>Feature sequence01 639 223 gene locus_tag LOCUS_00010 gene ruvX 639 223 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017103.1 protein_id gnl|my_center|LOCUS_00010 1202 639 gene locus_tag LOCUS_00020 1202 639 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053178.1 protein_id gnl|my_center|LOCUS_00020 2261 1311 gene locus_tag LOCUS_00030 gene gshB 2261 1311 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593273.1 protein_id gnl|my_center|LOCUS_00030 3005 2274 gene locus_tag LOCUS_00040 gene rsmE 3005 2274 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222508.1 protein_id gnl|my_center|LOCUS_00040 3792 3085 gene locus_tag LOCUS_00050 gene endA 3792 3085 CDS product deoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286500.1 protein_id gnl|my_center|LOCUS_00050 4342 3887 gene locus_tag LOCUS_00060 4342 3887 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858396.1 protein_id gnl|my_center|LOCUS_00060 5855 4461 gene locus_tag LOCUS_00070 gene galP 5855 4461 CDS product galactose/proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112301.1 protein_id gnl|my_center|LOCUS_00070 7445 6291 gene locus_tag LOCUS_00080 gene metK 7445 6291 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062128.1 protein_id gnl|my_center|LOCUS_00080 8318 10216 gene locus_tag LOCUS_00090 gene speA 8318 10216 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295380.1 protein_id gnl|my_center|LOCUS_00090 10362 11093 gene locus_tag LOCUS_00100 10362 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758915.1 protein_id gnl|my_center|LOCUS_00100 11229 12149 gene locus_tag LOCUS_00110 gene speB 11229 12149 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105559.1 protein_id gnl|my_center|LOCUS_00110 13113 12355 gene locus_tag LOCUS_00120 gene loiP 13113 12355 CDS product metalloprotease LoiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701841.1 protein_id gnl|my_center|LOCUS_00120 13391 15382 gene locus_tag LOCUS_00130 gene tkt 13391 15382 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098614.1 protein_id gnl|my_center|LOCUS_00130 15696 16139 gene locus_tag LOCUS_00140 gene cmtB 15696 16139 CDS product PTS mannitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239650.1 protein_id gnl|my_center|LOCUS_00140 16167 17555 gene locus_tag LOCUS_00150 gene cmtA 16167 17555 CDS product PTS mannitol transporter subunit IICB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428817.1 protein_id gnl|my_center|LOCUS_00150 17570 18847 gene locus_tag LOCUS_00160 17570 18847 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853221.1 protein_id gnl|my_center|LOCUS_00160 18844 19809 gene locus_tag LOCUS_00170 gene glpX 18844 19809 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987277.1 protein_id gnl|my_center|LOCUS_00170 19831 20340 gene locus_tag LOCUS_00180 gene fumE 19831 20340 CDS product fumarase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224138.1 protein_id gnl|my_center|LOCUS_00180 20337 21050 gene locus_tag LOCUS_00190 20337 21050 CDS product nucleoside/nucleotide kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687768.1 protein_id gnl|my_center|LOCUS_00190 21699 21022 gene locus_tag LOCUS_00200 21699 21022 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956868.1 protein_id gnl|my_center|LOCUS_00200 22370 21693 gene locus_tag LOCUS_00210 22370 21693 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256969.1 protein_id gnl|my_center|LOCUS_00210 23065 22358 gene locus_tag LOCUS_00220 23065 22358 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553215.1 protein_id gnl|my_center|LOCUS_00220 23644 23066 gene locus_tag LOCUS_00230 23644 23066 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124312.1 protein_id gnl|my_center|LOCUS_00230 24098 23667 gene locus_tag LOCUS_00240 24098 23667 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988693.1 protein_id gnl|my_center|LOCUS_00240 24470 25489 gene locus_tag LOCUS_00250 gene epd 24470 25489 CDS product erythrose-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218480.1 protein_id gnl|my_center|LOCUS_00250 25539 26702 gene locus_tag LOCUS_00260 gene pgk 25539 26702 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111269.1 protein_id gnl|my_center|LOCUS_00260 26917 27996 gene locus_tag LOCUS_00270 gene fbaA 26917 27996 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034372.1 protein_id gnl|my_center|LOCUS_00270 28354 29214 gene locus_tag LOCUS_00280 gene mscS 28354 29214 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389818.1 protein_id gnl|my_center|LOCUS_00280 29353 29988 gene locus_tag LOCUS_00290 gene argO 29353 29988 CDS product arginine exporter ArgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493346.1 protein_id gnl|my_center|LOCUS_00290 30081 30821 gene locus_tag LOCUS_00300 30081 30821 CDS product oxidative stress defense protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669834.1 protein_id gnl|my_center|LOCUS_00300 30988 31884 gene locus_tag LOCUS_00310 30988 31884 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350807.1 protein_id gnl|my_center|LOCUS_00310 33359 31881 gene locus_tag LOCUS_00320 gene scpC 33359 31881 CDS product propionyl-CoA:succinate CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449948.1 protein_id gnl|my_center|LOCUS_00320 34168 33383 gene locus_tag LOCUS_00330 gene scpB 34168 33383 CDS product methylmalonyl-CoA decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122080.1 protein_id gnl|my_center|LOCUS_00330 35174 34179 gene locus_tag LOCUS_00340 gene meaB 35174 34179 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606525.1 protein_id gnl|my_center|LOCUS_00340 37311 35167 gene locus_tag LOCUS_00350 gene scpA 37311 35167 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073261.1 protein_id gnl|my_center|LOCUS_00350 38408 37515 gene locus_tag LOCUS_00360 gene argP 38408 37515 CDS product DNA-binding transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828351.1 protein_id gnl|my_center|LOCUS_00360 38550 38780 gene locus_tag LOCUS_00370 38550 38780 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545308.1 protein_id gnl|my_center|LOCUS_00370 38836 39495 gene locus_tag LOCUS_00380 gene rpiA 38836 39495 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189743.1 protein_id gnl|my_center|LOCUS_00380 39751 40983 gene locus_tag LOCUS_00390 gene serA 39751 40983 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151604.1 protein_id gnl|my_center|LOCUS_00390 42312 41764 gene locus_tag LOCUS_00400 42312 41764 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621065.1 protein_id gnl|my_center|LOCUS_00400 42941 42612 gene locus_tag LOCUS_00410 gene zapA 42941 42612 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276008.1 protein_id gnl|my_center|LOCUS_00410 43109 43687 gene locus_tag LOCUS_00420 gene ygfB 43109 43687 CDS product UPF0149 family protein YgfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295378.1 protein_id gnl|my_center|LOCUS_00420 43713 45038 gene locus_tag LOCUS_00430 gene pepP 43713 45038 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290106.1 protein_id gnl|my_center|LOCUS_00430 45035 46213 gene locus_tag LOCUS_00440 gene ubiH 45035 46213 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111174.1 protein_id gnl|my_center|LOCUS_00440 46236 47438 gene locus_tag LOCUS_00450 gene ubiI 46236 47438 CDS product FAD-dependent 2-octaprenylphenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192185.1 protein_id gnl|my_center|LOCUS_00450 47885 48979 gene locus_tag LOCUS_00460 gene gcvT 47885 48979 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068701.1 protein_id gnl|my_center|LOCUS_00460 49003 49392 gene locus_tag LOCUS_00470 gene gcvH 49003 49392 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295377.1 protein_id gnl|my_center|LOCUS_00470 49511 52384 gene locus_tag LOCUS_00480 gene gcvP 49511 52384 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195023.1 protein_id gnl|my_center|LOCUS_00480 52650 53393 gene locus_tag LOCUS_00490 52650 53393 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951964.1 protein_id gnl|my_center|LOCUS_00490 54883 53450 gene locus_tag LOCUS_00500 gene bglA 54883 53450 CDS product 6-phospho-beta-glucosidase BglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387034.1 protein_id gnl|my_center|LOCUS_00500 54928 55239 gene locus_tag LOCUS_00510 gene yqfB 54928 55239 CDS product N(4)-acetylcytidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182954.1 protein_id gnl|my_center|LOCUS_00510 55403 56062 gene locus_tag LOCUS_00520 55403 56062 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250274.1 protein_id gnl|my_center|LOCUS_00520 57238 56258 gene locus_tag LOCUS_00530 gene ygfZ 57238 56258 CDS product tRNA-modifying protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886062.1 protein_id gnl|my_center|LOCUS_00530 57481 57747 gene locus_tag LOCUS_00540 gene sdhE 57481 57747 CDS product FAD assembly factor SdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354046.1 protein_id gnl|my_center|LOCUS_00540 57728 58135 gene locus_tag LOCUS_00550 57728 58135 CDS product protein YgfX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244772.1 protein_id gnl|my_center|LOCUS_00550 58696 58175 gene locus_tag LOCUS_00560 gene fldB 58696 58175 CDS product flavodoxin FldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055874.1 protein_id gnl|my_center|LOCUS_00560 58808 59704 gene locus_tag LOCUS_00570 gene xerD 58808 59704 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806638.1 protein_id gnl|my_center|LOCUS_00570 59729 60439 gene locus_tag LOCUS_00580 gene dsbC 59729 60439 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715208.1 protein_id gnl|my_center|LOCUS_00580 60445 62178 gene locus_tag LOCUS_00590 gene recJ 60445 62178 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813220.1 protein_id gnl|my_center|LOCUS_00590 62486 63367 gene locus_tag LOCUS_00600 gene prfB 62486 63367 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001701073.