COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence01 source 1..200908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..639) product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017103.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene ruvX CDS complement(639..1202) product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS complement(1311..2261) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene gshB CDS complement(2274..3005) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222508.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 gene rsmE CDS complement(3085..3792) product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene endA CDS complement(3887..4342) product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858396.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(4461..5855) product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene galP CDS complement(6291..7445) product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene metK CDS 8318..10216 product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295380.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene speA CDS 10362..11093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758915.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS 11229..12149 product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105559.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 gene speB CDS complement(12355..13113) product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00120 gene loiP CDS 13391..15382 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098614.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene tkt CDS 15696..16139 product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 gene cmtB CDS 16167..17555 product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428817.1 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene cmtA CDS 17570..18847 product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853221.1 transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 18844..19809 product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987277.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene glpX CDS 19831..20340 product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00180 gene fumE CDS 20337..21050 product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687768.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS complement(21022..21699) product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956868.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(21693..22370) product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(22358..23065) product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(23066..23644) product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124312.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(23667..24098) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988693.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 24470..25489 product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 transl_table 11 codon_start 1 locus_tag LOCUS_00250 gene epd CDS 25539..26702 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 gene pgk CDS 26917..27996 product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 gene fbaA CDS 28354..29214 product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene mscS CDS 29353..29988 product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493346.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene argO CDS 30081..30821 product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 30988..31884 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS complement(31881..33359) product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449948.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 gene scpC CDS complement(33383..34168) product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene scpB CDS complement(34179..35174) product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene meaB CDS complement(35167..37311) product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073261.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene scpA CDS complement(37515..38408) product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene argP CDS 38550..38780 product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 38836..39495 product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene rpiA CDS 39751..40983 product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151604.1 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene serA CDS complement(41764..42312) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621065.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS complement(42612..42941) product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene zapA CDS 43109..43687 product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene ygfB CDS 43713..45038 product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290106.1 transl_table 11 codon_start 1 locus_tag LOCUS_00430 gene pepP CDS 45035..46213 product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111174.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 gene ubiH CDS 46236..47438 product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192185.1 transl_table 11 codon_start 1 locus_tag LOCUS_00450 gene ubiI CDS 47885..48979 product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene gcvT CDS 49003..49392 product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00470 gene gcvH CDS 49511..52384 product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195023.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 gene gcvP CDS 52650..53393 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(53450..54883) product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387034.1 transl_table 11 codon_start 1 locus_tag LOCUS_00500 gene bglA CDS 54928..55239 product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182954.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene yqfB CDS 55403..56062 product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(56258..57238) product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene ygfZ CDS 57481..57747 product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene sdhE CDS 57728..58135 product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(58175..58696) product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene fldB CDS 58808..59704 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806638.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene xerD CDS 59729..60439 product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715208.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene dsbC CDS 60445..62178 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene recJ CDS 62486..63367 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene prfB note possible pseudo, frameshifted CDS 63377..64894 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 gene lysS CDS complement(64937..65485) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192814.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 gene idi CDS complement(65735..67183) product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 gene uacT CDS 67928..69538 product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 gene ygfT CDS 69538..70026 product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(70062..71429) product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene ghxQ CDS complement(71465..72781) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene guaD CDS complement(72799..74199) product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280192.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 gene xanQ CDS complement(74364..77234) product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(77231..78010) product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 gene ygfM CDS complement(78061..79389) product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906276.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 gene ssnA CDS complement(79392..82490) product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene ygfK CDS complement(82812..83390) product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272856.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene mocA CDS 83784..84263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 84311..85936 product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020377.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene yqeB CDS complement(85977..86909) product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 transl_table 11 codon_start 1 locus_tag LOCUS_00760 gene arcC CDS complement(86957..88342) product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264447.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene hyuA CDS complement(88395..89606) product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(89664..90860) product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 gene dpaL CDS complement(90918..92105) product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene ygeW CDS 92584..94362 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417808.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(94402..94881) product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016606.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 gene xdhC CDS complement(94878..95756) product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene xdhB CDS complement(95767..98064) product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene xdhA CDS 98479..99234 product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene actS tRNA 99313..99386 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS 99620..101230 product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS 101362..101727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 note possible pseudo, internal stop codon, frameshifted CDS 101788..102309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 note possible pseudo, internal stop codon CDS 102299..102964 product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 102974..103159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 note possible pseudo, frameshifted CDS 103235..104002 product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503284.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene sctT CDS 104011..104742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 note possible pseudo, frameshifted CDS 104769..105131 product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(105192..105485) product invasion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(105487..105987) product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS 106245..107426 product PrgH/EprH family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317292.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 107440..107595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307375.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS 107772..107987 product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566300.1 transl_table 11 codon_start 1 locus_tag LOCUS_00980 gene sctI CDS 108091..108762 product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875234.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 108778..109359 product type III secretion apparatus protein OrgA/MxiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341846.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 109575..110006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299900.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 110227..110382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 note possible pseudo, internal stop codon CDS 110413..110859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 note possible pseudo, internal stop codon CDS complement(110904..111278) product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336167.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(111463..111681) product protein YgeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184091.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 gene ygeI CDS complement(111849..113225) product HilA family transcriptional regulator YgeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362702.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene ygeH CDS complement(113560..114051) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(114329..114766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804528.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 114960..115385 product protein YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350591.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene yqeK CDS complement(115534..116016) product protein YqeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene yqeJ CDS complement(116009..116629) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(117152..117670) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305805.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(118244..119473) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065950.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 119728..120909 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS 121196..122032 product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383224.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene kduI CDS 122062..122823 product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603508.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene kduD CDS 123198..124556 product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene araE CDS 124685..125377 product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 gene ygeA CDS complement(125364..126299) product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741827.1 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene lysR CDS 126421..127683 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene lysA CDS complement(127690..128721) product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201048.1 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene galR CDS 129307..131466 product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene aas CDS 131459..132652 product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004616.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene lplT CDS complement(132684..133724) product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(133832..134050) product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 transl_table 11 codon_start 1 locus_tag LOCUS_01250 gene ygdR CDS complement(134188..134901) product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(134970..135659) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082188.1 transl_table 11 codon_start 1 locus_tag LOCUS_01270 gene mutH CDS complement(135838..136032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 136344..136874 product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene rppH CDS 136887..139133 product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene ptsP CDS 139284..140159 product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene lgt CDS 140166..140960 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene thyA CDS 141145..141615 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS 141606..142169 product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 142166..142573 product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078393.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 142558..142881 product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 142894..146262 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene recC CDS 146438..149326 product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138213.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 gene ptrA CDS 149319..152861 product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285993.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 gene recB CDS 152861..154687 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775955.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene recD CDS complement(154749..156080) product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 gene argA CDS 156369..157565 product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene amiC tRNA complement(157640..157716) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 tRNA complement(157750..157826) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(157860..157936) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 158175..159242 product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 gene mltA CDS 159319..160125 product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 gene tcdA CDS complement(160176..160619) product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184254.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene csdE CDS complement(160619..161824) product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene csdA CDS 162016..162243 product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 162594..163511 product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 gene gcvA CDS 163530..163925 product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 163918..165018 product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045520.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene rlmM CDS complement(165062..165793) product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene fucR CDS complement(165851..166273) product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene fucU CDS complement(166275..167693) product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene fucK CDS complement(167802..169577) product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 gene fucI CDS complement(169610..170926) product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528603.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene fucP CDS 171473..172120 product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440782.1 transl_table 11 codon_start 1 locus_tag LOCUS_01560 gene fucA CDS 172148..173296 product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 gene fucO CDS complement(173351..174106) product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene xni CDS complement(174218..175585) product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 transl_table 11 codon_start 1 locus_tag LOCUS_01590 gene sdaB CDS complement(175643..176932) product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene sdaC CDS complement(177489..178853) product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene ppnN CDS complement(178965..179813) product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100430.1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene queF CDS 179881..180426 product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 gene syd CDS 181048..181377 product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206990.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 181377..182159 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene truC CDS 182177..182626 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 183061..184413 product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene gudP CDS 184415..185755 product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 185776..187116 product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene gudD CDS complement(187348..190104) product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene barA CDS 190161..191462 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046785.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene rlmD CDS 191510..193744 product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS 193822..194070 product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 gene mazE CDS 194070..194405 product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254745.1 transl_table 11 codon_start 1 locus_tag LOCUS_01740 gene mazF CDS 194476..195267 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 gene mazG CDS 195495..197132 product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene pyrG CDS 197220..198518 product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 transl_table 11 codon_start 1 locus_tag LOCUS_01770 gene eno CDS complement(198578..199282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 note possible pseudo, internal stop codon CDS complement(199464..199604) product cell envelope stress response protein YqcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene yqcG CDS 199743..200414 product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199973.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 gene queE repeat_region 200754..200904 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagttccccgcgccagcggggataaaccg sequence02 source 1..183662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(50..1369) product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212619.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene dacB CDS 1731..2207 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene greA CDS complement(2363..2656) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene yhbY CDS 2782..3411 product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene rlmE CDS 3502..5445 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene ftsH CDS 5535..6383 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene folP CDS 6376..7713 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene glmM CDS 7941..8273 product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene secG tRNA 8288..8374 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 9271..10458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS complement(10466..11809) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207685.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 gene argG tRNA 12157..12233 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 12470..12892 product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene rimP CDS 12920..14407 product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031055.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene nusA CDS 14432..17104 product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133044.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene infB CDS 17268..17669 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene rbfA CDS 17669..18613 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene truB CDS 18762..19031 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene rpsO CDS 19278..21413 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene pnp CDS 21522..22406 product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene nlpI CDS 22586..24475 product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene deaD CDS 24629..25873 product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224340.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 gene mtr CDS complement(25991..26998) product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(27204..28082) product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(28091..29086) product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 29295..29819 product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 29813..30316 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(30303..30614) product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189314.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 gene yhbQ CDS 30656..31099 product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS complement(31079..31597) product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 gene yhbO CDS 31725..32360 product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 32433..33473 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147622.1 transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(33587..34162) product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646043.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene dolP CDS complement(34172..34762) product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene diaA CDS complement(34782..35177) product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246855.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(35135..37171) product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249157.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene lpoA CDS 37235..38095 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809253.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 gene rsmI CDS complement(38138..39229) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(39240..41756) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136472.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS complement(41786..42385) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044768.1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS complement(42561..43145) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045442.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(43545..44246) product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307409.1 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(44301..45092) product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene agaD CDS complement(45082..45885) product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 gene agaC CDS complement(45924..46400) product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098017.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 gene agaB CDS complement(46568..47428) product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 gene kbaY CDS complement(47441..48595) product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114873.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(48946..50079) product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326138.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 gene nagA CDS complement(50076..50510) product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 gene agaF CDS complement(50528..51406) product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781397.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene agaE CDS complement(51396..52175) product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 transl_table 11 codon_start 1 locus_tag LOCUS_02290 gene agaW CDS complement(52186..52659) product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 transl_table 11 codon_start 1 locus_tag LOCUS_02300 gene agaV CDS complement(52682..53962) product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene kbaZ CDS 54211..55020 product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 gene agaR CDS complement(55075..55539) product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 gene yhaV CDS complement(55539..55874) product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307405.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene prlF CDS complement(56023..57594) product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 gene garD CDS 57969..59303 product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 gene garP CDS 59319..60089 product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene garL CDS 60110..61009 product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene garR CDS 61106..62251 product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299416.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene garK CDS complement(63055..64242) product YhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484640.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(64264..64803) product protein YhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene yhaB CDS 65592..66530 product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene tdcA CDS 66629..67618 product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene tdcB CDS 67640..68971 product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107720.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene tdcC CDS 68997..70205 product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene tdcD CDS 70239..72533 product 2-ketobutyrate formate-lyase/pyruvate formate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861734.1 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene tdcE CDS 72547..72936 product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS 73008..74372 product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622115.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene tdcG CDS 74647..75978 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 76006..77316 product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460512.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene cyuA CDS complement(77528..77692) product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295544.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene yhaL CDS complement(77715..78416) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 78521..79417 product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041010.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 gene yhaJ CDS complement(79468..79824) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(80066..80431) product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(80724..81710) product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531201.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene yqjG CDS complement(81780..82172) product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732240.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(82358..82657) product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS complement(82647..83051) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(83054..83359) product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS complement(83397..83765) product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297156.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene yqjC CDS complement(83912..84295) product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166760.1 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene mzrA CDS complement(84299..84961) product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 transl_table 11 codon_start 1 locus_tag LOCUS_02630 gene yqjA CDS complement(85306..86082) product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 gene exuR CDS 86456..87094 product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225866.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 87124..87624 product CS1 type fimbrial major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755097.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS 87716..90400 product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358674.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 90853..91485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(91573..92871) product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 gene exuT CDS 93354..94766 product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187447.1 transl_table 11 codon_start 1 locus_tag LOCUS_02700 gene uxaC CDS 94781..96268 product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199376.1 transl_table 11 codon_start 1 locus_tag LOCUS_02710 gene uxaA CDS 96351..96902 product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128136.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(96907..98151) product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211655.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene sstT CDS complement(98356..98664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(98767..99732) product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098805.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 gene alx CDS complement(100015..101019) product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456357.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(101080..101763) product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183049.1 transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS complement(101840..102343) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297151.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 102428..103564 product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018690.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene rlmG CDS 103835..104251 product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 gene higA CDS complement(104296..106314) product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121487.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 gene fadH CDS complement(106740..109091) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695479.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 gene ygjK CDS complement(109108..110178) product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767652.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 gene ygjJ CDS complement(110312..111745) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285446.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(111808..112257) product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS complement(112254..115346) product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082869.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 gene ebgA CDS complement(115530..116513) product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212470.1 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene ebgR CDS 116732..117064 product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450589.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(117106..118395) product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633381.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene ygjG CDS 118903..120423 product aerotaxis sensor receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094682.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene aer CDS complement(120530..121153) product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018005.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene nfeR CDS 121441..122205 product NADPH-dependent ferric chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065895.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene nfeF tRNA complement(122259..122334) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 122459..122965 product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene mug CDS complement(123043..124884) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene rpoD CDS complement(125079..126824) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene dnaG CDS complement(126935..127150) product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene rpsU CDS 127387..128400 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene tsaD CDS complement(128443..129906) product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804973.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene ttdT CDS complement(129954..130559) product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene ttdB CDS complement(130556..131467) product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 gene ttdA CDS 131674..132606 product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene ttdR CDS complement(132619..133236) product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene plsY CDS 133338..133709 product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene folB CDS 133799..134620 product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305111.