <1 1590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245033.1:DAK2 domain-containing protein >Feature sequence70 94 9 gene locus_tag LOCUS_t00380 94 9 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 144 308 gene locus_tag LOCUS_17920 144 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 1235 288 gene locus_tag LOCUS_17930 1235 288 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437151.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence71 >Feature sequence72 1450 269 gene locus_tag LOCUS_17940 1450 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 >Feature sequence73 >Feature sequence74 <1551 828 gene locus_tag LOCUS_17950 <1551 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064443.1:Ku protein >Feature sequence75 1144 254 gene locus_tag LOCUS_17960 1144 254 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence76 484 615 gene locus_tag LOCUS_17970 484 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 679 1512 gene locus_tag LOCUS_17980 679 1512 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_17980