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00600 63377 64894 gene locus_tag LOCUS_00610 gene lysS 63377 64894 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003071.1 protein_id gnl|my_center|LOCUS_00610 65485 64937 gene locus_tag LOCUS_00620 gene idi 65485 64937 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192814.1 protein_id gnl|my_center|LOCUS_00620 67183 65735 gene locus_tag LOCUS_00630 gene uacT 67183 65735 CDS product urate/proton symporter UacT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295374.1 protein_id gnl|my_center|LOCUS_00630 67928 69538 gene locus_tag LOCUS_00640 gene ygfT 67928 69538 CDS product formate-dependent uric acid utilization protein YgfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350545.1 protein_id gnl|my_center|LOCUS_00640 69538 70026 gene locus_tag LOCUS_00650 69538 70026 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838428.1 protein_id gnl|my_center|LOCUS_00650 71429 70062 gene locus_tag LOCUS_00660 gene ghxQ 71429 70062 CDS product guanine/hypoxanthine transporter GhxQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012163.1 protein_id gnl|my_center|LOCUS_00660 72781 71465 gene locus_tag LOCUS_00670 gene guaD 72781 71465 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295158.1 protein_id gnl|my_center|LOCUS_00670 74199 72799 gene locus_tag LOCUS_00680 gene xanQ 74199 72799 CDS product xanthine/proton symporter XanQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280192.1 protein_id gnl|my_center|LOCUS_00680 77234 74364 gene locus_tag LOCUS_00690 77234 74364 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583615.1 protein_id gnl|my_center|LOCUS_00690 78010 77231 gene locus_tag LOCUS_00700 gene ygfM 78010 77231 CDS product molybdopterin-dependent oxidoreductase FAD-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572462.1 protein_id gnl|my_center|LOCUS_00700 79389 78061 gene locus_tag LOCUS_00710 gene ssnA 79389 78061 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906276.1 protein_id gnl|my_center|LOCUS_00710 82490 79392 gene locus_tag LOCUS_00720 gene ygfK 82490 79392 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502395.1 protein_id gnl|my_center|LOCUS_00720 83390 82812 gene locus_tag LOCUS_00730 gene mocA 83390 82812 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272856.1 protein_id gnl|my_center|LOCUS_00730 83784 84263 gene locus_tag LOCUS_00740 83784 84263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 84311 85936 gene locus_tag LOCUS_00750 gene yqeB 84311 85936 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020377.1 protein_id gnl|my_center|LOCUS_00750 86909 85977 gene locus_tag LOCUS_00760 gene arcC 86909 85977 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037992.1 protein_id gnl|my_center|LOCUS_00760 88342 86957 gene locus_tag LOCUS_00770 gene hyuA 88342 86957 CDS product D-phenylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264447.1 protein_id gnl|my_center|LOCUS_00770 89606 88395 gene locus_tag LOCUS_00780 89606 88395 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107117.1 protein_id gnl|my_center|LOCUS_00780 90860 89664 gene locus_tag LOCUS_00790 gene dpaL 90860 89664 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110493.1 protein_id gnl|my_center|LOCUS_00790 92105 90918 gene locus_tag LOCUS_00800 gene ygeW 92105 90918 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303128.1 protein_id gnl|my_center|LOCUS_00800 92584 94362 gene locus_tag LOCUS_00810 92584 94362 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417808.1 protein_id gnl|my_center|LOCUS_00810 94881 94402 gene locus_tag LOCUS_00820 gene xdhC 94881 94402 CDS product xanthine dehydrogenase iron sulfur-binding subunit XdhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016606.1 protein_id gnl|my_center|LOCUS_00820 95756 94878 gene locus_tag LOCUS_00830 gene xdhB 95756 94878 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459182.1 protein_id gnl|my_center|LOCUS_00830 98064 95767 gene locus_tag LOCUS_00840 gene xdhA 98064 95767 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388150.1 protein_id gnl|my_center|LOCUS_00840 98479 99234 gene locus_tag LOCUS_00850 gene actS 98479 99234 CDS product amidase activator ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272558.1 protein_id gnl|my_center|LOCUS_00850 99313 99386 gene locus_tag LOCUS_t00010 99313 99386 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 99620 101230 gene locus_tag LOCUS_00860 99620 101230 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676943.1 protein_id gnl|my_center|LOCUS_00860 101362 101727 gene locus_tag LOCUS_00870 101362 101727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00870 101788 102309 gene locus_tag LOCUS_00880 101788 102309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00880 102299 102964 gene locus_tag LOCUS_00890 102299 102964 CDS product EscR/YscR/HrcR family type III secretion system export apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071545.1 protein_id gnl|my_center|LOCUS_00890 102974 103159 gene locus_tag LOCUS_00900 102974 103159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 103235 104002 gene locus_tag LOCUS_00910 gene sctT 103235 104002 CDS product type III secretion system export apparatus subunit SctT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503284.1 protein_id gnl|my_center|LOCUS_00910 104011 104742 gene locus_tag LOCUS_00920 104011 104742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00920 104769 105131 gene locus_tag LOCUS_00930 104769 105131 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834139.1 protein_id gnl|my_center|LOCUS_00930 105485 105192 gene locus_tag LOCUS_00940 105485 105192 CDS product invasion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060557.1 protein_id gnl|my_center|LOCUS_00940 105987 105487 gene locus_tag LOCUS_00950 105987 105487 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195871.1 protein_id gnl|my_center|LOCUS_00950 106245 107426 gene locus_tag LOCUS_00960 106245 107426 CDS product PrgH/EprH family type III secretion apparatus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317292.1 protein_id gnl|my_center|LOCUS_00960 107440 107595 gene locus_tag LOCUS_00970 107440 107595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307375.1 protein_id gnl|my_center|LOCUS_00970 107772 107987 gene locus_tag LOCUS_00980 gene sctI 107772 107987 CDS product type III secretion system inner rod subunit SctI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566300.1 protein_id gnl|my_center|LOCUS_00980 108091 108762 gene locus_tag LOCUS_00990 108091 108762 CDS product EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875234.1 protein_id gnl|my_center|LOCUS_00990 108778 109359 gene locus_tag LOCUS_01000 108778 109359 CDS product type III secretion apparatus protein OrgA/MxiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341846.1 protein_id gnl|my_center|LOCUS_01000 109575 110006 gene locus_tag LOCUS_01010 109575 110006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299900.1 protein_id gnl|my_center|LOCUS_01010 110227 110382 gene locus_tag LOCUS_01020 110227 110382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01020 110413 110859 gene locus_tag LOCUS_01030 110413 110859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01030 111278 110904 gene locus_tag LOCUS_01040 111278 110904 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001336167.1 protein_id gnl|my_center|LOCUS_01040 111681 111463 gene locus_tag LOCUS_01050 gene ygeI 111681 111463 CDS product protein YgeI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184091.1 protein_id gnl|my_center|LOCUS_01050 113225 111849 gene locus_tag LOCUS_01060 gene ygeH 113225 111849 CDS product HilA family transcriptional regulator YgeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362702.1 protein_id gnl|my_center|LOCUS_01060 114051 113560 gene locus_tag LOCUS_01070 114051 113560 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102786.1 protein_id gnl|my_center|LOCUS_01070 114766 114329 gene locus_tag LOCUS_01080 114766 114329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804528.1 protein_id gnl|my_center|LOCUS_01080 114960 115385 gene locus_tag LOCUS_01090 gene yqeK 114960 115385 CDS product protein YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350591.1 protein_id gnl|my_center|LOCUS_01090 116016 115534 gene locus_tag LOCUS_01100 gene yqeJ 116016 115534 CDS product protein YqeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568339.1 protein_id gnl|my_center|LOCUS_01100 116629 116009 gene locus_tag LOCUS_01110 116629 116009 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001345937.1 protein_id gnl|my_center|LOCUS_01110 117670 117152 gene locus_tag LOCUS_01120 117670 117152 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305805.1 protein_id gnl|my_center|LOCUS_01120 119473 118244 gene locus_tag LOCUS_01130 119473 118244 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065950.1 protein_id gnl|my_center|LOCUS_01130 119728 120909 gene locus_tag LOCUS_01140 119728 120909 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656030.1 protein_id gnl|my_center|LOCUS_01140 121196 122032 gene locus_tag LOCUS_01150 gene kduI 121196 122032 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383224.1 protein_id gnl|my_center|LOCUS_01150 122062 122823 gene locus_tag LOCUS_01160 gene kduD 122062 122823 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000603508.1 protein_id gnl|my_center|LOCUS_01160 123198 124556 gene locus_tag LOCUS_01170 gene araE 123198 124556 CDS product arabinose-proton symporter AraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256438.1 protein_id gnl|my_center|LOCUS_01170 124685 125377 gene locus_tag LOCUS_01180 gene ygeA 124685 125377 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848664.1 protein_id gnl|my_center|LOCUS_01180 126299 125364 gene locus_tag LOCUS_01190 gene lysR 126299 125364 CDS product DNA-binding transcriptional regulator LysR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741827.1 protein_id gnl|my_center|LOCUS_01190 126421 127683 gene locus_tag LOCUS_01200 gene lysA 126421 127683 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120711.1 protein_id gnl|my_center|LOCUS_01200 128721 127690 gene locus_tag LOCUS_01210 gene galR 128721 127690 CDS product HTH-type transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201048.1 protein_id gnl|my_center|LOCUS_01210 129307 131466 gene locus_tag LOCUS_01220 gene aas 129307 131466 CDS product bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899069.1 protein_id gnl|my_center|LOCUS_01220 131459 132652 gene locus_tag LOCUS_01230 gene lplT 131459 132652 CDS product lysophospholipid transporter LplT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004616.1 protein_id gnl|my_center|LOCUS_01230 133724 132684 gene