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene bacA CDS complement(134783..136021) product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 gene cca CDS complement(136085..136705) product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 136947..138248 product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046264.1 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene ygiF CDS 138271..141111 product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene glnE CDS 141159..142592 product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03090 gene hldE CDS complement(143386..145047) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000341046.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(145074..145703) product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599947.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 145972..146172 product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350095.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 gene glgS CDS complement(146215..147279) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269793.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(147281..148030) product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387080.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(148046..150559) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277116.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS complement(150610..151161) product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(151444..151794) product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene ubiK CDS 152108..152761 product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene ribB CDS 153022..153192 product protein YqiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469266.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene yqiD CDS complement(153250..154023) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 gene zupT CDS 154139..154954 product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03210 gene ygiD CDS complement(154992..156152) product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(156158..156700) product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(156977..158458) product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene tolC CDS 158663..159292 product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene nudF CDS 159293..159715 product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS 159740..160567 product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 gene cpdA CDS 160567..161148 product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene yqiA CDS 161177..163069 product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195296.1 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene parE CDS complement(163117..163431) product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(163462..164043) product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene mdaB CDS 164362..164694 product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912120.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(164740..166089) product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673354.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene qseC CDS complement(166086..166745) product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221502.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene qseB CDS 166897..167289 product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 gene ygiW CDS 167342..167824 product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183494.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 168370..170628 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene parC CDS 170862..171599 product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 gene plsC CDS 171674..173086 product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059395.1 transl_table 11 codon_start 1 locus_tag LOCUS_03390 gene ftsP CDS 173197..175416 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095187.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(175459..175716) product lipoprotein YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848528.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene yqhH CDS complement(175767..176693) product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691598.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(176893..177720) product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene dkgA CDS complement(177825..178988) product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene yqhD CDS 179182..180081 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(180121..180780) product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 gene yghB CDS complement(180920..182107) product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 gene metC CDS 182359..183093 product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 gene exbB CDS 183100..183525 product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene exbD sequence03 source 1..148746 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(281..1150) product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008054.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS complement(1545..2573) product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene epmB CDS 2615..3181 product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 gene efp CDS 3469..3615 product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene ecnB CDS 3790..4107 product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 gene sugE CDS complement(4104..4637) product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238369.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene blc CDS complement(4726..5859) product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001367937.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(5922..6281) product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03570 gene frdD CDS complement(6292..6687) product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 gene frdC CDS complement(6698..7432) product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene frdB CDS complement(7425..9233) product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192973.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene frdA CDS 9558..10535 product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 gene epmA CDS 10799..12256 product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300174.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 gene yjeM CDS complement(12407..15730) product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236813.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 gene mscM CDS complement(15752..16720) product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 transl_table 11 codon_start 1 locus_tag LOCUS_03640 gene asd CDS complement(16817..17869) product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene rsgA CDS 17964..18509 product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 gene orn tRNA 18720..18795 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 tRNA 18832..18907 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 tRNA 18943..19018 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(19288..20427) product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene queG CDS 20441..21973 product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 gene nnr CDS 21945..22406 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 gene tsaE CDS 22425..23762 product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990321.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene amiB CDS 23772..25619 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122523.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 gene mutL CDS 25612..26562 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 26648..26956 product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene hfq CDS 27032..28312 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene hflX CDS 28398..29657 product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene hflK CDS 29660..30664 product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene hflC CDS 30746..30943 product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 31047..32345 product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 gene purA CDS 32550..32975 product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene nsrR CDS 33014..35455 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076316.1 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rnr CDS 35635..36366 product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene rlmB CDS 36493..36894 product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220137.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 36913..37611 product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 37661..38320 product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012550.1 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 38338..38736 product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 38746..39384 product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101644.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS 39387..40550 product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943976.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 40634..42259 product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299838.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(42376..42651) product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene yjfN CDS complement(42800..43069) product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254633.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 gene bsmA CDS 43311..44060 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569721.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 gene yjfP CDS complement(44057..44812) product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 gene ulaR CDS complement(44920..45990) product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene ulaG CDS 46339..47736 product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300695.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 gene ulaA CDS 47752..48057 product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218360.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene ulaB CDS 48067..48531 product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776505.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 gene ulaC CDS 48545..49195 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056749.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene ulaD CDS 49205..50059 product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949511.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene ulaE CDS 50059..50745 product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170812.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 gene ulaF CDS complement(50874..51149) product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 51476..51871 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 transl_table 11 codon_start 1 locus_tag LOCUS_04010 gene rpsF CDS 51878..52192 product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene priB CDS 52197..52424 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene rpsR CDS 52466..52915 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 gene rplI CDS complement(52986..53543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 note possible pseudo, frameshifted CDS complement(54051..55298) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033613.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(55421..57493) product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080381.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(57490..59031) product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS complement(59041..59817) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(59827..60669) product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205251.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(60679..61470) product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS 61682..62329 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(62313..62951) product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene ytfB CDS 63169..63789 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene fklB CDS 64098..65510 product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene cycA CDS complement(65555..66217) product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene ytfE CDS complement(66325..67290) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296686.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS complement(67399..68259) product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene qorB CDS 68348..68728 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(68857..70800) product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589423.1 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene cpdB CDS 70990..71730 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene cysQ CDS complement(71720..72277) product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 72602..72808 product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 CDS complement(72870..74213) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(74536..75174) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305659.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene msrA CDS 75231..75410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 75380..77113 product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269327.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 gene tamA CDS 77110..80889 product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060946.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 gene tamB CDS 80892..81233 product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 81445..81696 product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223208.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene chpS CDS 81690..82040 product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239579.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 gene chpB CDS complement(82120..82650) product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 transl_table 11 codon_start 1 locus_tag LOCUS_04320 gene ppa CDS 82960..83916 product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265933.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene ytfQ CDS 84056..85558 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205794.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS 85572..86594 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 86581..87576 product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595979.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 gene yjfF CDS complement(87609..88607) product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene fbp CDS 88783..90156 product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219816.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 gene mpl CDS complement(90312..90863) product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 gene yjgA CDS 90957..92309 product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene pmbA CDS 92492..92878 product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232240.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 gene cybC CDS complement(92923..93387) product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 gene nrdG CDS complement(93546..95684) product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 gene nrdD CDS complement(96078..97733) product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331056.1 transl_table 11 codon_start 1 locus_tag LOCUS_04440 gene treC CDS complement(97783..99204) product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene treB CDS complement(99323..100270) product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181324.1 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene treR CDS 100649..103345 product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471866.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 gene mgtA CDS complement(103390..103845) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(103911..104297) product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 gene ridA CDS complement(104370..104831) product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene pyrI CDS complement(104844..105779) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 gene pyrB CDS complement(106198..106593) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS complement(106724..107437) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene bdcA CDS 107508..108101 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256656.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 108246..108698 product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583470.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene tabA CDS 108821..110164 product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene yjgL note possible pseudo, internal stop codon, frameshifted CDS 110151..110381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(110482..111486) product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012907.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 gene argF CDS 111648..112064 product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 gene rraB CDS complement(112110..112613) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059422.1 transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 112806..114002 product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(114058..116913) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416392.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 gene valS CDS complement(116913..117356) product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 transl_table 11 codon_start 1 locus_tag LOCUS_04630 gene holC CDS complement(117490..119001) product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene pepA CDS 119361..120368 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene lptF CDS 120368..121450 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene lptG CDS complement(121569..123071) product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04670 tRNA 123598..123682 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS 123883..125151 product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS 125367..126242 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141174869.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(126320..127285) product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(127388..129130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS complement(129195..132326) product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(132323..133339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(133339..134757) product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694527.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(134747..136453) product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 136667..137644 product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002890.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 137959..138642 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703837.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 138682..139695 product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047369808.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 139707..140492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(140707..140925) product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703404.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(141043..141657) product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148641.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS 142250..143203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS 143439..144257 product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703839.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 144287..144760 product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 gene radC CDS 144781..145095 product type IV toxin-antitoxin system cytoskeleton bundling-enhancing antitoxin CbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene cbeA CDS 145126..145467 product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene ykfI CDS 145582..146415 product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 146468..146740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS 146744..147019 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS 147133..147930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS 148259..148666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 sequence04 source 1..139976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1023..3437) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561899.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(3434..4120) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS 4058..4714 product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene tesA CDS 4704..5513 product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 transl_table 11 codon_start 1 locus_tag LOCUS_04950 gene ybbO CDS 5574..6428 product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 gene cnoX CDS complement(6491..7270) product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene fetB CDS complement(7257..7934) product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157535.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 gene fetA CDS 8080..8997 product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 8994..9452 product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(9453..9860) product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 gene cueR CDS complement(9985..11277) product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(11280..12212) product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883024.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 gene glsA CDS 12474..14978 product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078268.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene copA CDS complement(15092..15487) product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617168.1 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 15571..16365 product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 16569..17048 product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186627.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene ybaK CDS complement(17085..18737) product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771766.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene ushA CDS 18955..20175 product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene fsr CDS 20413..22089 product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene ybaL CDS complement(22172..23476) product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 gene gsk CDS 23628..24587 product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801832.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 gene aes CDS complement(24584..25546) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250088.1 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene hemH CDS complement(25782..26426) product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene adk CDS complement(26607..28481) product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene htpG CDS complement(28591..29196) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene recR CDS complement(29196..29525) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(29578..31509) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122013.1 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene dnaX CDS complement(31638..32189) product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene apt CDS complement(32342..32719) product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 32789..33316 product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05210 gene priC CDS 33330..33491 product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051146.1 transl_table 11 codon_start 1 locus_tag LOCUS_05220 gene rsmS CDS complement(33703..37065) product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 gene mscK CDS complement(37193..37840) product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 gene acrR CDS 38090..39175 product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 gene acrA CDS 39198..42347 product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132469.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene acrB CDS 42893..43267 product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05270 gene tomB CDS 43281..43511 product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 43682..44233 product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 gene maa CDS 44349..44819 product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 44983..46533 product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299455.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 gene pdeB CDS complement(46575..46928) product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS 47307..47618 product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 gene atl CDS complement(47649..48221) product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 48439..49299 product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 gene tesB CDS complement(49347..50633) product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 transl_table 11 codon_start 1 locus_tag LOCUS_05360 gene amtB CDS complement(50663..51001) product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 transl_table 11 codon_start 1 locus_tag LOCUS_05370 gene glnK CDS complement(51182..52963) product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS complement(52956..54728) product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235599.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS complement(54758..55216) product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene decR CDS complement(55369..56187) product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113027.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene cof CDS 56287..57987 product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 58052..58747 product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene queC CDS complement(58799..59197) product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene fadM CDS complement(59291..59662) product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(59813..61684) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 gene ppiD CDS complement(61876..62148) product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene hupB CDS complement(62357..64711) product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene lon CDS complement(64899..66173) product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene clpX CDS complement(66299..66922) product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene clpP CDS complement(67168..68466) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene tig CDS complement(68810..69127) product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene bolA CDS 69432..70010 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 70102..71529 product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098438.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene ampG CDS 72049..72936 product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene cyoA CDS 72958..74949 product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene cyoB CDS 75038..75553 product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 75553..75882 product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 75894..76784 product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 gene cyoE CDS 76969..77280 product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 77264..77806 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227784.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(77862..78797) product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 79205..80569 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000978.1 transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS complement(80697..81188) product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 gene yajQ CDS 81356..82267 product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705874.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene panE CDS 82230..82820 product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276309.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene yajL CDS complement(82874..84322) product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene thiI CDS 84528..84770 product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 transl_table 11 codon_start 1 locus_tag LOCUS_05680 gene xseB CDS 84770..85669 product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347217.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 gene ispA CDS 85694..87556 product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006797.1 transl_table 11 codon_start 1 locus_tag LOCUS_05700 gene dxs CDS 87611..88585 product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199800.1 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene yajO CDS complement(88639..89157) product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 gene pgpA CDS complement(89135..90112) product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05730 gene thiL CDS complement(90190..90609) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene nusB CDS complement(90629..91099) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene ribE CDS complement(91188..92291) product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150468.1 transl_table 11 codon_start 1 locus_tag LOCUS_05760 gene ribD CDS complement(92295..92744) product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene nrdR CDS 92895..93434 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314529.1 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 93733..94617 product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene tsx CDS complement(94794..95141) product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene yajD CDS complement(95270..96241) product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene secF CDS complement(96252..98066) product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene secD CDS complement(98127..98459) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene yajC CDS complement(98482..99609) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(99665..100735) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 100828..101409 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009884.1 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene acpH CDS complement(101414..103231) product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297133.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 gene malZ CDS complement(103387..104760) product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 gene proY CDS complement(104836..106155) product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 gene brnQ CDS complement(106562..107857) product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893603.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene phoR CDS complement(107915..108604) product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene phoB CDS 108794..109996 product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221319.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene sbcD CDS 109993..113136 product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 gene sbcC CDS 113178..114446 product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 gene araJ CDS complement(114589..115497) product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219342.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene mak CDS 115556..116533 product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rdgC CDS complement(116691..116864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS complement(117180..117464) product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene ppnP CDS complement(117536..118213) product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS complement(118471..118662) product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 gene yaiA CDS complement(118712..119179) product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 gene aroL CDS complement(119419..119877) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 119997..120806 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 gene proC CDS complement(120823..121938) product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 gene adrA CDS complement(122040..122360) product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene psiF CDS complement(122479..123894) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene phoA CDS complement(123995..124255) product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene iraP CDS 124718..125812 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene ddlA CDS complement(125836..126048) product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 126308..126616 product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(126675..127769) product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092029.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 gene yaiW CDS complement(127782..129002) product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001342332.1 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene sbmA CDS 129354..130511 product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 gene ampH CDS complement(130512..131135) product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06140 gene iprA CDS complement(131223..134129) product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556441.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 134653..135627 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06160 gene hemB CDS complement(135733..136584) product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004044.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 gene tauD CDS complement(136581..137408) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114607.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 gene tauC CDS complement(137405..138172) product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939375.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene tauB CDS complement(138185..139147) product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297135.1 transl_table 11 codon_start 1 locus_tag LOCUS_06200 gene tauA sequence05 source 1..134287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(140..439) product PRD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295165.1 transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS complement(519..1424) product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254820.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 gene yhfZ CDS complement(1693..2697) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165553.1 transl_table 11 codon_start 1 locus_tag LOCUS_06230 gene trpS CDS complement(2690..3448) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 transl_table 11 codon_start 1 locus_tag LOCUS_06240 gene gph CDS complement(3441..4118) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 gene rpe CDS complement(4136..4852) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene dam CDS complement(5079..6365) product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343178.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 gene damX CDS complement(6457..7545) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 gene aroB CDS complement(7602..8087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS complement(8524..9762) product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene hofQ CDS complement(9674..10078) product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 gene hofP CDS complement(10068..10508) product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055760.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene hofO CDS complement(10492..11031) product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 transl_table 11 codon_start 1 locus_tag LOCUS_06330 gene hofN CDS complement(11031..11810) product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315880.1 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene hofM CDS 11951..14482 product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 gene mrcA CDS complement(14647..15207) product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene nudE CDS 15527..17662 product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104539.1 transl_table 11 codon_start 1 locus_tag LOCUS_06370 gene igaA CDS 17727..18395 product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936227.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene yrfG CDS 18406..18807 product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene hslR CDS 18832..19710 product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135574.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 gene hslO CDS complement(19845..21569) product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370795.1 transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS 21948..23570 product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 gene pckA CDS 23687..24004 product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS 24063..24359 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650976.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 gene nadS CDS complement(24390..25733) product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 gene envZ CDS complement(25739..26458) product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene ompR CDS 26686..27162 product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene greB CDS 27259..29580 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980724.1 transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 30018..30245 product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 gene feoA CDS 30262..32583 product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737014.1 transl_table 11 codon_start 1 locus_tag LOCUS_06500 gene feoB CDS 32583..32819 product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 gene feoC CDS 33022..33315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06520 note possible pseudo, internal stop codon CDS 33328..33900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06530 note possible pseudo, internal stop codon CDS complement(33929..34699) product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060072.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene bioH CDS 35040..35420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 35479..36054 product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 transl_table 11 codon_start 1 locus_tag LOCUS_06560 gene nfuA CDS 36415..37731 product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene gntT CDS complement(37776..39860) product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444333.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 gene malQ CDS complement(39870..42263) product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081909.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene malP CDS 42875..45580 product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906970.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 gene malT CDS complement(45623..46639) product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387129.1 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene rtcA CDS complement(46643..47869) product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105504.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene rtcB CDS 48058..49656 product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232966.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 gene rtcR CDS complement(49638..50396) product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815099.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(50413..51243) product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928731.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 gene glpG CDS complement(51288..51614) product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 gene glpE CDS 51804..53309 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448136.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene glpD CDS complement(53971..54738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183164.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(54741..55451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424547.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(55466..56971) product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181201.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(57099..59546) product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993449.1 transl_table 11 codon_start 1 locus_tag LOCUS_06710 gene glgP CDS complement(59565..60998) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 gene glgA CDS complement(60998..62293) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 gene glgC CDS complement(62311..64284) product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192523.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 gene glgX CDS complement(64281..66467) product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene glgB CDS complement(66740..67843) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene asd CDS 68036..68629 product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene yhgN CDS complement(68686..69951) product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 gene gntU CDS complement(70030..70518) product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108330.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 gene gntK CDS complement(70696..71634) product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene gntR CDS complement(71915..72610) product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639811.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 gene yhhW CDS complement(72733..73770) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS 73717..73869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 74103..74591 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295206.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 gene yhhY CDS 74825..76003 product Hcp1 family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065894.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 76000..76494 product protein YrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988501.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 gene yrhA CDS 76589..76744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS 76944..77228 product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 CDS complement(77266..79008) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene ggt CDS 79128..79568 product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(79555..80298) product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073609.1 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene ugpQ CDS complement(80295..81365) product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907790.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene ugpC CDS complement(81367..82212) product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572164.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene ugpE CDS complement(82209..83096) product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099276.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene ugpA CDS complement(83194..84510) product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803193.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene ugpB CDS complement(84906..85619) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416895.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene livF CDS complement(85621..86388) product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene livG CDS complement(86385..87662) product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803797.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene livM CDS complement(87659..88585) product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene livH CDS complement(88633..89796) product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene livK CDS 90166..90549 product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778785.1 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene panM CDS complement(90748..91851) product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene livJ CDS complement(92123..92977) product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rpoH CDS complement(93222..94280) product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene ftsX CDS complement(94273..94941) product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene ftsE CDS complement(94944..96440) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040676.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene ftsY CDS 96590..97186 product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene rsmD CDS 97176..97445 product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(97448..97807) product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042900.1 transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS 97948..98574 product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS 98648..100846 product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106527.1 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene zntA CDS complement(100948..101193) product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene tusA CDS 101414..102079 product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100467.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS 102152..102709 product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene dcrB CDS complement(102713..103930) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 104062..105111 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297848.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 105166..105753 product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285784.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene acpT CDS 105864..107438 product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 gene nikA CDS 107438..108382 product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene nikB CDS 108379..109212 product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene nikC CDS 109212..109976 product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 transl_table 11 codon_start 1 locus_tag LOCUS_07210 gene nikD CDS 109973..110779 product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173630.1 transl_table 11 codon_start 1 locus_tag LOCUS_07220 gene nikE CDS 110785..111186 product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene nikR CDS complement(111306..111665) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593555.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(111662..111937) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(112010..113134) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314210.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS complement(113134..115869) product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149156.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene rbbA CDS complement(115866..116933) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361470.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(117299..118921) product YhiJ/YhiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393583.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(119183..120541) product DUF4049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069547.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 note possible pseudo, internal stop codon CDS 120425..120715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 121156..122208 product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028905.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS complement(122524..123726) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439170.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS 123958..125457 product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902780.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 gene pitA CDS complement(125528..125863) product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626187.1 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene uspB CDS 126254..126688 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 gene uspA CDS complement(126872..127051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 127024..128475 product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098652.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene dtpB CDS complement(128524..129276) product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene rsmJ CDS complement(129282..131324) product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 gene prlC CDS 131527..132369 product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 gene rlmJ CDS 132441..133793 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160808.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 gene gorA CDS complement(133847..133996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 133958..134131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059235695.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 sequence06 source 1..133958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 note possible pseudo, internal stop codon CDS 1518..2300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871667.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 note possible pseudo, internal stop codon CDS complement(2516..3415) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062888.1 transl_table 11 codon_start 1 locus_tag LOCUS_07470 gene nhaR CDS complement(3481..4647) product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681360.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 gene nhaA CDS 5233..5385 product type I toxin-antitoxin system toxin MokC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809168.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene mokC CDS complement(5489..6619) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 transl_table 11 codon_start 1 locus_tag LOCUS_07500 gene dnaJ CDS complement(6708..8624) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene dnaK CDS 9001..9405 product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843559.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 9431..10144 product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102379.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 gene msyB CDS 10293..10859 product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene satP CDS complement(10894..11481) product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene mog CDS complement(11596..12549) product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130189.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene tal CDS 12828..14258 product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112597.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS 14328..15104 product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906203.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene yaaA CDS complement(15253..15414) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(15767..17053) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene thrC CDS complement(17054..17986) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241660.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene thrB CDS complement(17988..20450) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264697.1 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene thrA CDS complement(20810..21496) product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223177.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 22132..22848 product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 gene arcA CDS complement(22908..24260) product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 gene creD CDS complement(24318..25742) product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 gene creC CDS complement(25742..26431) product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene creB CDS complement(26444..26917) product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene creA CDS 27128..27997 product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 transl_table 11 codon_start 1 locus_tag LOCUS_07690 gene robA CDS complement(27994..28641) product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene gpmB CDS 28684..29214 product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene yjjX CDS complement(29299..29625) product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene trpR CDS complement(29715..31652) product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409453.1 transl_table 11 codon_start 1 locus_tag LOCUS_07730 gene sltY CDS 31863..33530 product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene ettA CDS complement(33837..35069) product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093810.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene nadR CDS complement(35090..36472) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene radA CDS complement(36521..37489) product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene serB CDS 37595..38239 product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 38267..39283 product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105898.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene lplA CDS 39315..39464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 note possible pseudo, internal stop codon CDS complement(39739..40458) product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224877.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 gene deoD CDS complement(40538..41761) product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 transl_table 11 codon_start 1 locus_tag LOCUS_07820 gene deoB CDS complement(41813..43135) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 gene deoA CDS complement(43262..44041) product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 gene deoC CDS 44299..45849 product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 45980..46684 product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088391.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(46797..47579) product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563014.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(47576..48649) product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299799.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS complement(48771..48932) product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(49059..49664) product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295748.1 transl_table 11 codon_start 1 locus_tag LOCUS_07900 gene osmY CDS complement(50057..51646) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175940.1 transl_table 11 codon_start 1 locus_tag LOCUS_07910 gene prfC CDS complement(51737..52414) product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870703.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 gene yjjG CDS complement(52429..52875) product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 transl_table 11 codon_start 1 locus_tag LOCUS_07930 gene rimI CDS complement(52844..53257) product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07940 gene holD CDS 53360..54391 product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene rsmC tRNA 54692..54778 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(54817..55053) product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350368.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 55194..55982 product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331556.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 gene fhuF CDS complement(56020..56643) product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301727.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene bglJ CDS complement(56655..57380) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 57945..58769 product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 58760..59233 product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 59341..59880 product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 transl_table 11 codon_start 1 locus_tag LOCUS_08020 gene dnaT CDS 59883..60620 product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 gene dnaC CDS 60672..61163 product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308243.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 gene yjjA CDS 61417..63708 product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292674.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene opgB CDS complement(63847..64869) product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene lgoD CDS 65008..65922 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS 66137..67498 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(67547..69202) product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919536.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 gene tsr CDS complement(69321..69767) product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543916.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 gene hpaR CDS 70039..71328 product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679076.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 gene hpaG CDS 71325..72791 product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 gene hpaE CDS 72793..73644 product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516990.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 gene hpaD CDS 73654..74034 product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119868.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 74102..74905 product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459750.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 gene hpaH CDS 74916..75704 product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 gene hpaI CDS 75879..77255 product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 gene hpaX CDS 77265..78155 product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205639.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 gene hpaA CDS 78406..79968 product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801481.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene hpaB CDS 79986..80498 product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175460.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS 80876..83041 product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene btsT CDS 83091..83294 product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 83305..84261 product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068090.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene yjiA CDS complement(84339..86879) product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(87277..87426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 87572..88984 product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199300.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS complement(89226..90170) product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181149.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 CDS 90637..91869 product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 gene mdtM CDS 91943..93190 product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037419.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 93306..94457 product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298064.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 94467..95234 product putative 2-hydroxyacyl-CoA dehydratase activator YjiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222495.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 gene yjiL CDS 95231..95488 product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657676.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 95553..96413 product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253426.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 96481..97659 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141192.1 transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS complement(97776..98225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 note possible pseudo, frameshifted CDS 98475..99158 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295597.1 transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS 99155..99616 product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211971.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 99629..100801 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568432.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 gene iadA CDS 100866..101777 product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340758.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 gene hypT CDS complement(101770..102021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 102835..103665 product DUF2686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062596.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(103806..104579) product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene uxuR CDS complement(104794..106254) product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208185.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(106335..107519) product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438591.1 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene uxuA CDS 107859..109202 product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene gntP CDS complement(109446..110348) product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832247.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 gene fimH CDS complement(110368..110871) product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872005.1 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene fimG CDS complement(110884..111414) product type 1 fimbria minor subunit FimF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244826.1 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene fimF CDS complement(111424..114060) product fimbrial usher FimD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120940.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene fimD CDS complement(114127..114852) product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene fimC CDS complement(114889..115386) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824114.1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(115493..116041) product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene fimA CDS complement(116521..117117) product type 1 fimbria switch DNA invertase FimE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044711.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene fimE CDS 119654..120370 product N-acetylneuraminic acid outer membrane channel NanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08540 gene nanC CDS 120390..121496 product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309184.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 gene nanM CDS 121534..122541 product 9-O-acetyl-N-acetylneuraminic acid deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991438.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS 122753..123625 product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168589.1 transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 123795..125870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 125863..127206 product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209167.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 127203..127589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 127640..129787 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS 129787..131241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS 131277..132563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 sequence07 source 1..123901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(1973..2236) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 transl_table 11 codon_start 1 locus_tag LOCUS_08650 gene rpsT CDS 2619..3506 product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene ribF CDS 3549..6365 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286857.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene ileS CDS 6365..6859 product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083369.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 gene lspA CDS 6947..7396 product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 gene fkpB CDS 7398..8348 product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166389.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene ispH CDS 8414..9328 product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239142.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene rihC CDS 9495..10316 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene dapB CDS complement(10358..10525) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 10772..11920 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene carA CDS 11938..15159 product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 gene carB CDS complement(15167..15385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196529.1 transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 15420..15815 product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333120.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene caiF CDS complement(15901..16491) product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122876.1 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene caiE CDS complement(16497..17282) product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004397.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 gene caiD CDS complement(17391..18944) product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386575.1 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene caiC CDS complement(19018..20235) product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349932.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene caiB CDS complement(20364..21506) product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 gene caiA CDS complement(21537..22877) product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene caiT CDS 23525..24295 product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331240.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 24310..25251 product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091525.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS 25302..26588 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 26585..26872 product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203747.1 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene fixX CDS 26930..28261 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS 28369..28899 product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene kefF CDS 28892..30754 product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377194.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene kefC CDS 30835..31425 product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301983.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene folA CDS complement(31503..32345) product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257186.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 gene apaH CDS complement(32352..32729) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene apaG CDS complement(32732..33553) product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 gene rsmA CDS complement(33550..34539) product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241259.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 gene pdxA CDS complement(34539..35825) product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene surA CDS complement(35878..38232) product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746151.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene lptD CDS 38487..39302 product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200573.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene djlA CDS complement(39419..40078) product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 gene rluA CDS complement(40090..42996) product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 gene rapA CDS complement(43161..45512) product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035654.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 gene polB CDS complement(45587..46282) product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene araD CDS complement(46451..47953) product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene araA CDS complement(47964..49664) product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951795.1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene araB CDS 49952..50881 product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 transl_table 11 codon_start 1 locus_tag LOCUS_09050 gene araC CDS 50967..51731 product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148402.1 transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS complement(51845..52543) product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916310.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene thiQ CDS complement(52527..54137) product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235706.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene thiP CDS complement(54113..55096) product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053588.