locus_tag LOCUS_01240 133724 132684 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199295.1 protein_id gnl|my_center|LOCUS_01240 134050 133832 gene locus_tag LOCUS_01250 gene ygdR 134050 133832 CDS product lipoprotein YgdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758655.1 protein_id gnl|my_center|LOCUS_01250 134901 134188 gene locus_tag LOCUS_01260 134901 134188 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895624.1 protein_id gnl|my_center|LOCUS_01260 135659 134970 gene locus_tag LOCUS_01270 gene mutH 135659 134970 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082188.1 protein_id gnl|my_center|LOCUS_01270 136032 135838 gene locus_tag LOCUS_01280 136032 135838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 136344 136874 gene locus_tag LOCUS_01290 gene rppH 136344 136874 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564489.1 protein_id gnl|my_center|LOCUS_01290 136887 139133 gene locus_tag LOCUS_01300 gene ptsP 136887 139133 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000957914.1 protein_id gnl|my_center|LOCUS_01300 139284 140159 gene locus_tag LOCUS_01310 gene lgt 139284 140159 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204658.1 protein_id gnl|my_center|LOCUS_01310 140166 140960 gene locus_tag LOCUS_01320 gene thyA 140166 140960 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816232.1 protein_id gnl|my_center|LOCUS_01320 141145 141615 gene locus_tag LOCUS_01330 141145 141615 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857051.1 protein_id gnl|my_center|LOCUS_01330 141606 142169 gene locus_tag LOCUS_01340 141606 142169 CDS product prepilin peptidase-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144322.1 protein_id gnl|my_center|LOCUS_01340 142166 142573 gene locus_tag LOCUS_01350 142166 142573 CDS product DUF2509 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078393.1 protein_id gnl|my_center|LOCUS_01350 142558 142881 gene locus_tag LOCUS_01360 142558 142881 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276476.1 protein_id gnl|my_center|LOCUS_01360 142894 146262 gene locus_tag LOCUS_01370 gene recC 142894 146262 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946938.1 protein_id gnl|my_center|LOCUS_01370 146438 149326 gene locus_tag LOCUS_01380 gene ptrA 146438 149326 CDS product pitrilysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138213.1 protein_id gnl|my_center|LOCUS_01380 149319 152861 gene locus_tag LOCUS_01390 gene recB 149319 152861 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285993.1 protein_id gnl|my_center|LOCUS_01390 152861 154687 gene locus_tag LOCUS_01400 gene recD 152861 154687 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775955.1 protein_id gnl|my_center|LOCUS_01400 156080 154749 gene locus_tag LOCUS_01410 gene argA 156080 154749 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237947.1 protein_id gnl|my_center|LOCUS_01410 156369 157565 gene locus_tag LOCUS_01420 gene amiC 156369 157565 CDS product N-acetylmuramoyl-L-alanine amidase AmiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016907.1 protein_id gnl|my_center|LOCUS_01420 157716 157640 gene locus_tag LOCUS_t00020 157716 157640 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 157826 157750 gene locus_tag LOCUS_t00030 157826 157750 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 157936 157860 gene locus_tag LOCUS_t00040 157936 157860 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 158175 159242 gene locus_tag LOCUS_01430 gene mltA 158175 159242 CDS product murein transglycosylase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678646.1 protein_id gnl|my_center|LOCUS_01430 159319 160125 gene locus_tag LOCUS_01440 gene tcdA 159319 160125 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117728.1 protein_id gnl|my_center|LOCUS_01440 160619 160176 gene locus_tag LOCUS_01450 gene csdE 160619 160176 CDS product cysteine desulfurase sulfur acceptor subunit CsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184254.1 protein_id gnl|my_center|LOCUS_01450 161824 160619 gene locus_tag LOCUS_01460 gene csdA 161824 160619 CDS product cysteine desulfurase CsdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300698.1 protein_id gnl|my_center|LOCUS_01460 162016 162243 gene locus_tag LOCUS_01470 162016 162243 CDS product YgdI/YgdR family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750398.1 protein_id gnl|my_center|LOCUS_01470 162594 163511 gene locus_tag LOCUS_01480 gene gcvA 162594 163511 CDS product glycine cleavage system transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044401.1 protein_id gnl|my_center|LOCUS_01480 163530 163925 gene locus_tag LOCUS_01490 163530 163925 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203905.1 protein_id gnl|my_center|LOCUS_01490 163918 165018 gene locus_tag LOCUS_01500 gene rlmM 163918 165018 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045520.1 protein_id gnl|my_center|LOCUS_01500 165793 165062 gene locus_tag LOCUS_01510 gene fucR 165793 165062 CDS product L-fucose operon activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642344.1 protein_id gnl|my_center|LOCUS_01510 166273 165851 gene locus_tag LOCUS_01520 gene fucU 166273 165851 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920840.1 protein_id gnl|my_center|LOCUS_01520 167693 166275 gene locus_tag LOCUS_01530 gene fucK 167693 166275 CDS product L-fuculokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808376.1 protein_id gnl|my_center|LOCUS_01530 169577 167802 gene locus_tag LOCUS_01540 gene fucI 169577 167802 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724153.1 protein_id gnl|my_center|LOCUS_01540 170926 169610 gene locus_tag LOCUS_01550 gene fucP 170926 169610 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528603.1 protein_id gnl|my_center|LOCUS_01550 171473 172120 gene locus_tag LOCUS_01560 gene fucA 171473 172120 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440782.1 protein_id gnl|my_center|LOCUS_01560 172148 173296 gene locus_tag LOCUS_01570 gene fucO 172148 173296 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_01570 174106 173351 gene locus_tag LOCUS_01580 gene xni 174106 173351 CDS product flap endonuclease Xni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268232.1 protein_id gnl|my_center|LOCUS_01580 175585 174218 gene locus_tag LOCUS_01590 gene sdaB 175585 174218 CDS product L-serine ammonia-lyase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626410.1 protein_id gnl|my_center|LOCUS_01590 176932 175643 gene locus_tag LOCUS_01600 gene sdaC 176932 175643 CDS product HAAAP family serine/threonine permease SdaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450476.1 protein_id gnl|my_center|LOCUS_01600 178853 177489 gene locus_tag LOCUS_01610 gene ppnN 178853 177489 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627995.1 protein_id gnl|my_center|LOCUS_01610 179813 178965 gene locus_tag LOCUS_01620 gene queF 179813 178965 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100430.1 protein_id gnl|my_center|LOCUS_01620 179881 180426 gene locus_tag LOCUS_01630 gene syd 179881 180426 CDS product SecY-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342431.1 protein_id gnl|my_center|LOCUS_01630 181048 181377 gene locus_tag LOCUS_01640 181048 181377 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206990.1 protein_id gnl|my_center|LOCUS_01640 181377 182159 gene locus_tag LOCUS_01650 gene truC 181377 182159 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000890001.1 protein_id gnl|my_center|LOCUS_01650 182177 182626 gene locus_tag LOCUS_01660 182177 182626 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807753.1 protein_id gnl|my_center|LOCUS_01660 183061 184413 gene locus_tag LOCUS_01670 gene gudP 183061 184413 CDS product galactarate/glucarate/glycerate transporter GudP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097082.1 protein_id gnl|my_center|LOCUS_01670 184415 185755 gene locus_tag LOCUS_01680 184415 185755 CDS product enolase C-terminal domain-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211753.1 protein_id gnl|my_center|LOCUS_01680 185776 187116 gene locus_tag LOCUS_01690 gene gudD 185776 187116 CDS product glucarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098237.1 protein_id gnl|my_center|LOCUS_01690 190104 187348 gene locus_tag LOCUS_01700 gene barA 190104 187348 CDS product two-component sensor histidine kinase BarA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186450.1 protein_id gnl|my_center|LOCUS_01700 190161 191462 gene locus_tag LOCUS_01710 gene rlmD 190161 191462 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046785.1 protein_id gnl|my_center|LOCUS_01710 191510 193744 gene locus_tag LOCUS_01720 191510 193744 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226815.1 protein_id gnl|my_center|LOCUS_01720 193822 194070 gene locus_tag LOCUS_01730 gene mazE 193822 194070 CDS product type II toxin-antitoxin system antitoxin MazE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581937.1 protein_id gnl|my_center|LOCUS_01730 194070 194405 gene locus_tag LOCUS_01740 gene mazF 194070 194405 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254745.1 protein_id gnl|my_center|LOCUS_01740 194476 195267 gene locus_tag LOCUS_01750 gene mazG 194476 195267 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071648.1 protein_id gnl|my_center|LOCUS_01750 195495 197132 gene locus_tag LOCUS_01760 gene pyrG 195495 197132 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210878.1 protein_id gnl|my_center|LOCUS_01760 197220 198518 gene locus_tag LOCUS_01770 gene eno 197220 198518 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036723.1 protein_id gnl|my_center|LOCUS_01770 199282 198578 gene locus_tag LOCUS_01780 199282 198578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01780 199604 199464 gene locus_tag LOCUS_01790 gene yqcG 199604 199464 CDS product cell envelope stress response protein YqcG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288227.1 protein_id gnl|my_center|LOCUS_01790 199743 200414 gene locus_tag LOCUS_01800 gene queE 199743 200414 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199973.1 protein_id gnl|my_center|LOCUS_01800 200754 200904 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagttccccgcgccagcggggataaaccg >Feature sequence02 1369 50 gene locus_tag LOCUS_01810 gene dacB 1369 50 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212619.1 