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene thiB CDS complement(55260..56915) product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138624.1 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene sgrR CDS 57004..57135 product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 gene sgrT CDS 57113..57364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS 57255..58415 product sugar efflux transporter SetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 gene setA CDS complement(58464..59069) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818228.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene leuD CDS complement(59080..60480) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 gene leuC CDS complement(60483..61574) product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene leuB CDS complement(61574..63145) product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082846.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene leuA CDS 63966..64928 product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395589.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene leuO CDS 65246..66970 product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425657.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene ilvI CDS 66943..67464 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene ilvN CDS 67644..68648 product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene cra CDS 69250..69708 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene mraZ CDS 69710..70651 product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 gene rsmH CDS 70648..71013 product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene ftsL CDS 71029..72795 product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene ftsI CDS 72782..74269 product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785141.1 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene murE CDS 74266..75624 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626688.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene murF CDS 75618..76700 product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene mraY CDS 76703..78019 product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796468.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene murD CDS 78019..79263 product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene ftsW CDS 79284..80327 product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016559.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene murG CDS 80381..81856 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096048.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 gene murC CDS 81849..82769 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene ddlB CDS 82771..83601 product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene ftsQ CDS 83598..84860 product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 gene ftsA CDS 84921..86072 product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09360 gene ftsZ CDS 86173..87090 product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 transl_table 11 codon_start 1 locus_tag LOCUS_09370 gene lpxC CDS 87246..87833 product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014321.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene secM CDS 87895..90600 product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene secA CDS 90660..91049 product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736013.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 gene mutT CDS complement(91149..91346) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 transl_table 11 codon_start 1 locus_tag LOCUS_09410 gene yacG CDS complement(91356..92099) product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 gene zapD CDS complement(92099..92719) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene coaE CDS 92944..93987 product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 gene guaC CDS complement(94022..95224) product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157234.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene hofC CDS complement(95214..96599) product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025173.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 gene gspE CDS complement(96609..97049) product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360895.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene ppdD CDS complement(97252..98145) product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135174.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene nadC CDS 98233..98784 product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene ampD CDS 98781..99635 product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene ampE CDS complement(99678..101051) product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene aroP CDS 101592..102356 product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene pdhR CDS 102517..105180 product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene aceE CDS 105195..107087 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene aceF CDS 107412..108836 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene lpdA CDS complement(108907..110565) product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784502.1 transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 111019..113616 product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene acnB CDS 113791..114153 product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 gene yacL CDS complement(114191..114985) product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene speD CDS complement(115001..115867) product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene speE CDS complement(115973..116299) product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 116486..118036 product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene cueO CDS complement(118083..120473) product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349940.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene gcd CDS 120679..121215 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene hpt CDS complement(121256..121918) product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 transl_table 11 codon_start 1 locus_tag LOCUS_09650 gene can CDS 122027..122953 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 122950..123720 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 transl_table 11 codon_start 1 locus_tag LOCUS_09670 sequence08 source 1..103442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(239..682) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236960.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS 839..1768 product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122782.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene metA CDS 2037..3638 product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138905.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 gene aceB CDS 3668..4972 product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene aceA CDS 5156..6892 product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137214.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene aceK CDS complement(6861..7172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 note possible pseudo, frameshifted CDS complement(7214..8434) product ShET2/EspL2 family type III secretion system effector toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632888.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 note possible pseudo, frameshifted CDS complement(8751..9575) product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 gene iclR CDS 9775..13458 product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096011.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene metH CDS 13678..15309 product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956830.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(15400..16089) product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene pepE CDS 16301..17173 product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936361.1 transl_table 11 codon_start 1 locus_tag LOCUS_09790 gene rluF CDS complement(17174..17446) product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207635.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 17976..19103 product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592029.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS 19136..19900 product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(19936..20862) product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212693.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(21007..22356) product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290316.1 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene lysC CDS 22881..24530 product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene pgi CDS 24885..25127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 25241..25879 product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296632.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 25876..26613 product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595558.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS 26613..28709 product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 29304..29714 product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene psiE CDS complement(29758..31233) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene xylE CDS complement(31605..32495) product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene malG CDS complement(32510..34054) product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene malF CDS complement(34208..35398) product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene malE CDS 35763..36878 product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene malK CDS 36950..38290 product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973658.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene lamB CDS 38533..39453 product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene malM CDS 39682..39876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623309.1 transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 39967..41262 product SopA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579094.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 note possible pseudo, frameshifted CDS 41485..41982 product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305723.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 gene ubiC CDS 41995..42867 product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene ubiA CDS complement(43022..45505) product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141711.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene plsB CDS 45616..45984 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 gene dgkA CDS 46094..46702 product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 gene lexA CDS 46775..48100 product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128149.1 transl_table 11 codon_start 1 locus_tag LOCUS_10050 gene dinF CDS 48216..48425 product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS complement(48467..48982) product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene zur CDS 49300..50316 product DUF2713 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912582.1 transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS 50775..51716 product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 gene dusA CDS 51850..52092 product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 gene pspG CDS complement(52258..53241) product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235522.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 53324..54739 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 gene dnaB CDS 54792..55871 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10130 gene alr CDS 56124..57317 product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene tyrB CDS 57436..57615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(57642..58022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069596.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 58425..59138 product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 gene aphA CDS 59249..59665 product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS 59669..60025 product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(60060..62882) product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 gene uvrA CDS 63136..63672 product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 gene ssb1 CDS complement(63771..64052) product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295689.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 64482..66068 product c-di-GMP phosphodiesterase PdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene pdeC CDS complement(66071..66394) product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019358.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 gene soxS CDS 66480..66944 product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 gene soxR CDS 67490..68839 product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106882.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 gene ghxP CDS 68990..70639 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(70793..72085) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270143.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(72263..73912) product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene actP CDS complement(73909..74223) product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296646.1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(74423..76381) product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10310 gene acs CDS 76884..78209 product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene nrfA CDS 78254..78820 product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 gene nrfB CDS 78817..79488 product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene nrfC CDS 79485..80441 product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195171.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 gene nrfD CDS 80497..82179 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071524619.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 82172..82555 product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032546.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene nrfF CDS 82552..83148 product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662608.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene nrfG CDS 83490..84803 product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835799.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene gltP CDS complement(84881..85570) product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 gene yjcO CDS complement(85664..87811) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_table 11 codon_start 1 transl_except (pos:87392..87394,aa:Sec) note codon on position 140 is selenocysteine opal codon. locus_tag LOCUS_10410 gene fdhF CDS complement(88009..89475) product multidrug efflux transporter outer membrane subunit MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610574.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene mdtP CDS complement(89472..91523) product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275193.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene mdtO CDS complement(91523..92554) product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446354.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene mdtN CDS complement(92573..92848) product YtcA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001356044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(93057..95042) product alkyl sulfatase YjcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307516.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene yjcS CDS complement(95315..96244) product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 gene alsK CDS complement(96228..96923) product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene alsE CDS complement(96934..97914) product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 transl_table 11 codon_start 1 locus_tag LOCUS_10490 gene alsC CDS complement(97893..99425) product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235257.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene alsA CDS complement(99552..100487) product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361478.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene alsB CDS complement(100546..101436) product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene alsR CDS 101795..102244 product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10530 gene rpiB CDS 102313..102642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 misc_feature complement(102789..>103442) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000059926.1:phosphonate metabolism protein PhnP locus_tag LOCUS_10550 sequence09 source 1..94845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 64..140 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 tRNA 149..224 product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS complement(320..1159) product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379246.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 gene hdfR CDS 1278..1616 product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 transl_table 11 codon_start 1 locus_tag LOCUS_10570 gene maoP CDS complement(1641..3161) product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058976.1 transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 3752..5398 product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012602.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene ilvG CDS 5395..5658 product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 gene ilvM CDS 5678..6607 product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene ilvE CDS 6672..8522 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 gene ilvD CDS 8525..10069 product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785599.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 gene ilvA CDS complement(10066..10956) product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene ilvY CDS 11106..12581 product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024951.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene ilvC CDS complement(12668..12949) product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 gene ppiC CDS complement(13148..13597) product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996694.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 13814..15835 product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238869.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene rep CDS complement(15882..17366) product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295254.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene gppA CDS complement(17500..18765) product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 gene rhlB CDS 18896..19225 product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene trxA CDS 19552..20811 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene rho CDS 20821..21039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127070.1 transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS 21051..22154 product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 transl_table 11 codon_start 1 locus_tag LOCUS_10740 gene wecA CDS 22166..23212 product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene wzzE CDS 23268..24398 product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866672.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 gene wecB CDS 24395..25657 product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene wecC CDS 25657..26724 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226604.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 gene rffG CDS 26743..27624 product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene rfbA CDS 27602..28276 product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145196.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 gene rffC CDS 28281..29411 product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene rffA CDS 29413..30663 product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050265.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene wzxE CDS 30660..31739 product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217240.1 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene rffT CDS 31736..33088 product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10840 gene wzyE CDS 33091..33831 product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene wecG CDS 34022..35407 product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10860 tRNA 35510..35586 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 tRNA 35645..35720 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 tRNA 35741..35827 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 tRNA 35870..35946 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 36093..37328 product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941543.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(38252..39448) product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 gene hemY CDS complement(39451..40644) product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138997.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene hemX CDS complement(40666..41406) product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026061.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 gene hemD CDS complement(41403..42365) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 gene hemC CDS 42731..45277 product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281680.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene cyaA CDS complement(45317..45637) product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene cyaY CDS complement(45685..46998) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(46995..48473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(48534..49844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(49841..51205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300182.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS complement(51655..52209) product DUF3304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522559.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 52559..52762 product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799884.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 52799..53623 product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 gene dapF CDS 53620..54327 product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812796.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 54324..55220 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130691.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene xerC CDS 55220..55936 product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene yigB CDS 56020..58182 product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383406.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 gene uvrD CDS complement(58329..59093) product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951164.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS 59463..60413 product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene corA CDS complement(60467..60946) product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837563.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS complement(60943..61791) product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059699.1 transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 61927..62124 product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315926.1 transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 62750..63049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526434.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS complement(63096..63983) product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339103.1 transl_table 11 codon_start 1 locus_tag LOCUS_11110 gene rarD CDS complement(64035..64502) product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 gene yigI CDS 64667..65536 product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene pldA CDS 65663..67498 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene recQ CDS 67568..68182 product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene rhtC CDS complement(68244..68864) product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 gene rhtB CDS 68975..69997 product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene pldB CDS 70005..70805 product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285348.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 gene yigL CDS 70881..71780 product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene bioP CDS complement(71668..72621) product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene metR CDS 72739..75000 product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 gene metE CDS complement(75040..75855) product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562775.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS 76117..76878 product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045180.1 transl_table 11 codon_start 1 locus_tag LOCUS_11230 gene udp CDS 77018..78445 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene rmuC CDS 78540..79295 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene ubiE CDS 79309..79914 product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 transl_table 11 codon_start 1 locus_tag LOCUS_11260 gene ubiJ CDS 79911..81551 product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 transl_table 11 codon_start 1 locus_tag LOCUS_11270 gene ubiB CDS 81630..81899 product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 gene tatA CDS 81903..82418 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 gene tatB CDS 82421..83197 product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 gene tatC CDS 83239..84021 product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299486.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene tatD CDS complement(84018..84506) product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene rfaH CDS 84673..86166 product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene ubiD CDS 86212..86913 product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 gene fre CDS complement(87105..88268) product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438788.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene fadA CDS complement(88278..90467) product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965943.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 gene fadB CDS 90657..91988 product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 gene pepQ CDS 92060..92602 product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296979.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 92641..94092 product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 gene trkH CDS 94104..94649 product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853969.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene hemG sequence10 source 1..86786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..839 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000014967.1:RHS element core protein locus_tag LOCUS_11410 CDS 851..1312 product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642490.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 1637..1930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 2019..2456 product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(2916..4052) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(4055..4417) product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479626.1 transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 4954..6867 product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 transl_table 11 codon_start 1 locus_tag LOCUS_11470 gene mtlA CDS 6962..8110 product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645424.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 gene mtlD CDS 8110..8697 product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228271.1 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene mtlR CDS complement(8709..8918) product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 gene yibT CDS 9203..9565 product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 10109..10792 product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049544.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS 10836..15686 product trimeric autotransporter adhesin EhaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033221.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene ehaG CDS 16055..17710 product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene lldP CDS 17710..18486 product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297449.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 gene lldR CDS 18483..19673 product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586964.1 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene lldD CDS 19859..20332 product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 gene trmL CDS complement(20385..21206) product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene cysE CDS complement(21286..22305) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene gpsA CDS complement(22305..22772) product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003382.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene secB CDS complement(22835..23086) product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene grxC CDS complement(23227..23658) product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001368341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 23903..25447 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11630 gene gpmM CDS 25481..26740 product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214147.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 gene envC CDS 26744..27703 product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(27690..28724) product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982100.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 gene waaH CDS complement(28963..29988) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11670 gene tdh CDS complement(29998..31194) product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene kbl CDS complement(31469..32326) product protein YibB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842823.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 gene yibB CDS 32630..33562 product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587764.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene rfaD CDS 33572..34618 product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699219.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene rfaF CDS 34622..35614 product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264565.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 gene rfaC CDS 36283..36819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(36855..37997) product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227812.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(38006..39019) product UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(39044..39751) product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639946.1 transl_table 11 codon_start 1 locus_tag LOCUS_11760 gene rfaY CDS complement(39777..40784) product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080643.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 gene waaO CDS complement(40827..41624) product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene rfaP CDS complement(41617..42741) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(42738..43742) product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360402.1 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene rfaQ CDS 44209..45486 product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891564.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene waaA CDS 45494..45973 product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 gene coaD CDS complement(46012..46821) product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 gene mutM CDS complement(46919..47086) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 gene rpmG CDS complement(47107..47343) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 gene rpmB CDS complement(47560..48228) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298959.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 gene radC CDS 48400..49620 product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene coaBC CDS 49598..50056 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 gene dut CDS 50163..50759 product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene slmA CDS complement(50796..51437) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806161.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene pyrE CDS complement(51503..52219) product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene rph CDS 52346..53209 product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS 53430..54254 product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002036.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dinD CDS 54546..55163 product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(55160..56677) product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870052.1 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene ligB CDS complement(56703..56960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638625.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 57100..57723 product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 gene gmk CDS 57778..58053 product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene rpoZ CDS 58072..60180 product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene spoT CDS 60187..60876 product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene trmH CDS 60882..62963 product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678442.1 transl_table 11 codon_start 1 locus_tag LOCUS_12010 gene recG CDS complement(62948..63814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(63817..65022) product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468836.1 transl_table 11 codon_start 1 locus_tag LOCUS_12030 gene gltS CDS 65302..66693 product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 gene xanP CDS 66814..68523 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307467.1 transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(68576..70894) product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702944.