protein_id gnl|my_center|LOCUS_01810 1731 2207 gene locus_tag LOCUS_01820 gene greA 1731 2207 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148001.1 protein_id gnl|my_center|LOCUS_01820 2656 2363 gene locus_tag LOCUS_01830 gene yhbY 2656 2363 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054420.1 protein_id gnl|my_center|LOCUS_01830 2782 3411 gene locus_tag LOCUS_01840 gene rlmE 2782 3411 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145975.1 protein_id gnl|my_center|LOCUS_01840 3502 5445 gene locus_tag LOCUS_01850 gene ftsH 3502 5445 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107467.1 protein_id gnl|my_center|LOCUS_01850 5535 6383 gene locus_tag LOCUS_01860 gene folP 5535 6383 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311155.1 protein_id gnl|my_center|LOCUS_01860 6376 7713 gene locus_tag LOCUS_01870 gene glmM 6376 7713 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071134.1 protein_id gnl|my_center|LOCUS_01870 7941 8273 gene locus_tag LOCUS_01880 gene secG 7941 8273 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295556.1 protein_id gnl|my_center|LOCUS_01880 8288 8374 gene locus_tag LOCUS_t00050 8288 8374 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9271 10458 gene locus_tag LOCUS_01890 9271 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 11809 10466 gene locus_tag LOCUS_01900 gene argG 11809 10466 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207685.1 protein_id gnl|my_center|LOCUS_01900 12157 12233 gene locus_tag LOCUS_t00060 12157 12233 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12470 12892 gene locus_tag LOCUS_01910 gene rimP 12470 12892 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296446.1 protein_id gnl|my_center|LOCUS_01910 12920 14407 gene locus_tag LOCUS_01920 gene nusA 12920 14407 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031055.1 protein_id gnl|my_center|LOCUS_01920 14432 17104 gene locus_tag LOCUS_01930 gene infB 14432 17104 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133044.1 protein_id gnl|my_center|LOCUS_01930 17268 17669 gene locus_tag LOCUS_01940 gene rbfA 17268 17669 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040205.1 protein_id gnl|my_center|LOCUS_01940 17669 18613 gene locus_tag LOCUS_01950 gene truB 17669 18613 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089698.1 protein_id gnl|my_center|LOCUS_01950 18762 19031 gene locus_tag LOCUS_01960 gene rpsO 18762 19031 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059466.1 protein_id gnl|my_center|LOCUS_01960 19278 21413 gene locus_tag LOCUS_01970 gene pnp 19278 21413 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298740.1 protein_id gnl|my_center|LOCUS_01970 21522 22406 gene locus_tag LOCUS_01980 gene nlpI 21522 22406 CDS product lipoprotein NlpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802080.1 protein_id gnl|my_center|LOCUS_01980 22586 24475 gene locus_tag LOCUS_01990 gene deaD 22586 24475 CDS product ATP-dependent RNA helicase DeaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301504.1 protein_id gnl|my_center|LOCUS_01990 24629 25873 gene locus_tag LOCUS_02000 gene mtr 24629 25873 CDS product tryptophan permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224340.1 protein_id gnl|my_center|LOCUS_02000 26998 25991 gene locus_tag LOCUS_02010 26998 25991 CDS product luciferase-like monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130380.1 protein_id gnl|my_center|LOCUS_02010 28082 27204 gene locus_tag LOCUS_02020 28082 27204 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301318.1 protein_id gnl|my_center|LOCUS_02020 29086 28091 gene locus_tag LOCUS_02030 29086 28091 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421305.1 protein_id gnl|my_center|LOCUS_02030 29295 29819 gene locus_tag LOCUS_02040 29295 29819 CDS product SCP2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295552.1 protein_id gnl|my_center|LOCUS_02040 29813 30316 gene locus_tag LOCUS_02050 29813 30316 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908554.1 protein_id gnl|my_center|LOCUS_02050 30614 30303 gene locus_tag LOCUS_02060 gene yhbQ 30614 30303 CDS product DNA damage response exodeoxyribonuclease YhbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189314.1 protein_id gnl|my_center|LOCUS_02060 30656 31099 gene locus_tag LOCUS_02070 30656 31099 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449030.1 protein_id gnl|my_center|LOCUS_02070 31597 31079 gene locus_tag LOCUS_02080 gene yhbO 31597 31079 CDS product protein/nucleic acid deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037608.1 protein_id gnl|my_center|LOCUS_02080 31725 32360 gene locus_tag LOCUS_02090 31725 32360 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298741.1 protein_id gnl|my_center|LOCUS_02090 32433 33473 gene locus_tag LOCUS_02100 32433 33473 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147622.1 protein_id gnl|my_center|LOCUS_02100 34162 33587 gene locus_tag LOCUS_02110 gene dolP 34162 33587 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646043.1 protein_id gnl|my_center|LOCUS_02110 34762 34172 gene locus_tag LOCUS_02120 gene diaA 34762 34172 CDS product DnaA initiator-associating protein DiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158034.1 protein_id gnl|my_center|LOCUS_02120 35177 34782 gene locus_tag LOCUS_02130 35177 34782 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246855.1 protein_id gnl|my_center|LOCUS_02130 37171 35135 gene locus_tag LOCUS_02140 gene lpoA 37171 35135 CDS product penicillin-binding protein activator LpoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249157.1 protein_id gnl|my_center|LOCUS_02140 37235 38095 gene locus_tag LOCUS_02150 gene rsmI 37235 38095 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809253.1 protein_id gnl|my_center|LOCUS_02150 39229 38138 gene locus_tag LOCUS_02160 39229 38138 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817005.1 protein_id gnl|my_center|LOCUS_02160 41756 39240 gene locus_tag LOCUS_02170 41756 39240 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136472.1 protein_id gnl|my_center|LOCUS_02170 42385 41786 gene locus_tag LOCUS_02180 42385 41786 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044768.1 protein_id gnl|my_center|LOCUS_02180 43145 42561 gene locus_tag LOCUS_02190 43145 42561 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045442.1 protein_id gnl|my_center|LOCUS_02190 44246 43545 gene locus_tag LOCUS_02200 44246 43545 CDS product galactosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307409.1 protein_id gnl|my_center|LOCUS_02200 45092 44301 gene locus_tag LOCUS_02210 gene agaD 45092 44301 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534351.1 protein_id gnl|my_center|LOCUS_02210 45885 45082 gene locus_tag LOCUS_02220 gene agaC 45885 45082 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544489.1 protein_id gnl|my_center|LOCUS_02220 46400 45924 gene locus_tag LOCUS_02230 gene agaB 46400 45924 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098017.1 protein_id gnl|my_center|LOCUS_02230 47428 46568 gene locus_tag LOCUS_02240 gene kbaY 47428 46568 CDS product tagatose-bisphosphate aldolase subunit KbaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022766.1 protein_id gnl|my_center|LOCUS_02240 48595 47441 gene locus_tag LOCUS_02250 48595 47441 CDS product AgaS family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114873.1 protein_id gnl|my_center|LOCUS_02250 50079 48946 gene locus_tag LOCUS_02260 gene nagA 50079 48946 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326138.1 protein_id gnl|my_center|LOCUS_02260 50510 50076 gene locus_tag LOCUS_02270 gene agaF 50510 50076 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000948824.1 protein_id gnl|my_center|LOCUS_02270 51406 50528 gene locus_tag LOCUS_02280 gene agaE 51406 50528 CDS product PTS N-acetylgalactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781397.1 protein_id gnl|my_center|LOCUS_02280 52175 51396 gene locus_tag LOCUS_02290 gene agaW 52175 51396 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406214.1 protein_id gnl|my_center|LOCUS_02290 52659 52186 gene locus_tag LOCUS_02300 gene agaV 52659 52186 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295547.1 protein_id gnl|my_center|LOCUS_02300 53962 52682 gene locus_tag LOCUS_02310 gene kbaZ 53962 52682 CDS product tagatose-bisphosphate aldolase subunit KbaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681920.1 protein_id gnl|my_center|LOCUS_02310 54211 55020 gene locus_tag LOCUS_02320 gene agaR 54211 55020 CDS product aga operon transcriptional regulator AgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072187.1 protein_id gnl|my_center|LOCUS_02320 55539 55075 gene locus_tag LOCUS_02330 gene yhaV 55539 55075 CDS product type II toxin-antitoxin system ribonuclease toxin YhaV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347267.1 protein_id gnl|my_center|LOCUS_02330 55874 55539 gene locus_tag LOCUS_02340 gene prlF 55874 55539 CDS product type II toxin-antitoxin system antitoxin PrlF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307405.1 protein_id gnl|my_center|LOCUS_02340 57594 56023 gene locus_tag LOCUS_02350 gene garD 57594 56023 CDS product galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273741.1 protein_id gnl|my_center|LOCUS_02350 57969 59303 gene locus_tag LOCUS_02360 gene garP 57969 59303 CDS product galactarate/glucarate/glycerate transporter GarP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599636.1 protein_id gnl|my_center|LOCUS_02360 59319 60089 gene locus_tag LOCUS_02370 gene garL 59319 60089 CDS product 2-dehydro-3-deoxyglucarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058227.1 protein_id gnl|my_center|LOCUS_02370 60110 61009 gene locus_tag LOCUS_02380 gene garR 60110 61009 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566608.1 protein_id gnl|my_center|LOCUS_02380 61106 62251 gene locus_tag LOCUS_02390 gene garK 61106 62251 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299416.1 protein_id gnl|my_center|LOCUS_02390 64242 63055 gene locus_tag LOCUS_02400 64242 63055 CDS product YhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484640.1 protein_id gnl|my_center|LOCUS_02400 64803 64264 gene locus_tag LOCUS_02410 gene yhaB 64803 64264 CDS product protein YhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675733.1 protein_id gnl|my_center|LOCUS_02410 65592 66530 gene locus_tag LOCUS_02420 gene tdcA 65592 66530 CDS product transcriptional regulator TdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104211.1 protein_id gnl|my_center|LOCUS_02420 66629 67618 gene locus_tag LOCUS_02430 gene tdcB 66629 67618 CDS product bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548347.1 protein_id gnl|my_center|LOCUS_02430 67640 68971 gene locus_tag LOCUS_02440 gene tdcC 67640 68971 CDS product threonine/serine transporter TdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107720.1 protein_id gnl|my_center|LOCUS_02440 68997 70205 gene locus_tag LOCUS_02450 gene tdcD 68997 70205 CDS product propionate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295545.1 protein_id gnl|my_center|LOCUS_02450 70239 72533 gene locus_tag LOCUS_02460 gene tdcE 70239 72533 CDS product 2-ketobutyrate formate-lyase/pyruvate formate-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861734.1 protein_id gnl|my_center|LOCUS_02460 72547 72936 gene locus_tag LOCUS_02470 72547 72936 CDS product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 protein_id gnl|my_center|LOCUS_02470 73008 74372 gene locus_tag LOCUS_02480 gene tdcG 73008 74372 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622115.1 protein_id gnl|my_center|LOCUS_02480 74647 75978 gene locus_tag LOCUS_02490 74647 75978 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401598.1 protein_id gnl|my_center|LOCUS_02490 76006 77316 gene locus_tag LOCUS_02500 gene cyuA 76006 77316 CDS product cysteine desulfidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460512.1 protein_id gnl|my_center|LOCUS_02500 77692 77528 gene locus_tag LOCUS_02510 gene yhaL 77692 77528 CDS product protein YhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295544.1 protein_id gnl|my_center|LOCUS_02510 78416 77715 gene locus_tag LOCUS_02520 78416 77715 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633576.1 protein_id gnl|my_center|LOCUS_02520 78521 79417 gene locus_tag LOCUS_02530 gene yhaJ 78521 79417 CDS product DNA-binding transcriptional regulator YhaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041010.1 protein_id gnl|my_center|LOCUS_02530 79824 79468 gene locus_tag LOCUS_02540 79824 79468 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 protein_id gnl|my_center|LOCUS_02540 80431 80066 gene locus_tag LOCUS_02550 80431 80066 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384145.1 protein_id gnl|my_center|LOCUS_02550 81710 80724 gene locus_tag LOCUS_02560 gene yqjG 81710 80724 CDS product glutathionyl-hydroquinone reductase YqjG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531201.1 protein_id gnl|my_center|LOCUS_02560 82172 81780 gene locus_tag LOCUS_02570 82172 81780 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732240.1 protein_id gnl|my_center|LOCUS_02570 82657 82358 gene locus_tag LOCUS_02580 82657 82358 CDS product YqjK-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096086.1 protein_id gnl|my_center|LOCUS_02580 83051 82647 gene locus_tag LOCUS_02590 83051 82647 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785722.1 protein_id gnl|my_center|LOCUS_02590 83359 83054 gene locus_tag LOCUS_02600 83359 83054 CDS product YqjD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031415.1 protein_id gnl|my_center|LOCUS_02600 83765 83397 gene locus_tag LOCUS_02610 gene yqjC 83765 83397 CDS product DUF1090 family protein YqjC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297156.1 protein_id gnl|my_center|LOCUS_02610 84295 83912 gene locus_tag LOCUS_02620 gene mzrA 84295 83912 CDS product EnvZ/OmpR regulon moderator MzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166760.1 protein_id gnl|my_center|LOCUS_02620 84961 84299 gene locus_tag LOCUS_02630 gene yqjA 84961 84299 CDS product DedA family general envelope maintenance protein YqjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422149.1 protein_id gnl|my_center|LOCUS_02630 86082 85306 gene locus_tag LOCUS_02640 gene exuR 86082 85306 CDS product transcriptional regulator ExuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406488.1 protein_id gnl|my_center|LOCUS_02640 86456 87094 gene locus_tag LOCUS_02650 86456 87094 CDS product fimbria/pilus periplasmic chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225866.1 protein_id gnl|my_center|LOCUS_02650 87124 87624 gene locus_tag LOCUS_02660 87124 87624 CDS product CS1 type fimbrial major subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755097.1 protein_id gnl|my_center|LOCUS_02660 87716 90400 gene locus_tag LOCUS_02670 87716 90400 CDS product TcfC E-set like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358674.1 protein_id gnl|my_center|LOCUS_02670 90853 91485 gene locus_tag LOCUS_02680 90853 91485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 92871 91573 gene locus_tag LOCUS_02690 gene exuT 92871 91573 CDS product hexuronate transporter ExuT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226465.1 protein_id gnl|my_center|LOCUS_02690 93354 94766 gene locus_tag LOCUS_02700 gene uxaC 93354 94766 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187447.1 protein_id gnl|my_center|LOCUS_02700 94781 96268 gene locus_tag LOCUS_02710 gene uxaA 94781 96268 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199376.1 protein_id gnl|my_center|LOCUS_02710 96351 96902 gene locus_tag LOCUS_02720 96351 96902 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000128136.1 protein_id gnl|my_center|LOCUS_02720 98151 96907 gene locus_tag LOCUS_02730 gene sstT 98151 96907 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211655.1 protein_id gnl|my_center|LOCUS_02730 98664 98356 gene locus_tag LOCUS_02740 98664 98356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 99732 98767 gene locus_tag LOCUS_02750 gene alx 99732 98767 CDS product TerC family membrane protein Alx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098805.1 protein_id gnl|my_center|LOCUS_02750 101019 100015 gene locus_tag LOCUS_02760 101019 100015 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456357.1 protein_id gnl|my_center|LOCUS_02760 101763 101080 gene locus_tag LOCUS_02770 101763 101080 CDS product vancomycin high temperature exclusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183049.1 protein_id gnl|my_center|LOCUS_02770 102343 101840 gene locus_tag LOCUS_02780 102343 101840 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297151.1 protein_id gnl|my_center|LOCUS_02780 102428 103564 gene locus_tag LOCUS_02790 gene rlmG 102428 103564 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018690.1 protein_id gnl|my_center|LOCUS_02790 103835 104251 gene locus_tag LOCUS_02800 gene higA 103835 104251 CDS product type II toxin-antitoxin system antitoxin HigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560266.1 protein_id gnl|my_center|LOCUS_02800 106314 104296 gene locus_tag LOCUS_02810 gene fadH 106314 104296 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121487.1 protein_id gnl|my_center|LOCUS_02810 109091 106740 gene locus_tag LOCUS_02820 gene ygjK 109091 106740 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695479.1 protein_id gnl|my_center|LOCUS_02820 110178 109108 gene locus_tag LOCUS_02830 gene ygjJ 110178 109108 CDS product protein YgjJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767652.1 protein_id gnl|my_center|LOCUS_02830 111745 110312 gene locus_tag LOCUS_02840 111745 110312 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285446.1 protein_id gnl|my_center|LOCUS_02840 112257 111808 gene locus_tag LOCUS_02850 112257 111808 CDS product beta-galactosidase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219954.1 protein_id gnl|my_center|LOCUS_02850 115346 112254 gene locus_tag LOCUS_02860 gene ebgA 115346 112254 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082869.1 protein_id gnl|my_center|LOCUS_02860 116513 115530 gene locus_tag LOCUS_02870 gene ebgR 116513 115530 CDS product transcriptional regulator EbgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212470.1 protein_id gnl|my_center|LOCUS_02870 116732 117064 gene locus_tag LOCUS_02880 116732 117064 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450589.1 protein_id gnl|my_center|LOCUS_02880 118395 117106 gene locus_tag LOCUS_02890 gene ygjG 118395 117106 CDS product putrescine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633381.1 protein_id gnl|my_center|LOCUS_02890 118903 120423 gene locus_tag LOCUS_02900 gene aer 118903 120423 CDS product aerotaxis sensor receptor Aer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094682.1 protein_id gnl|my_center|LOCUS_02900 121153 120530 gene locus_tag LOCUS_02910 gene nfeR 121153 120530 CDS product DNA-binding transcriptional regulator NfeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018005.1 protein_id gnl|my_center|LOCUS_02910 121441 122205 gene locus_tag LOCUS_02920 gene nfeF 121441 122205 CDS product NADPH-dependent ferric chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065895.1 protein_id gnl|my_center|LOCUS_02920 122334 122259 gene locus_tag LOCUS_t00070 122334 122259 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 122459 122965 gene locus_tag LOCUS_02930 gene mug 122459 122965 CDS product G/U mismatch-specific DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228937.1 protein_id gnl|my_center|LOCUS_02930 124884 123043 gene locus_tag LOCUS_02940 gene rpoD 124884 123043 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437371.1 protein_id gnl|my_center|LOCUS_02940 126824 125079 gene locus_tag LOCUS_02950 gene dnaG 126824 125079 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918827.1 protein_id gnl|my_center|LOCUS_02950 127150 126935 gene locus_tag LOCUS_02960 gene rpsU 127150 126935 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_02960 127387 128400 gene locus_tag LOCUS_02970 gene tsaD 127387 128400 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264365.1 protein_id gnl|my_center|LOCUS_02970 129906 128443 gene locus_tag LOCUS_02980 gene ttdT 129906 128443 CDS product L-tartrate/succinate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804973.1 protein_id gnl|my_center|LOCUS_02980 130559 129954 gene locus_tag LOCUS_02990 gene ttdB 130559 129954 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722957.1 protein_id gnl|my_center|LOCUS_02990 131467 130556 gene locus_tag LOCUS_03000 gene ttdA 131467 130556 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986797.1 protein_id