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 gene yicI CDS complement(70904..72286) product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 transl_table 11 codon_start 1 locus_tag LOCUS_12070 tRNA 72579..72673 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 72969..74150 product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 74426..75055 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 75055..76596 product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089287.1 transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS 76681..77985 product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene uhpC CDS 77982..79013 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 CDS 79082..81160 product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 81172..82218 product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene fbpC CDS complement(82537..83925) product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(84203..84958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 85127..85357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 85563..85970 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 note possible pseudo, frameshifted CDS 85975..86274 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 note possible pseudo, internal stop codon, frameshifted sequence11 source 1..75190 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(334..1743) product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188776.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene glnG CDS complement(1755..2804) product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene glnL CDS complement(2978..4387) product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene glnA CDS 4760..6583 product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 transl_table 11 codon_start 1 locus_tag LOCUS_12230 gene typA CDS 6800..7510 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS 7623..8498 product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 8600..9865 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS complement(9956..10648) product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene ompL CDS complement(10716..12119) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295267.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(12162..13547) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018376.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS complement(13593..15629) product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 gene yihQ CDS complement(15828..16754) product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(16868..18109) product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene yihS CDS complement(18126..19004) product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 gene yihT CDS complement(19028..19924) product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 gene yihU CDS 20092..20988 product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 gene yihV CDS 21022..21807 product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 21906..22505 product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene yihX CDS 22499..23371 product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 23368..23805 product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 gene dtd CDS 23850..24791 product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080791.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 gene fabY CDS complement(24855..25763) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387201.1 transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS 25992..26303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897305.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS 26304..26594 product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene nadS CDS 27180..27398 product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295676.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 27617..27859 product protein YiiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087409.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene yiiF CDS complement(28189..29118) product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027708.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene fdhE CDS complement(29115..29750) product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 gene fdoI CDS complement(29747..30649) product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 gene fdoH CDS complement(30662..33712) product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011310337.1 transl_table 11 codon_start 1 transl_except (pos:33125..33127,aa:Sec) note codon on position 196 is selenocysteine opal codon. locus_tag LOCUS_12490 gene fdnG CDS 33906..34739 product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753589.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene fdhD CDS 34892..35932 product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387797.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS complement(35982..37730) product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931302.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS complement(37730..38800) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019472.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(38790..40241) product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(40252..40698) product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS complement(40999..41313) product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619503.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 gene rhaM CDS complement(41323..42147) product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 transl_table 11 codon_start 1 locus_tag LOCUS_12570 gene rhaD CDS complement(42389..43648) product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325794.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 gene rhaA CDS complement(43645..45114) product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144117.1 transl_table 11 codon_start 1 locus_tag LOCUS_12590 gene rhaB CDS 45402..46238 product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 transl_table 11 codon_start 1 locus_tag LOCUS_12600 gene rhaS CDS 46312..47160 product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296618.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene rhaR CDS complement(47157..48191) product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene rhaT CDS 48476..49096 product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 gene sodA CDS 49356..50339 product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene kdgT CDS 50488..51162 product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270270.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene yiiM CDS complement(51268..52641) product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene cpxA CDS complement(52638..53336) product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene cpxR CDS 53486..53986 product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 gene cpxP CDS 54135..55037 product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene fieF CDS 55218..56180 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 transl_table 11 codon_start 1 locus_tag LOCUS_12700 gene pfkA CDS 56499..57488 product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 transl_table 11 codon_start 1 locus_tag LOCUS_12710 gene sbp CDS 57595..58350 product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708998.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 gene cdh CDS complement(58405..59172) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 transl_table 11 codon_start 1 locus_tag LOCUS_12730 gene tpiA CDS complement(59280..59879) product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802226.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 59980..60420 product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS 60632..60931 product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS 60958..61386 product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 gene uspD CDS complement(61391..62137) product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796320.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene fpr CDS complement(62234..63244) product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 transl_table 11 codon_start 1 locus_tag LOCUS_12790 gene glpX CDS complement(63380..64888) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 gene glpK CDS complement(64911..65756) product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene glpF CDS 66187..66426 product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 gene zapB CDS complement(66511..66996) product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 transl_table 11 codon_start 1 locus_tag LOCUS_12830 gene rraA CDS complement(67089..68015) product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 gene menA CDS complement(68082..69413) product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293343.1 transl_table 11 codon_start 1 locus_tag LOCUS_12850 gene hslU CDS complement(69423..69953) product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 gene hslV CDS complement(70046..70900) product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068834.1 transl_table 11 codon_start 1 locus_tag LOCUS_12870 gene ftsN CDS complement(71097..72122) product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 gene cytR CDS complement(72278..74476) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350069.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 gene priA CDS 74679..74891 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 gene rpmE sequence12 source 1..73961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 23..475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 CDS 478..798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(1289..2041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(2028..2924) product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039730.1 transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(2928..3158) product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(3444..4700) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(4961..6538) product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138282.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene guaA CDS complement(6607..8073) product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene guaB CDS 8235..9605 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937933.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene xseA CDS complement(9602..9817) product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301444.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS complement(9886..11358) product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene der CDS complement(11476..12654) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177043.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene bamB CDS complement(12665..13285) product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 transl_table 11 codon_start 1 locus_tag LOCUS_13030 gene yfgM CDS complement(13303..14577) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 gene hisS CDS complement(14688..15806) product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 transl_table 11 codon_start 1 locus_tag LOCUS_13050 gene ispG CDS complement(15833..16846) product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090858.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 gene rodZ CDS complement(17131..18285) product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(18435..18866) product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene ndk CDS complement(19015..21327) product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137711.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene pbpC CDS complement(21328..26286) product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736368.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 gene yfhM CDS 26493..27338 product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 gene sseA CDS complement(27831..28607) product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene sseB CDS complement(28749..30032) product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133582.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene pepB CDS complement(30210..30410) product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene iscX CDS complement(30422..30757) product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124469.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene fdx CDS complement(30759..32609) product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 gene hscA CDS complement(32626..33141) product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384411.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene hscB CDS complement(33237..33560) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 gene iscA CDS complement(33577..33963) product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 gene iscU CDS complement(33991..35205) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 gene iscS CDS complement(35317..35805) product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene iscR CDS complement(36106..36843) product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940018.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene trmJ CDS 36962..37765 product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 gene suhB CDS 37910..38764 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 38955..40235 product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983009.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene csiE CDS complement(40227..41366) product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(41526..42416) product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423257.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 gene hcaR CDS 42552..43913 product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 43910..44428 product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 44428..44748 product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 44745..45557 product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene hcaB CDS 45567..46769 product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660797.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS 46866..47288 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094726.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(47336..48208) product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158547.1 transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS complement(48220..49281) product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(49347..50345) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276670.1 transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(50370..51881) product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS complement(51904..52887) product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(52984..56265) product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386984.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 56377..57576 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299519.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(57640..58893) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 gene glyA CDS 59221..60411 product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene hmpA CDS complement(60456..60794) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene glnB CDS complement(60855..62189) product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298983.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 gene glrR CDS complement(62179..62868) product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215888.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene qseG CDS complement(63057..64439) product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297612.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene qseE CDS complement(65042..68929) product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970087.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene purL CDS 69187..70743 product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene mltF CDS complement(70740..71243) product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene tadA CDS complement(71301..71936) product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene yfhb CDS 72073..72993 product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455839.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 73124..73309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 sequence13 source 1..70861 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..896) product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239154.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 gene nlpE CDS complement(910..1332) product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13540 gene arfB CDS complement(1329..1874) product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 2040..2240 product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS 2227..2487 product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene rof CDS complement(2536..3834) product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176578.1 transl_table 11 codon_start 1 locus_tag LOCUS_13580 gene tilS CDS complement(3899..4288) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901098.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(4345..6486) product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene ldcC CDS complement(6585..7544) product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055741.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 gene accA CDS complement(7557..11039) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294757.1 transl_table 11 codon_start 1 locus_tag LOCUS_13620 gene dnaE CDS complement(11076..11672) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 gene rnhB CDS complement(11669..12817) product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139667.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 gene lpxB CDS complement(12817..13605) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 gene lpxA CDS complement(13609..14064) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene fabZ CDS complement(14169..15194) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene lpxD CDS complement(15198..15683) product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene skp CDS complement(15805..18237) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 transl_table 11 codon_start 1 locus_tag LOCUS_13690 gene bamA CDS complement(18267..19619) product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 transl_table 11 codon_start 1 locus_tag LOCUS_13700 gene rseP CDS complement(19631..20380) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 gene cdsA CDS complement(20501..21190) product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295562.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene ispU CDS complement(21448..22644) product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene ispC CDS complement(22736..23293) product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene frr CDS complement(23585..24310) product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene pyrH CDS complement(24457..25308) product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene tsf CDS complement(25566..26291) product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246884.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene rpsB CDS 26659..27453 product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene map CDS 27515..30187 product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094571.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene glnD CDS 30218..31042 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene dapD CDS 31354..31740 product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(31829..32986) product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 transl_table 11 codon_start 1 locus_tag LOCUS_13820 gene cdaR CDS complement(33141..34565) product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753945.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 gene degP CDS complement(34695..36212) product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 gene dgt CDS 36296..36994 product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 gene mtnN CDS 36987..37787 product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 gene btuF CDS 37825..38448 product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(38495..38839) product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene erpA CDS complement(38921..40342) product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene clcA CDS 40567..41847 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045290.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene hemL CDS complement(41882..43864) product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044094.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene fhuB CDS complement(43861..44751) product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295787.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene fhuD CDS complement(44751..45548) product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 gene fhuC CDS complement(45599..47842) product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 gene fhuA CDS complement(48062..50596) product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918166.1 transl_table 11 codon_start 1 locus_tag LOCUS_13950 gene mrcB CDS complement(50583..50789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS complement(50792..53266) product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene hrpB CDS 53295..53825 product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene thpR CDS 53840..54544 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene sfsA CDS 54722..55177 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene dksA CDS 55214..56140 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937432.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 gene gluQRS CDS 56233..57597 product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174643.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 gene pcnB CDS 57594..58073 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215124.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene folK CDS 58443..59027 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS 59132..59872 product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465930.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 59907..62507 product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153166.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 gene htrE CDS 62524..63093 product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591057.1 transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 63108..63710 product fimbrial-like protein YadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene yadL CDS 63737..64333 product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 64386..65660 product fimbrial-like adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS 65773..66567 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805455.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 gene panB CDS 66579..67430 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905383.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene panC CDS complement(67504..68406) product recombination-promoting nuclease RpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339945.1 transl_table 11 codon_start 1 locus_tag LOCUS_14130 gene rpnC CDS 68680..69060 product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 gene panD CDS complement(69064..70293) product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277872.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS complement(70357..70797) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901989.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 sequence14 source 1..69158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(142..2559) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14170 gene gyrB CDS complement(2585..3658) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 gene recF CDS complement(3658..4758) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene dnaN CDS complement(4763..6097) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 transl_table 11 codon_start 1 locus_tag LOCUS_14200 gene dnaA CDS 6773..6913 product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene rpmH CDS 6963..7289 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene rnpA CDS 7513..9159 product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378258.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene yidC CDS 9265..10629 product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282346.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene mnmE CDS 11167..12582 product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 transl_table 11 codon_start 1 locus_tag LOCUS_14250 gene tnaA CDS 12673..13920 product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131911.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene tnaB CDS 14053..15228 product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 gene mdtL CDS 15194..16162 product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748502.1 transl_table 11 codon_start 1 locus_tag LOCUS_14280 gene yidZ CDS 16319..17068 product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296581.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 CDS 17090..17656 product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291260.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene yieF CDS complement(17710..19047) product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082693.1 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene adeP CDS 19214..19879 product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078043.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene yieH CDS 19946..20419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116764.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS 20468..21055 product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene cbrC CDS complement(21117..21839) product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(21854..23023) product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(23050..24666) product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene bglH CDS complement(24752..26146) product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene bglB CDS complement(26165..28042) product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137312.1 transl_table 11 codon_start 1 locus_tag LOCUS_14390 gene bglF CDS complement(28176..29012) product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 gene bglG CDS complement(29299..30024) product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene phoU CDS complement(30039..30812) product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 gene pstB CDS complement(30903..31793) product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251991.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene pstA CDS complement(31793..32752) product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene pstC CDS complement(32839..33879) product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 transl_table 11 codon_start 1 locus_tag LOCUS_14450 gene pstS CDS complement(34127..35200) product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(35211..37733) product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989215.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(37758..38150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 note possible pseudo, internal stop codon CDS complement(38277..38489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 note possible pseudo, internal stop codon CDS complement(38537..39109) product long polar fimbria major subunit LpfA-O113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827808.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(39411..41240) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 gene glmS CDS complement(41402..42772) product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933736.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene glmU CDS complement(43123..43542) product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(43563..44945) product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene atpD CDS complement(44972..45835) product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene atpG CDS complement(45886..47427) product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 gene atpA CDS complement(47440..47973) product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 gene atpH CDS complement(47988..48458) product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 transl_table 11 codon_start 1 locus_tag LOCUS_14580 gene atpF CDS complement(48520..48759) product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 gene atpE CDS complement(48806..49621) product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 transl_table 11 codon_start 1 locus_tag LOCUS_14600 gene atpB CDS complement(49630..50022) product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 gene atpI CDS complement(50627..51250) product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene rsmG CDS complement(51314..53203) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 transl_table 11 codon_start 1 locus_tag LOCUS_14630 gene mnmG CDS complement(53582..54025) product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763731.1 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene mioC CDS complement(54115..54573) product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 transl_table 11 codon_start 1 locus_tag LOCUS_14650 gene asnC CDS 54725..55717 product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845133.1 transl_table 11 codon_start 1 locus_tag LOCUS_14660 gene asnA CDS complement(55722..57173) product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956630.1 transl_table 11 codon_start 1 locus_tag LOCUS_14670 gene viaA CDS complement(57167..58663) product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315921.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 gene ravA CDS 58886..60754 product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene kup CDS 60921..61340 product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene rbsD CDS 61348..62853 product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387753.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 gene rbsA CDS 62858..63823 product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene rbsC CDS 63848..64738 product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 gene rbsB CDS 64849..65793 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene rbsK CDS 65806..66789 product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene rbsR CDS complement(66755..68182) product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280837.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene mdtD CDS complement(68205..68897) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131164.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 sequence15 source 1..62926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 3..216 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccggc CDS complement(296..1333) product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490426.1 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene iap CDS 1585..2493 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene cysD CDS 2495..3922 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090348.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 gene cysN CDS 3922..4527 product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene cysC CDS 4577..4900 product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 4885..5106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS 5094..5405 product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 gene ftsB CDS 5424..6134 product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 transl_table 11 codon_start 1 locus_tag LOCUS_14850 gene ispD CDS 6134..6613 product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 gene ispF CDS 6610..7659 product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568924.1 transl_table 11 codon_start 1 locus_tag LOCUS_14870 gene truD CDS 7640..8401 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 transl_table 11 codon_start 1 locus_tag LOCUS_14880 gene surE CDS 8395..9021 product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 gene pcm CDS 9161..10300 product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene nlpD CDS 10363..11355 product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 gene rpoS CDS complement(11476..11883) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208070.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 12030..12623 product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767718.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 12623..14050 product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863205.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 14061..14297 product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562982.1 transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(14336..15655) product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS complement(15789..16565) product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136918.1 transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(16570..17208) product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(17205..18467) product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS complement(18464..19372) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 19568..20335 product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297141.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene ygbI CDS complement(20386..21042) product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141350.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 gene pphB CDS complement(21148..23709) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272898.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 gene mutS CDS 23996..24349 product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015498.1 transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(24386..26464) product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297144.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene flhA CDS complement(26538..27548) product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059931.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 gene hypE CDS complement(27545..28666) product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212982.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 gene hypD CDS complement(28666..28938) product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene hypC CDS complement(28929..29801) product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337668.1 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene hypB CDS complement(29805..30155) product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene hypA CDS 30367..30828 product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene hycA CDS 30953..31564 product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079181.