gnl|my_center|LOCUS_03000 131674 132606 gene locus_tag LOCUS_03010 gene ttdR 131674 132606 CDS product DNA-binding transcriptional activator TtdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935206.1 protein_id gnl|my_center|LOCUS_03010 133236 132619 gene locus_tag LOCUS_03020 gene plsY 133236 132619 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272796.1 protein_id gnl|my_center|LOCUS_03020 133338 133709 gene locus_tag LOCUS_03030 gene folB 133338 133709 CDS product bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295541.1 protein_id gnl|my_center|LOCUS_03030 133799 134620 gene locus_tag LOCUS_03040 gene bacA 133799 134620 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305111.1 protein_id gnl|my_center|LOCUS_03040 136021 134783 gene locus_tag LOCUS_03050 gene cca 136021 134783 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 protein_id gnl|my_center|LOCUS_03050 136705 136085 gene locus_tag LOCUS_03060 136705 136085 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 protein_id gnl|my_center|LOCUS_03060 136947 138248 gene locus_tag LOCUS_03070 gene ygiF 136947 138248 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046264.1 protein_id gnl|my_center|LOCUS_03070 138271 141111 gene locus_tag LOCUS_03080 gene glnE 138271 141111 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315860.1 protein_id gnl|my_center|LOCUS_03080 141159 142592 gene locus_tag LOCUS_03090 gene hldE 141159 142592 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869178.1 protein_id gnl|my_center|LOCUS_03090 145047 143386 gene locus_tag LOCUS_03100 145047 143386 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000341046.1 protein_id gnl|my_center|LOCUS_03100 145703 145074 gene locus_tag LOCUS_03110 145703 145074 CDS product DUF1449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599947.1 protein_id gnl|my_center|LOCUS_03110 145972 146172 gene locus_tag LOCUS_03120 gene glgS 145972 146172 CDS product cell surface composition regulator GlgS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350095.1 protein_id gnl|my_center|LOCUS_03120 147279 146215 gene locus_tag LOCUS_03130 147279 146215 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269793.1 protein_id gnl|my_center|LOCUS_03130 148030 147281 gene locus_tag LOCUS_03140 148030 147281 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387080.1 protein_id gnl|my_center|LOCUS_03140 150559 148046 gene locus_tag LOCUS_03150 150559 148046 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277116.1 protein_id gnl|my_center|LOCUS_03150 151161 150610 gene locus_tag LOCUS_03160 151161 150610 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272149.1 protein_id gnl|my_center|LOCUS_03160 151794 151444 gene locus_tag LOCUS_03170 gene ubiK 151794 151444 CDS product ubiquinone biosynthesis accessory factor UbiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222100.1 protein_id gnl|my_center|LOCUS_03170 152108 152761 gene locus_tag LOCUS_03180 gene ribB 152108 152761 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076997.1 protein_id gnl|my_center|LOCUS_03180 153022 153192 gene locus_tag LOCUS_03190 gene yqiD 153022 153192 CDS product protein YqiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469266.1 protein_id gnl|my_center|LOCUS_03190 154023 153250 gene locus_tag LOCUS_03200 gene zupT 154023 153250 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295627.1 protein_id gnl|my_center|LOCUS_03200 154139 154954 gene locus_tag LOCUS_03210 gene ygiD 154139 154954 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000188393.1 protein_id gnl|my_center|LOCUS_03210 156152 154992 gene locus_tag LOCUS_03220 156152 154992 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442860.1 protein_id gnl|my_center|LOCUS_03220 156700 156158 gene locus_tag LOCUS_03230 156700 156158 CDS product DUF1190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831543.1 protein_id gnl|my_center|LOCUS_03230 158458 156977 gene locus_tag LOCUS_03240 gene tolC 158458 156977 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735278.1 protein_id gnl|my_center|LOCUS_03240 158663 159292 gene locus_tag LOCUS_03250 gene nudF 158663 159292 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917117.1 protein_id gnl|my_center|LOCUS_03250 159293 159715 gene locus_tag LOCUS_03260 159293 159715 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833393.1 protein_id gnl|my_center|LOCUS_03260 159740 160567 gene locus_tag LOCUS_03270 gene cpdA 159740 160567 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444747.1 protein_id gnl|my_center|LOCUS_03270 160567 161148 gene locus_tag LOCUS_03280 gene yqiA 160567 161148 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105733.1 protein_id gnl|my_center|LOCUS_03280 161177 163069 gene locus_tag LOCUS_03290 gene parE 161177 163069 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195296.1 protein_id gnl|my_center|LOCUS_03290 163431 163117 gene locus_tag LOCUS_03300 163431 163117 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958598.1 protein_id gnl|my_center|LOCUS_03300 164043 163462 gene locus_tag LOCUS_03310 gene mdaB 164043 163462 CDS product NADPH:quinone oxidoreductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 protein_id gnl|my_center|LOCUS_03310 164362 164694 gene locus_tag LOCUS_03320 164362 164694 CDS product DUF2645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912120.1 protein_id gnl|my_center|LOCUS_03320 166089 164740 gene locus_tag LOCUS_03330 gene qseC 166089 164740 CDS product quorum sensing histidine kinase QseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673354.1 protein_id gnl|my_center|LOCUS_03330 166745 166086 gene locus_tag LOCUS_03340 gene qseB 166745 166086 CDS product quorum sensing response regulator transcription factor QseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221502.1 protein_id gnl|my_center|LOCUS_03340 166897 167289 gene locus_tag LOCUS_03350 gene ygiW 166897 167289 CDS product OB fold stress tolerance protein YgiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712658.1 protein_id gnl|my_center|LOCUS_03350 167342 167824 gene locus_tag LOCUS_03360 167342 167824 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183494.1 protein_id gnl|my_center|LOCUS_03360 168370 170628 gene locus_tag LOCUS_03370 gene parC 168370 170628 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281881.1 protein_id gnl|my_center|LOCUS_03370 170862 171599 gene locus_tag LOCUS_03380 gene plsC 170862 171599 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965712.1 protein_id gnl|my_center|LOCUS_03380 171674 173086 gene locus_tag LOCUS_03390 gene ftsP 171674 173086 CDS product cell division protein FtsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059395.1 protein_id gnl|my_center|LOCUS_03390 173197 175416 gene locus_tag LOCUS_03400 173197 175416 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095187.1 protein_id gnl|my_center|LOCUS_03400 175716 175459 gene locus_tag LOCUS_03410 gene yqhH 175716 175459 CDS product lipoprotein YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000848528.1 protein_id gnl|my_center|LOCUS_03410 176693 175767 gene locus_tag LOCUS_03420 176693 175767 CDS product YbjP/YqhG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691598.1 protein_id gnl|my_center|LOCUS_03420 177720 176893 gene locus_tag LOCUS_03430 gene dkgA 177720 176893 CDS product 2,5-didehydrogluconate reductase DkgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013149.1 protein_id gnl|my_center|LOCUS_03430 178988 177825 gene locus_tag LOCUS_03440 gene yqhD 178988 177825 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058807.1 protein_id gnl|my_center|LOCUS_03440 179182 180081 gene locus_tag LOCUS_03450 179182 180081 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263712.1 protein_id gnl|my_center|LOCUS_03450 180780 180121 gene locus_tag LOCUS_03460 gene yghB 180780 180121 CDS product DedA family general envelope maintenance protein YghB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268419.1 protein_id gnl|my_center|LOCUS_03460 182107 180920 gene locus_tag LOCUS_03470 gene metC 182107 180920 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315867.1 protein_id gnl|my_center|LOCUS_03470 182359 183093 gene locus_tag LOCUS_03480 gene exbB 182359 183093 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527844.1 protein_id gnl|my_center|LOCUS_03480 183100 183525 gene locus_tag LOCUS_03490 gene exbD 183100 183525 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240712.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence03 1150 281 gene locus_tag LOCUS_03500 1150 281 CDS product YjeJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008054.1 protein_id gnl|my_center|LOCUS_03500 2573 1545 gene locus_tag LOCUS_03510 gene epmB 2573 1545 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940530.1 protein_id gnl|my_center|LOCUS_03510 2615 3181 gene locus_tag LOCUS_03520 gene efp 2615 3181 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257278.1 protein_id gnl|my_center|LOCUS_03520 3469 3615 gene locus_tag LOCUS_03530 gene ecnB 3469 3615 CDS product lipoprotein toxin entericidin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239596.1 protein_id gnl|my_center|LOCUS_03530 3790 4107 gene locus_tag LOCUS_03540 gene sugE 3790 4107 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118482.1 protein_id gnl|my_center|LOCUS_03540 4637 4104 gene locus_tag LOCUS_03550 gene blc 4637 4104 CDS product lipocalin Blc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238369.1 protein_id gnl|my_center|LOCUS_03550 5859 4726 gene locus_tag LOCUS_03560 5859 4726 CDS product BlaEC family class C beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001367937.1 protein_id gnl|my_center|LOCUS_03560 6281 5922 gene locus_tag LOCUS_03570 gene frdD 6281 5922 CDS product fumarate reductase subunit FrdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299198.1 protein_id gnl|my_center|LOCUS_03570 6687 6292 gene locus_tag LOCUS_03580 gene frdC 6687 6292 CDS product fumarate reductase subunit FrdC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208757.1 protein_id gnl|my_center|LOCUS_03580 7432 6698 gene locus_tag LOCUS_03590 gene frdB 7432 6698 CDS product fumarate reductase iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829498.1 protein_id gnl|my_center|LOCUS_03590 9233 7425 gene locus_tag LOCUS_03600 gene frdA 9233 7425 CDS product fumarate reductase (quinol) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192973.1 protein_id gnl|my_center|LOCUS_03600 9558 10535 gene locus_tag LOCUS_03610 gene epmA 9558 10535 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004771.1 protein_id gnl|my_center|LOCUS_03610 10799 12256 gene locus_tag LOCUS_03620 gene yjeM 10799 12256 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300174.1 protein_id gnl|my_center|LOCUS_03620 15730 12407 gene locus_tag LOCUS_03630 gene mscM 15730 12407 CDS product miniconductance mechanosensitive channel MscM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236813.1 protein_id gnl|my_center|LOCUS_03630 16720 15752 gene locus_tag LOCUS_03640 gene asd 16720 15752 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934927.1 protein_id gnl|my_center|LOCUS_03640 17869 16817 gene locus_tag LOCUS_03650 gene rsgA 17869 16817 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041970.1 protein_id gnl|my_center|LOCUS_03650 17964 18509 gene locus_tag LOCUS_03660 gene orn 17964 18509 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295188.1 protein_id gnl|my_center|LOCUS_03660 18720 18795 gene locus_tag LOCUS_t00080 18720 18795 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18832 18907 gene locus_tag LOCUS_t00090 18832 18907 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 18943 19018 gene locus_tag LOCUS_t00100 18943 19018 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20427 19288 gene locus_tag LOCUS_03670 gene queG 20427 19288 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294219.1 protein_id gnl|my_center|LOCUS_03670 20441 21973 gene locus_tag LOCUS_03680 gene nnr 20441 21973 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307537.1 protein_id gnl|my_center|LOCUS_03680 21945 22406 gene locus_tag LOCUS_03690 gene tsaE 21945 22406 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_03690 22425 23762 gene locus_tag LOCUS_03700 gene amiB 22425 23762 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990321.1 protein_id gnl|my_center|LOCUS_03700 23772 25619 gene locus_tag LOCUS_03710 gene mutL 23772 25619 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122523.1 protein_id gnl|my_center|LOCUS_03710 25612 26562 gene locus_tag LOCUS_03720 25612 26562 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280345.1 protein_id gnl|my_center|LOCUS_03720 26648 26956 gene locus_tag LOCUS_03730 gene hfq 26648 26956 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051883.1 protein_id gnl|my_center|LOCUS_03730 27032 28312 gene locus_tag LOCUS_03740 gene hflX 27032 28312 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460360.1 protein_id gnl|my_center|LOCUS_03740 28398 29657 gene locus_tag LOCUS_03750 gene hflK 28398 29657 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312488.1 protein_id gnl|my_center|LOCUS_03750 29660 30664 gene locus_tag LOCUS_03760 gene hflC 29660 30664 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232412.1 protein_id gnl|my_center|LOCUS_03760 30746 30943 gene locus_tag LOCUS_03770 30746 30943 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001089295.1 protein_id gnl|my_center|LOCUS_03770 31047 32345 gene locus_tag LOCUS_03780 gene purA 31047 32345 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527955.1 protein_id gnl|my_center|LOCUS_03780 32550 32975 gene locus_tag LOCUS_03790 gene nsrR 32550 32975 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177639.1 protein_id gnl|my_center|LOCUS_03790 33014 35455 gene locus_tag LOCUS_03800 gene rnr 33014 35455 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076316.1 protein_id gnl|my_center|LOCUS_03800 35635 36366 gene locus_tag LOCUS_03810 gene rlmB 35635 36366 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293282.1 protein_id gnl|my_center|LOCUS_03810 36493 36894 gene locus_tag LOCUS_03820 36493 36894 CDS product DUF2170 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220137.1 protein_id gnl|my_center|LOCUS_03820 36913 37611 gene locus_tag LOCUS_03830 36913 37611 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511955.1 protein_id gnl|my_center|LOCUS_03830 37661 38320 gene locus_tag LOCUS_03840 37661 38320 CDS product YjfK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012550.1 protein_id gnl|my_center|LOCUS_03840 38338 38736 gene locus_tag LOCUS_03850 38338 38736 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547760.1 protein_id gnl|my_center|LOCUS_03850 38746 39384 gene locus_tag LOCUS_03860 38746 39384 CDS product DUF1190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101644.1 protein_id gnl|my_center|LOCUS_03860 39387 40550 gene locus_tag LOCUS_03870 39387 40550 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943976.1 protein_id gnl|my_center|LOCUS_03870 40634 42259 gene locus_tag LOCUS_03880 40634 42259 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299838.1 protein_id gnl|my_center|LOCUS_03880 42651 42376 gene locus_tag LOCUS_03890 gene yjfN 42651 42376 CDS product DUF1471 family protease activator YjfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811566.1 protein_id gnl|my_center|LOCUS_03890 43069 42800 gene locus_tag LOCUS_03900 gene bsmA 43069 42800 CDS product biofilm peroxide resistance protein BsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254633.1 protein_id gnl|my_center|LOCUS_03900 43311 44060 gene locus_tag LOCUS_03910 gene yjfP 43311 44060 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569721.1 protein_id gnl|my_center|LOCUS_03910 44812 44057 gene locus_tag LOCUS_03920 gene ulaR 44812 44057 CDS product HTH-type transcriptional regulator UlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133631.1 protein_id gnl|my_center|LOCUS_03920 45990 44920 gene locus_tag LOCUS_03930 gene ulaG 45990 44920 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 protein_id gnl|my_center|LOCUS_03930 46339 47736 gene locus_tag LOCUS_03940 gene ulaA 46339 47736 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300695.1 protein_id gnl|my_center|LOCUS_03940 47752 48057 gene locus_tag LOCUS_03950 gene ulaB 47752 48057 CDS product PTS ascorbate transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218360.1 protein_id gnl|my_center|LOCUS_03950 48067 48531 gene locus_tag LOCUS_03960 gene ulaC 48067 48531 CDS product PTS ascorbate transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776505.1 protein_id gnl|my_center|LOCUS_03960 48545 49195 gene locus_tag LOCUS_03970 gene ulaD 48545 49195 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056749.1 protein_id gnl|my_center|LOCUS_03970 49205 50059 gene locus_tag LOCUS_03980 gene ulaE 49205 50059 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949511.1 protein_id gnl|my_center|LOCUS_03980 50059 50745 gene locus_tag LOCUS_03990 gene ulaF 50059 50745 CDS product L-ribulose-5-phosphate 4-epimerase UlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170812.1 protein_id gnl|my_center|LOCUS_03990 51149 50874 gene locus_tag LOCUS_04000 51149 50874 CDS product DUF1471 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324306.1 protein_id gnl|my_center|LOCUS_04000 51476 51871 gene locus_tag LOCUS_04010 gene rpsF 51476 51871 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216676.1 protein_id gnl|my_center|LOCUS_04010 51878 52192 gene locus_tag LOCUS_04020 gene priB 51878 52192 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296681.1 protein_id gnl|my_center|LOCUS_04020 52197 52424 gene locus_tag LOCUS_04030 gene rpsR 52197 52424 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135199.1 protein_id gnl|my_center|LOCUS_04030 52466 52915 gene locus_tag LOCUS_04040 gene rplI 52466 52915 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196062.1 protein_id gnl|my_center|LOCUS_04040 53543 52986 gene locus_tag LOCUS_04050 53543 52986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 55298 54051 gene locus_tag LOCUS_04060 55298 54051 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033613.1 protein_id gnl|my_center|LOCUS_04060 57493 55421 gene locus_tag LOCUS_04070 57493 55421 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080381.1 protein_id gnl|my_center|LOCUS_04070 59031 57490 gene locus_tag LOCUS_04080 59031 57490 CDS product acyl CoA:acetate/3-ketoacid CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226977.1 protein_id gnl|my_center|LOCUS_04080 59817 59041 gene locus_tag LOCUS_04090 59817 59041 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283536.1 protein_id gnl|my_center|LOCUS_04090 60669 59827 gene locus_tag LOCUS_04100 60669 59827 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205251.1 protein_id gnl|my_center|LOCUS_04100 61470 60679 gene locus_tag LOCUS_04110 61470 60679 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843394.1 protein_id gnl|my_center|LOCUS_04110 61682 62329 gene locus_tag LOCUS_04120 61682 62329 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001317442.1 protein_id gnl|my_center|LOCUS_04120 62951 62313 gene locus_tag LOCUS_04130 gene ytfB 62951 62313 CDS product cell division protein YtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119478.1 protein_id gnl|my_center|LOCUS_04130 63169 63789 gene locus_tag LOCUS_04140 gene fklB 63169 63789 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311330.1 protein_id gnl|my_center|LOCUS_04140 64098 65510 gene locus_tag LOCUS_04150 gene cycA 64098 65510 CDS product D-serine/D-alanine/glycine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228371.1 protein_id gnl|my_center|LOCUS_04150 66217 65555 gene locus_tag LOCUS_04160 gene ytfE 66217 65555 CDS product iron-sulfur cluster repair protein YtfE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331456.1 protein_id gnl|my_center|LOCUS_04160 67290 66325 gene locus_tag LOCUS_04170 67290 66325 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296686.1 protein_id gnl|my_center|LOCUS_04170 68259 67399 gene locus_tag LOCUS_04180 gene qorB 68259 67399 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_04180 68348 68728 gene locus_tag LOCUS_04190 68348 68728 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084622.1 protein_id gnl|my_center|LOCUS_04190 70800 68857 gene locus_tag LOCUS_04200 gene cpdB 70800 68857 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589423.1 protein_id gnl|my_center|LOCUS_04200 70990 71730 gene locus_tag LOCUS_04210 gene cysQ 70990 71730 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886909.1 protein_id gnl|my_center|LOCUS_04210 72277 71720 gene locus_tag LOCUS_04220 72277 71720 