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 gene hycB CDS 31561..33387 product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274388.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 gene hycC CDS 33390..34313 product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115223.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 gene hycD CDS 34331..36040 product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288134.1 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene hycE CDS 36050..36592 product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 gene hycF CDS 36592..37359 product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067399.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 gene hycG CDS 37356..37766 product formate hydrogenlyase assembly protein HycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 gene hycH CDS 37759..38229 product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 gene hycI CDS complement(38388..39812) product 6-phospho-beta-glucosidase AscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110331.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene ascB CDS complement(39821..41278) product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107859.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 gene ascF CDS 41547..42548 product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001374632.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene ascG CDS 42697..43224 product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078777.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 gene hydN CDS 43377..45629 product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107688.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 gene hypF CDS complement(45757..46890) product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064748.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene norW CDS complement(46887..48326) product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029634.1 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene norV CDS 48513..50027 product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010723.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 gene norR CDS complement(50024..50989) product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287415.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene gutQ CDS complement(50982..51755) product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 gene srlR CDS complement(51822..52181) product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene gutM CDS complement(52286..53065) product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077358.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene srlD CDS complement(53069..53440) product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216201.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene srlB CDS complement(53451..54410) product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148875.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene srlE CDS complement(54407..54970) product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene srlA CDS 55226..56311 product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295177.1 transl_table 11 codon_start 1 locus_tag LOCUS_15350 gene mltB CDS 56456..56953 product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene pncC CDS 57033..58094 product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene recA CDS 58337..58837 product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140506.1 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene recX CDS 58965..61595 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene alaS CDS 61830..62015 product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene csrA tRNA 62331..62423 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 62427..62503 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA complement(62447..62518) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 62701..62777 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence16 source 1..47162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..508) product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene phnO CDS complement(495..1052) product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 gene phnN CDS complement(1052..2188) product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586282.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene phnM CDS complement(2185..2865) product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611405.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 gene phnL CDS complement(2976..3734) product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075514.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 gene phnK CDS complement(3731..4576) product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002284.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 gene phnJ CDS complement(4569..5633) product alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301782.1 transl_table 11 codon_start 1 locus_tag LOCUS_15470 gene phnI CDS complement(5633..6217) product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171603.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 gene phnH CDS complement(6214..6666) product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542776.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene phnG CDS complement(6667..7392) product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene phnF CDS complement(7413..8243) product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 transl_table 11 codon_start 1 locus_tag LOCUS_15510 gene phnE CDS complement(8298..9314) product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992002.1 transl_table 11 codon_start 1 locus_tag LOCUS_15520 gene phnD CDS complement(9339..10127) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193391.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 gene phnC CDS complement(10260..10703) product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131311.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 gene yjdN CDS complement(10863..11198) product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 11600..13828 product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288590.1 transl_table 11 codon_start 1 locus_tag LOCUS_15560 gene crfC CDS 13825..14703 product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169175.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 14967..16469 product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296882.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 gene proP CDS complement(16646..17746) product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052137.1 transl_table 11 codon_start 1 locus_tag LOCUS_15590 gene pmrB CDS complement(17747..18415) product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 gene basR CDS complement(18412..20025) product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298860.1 transl_table 11 codon_start 1 locus_tag LOCUS_15610 gene eptA CDS complement(20159..21496) product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene adiC CDS complement(21633..22394) product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217059.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 gene adiY CDS complement(22719..24989) product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978640.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 gene adiA CDS complement(25185..26093) product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 transl_table 11 codon_start 1 locus_tag LOCUS_15650 gene melR CDS 26376..27731 product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 gene melA CDS 27846..29255 product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 transl_table 11 codon_start 1 locus_tag LOCUS_15670 gene melB CDS complement(29394..30023) product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(30146..31792) product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 gene fumB CDS complement(31870..33210) product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene dcuB CDS complement(33781..34500) product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 gene dcuR CDS complement(34497..36128) product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 36309..36539 product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371700.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 gene yjdI CDS 36551..36823 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405647.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS 37050..37346 product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398619.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene ghoS CDS 37374..37547 product type V toxin-antitoxin system toxin GhoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene ghoT CDS complement(37666..39183) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295074.1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene lysS CDS complement(39420..40877) product dipeptide/tripeptide permease DtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856829.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 gene dtpC CDS complement(40936..43083) product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 transl_table 11 codon_start 1 locus_tag LOCUS_15790 gene cadA CDS complement(43163..44497) product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092909.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 gene cadB CDS complement(44862..46400) product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187182.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 gene cadC sequence17 source 1..44678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(238..1104) product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene yghU CDS 1309..3168 product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297309.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 gene gss CDS 3460..4959 product inorganic phosphate transporter PitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933296.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene pitB CDS complement(5008..5700) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 5997..6587 product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076250.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS 6619..7377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339532.1 transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 7423..8772 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896880.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS 8772..9596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984978.1 transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS 9608..10168 product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299422.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS 10199..11269 product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779661.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene lptF CDS 11266..12345 product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296409.1 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene lptG CDS complement(12381..13553) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524972.1 transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS complement(13553..13801) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS complement(13833..14747) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077177.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS complement(14744..16432) product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS 16836..17978 product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene yghO CDS complement(17985..18749) product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene glcC CDS 19000..20499 product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 gene glcD CDS 20499..21551 product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943059.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene glcE CDS 21562..22785 product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194680.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene glcF CDS 22790..23194 product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 23216..25387 product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084080.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene glcB CDS 25743..27425 product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259303.1 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene glcA CDS complement(27551..27760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS 28043..32479 product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034469.1 transl_table 11 codon_start 1 locus_tag LOCUS_16060 gene sslE CDS 32619..33428 product prepilin peptidase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001365924.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene pppA CDS 33494..33904 product type II secretion system pilot lipoprotein GspS-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324279.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene gspS2 CDS 34063..34881 product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135063.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene gspC CDS 34911..36971 product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498829.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene gspD CDS 36971..38464 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249348.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 gene gspE CDS 38464..39687 product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173453.1 transl_table 11 codon_start 1 locus_tag LOCUS_16120 gene gspF CDS 39704..40159 product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087296.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 gene gspG CDS 40163..40726 product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115140.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene gspH CDS 40723..41094 product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820120.1 transl_table 11 codon_start 1 locus_tag LOCUS_16150 gene gspI CDS 41091..41690 product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255040.1 transl_table 11 codon_start 1 locus_tag LOCUS_16160 gene gspJ CDS 41693..42670 product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633238.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 gene gspK CDS 42667..43845 product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094962.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 gene gspL CDS 43847..44383 product GspM family type II secretion system protein YghD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942785.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene yghD sequence18 source 1..43677 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 683..1006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(976..1290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 note possible pseudo, internal stop codon, frameshifted CDS complement(1496..1768) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303397.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(1913..2521) product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702307.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(2581..2898) product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene metJ CDS 3175..4335 product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 gene metB CDS 4338..6770 product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene metL CDS 7119..8009 product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 gene metF CDS 8338..10518 product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297636.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene katG CDS 10612..11517 product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297632.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene yijE CDS complement(11544..12161) product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(12436..13539) product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 transl_table 11 codon_start 1 locus_tag LOCUS_16320 gene gldA CDS complement(13550..14212) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424845.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 gene fsa CDS complement(14224..16725) product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 gene ptsP CDS 17034..18113 product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004446.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 18128..18448 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 18499..20796 product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS 20762..21640 product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 21642..21983 product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323849.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(21970..22821) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274623.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(22970..24703) product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556306.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS complement(24885..27536) product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005579.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 gene ppc CDS complement(27888..29039) product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309894.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene argE CDS 29193..30197 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 gene argC CDS 30208..30981 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene argB CDS 31042..32415 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene argH CDS 32913..34127 product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690934.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 34194..35477 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382183.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 35728..36645 product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 gene oxyR CDS complement(36628..38028) product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 gene sthA CDS 38305..39009 product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene fabR CDS 39009..39368 product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS complement(39408..40508) product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene trmA CDS 40877..42721 product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene btuB CDS 42666..43523 product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201827.1 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene murI sequence19 source 1..40730 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(334..1104) product 2-oxoglutaramate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene yafV CDS 1285..1731 product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 transl_table 11 codon_start 1 locus_tag LOCUS_16570 gene ivy CDS complement(1774..4218) product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973081.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene fadE CDS 4458..5036 product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 gene lpcA CDS 5242..6009 product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(5980..6720) product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene dpaA CDS complement(6876..7154) product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene yafQ CDS complement(7157..7417) product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729704.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 gene dinJ CDS 7633..8376 product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS complement(8433..8789) product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030484.1 transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS complement(8782..9081) product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598758.1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(9165..11258) product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 gene flhA CDS complement(11242..12381) product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(12371..13153) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 gene fliR CDS complement(13155..13430) product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(13430..14182) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene fliP CDS complement(14179..14550) product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(14543..15394) product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 15781..16767 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 transl_table 11 codon_start 1 locus_tag LOCUS_16740 CDS 16782..17123 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 17128..18774 product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene fliF CDS 18752..19762 product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 19765..20475 product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151516.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene fliH CDS 20468..21805 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 transl_table 11 codon_start 1 locus_tag LOCUS_16790 gene fliI CDS 21808..22242 product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 gene fliJ CDS 22245..22640 product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS complement(22758..25202) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181816997.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(25381..26310) product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(26437..26865) product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS complement(26878..27156) product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705404.1 transl_table 11 codon_start 1 locus_tag LOCUS_16850 gene flgM CDS complement(27237..27974) product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene flgA CDS 28056..28391 product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS 28394..28825 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010941.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene flgC CDS 28825..29538 product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093678.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 29623..30825 product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 gene flgE CDS 30825..31562 product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375450.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 31741..32526 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990540.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 gene flgG CDS 32798..33463 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800864.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 gene flgH CDS 33478..34578 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 CDS 34578..34877 product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS 35066..36442 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene flgK CDS 36457..37386 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene flgL CDS 37403..38380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(38435..39277) product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS 39763..40677 product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene lafA sequence20 source 1..39973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..2135) product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291774.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene glyS CDS complement(2145..3056) product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene glyQ CDS complement(3151..3450) product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980111.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 3625..4620 product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182653.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene wecH CDS complement(4662..5099) product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene yiaA CDS complement(5145..5486) product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858193.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 gene yiaB CDS complement(5655..7109) product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275386.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene xylB CDS complement(7181..8503) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene xylA CDS 8869..9861 product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296518.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 gene xylF CDS 9939..11480 product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146479.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene xylG CDS 11458..12639 product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene xylH CDS 12717..13895 product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 gene xylR CDS complement(14003..14575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 CDS 15147..17177 product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761268.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 gene malS CDS 17355..18608 product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144361.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 gene avtA CDS complement(18760..19233) product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296790.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(19335..20183) product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514230.1 transl_table 11 codon_start 1 locus_tag LOCUS_17170 gene yiaJ CDS 20384..21382 product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 gene yiaK CDS 21394..21861 product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576071.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS 21979..22452 product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene yiaM CDS 22455..23732 product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene yiaN CDS 23745..24731 product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene yiaO CDS 24735..26231 product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196081.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 gene lyxK CDS 26228..26890 product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089497.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 gene ulaD CDS 26883..27743 product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296811.1 transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS 27737..28432 product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 gene araD CDS complement(28779..29519) product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906806.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 29643..30617 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(30614..31483) product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 transl_table 11 codon_start 1 locus_tag LOCUS_17290 note possible pseudo, frameshifted CDS complement(31432..31749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 note possible pseudo, frameshifted CDS complement(31755..32078) product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478195.1 transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 32192..32404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS complement(32623..34161) product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene aldB CDS complement(34326..35477) product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene yiaY CDS complement(35667..37511) product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582466.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene selB CDS complement(37508..38899) product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene selA CDS complement(38997..39605) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 sequence21 source 1..36141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(836..1306) product tyrosine-type DNA invertase IpbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295805.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 gene ipbA CDS 2204..2455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(2474..4144) product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159102.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene betA CDS complement(4158..5630) product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 gene betB CDS complement(5644..6231) product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295527.1 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene betI CDS 6405..8393 product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131044.1 transl_table 11 codon_start 1 locus_tag LOCUS_17440 gene betT CDS complement(8763..8948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001328114.1 transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 9268..10356 product DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301264.1 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene pdeL CDS complement(10398..11330) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084388.1 transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(11422..11919) product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013892.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 12177..12782 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023640.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 12822..13685 product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296901.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS 13675..15222 product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111846.1 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene fdrA CDS 15222..16640 product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083455.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS 16783..17733 product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661672.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 17743..19125 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662407.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 19394..19834 product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 20085..21071 product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981355.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 21120..22604 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447335.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 CDS 22597..23568 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818900.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS 23565..24521 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750340.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 24608..25657 product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 gene yahK CDS 25900..26715 product protein YahL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309286.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 gene yahL tRNA 27058..27138 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(27390..28022) product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976975.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 28208..28483 product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691953.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 gene yahO CDS complement(28581..30167) product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941076.1 transl_table 11 codon_start 1 locus_tag LOCUS_17640 gene prpR CDS 30406..31296 product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052206.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 gene prpB CDS 31341..32510 product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285908.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 gene prpC CDS 32544..33995 product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275861.1 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene prpD CDS 34035..35921 product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 gene prpE sequence22 source 1..35832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1328..3469) product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103304.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(3679..4197) product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142958.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 4894..5394 product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037389.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 gene tssB CDS 5429..5653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123970.1 transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 5704..7179 product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056978.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 gene tssC CDS 7186..7599 product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611748.1 transl_table 11 codon_start 1 locus_tag LOCUS_17740 gene tssE CDS 7603..9453 product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393844.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 gene tssF CDS 9417..10361 product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348793.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene tssG CDS 10524..11804 product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113725.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 gene tagH CDS 11801..12325 product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080149.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene tssJ CDS 12328..13659 product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246434.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene tssK CDS 13664..14425 product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343303.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 gene icmH CDS 14434..17199 product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614374.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 gene tssH CDS 17196..17939 product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088854.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene vasI CDS 17944..19356 product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240532.1 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene tssA CDS 19375..22899 product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122985420.1 transl_table 11 codon_start 1 locus_tag LOCUS_17840 gene tssM CDS 22910..24262 product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087741.1 transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS 24286..24768 product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS 24812..25726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908057.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 25736..26215 product protein YkfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17880 gene ykfM CDS complement(26352..27137) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 transl_table 11 codon_start 1 locus_tag LOCUS_17890 tRNA complement(27468..27544) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(27678..28409) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297205.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 gene dnaQ CDS 28474..28941 product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 gene rnhA CDS complement(28938..29660) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307587.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 29694..30449 product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052751.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene gloB CDS 30659..31879 product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 transl_table 11 codon_start 1 locus_tag LOCUS_17940 gene mltD CDS complement(31927..32697) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211710.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS complement(32775..33575) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 33816..34730 product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 gene yafC CDS complement(34727..35530) product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997010.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 gene dkgB tRNA complement(35693..35769) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence23 source 1..33907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(422..2536) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene fusA CDS complement(2633..3103) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene rpsG CDS complement(3200..3574) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 gene rpsL CDS complement(3700..3987) product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903377.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene tusB CDS complement(3995..4354) product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820720.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene tusC CDS complement(4354..4740) product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 gene tusD CDS complement(4740..5462) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(5629..6441) product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838264.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 gene fkpA CDS 6662..6880 product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(6929..7519) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene slyD CDS complement(7614..7814) product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(7824..9629) product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399122.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene kefB CDS complement(9629..10180) product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 gene kefG CDS 10311..12224 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 12224..13246 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057405.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 13240..13458 product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS 13512..14381 product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 transl_table 11 codon_start 1 locus_tag LOCUS_18150 CDS complement(14436..14840) product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 15142..15774 product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene crp CDS 15912..17915 product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(17982..19202) product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene argD CDS complement(19288..19851) product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene pabA CDS complement(19883..20485) product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280623.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS complement(20475..20642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(20747..21319) product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 gene ppiA CDS 21590..22771 product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185247.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene tsgA CDS 23033..25576 product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049213.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene nirB CDS 25573..25899 product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene nirD CDS 26026..26832 product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene nirC CDS 26851..28224 product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene cysG CDS 28471..28638 product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 28933..30270 product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 gene frlA CDS 30291..31313 product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene frlB CDS 31363..32193 product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847834.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene frlC CDS 32190..32975 product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853346.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene frlD CDS 33075..33806 product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene frlR sequence24 source 1..33074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(325..2004) product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191596.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 gene bcsG CDS complement(2001..2192) product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 gene bcsF CDS complement(2189..3748) product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene bcsE CDS 4033..4221 product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene bcsR CDS 4233..4985 product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene bcsQ CDS 4982..7600 product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025914.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 gene bcsA CDS 7611..9950 product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 gene bcsB CDS 9957..11063 product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307453.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 gene bcsZ CDS 11045..14518 product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 transl_table 11 codon_start 1 locus_tag LOCUS_18430 gene bcsC CDS 14639..16588 product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266306.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 gene hmsP CDS 16771..18057 product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 transl_table 11 codon_start 1 locus_tag LOCUS_18450 gene dctA CDS 18278..19774 product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163137.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(19870..20799) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 gene kdgK CDS 21163..21798 product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene pdeH CDS 21868..23928 product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS complement(24162..25484) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149006.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS complement(25895..26908) product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191257.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene yhjD CDS complement(26957..27838) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 28376..28978 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(29029..30678) product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934218.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS 31083..32480 product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784821.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene ccp sequence25 source 1..31185 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(164..922) product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078338.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(930..2033) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS complement(2043..3242) product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS complement(3292..4317) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(4748..4969) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(5222..8326) product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273212.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene acrF CDS complement(8338..9495) product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene acrE CDS 9894..10556 product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129522.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 gene acrS CDS complement(10822..11706) product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258895.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 gene yhdJ CDS complement(11792..12088) product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 gene fis CDS complement(12114..12959) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene dusB CDS complement(13408..14289) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene prmA CDS complement(14301..15752) product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene panF CDS complement(15742..15984) product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381175.1 transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(16093..17442) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 gene accC CDS complement(17453..17923) product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene accB CDS complement(17896..18084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(18901..19875) product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148478.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS 20027..21967 product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 gene csrD CDS 22272..23315 product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene mreB CDS 23381..24484 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 gene mreC CDS 24484..24972 product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene mreD CDS 24981..25574 product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 gene yhdE CDS 25564..27033 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 gene rng CDS 27101..30901 product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253618.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 gene yhdP sequence26 source 1..30994 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 452..2041 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187566.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene purH CDS 2053..3342 product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866800.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene purD CDS complement(3339..4664) product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene zraR CDS complement(4661..6037) product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211931.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene zraS CDS 6275..6700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS complement(6702..7337) product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299291.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(7410..7682) product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene hupA CDS complement(7869..8459) product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(8502..9173) product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362388.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 gene nfi CDS complement(9183..10247) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137657.1 transl_table 11 codon_start 1 locus_tag LOCUS_18900 gene hemE CDS complement(10287..11060) product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373940.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene nudC CDS 11155..11631 product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene rsd CDS 11864..13759 product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276926.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 gene thiC CDS 13759..14394 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene thiE CDS 14387..15142 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene thiF CDS 15126..15326 product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166230.1 transl_table 11 codon_start 1 locus_tag LOCUS_18960 gene thiS CDS 15328..16098 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944103.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 gene thiG CDS 16095..17228 product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847445.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene thiH CDS complement(17638..18177) product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(18390..22613) product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene rpoC CDS complement(22690..26718) product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 gene rpoB CDS complement(27038..27403) product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19020 gene rplL CDS complement(27470..27967) product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207201.1 transl_table 11 codon_start 1 locus_tag LOCUS_19030 gene rplJ CDS complement(28380..29084) product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene rplA CDS complement(29088..29516) product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene rplK CDS complement(29675..30220) product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 gene nusG CDS complement(30222..30605) product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 gene secE sequence27 source 1..30850 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 note possible pseudo, internal stop codon CDS 977..1249 product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326686.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS 1585..2562 product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993087.1 transl_table 11 codon_start 1 locus_tag LOCUS_19100 gene glaH CDS 2582..3850 product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271909.1 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene lhgO CDS 3873..5321 product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772689.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene gabD CDS 5335..6615 product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087611.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene gabT CDS 6853..8253 product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295173.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene gabP CDS 8274..8936 product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene csiR CDS complement(8937..9386) product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522424.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 gene kbp CDS complement(9470..9628) product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS 9811..10110 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 10120..10644 product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229458.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 gene ygaP CDS complement(10691..11095) product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 gene stpA CDS 11763..12212 product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 transl_table 11 codon_start 1 locus_tag LOCUS_19210 gene alaE CDS complement(12249..12593) product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 12745..13074 product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 13322..13567 product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 gene nrdH CDS 13564..13974 product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene nrdI CDS 13947..16091 product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246520.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene nrdE CDS 16101..17060 product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 transl_table 11 codon_start 1 locus_tag LOCUS_19270 gene nrdF CDS 17415..18617 product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19280 gene proV CDS 18610..19674 product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774996.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 gene proW CDS 19731..20723 product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216527.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 gene proX CDS 21015..22199 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS 22368..23060 product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene ygaZ CDS 23050..23385 product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene ygaH CDS 23476..24006 product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 gene emrR CDS 24133..25305 product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295175.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 gene emrA CDS 25322..26860 product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 transl_table 11 codon_start 1 locus_tag LOCUS_19360 gene emrB CDS complement(26924..27439) product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130210.1 transl_table 11 codon_start 1 locus_tag LOCUS_19370 gene luxS CDS complement(27589..29145) product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene gshA CDS complement(29218..29646) product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(29643..30209) product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273309.1 transl_table 11 codon_start 1 locus_tag LOCUS_19400 gene yqaB tRNA complement(30490..30566) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA complement(30765..30841) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 sequence28 source 1..30324 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(919..1884) product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(2011..2268) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene rpmA CDS complement(2289..2600) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 gene rplU CDS 2859..3830 product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 gene ispB CDS 4058..4336 product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 gene sfsB CDS complement(4384..5643) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19460 gene murA CDS complement(5698..5967) product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene ibaG CDS complement(6112..6405) product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 gene mlaB CDS complement(6405..7040) product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 transl_table 11 codon_start 1 locus_tag LOCUS_19490 gene mlaC CDS complement(7059..7610) product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 gene mlaD CDS complement(7615..8397) product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 gene mlaE CDS complement(8405..9214) product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene mlaF CDS 9424..10401 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 10415..11401 product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene kdsD CDS 11422..11988 product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030016.1 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene kdsC CDS 11985..12560 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 gene lptC CDS 12529..13086 product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 transl_table 11 codon_start 1 locus_tag LOCUS_19570 gene lptA CDS 13093..13818 product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene lptB CDS 13866..15299 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene rpoN CDS 15322..15609 product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene hpf CDS 15727..16218 product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 transl_table 11 codon_start 1 locus_tag LOCUS_19610 gene ptsN CDS 16264..17118 product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene rapZ CDS 17115..17387 product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene npr CDS 17601..18233 product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 transl_table 11 codon_start 1 locus_tag LOCUS_19640 gene yrbL CDS complement(18230..18958) product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene mtgA CDS complement(18955..19608) product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 gene elbB CDS complement(19838..22174) product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 transl_table 11 codon_start 1 locus_tag LOCUS_19670 gene arcB CDS complement(22270..23232) product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176896.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS 23766..28334 product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 gene gltB CDS 28347..29765 product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 gene gltD sequence29 source 1..29762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..1508 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 gene fliD CDS 1531..1923 product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 transl_table 11 codon_start 1 locus_tag LOCUS_19720 gene fliS CDS 1928..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 2236..3297 product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 3305..3772 product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 3792..4508 product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS 4521..5384 product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169518.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene motA CDS 5519..6310 product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232550.1 transl_table 11 codon_start 1 locus_tag LOCUS_19780 gene lafU CDS 6381..7436 product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 gene dinB CDS 7433..7885 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059855.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS 8131..9270 product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS 9267..9881 product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602112.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 gene prfH CDS complement(9938..11395) product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293014.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 gene pepD CDS 11656..12114 product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 gene gpt CDS 12206..13450 product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189558.1 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene frsA CDS 13508..13909 product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 transl_table 11 codon_start 1 locus_tag LOCUS_19860 gene crl CDS complement(13948..15003) product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749863.1 transl_table 11 codon_start 1 locus_tag LOCUS_19870 gene phoE CDS 15291..16394 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 gene proB CDS 16406..17659 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893256.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 gene proA tRNA 17774..17849 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(17864..19027) product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS complement(19254..19559) product protein YfdT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206732.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 gene yfdT CDS complement(19559..19921) product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242717.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 CDS complement(19912..20448) product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008178.1 transl_table 11 codon_start 1 locus_tag LOCUS_19930 gene yfdR CDS 20993..21427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016392.1 transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS complement(21399..21605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549623.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS complement(21945..22637) product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001353346.1 transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 22735..22995 product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191675.1 transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS 22988..23539 product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515837.1 transl_table 11 codon_start 1 locus_tag LOCUS_19980 gene ymfL CDS 23715..23894 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS 23884..24825 product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS 24841..25014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS 25065..25316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS 25316..25969 product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20030 CDS 25966..26292 product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210154.1 transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 26289..26678 product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767129.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 26698..27507 product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061438.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 27515..28504 product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS 28518..29096 product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640143.1 transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence30 source 1..27093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(737..967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS complement(1540..2322) product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295538.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 CDS 2625..3545 product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20120 gene rbsK CDS 3828..4889 product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998350.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 gene fucP CDS 4901..5914 product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107474.1 transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS complement(6832..8088) product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345347.1 transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(8101..8388) product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705930.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 CDS complement(8404..8847) product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916805.1 transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 9118..10149 product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416151.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS complement(10989..12218) product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198472.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(12215..12946) product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091664.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 CDS complement(12946..13410) product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020246.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS complement(13407..14576) product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301690.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS complement(14578..15162) product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 CDS complement(15159..17408) product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180194.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 CDS complement(17446..18051) product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS complement(18048..18470) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930891.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS complement(18474..20150) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115628.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS complement(20141..20494) product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703718.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS complement(20481..21839) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815059.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(21836..22417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(22422..22673) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS complement(22685..22942) product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(22917..23738) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302735.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(23735..24457) product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(24498..25556) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(25621..26010) product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 sequence31 source 1..26344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 574..936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20380 CDS complement(912..1169) product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(1166..1984) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451211.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene aroE CDS complement(1989..2561) product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297709.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 gene tsaC CDS 2656..2892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(3137..3610) product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460680.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 gene smg CDS complement(3582..3890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 note possible pseudo, internal stop codon CDS complement(4029..4706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 note possible pseudo, internal stop codon CDS 4836..5345 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene def CDS 5360..6307 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004454.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene fmt CDS 6353..7642 product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744779.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene rsmB CDS 7664..9040 product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene trkA CDS 9170..9580 product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022442.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene mscL CDS complement(9577..9795) product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 gene arfA CDS complement(9851..10276) product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene zntR CDS complement(10287..10655) product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266486.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(10762..11145) product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene rplQ CDS complement(11186..12175) product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene rpoA CDS complement(12201..12821) product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 gene rpsD CDS complement(12855..13244) product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 gene rpsK CDS complement(13261..13617) product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 gene rpsM CDS complement(13912..15243) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 gene secY CDS complement(15251..15685) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 transl_table 11 codon_start 1 locus_tag LOCUS_20600 gene rplO CDS complement(15689..15868) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 transl_table 11 codon_start 1 locus_tag LOCUS_20610 gene rpmD CDS complement(15872..16375) product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 gene rpsE CDS complement(16390..16743) product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene rplR CDS complement(16753..17286) product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 gene rplF CDS complement(17299..17691) product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 gene rpsH CDS complement(17725..18030) product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 transl_table 11 codon_start 1 locus_tag LOCUS_20660 gene rpsN CDS complement(18045..18584) product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 transl_table 11 codon_start 1 locus_tag LOCUS_20670 gene rplE CDS complement(18599..18913) product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 transl_table 11 codon_start 1 locus_tag LOCUS_20680 gene rplX CDS complement(18924..19295) product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 gene rplN CDS complement(19460..19714) product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 transl_table 11 codon_start 1 locus_tag LOCUS_20700 gene rpsQ CDS complement(19714..19905) product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 transl_table 11 codon_start 1 locus_tag LOCUS_20710 gene rpmC CDS complement(19905..20315) product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 gene rplP CDS complement(20328..21029) product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 transl_table 11 codon_start 1 locus_tag LOCUS_20730 gene rpsC CDS complement(21047..21379) product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 gene rplV CDS complement(21394..21672) product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 transl_table 11 codon_start 1 locus_tag LOCUS_20750 gene rpsS CDS complement(21689..22510) product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 gene rplB CDS complement(22528..22830) product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20770 gene rplW CDS complement(22827..23432) product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 transl_table 11 codon_start 1 locus_tag LOCUS_20780 gene rplD CDS complement(23443..24072) product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 gene rplC CDS complement(24105..24416) product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181004.1 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene rpsJ CDS 24795..25262 product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340167.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS complement(25259..25735) product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675515.1 transl_table 11 codon_start 1 locus_tag LOCUS_20820 gene bfr CDS complement(25808..26002) product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289090.1 transl_table 11 codon_start 1 locus_tag LOCUS_20830 gene bfd sequence32 source 1..25615 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ rRNA 16..126 product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 CDS 455..1753 product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 gene kgtP CDS complement(1750..2022) product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS complement(2119..3477) product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene pssA CDS complement(3588..6248) product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082988.1 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene pat CDS complement(6280..6810) product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138184.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene tapT CDS complement(7047..7466) product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 gene trxC CDS 7673..8710 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS complement(8758..9447) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262716.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene ung CDS 9752..10135 product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 transl_table 11 codon_start 1 locus_tag LOCUS_20920 gene grcA CDS complement(10191..10778) product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene eamB CDS 10881..11762 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386989.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS complement(11971..13305) product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene srmB CDS 13515..14174 product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298974.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene trmN CDS complement(14159..15781) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094498.1 transl_table 11 codon_start 1 locus_tag LOCUS_20970 gene nadB CDS 16189..16764 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 transl_table 11 codon_start 1 locus_tag LOCUS_20980 gene rpoE CDS 16797..17447 product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene rseA CDS 17447..18403 product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene rseB CDS 18400..18879 product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589070.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 gene rseC CDS 19077..20876 product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene lepA CDS 20892..21866 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 gene lepB CDS 22205..22819 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 gene rnc CDS 22816..23721 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020737.1 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene era CDS 23733..24461 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399393.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene recO CDS 24473..25204 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene pdxJ CDS 25204..25584 product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986029.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene acpS sequence33 source 1..24150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..757 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000445164.1:PDDEXK nuclease domain-containing protein locus_tag LOCUS_21090 CDS complement(817..1281) product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979882.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 gene nanQ CDS complement(1278..2153) product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069526.1 transl_table 11 codon_start 1 locus_tag LOCUS_21110 gene nanK CDS complement(2150..2839) product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS complement(2887..4377) product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108473.1 transl_table 11 codon_start 1 locus_tag LOCUS_21130 gene nanT CDS complement(4486..5379) product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 transl_table 11 codon_start 1 locus_tag LOCUS_21140 gene nanA CDS complement(5501..6283) product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene nanR CDS 6672..8039 product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene dcuC CDS complement(8082..8579) product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene sspB CDS complement(8585..9223) product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 gene sspA CDS complement(9618..10010) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 transl_table 11 codon_start 1 locus_tag LOCUS_21190 gene rpsI CDS complement(10026..10454) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 transl_table 11 codon_start 1 locus_tag LOCUS_21200 gene rplM CDS complement(10673..11644) product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192344.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 gene zapE CDS 11988..12392 product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene zapG CDS 12546..13913 product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene degQ CDS 14003..15070 product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497723.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene degS CDS complement(15133..16071) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307415.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 gene mdh CDS 16506..16976 product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene argR CDS 17290..17604 product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene yhcN CDS complement(17660..17932) product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029013.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(18024..19991) product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 transl_table 11 codon_start 1 locus_tag LOCUS_21290 gene aaeB CDS complement(19997..20929) product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854033.1 transl_table 11 codon_start 1 locus_tag LOCUS_21300 gene aaeA CDS complement(20937..21209) product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116614.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 gene aaeX CDS 21323..22252 product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 gene aaeR CDS complement(22386..23831) product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055909.1 transl_table 11 codon_start 1 locus_tag LOCUS_21330 gene tldD sequence34 source 1..23997 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 178..576 product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522196.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 691..1503 product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene yidA CDS complement(1549..2205) product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene yidX CDS 2483..3172 product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene dgoR CDS 3169..4047 product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127112.1 transl_table 11 codon_start 1 locus_tag LOCUS_21380 gene dgoK CDS 4031..4648 product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198730.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 gene dgoA CDS 4645..5793 product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene dgoD CDS 5913..7205 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354284.1 transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(7202..8266) product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 gene cbrA CDS 8367..9581 product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(9583..9843) product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 10221..10634 product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 transl_table 11 codon_start 1 locus_tag LOCUS_21450 gene ibpA CDS 10746..11174 product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 transl_table 11 codon_start 1 locus_tag LOCUS_21460 gene ibpB CDS 11371..13032 product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279752.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(13029..13745) product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300779.1 transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS 14041..15657 product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952141.1 transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 15657..16295 product inactive 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311230.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 16295..16471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(16468..17361) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 17528..19243 product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS 19240..20733 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828483.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(20780..21229) product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511287.1 transl_table 11 codon_start 1 locus_tag LOCUS_21550 gene yidI CDS 21339..21686 product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 21676..22038 product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 22035..22532 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148063.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(22540..23700) product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 gene emrD sequence35 source 1..22406 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(267..1127) product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(1124..1315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 1418..2923 product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS 2935..4860 product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098258.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 gene iolD CDS 5145..6131 product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 transl_table 11 codon_start 1 locus_tag LOCUS_21640 gene iolG CDS 6163..7092 product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098256.1 transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 7144..8691 product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098255.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS 8703..9731 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098254.1 transl_table 11 codon_start 1 locus_tag LOCUS_21670 CDS 9740..10873 product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 10886..12790 product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 gene iolC CDS 12802..13692 product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene iolE CDS 13702..14523 product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 gene iolB CDS complement(15545..15970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(16642..16971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21730 note possible pseudo, internal stop codon, frameshifted CDS 17514..18686 product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 gene istA CDS 18686..19483 product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene istB CDS 20205..20729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 note possible pseudo, internal stop codon, frameshifted CDS 21116..21415 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296472.1 transl_table 11 codon_start 1 locus_tag LOCUS_21770 sequence36 source 1..20741 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(434..1018) product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383554.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(1009..2067) product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163406301.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(2054..2479) product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424732.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS complement(2479..3027) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259080.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 CDS complement(3027..4106) product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(4103..5431) product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS 5542..5988 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(6021..7853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21850 CDS complement(7995..8264) product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316280.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(8264..8620) product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090992.1 transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(8620..10116) product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155695.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 CDS complement(10100..10270) product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497751.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(10279..10839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779294.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 CDS complement(10836..11342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224835.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 CDS complement(11317..11727) product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702391.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(11724..12047) product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927711.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS complement(12050..12250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(12300..13505) product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(13520..14170) product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193633.1 transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(14148..15389) product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS complement(15389..15571) product protein YmfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605606.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 gene ymfR CDS complement(15583..17316) product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS complement(17313..17807) product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929175.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(17933..18283) product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135200.1 transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS complement(18376..18696) product type III secretion system LEE GrlA-binding negative regulator GrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605370.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 gene grlR CDS complement(18943..19335) product DUF2570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309362.1 transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS complement(19332..19946) product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(19946..20227) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226307.1 transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS complement(20214..20609) product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 sequence37 source 1..18042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1008..2696 product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168480.1 transl_table 11 codon_start 1 locus_tag LOCUS_22070 gene ilvB CDS 2700..2990 product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 gene ilvN CDS 3065..3655 product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 gene uhpA CDS 3655..5157 product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330988.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 gene uhpB CDS 5167..6486 product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358267.1 transl_table 11 codon_start 1 locus_tag LOCUS_22110 gene uhpC CDS 6624..8015 product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 gene uhpT CDS complement(8060..9826) product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065695.1 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene adeD CDS 10001..11335 product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349999.1 transl_table 11 codon_start 1 locus_tag LOCUS_22140 gene adeQ CDS 11388..11840 product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS 12051..13241 product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 gene nepI CDS complement(13282..13575) product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 transl_table 11 codon_start 1 locus_tag LOCUS_22170 gene yicS CDS 13797..14615 product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 gene nlpA CDS complement(14619..15542) product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535960.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(15653..16837) product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172876.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(17633..17863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 sequence38 source 1..16491 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..1083) product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349546.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 1101..1805 product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 gene yggS CDS 1823..2389 product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene yggT CDS 2386..2676 product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313260.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 gene yggU CDS 2684..3277 product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174743.1 transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS 3270..4406 product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239939.1 transl_table 11 codon_start 1 locus_tag LOCUS_22270 gene hemW CDS complement(4561..5568) product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745217.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(5685..6731) product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394125.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 gene ansB CDS complement(6907..7626) product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(7810..8136) product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 CDS complement(8136..8855) product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene trmB CDS 9016..10068 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321419.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 gene mutY CDS 10096..10371 product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 CDS 10433..11515 product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760323.1 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene mltC CDS 11717..12973 product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333541.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene nupG CDS complement(13023..15149) product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839815.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 gene speC CDS 15556..16263 product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234514.1 transl_table 11 codon_start 1 locus_tag LOCUS_22380 tRNA 16369..16444 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 sequence39 source 1..13497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(464..697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124181.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS complement(800..958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 note possible pseudo, internal stop codon, frameshifted CDS complement(993..1268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 note possible pseudo, internal stop codon, frameshifted CDS complement(1998..2906) product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024633.1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS 3033..4391 product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194233.1 transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS 4403..5431 product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131688.1 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene gtdA CDS 5447..6148 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196038.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 6154..6801 product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781198.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 gene maiA CDS 6816..8009 product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170147.1 transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS 8359..8499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(8741..8863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS 9192..9881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22500 CDS complement(11027..11617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(11639..11770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22520 note possible pseudo, internal stop codon, frameshifted CDS 11848..12012 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS 12430..12978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 sequence40 source 1..12623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(68..541) product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22550 gene mobB CDS complement(538..1122) product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052174.1 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene mobA CDS 1192..1461 product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 1538..2524 product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065520.1 transl_table 11 codon_start 1 locus_tag LOCUS_22580 gene srkA CDS 2541..3167 product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 gene dsbA CDS 3322..4752 product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333507.1 transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(4793..5536) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303740.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 5571..5789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS complement(5845..6030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010556.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 6089..8875 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene polA CDS complement(9257..9889) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 gene yihA CDS 10471..10980 product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 gene yihI CDS 11169..12542 product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 transl_table 11 codon_start 1 locus_tag LOCUS_22670 gene hemN sequence41 source 1..12380 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 246..458 product type I toxin-antitoxin system toxin HokA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303715.1 transl_table 11 codon_start 1 locus_tag LOCUS_22680 gene hokA CDS complement(646..858) product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene cspA CDS complement(1139..1429) product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS 1863..2573 product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2623..3597) product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 gene ghrB CDS complement(3701..4360) product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS 4567..6846 product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013914.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene bisC CDS complement(6815..7255) product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617478.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 CDS complement(7252..7815) product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene tag CDS 7973..8671 product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296791.1 transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS 8900..10108 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189020.1 transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 10432..12123 product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269228.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 gene eptB tRNA 12215..12291 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 sequence42 source 1..11067 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(82..966) product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 transl_table 11 codon_start 1 locus_tag LOCUS_22800 gene yghA CDS 1157..1651 product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS complement(1691..2731) product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262150.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 gene gpr CDS 2888..3775 product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297303.1 transl_table 11 codon_start 1 locus_tag LOCUS_22830 gene yghX CDS 3894..4181 product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059136.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene yghW CDS 4370..5488 product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 gene hybO CDS 5491..6477 product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene hybA CDS 6467..7645 product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 transl_table 11 codon_start 1 locus_tag LOCUS_22870 gene hybB CDS 7642..9345 product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083065.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 gene hybC CDS 9345..9839 product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 CDS 9832..10320 product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene hybE CDS 10313..10654 product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544953.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene hypA CDS 10667..10915 product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene hybG sequence43 source 1..10819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..532) product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558209.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 CDS complement(670..2298) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene groL CDS complement(2342..2635) product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 2911..4167 product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015837.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 gene yjeH CDS complement(4183..4659) product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene fxsA CDS 4996..6432 product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069437.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 gene aspA CDS 6550..7851 product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 gene dcuA CDS 7967..8305 product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 transl_table 11 codon_start 1 locus_tag LOCUS_23000 gene cutA CDS 8281..9978 product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068978.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 gene dsbD CDS 10015..10590 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 tRNA 10697..10772 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence44 source 1..10388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 157..1416 product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076236.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 gene codB CDS 1406..2689 product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309292.1 transl_table 11 codon_start 1 locus_tag LOCUS_23040 gene codA CDS complement(2729..3628) product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952470.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 gene cynR CDS 3738..4397 product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658652.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene cynT CDS 4428..4898 product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616241.1 transl_table 11 codon_start 1 locus_tag LOCUS_23070 gene cynS CDS 4931..6085 product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927955.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 gene cynX CDS complement(6164..7417) product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291549.1 transl_table 11 codon_start 1 locus_tag LOCUS_23090 gene lacY misc_feature complement(7469..>10388) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000177906.1:beta-galactosidase locus_tag LOCUS_23100 sequence45 source 1..9639 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..564 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000044314.1:acetaldehyde dehydrogenase locus_tag LOCUS_23110 CDS 561..1574 product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 gene dmpG CDS 1750..2961 product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107624.1 transl_table 11 codon_start 1 locus_tag LOCUS_23130 gene mhpT CDS 3063..3602 product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096705.1 transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS complement(3827..4660) product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419049.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 gene fghA CDS complement(4753..5862) product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 gene frmA CDS complement(5897..6172) product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 gene frmR CDS complement(6357..7130) product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596085.1 transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(7132..7572) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088545487.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS complement(7691..8887) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860444.1 transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(8897..9514) product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362029.1 transl_table 11 codon_start 1 locus_tag LOCUS_23210 sequence46 source 1..9105 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 754..2361 product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 gene dppA CDS 2512..3531 product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938855.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene dppB CDS 3541..4443 product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 transl_table 11 codon_start 1 locus_tag LOCUS_23240 gene dppC CDS 4454..5437 product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 transl_table 11 codon_start 1 locus_tag LOCUS_23250 gene dppD CDS 5434..6438 product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107024.1 transl_table 11 codon_start 1 locus_tag LOCUS_23260 gene dppF CDS complement(6468..7739) product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307456.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 8155..8322 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 note possible pseudo, internal stop codon sequence47 source 1..8425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 238..756 product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS 746..1972 product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969032.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 gene dgcN CDS 1988..2470 product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589828.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(2547..2894) product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene rplS CDS complement(2936..3703) product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23330 gene trmD CDS complement(3734..4282) product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 transl_table 11 codon_start 1 locus_tag LOCUS_23340 gene rimM CDS complement(4301..4549) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 gene rpsP CDS complement(4798..6159) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 gene ffh CDS complement(6272..6508) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 6422..7117 product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338897.1 transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 7162..8424 product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 transl_table 11 codon_start 1 locus_tag LOCUS_23390 sequence48 source 1..7671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(201..773) product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140174.1 transl_table 11 codon_start 1 locus_tag LOCUS_23400 gene gmhB CDS 961..1992 product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 gene metN CDS 1985..2638 product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 2678..3493 product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 gene metQ CDS 3611..4015 product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 transl_table 11 codon_start 1 locus_tag LOCUS_23440 gene rcsF CDS 4012..4719 product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 CDS 4831..6549 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 gene proS CDS 6603..7184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 note possible pseudo, frameshifted CDS 7190..7426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 note possible pseudo, frameshifted sequence49 source 1..7638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(51..179) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS complement(344..649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS complement(756..1847) product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307621.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 gene lacI CDS complement(1915..2748) product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303819.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS 2939..4603 product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007420.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 4605..5549 product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 gene mhpB CDS 5567..6433 product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene mhpC CDS 6443..7252 product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160710.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene mhpD sequence50 source 1..4591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(466..541) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 tRNA complement(548..622) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 tRNA complement(739..823) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 tRNA complement(832..907) product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS 1293..2219 product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene coaA CDS complement(2248..3213) product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654614.1 transl_table 11 codon_start 1 locus_tag LOCUS_23580 gene birA CDS complement(3210..4238) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016695.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene murB sequence51 source 1..4513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..676 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000030657.1:cell envelope integrity protein TolA locus_tag LOCUS_23600 CDS 809..2101 product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 transl_table 11 codon_start 1 locus_tag LOCUS_23610 gene tolB CDS 2136..2657 product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 transl_table 11 codon_start 1 locus_tag LOCUS_23620 gene pal CDS 2667..3458 product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097580.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 gene cpoB tRNA 3623..3698 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA 3834..3909 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 tRNA 3912..3987 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 tRNA 4137..4212 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 4216..4291 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 4438..4513 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 sequence52 source 1..4289 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..1296 product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006983.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 1364..1726 product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816883.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 1735..3093 product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 CDS 3109..4215 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 transl_table 11 codon_start 1 locus_tag LOCUS_23670 sequence53 source 1..4143 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..1287 product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007011.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS 1298..1651 product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297518.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 1663..2967 product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366862.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 CDS 2979..4064 product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 sequence54 source 1..2470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1217..>2470) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001297242.1:ornithine decarboxylase SpeF locus_tag LOCUS_23720 sequence55 source 1..1831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(230..616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 misc_feature complement(613..>1831) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098820.1:contact-dependent inhibition effector 16S rRNA endonuclease locus_tag LOCUS_23740