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175289.1 protein_id gnl|my_center|LOCUS_04220 72602 72808 gene locus_tag LOCUS_04230 72602 72808 CDS product DUF1107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689228.1 protein_id gnl|my_center|LOCUS_04230 74213 72870 gene locus_tag LOCUS_04240 74213 72870 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935036.1 protein_id gnl|my_center|LOCUS_04240 75174 74536 gene locus_tag LOCUS_04250 gene msrA 75174 74536 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305659.1 protein_id gnl|my_center|LOCUS_04250 75231 75410 gene locus_tag LOCUS_04260 75231 75410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 75380 77113 gene locus_tag LOCUS_04270 gene tamA 75380 77113 CDS product autotransporter assembly complex protein TamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269327.1 protein_id gnl|my_center|LOCUS_04270 77110 80889 gene locus_tag LOCUS_04280 gene tamB 77110 80889 CDS product autotransporter assembly complex protein TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060946.1 protein_id gnl|my_center|LOCUS_04280 80892 81233 gene locus_tag LOCUS_04290 80892 81233 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219160.1 protein_id gnl|my_center|LOCUS_04290 81445 81696 gene locus_tag LOCUS_04300 gene chpS 81445 81696 CDS product type II toxin-antitoxin system antitoxin ChpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223208.1 protein_id gnl|my_center|LOCUS_04300 81690 82040 gene locus_tag LOCUS_04310 gene chpB 81690 82040 CDS product endoribonuclease toxin ChpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239579.1 protein_id gnl|my_center|LOCUS_04310 82650 82120 gene locus_tag LOCUS_04320 gene ppa 82650 82120 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055075.1 protein_id gnl|my_center|LOCUS_04320 82960 83916 gene locus_tag LOCUS_04330 gene ytfQ 82960 83916 CDS product galactofuranose ABC transporter substrate-binding protein YtfQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000265933.1 protein_id gnl|my_center|LOCUS_04330 84056 85558 gene locus_tag LOCUS_04340 84056 85558 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205794.1 protein_id gnl|my_center|LOCUS_04340 85572 86594 gene locus_tag LOCUS_04350 85572 86594 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001572298.1 protein_id gnl|my_center|LOCUS_04350 86581 87576 gene locus_tag LOCUS_04360 gene yjfF 86581 87576 CDS product sugar ABC transporter permease YjfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595979.1 protein_id gnl|my_center|LOCUS_04360 88607 87609 gene locus_tag LOCUS_04370 gene fbp 88607 87609 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853753.1 protein_id gnl|my_center|LOCUS_04370 88783 90156 gene locus_tag LOCUS_04380 gene mpl 88783 90156 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219816.1 protein_id gnl|my_center|LOCUS_04380 90863 90312 gene locus_tag LOCUS_04390 gene yjgA 90863 90312 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166270.1 protein_id gnl|my_center|LOCUS_04390 90957 92309 gene locus_tag LOCUS_04400 gene pmbA 90957 92309 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162171.1 protein_id gnl|my_center|LOCUS_04400 92492 92878 gene locus_tag LOCUS_04410 gene cybC 92492 92878 CDS product cytochrome b562 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232240.1 protein_id gnl|my_center|LOCUS_04410 93387 92923 gene locus_tag LOCUS_04420 gene nrdG 93387 92923 CDS product anaerobic ribonucleoside-triphosphate reductase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106233.1 protein_id gnl|my_center|LOCUS_04420 95684 93546 gene locus_tag LOCUS_04430 gene nrdD 95684 93546 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187778.1 protein_id gnl|my_center|LOCUS_04430 97733 96078 gene locus_tag LOCUS_04440 gene treC 97733 96078 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331056.1 protein_id gnl|my_center|LOCUS_04440 99204 97783 gene locus_tag LOCUS_04450 gene treB 99204 97783 CDS product PTS trehalose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299664.1 protein_id gnl|my_center|LOCUS_04450 100270 99323 gene locus_tag LOCUS_04460 gene treR 100270 99323 CDS product trehalose operon repressor TreR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181324.1 protein_id gnl|my_center|LOCUS_04460 100649 103345 gene locus_tag LOCUS_04470 gene mgtA 100649 103345 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471866.1 protein_id gnl|my_center|LOCUS_04470 103845 103390 gene locus_tag LOCUS_04480 103845 103390 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251083.1 protein_id gnl|my_center|LOCUS_04480 104297 103911 gene locus_tag LOCUS_04490 gene ridA 104297 103911 CDS product 2-iminobutanoate/2-iminopropanoate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298042.1 protein_id gnl|my_center|LOCUS_04490 104831 104370 gene locus_tag LOCUS_04500 gene pyrI 104831 104370 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148581.1 protein_id gnl|my_center|LOCUS_04500 105779 104844 gene locus_tag LOCUS_04510 gene pyrB 105779 104844 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013046.1 protein_id gnl|my_center|LOCUS_04510 106593 106198 gene locus_tag LOCUS_04520 106593 106198 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230281.1 protein_id gnl|my_center|LOCUS_04520 107437 106724 gene locus_tag LOCUS_04530 gene bdcA 107437 106724 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500727.1 protein_id gnl|my_center|LOCUS_04530 107508 108101 gene locus_tag LOCUS_04540 107508 108101 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256656.1 protein_id gnl|my_center|LOCUS_04540 108246 108698 gene locus_tag LOCUS_04550 gene tabA 108246 108698 CDS product toxin-antitoxin biofilm protein TabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583470.1 protein_id gnl|my_center|LOCUS_04550 108821 110164 gene locus_tag LOCUS_04560 gene yjgL 108821 110164 CDS product protein YjgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036434.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04560 110151 110381 gene locus_tag LOCUS_04570 110151 110381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 111486 110482 gene locus_tag LOCUS_04580 gene argF 111486 110482 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000012907.1 protein_id gnl|my_center|LOCUS_04580 111648 112064 gene locus_tag LOCUS_04590 gene rraB 111648 112064 CDS product ribonuclease E inhibitor RraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002952.1 protein_id gnl|my_center|LOCUS_04590 112613 112110 gene locus_tag LOCUS_04600 112613 112110 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059422.1 protein_id gnl|my_center|LOCUS_04600 112806 114002 gene locus_tag LOCUS_04610 112806 114002 CDS product YjgN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079641.1 protein_id gnl|my_center|LOCUS_04610 116913 114058 gene locus_tag LOCUS_04620 gene valS 116913 114058 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416392.1 protein_id gnl|my_center|LOCUS_04620 117356 116913 gene locus_tag LOCUS_04630 gene holC 117356 116913 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786399.1 protein_id gnl|my_center|LOCUS_04630 119001 117490 gene locus_tag LOCUS_04640 gene pepA 119001 117490 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397144.1 protein_id gnl|my_center|LOCUS_04640 119361 120368 gene locus_tag LOCUS_04650 gene lptF 119361 120368 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000584114.1 protein_id gnl|my_center|LOCUS_04650 120368 121450 gene locus_tag LOCUS_04660 gene lptG 120368 121450 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295681.1 protein_id gnl|my_center|LOCUS_04660 123071 121569 gene locus_tag LOCUS_04670 123071 121569 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294573.1 protein_id gnl|my_center|LOCUS_04670 123598 123682 gene locus_tag LOCUS_t00110 123598 123682 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 123883 125151 gene locus_tag LOCUS_04680 123883 125151 CDS product integrase arm-type DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032666220.1 protein_id gnl|my_center|LOCUS_04680 125367 126242 gene locus_tag LOCUS_04690 125367 126242 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141174869.1 protein_id gnl|my_center|LOCUS_04690 127285 126320 gene locus_tag LOCUS_04700 127285 126320 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958093.1 protein_id gnl|my_center|LOCUS_04700 129130 127388 gene locus_tag LOCUS_04710 129130 127388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 132326 129195 gene locus_tag LOCUS_04720 132326 129195 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_04720 133339 132323 gene locus_tag LOCUS_04730 133339 132323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 134757 133339 gene locus_tag LOCUS_04740 134757 133339 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694527.1 protein_id gnl|my_center|LOCUS_04740 136453 134747 gene locus_tag LOCUS_04750 136453 134747 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039057.1 protein_id gnl|my_center|LOCUS_04750 136667 137644 gene locus_tag LOCUS_04760 136667 137644 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028002890.1 protein_id gnl|my_center|LOCUS_04760 137959 138642 gene locus_tag LOCUS_04770 137959 138642 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703837.1 protein_id gnl|my_center|LOCUS_04770 138682 139695 gene locus_tag LOCUS_04780 138682 139695 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047369808.1 protein_id gnl|my_center|LOCUS_04780 139707 140492 gene locus_tag LOCUS_04790 139707 140492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 140925 140707 gene locus_tag LOCUS_04800 140925 140707 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703404.1 protein_id gnl|my_center|LOCUS_04800 141657 141043 gene locus_tag LOCUS_04810 141657 141043 CDS product inovirus Gp2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148641.1 protein_id gnl|my_center|LOCUS_04810 142250 143203 gene locus_tag LOCUS_04820 142250 143203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 143439 144257 gene locus_tag LOCUS_04830 143439 144257 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703839.1 protein_id gnl|my_center|LOCUS_04830 144287 144760 gene locus_tag LOCUS_04840 gene radC 144287 144760 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703840.1 protein_id gnl|my_center|LOCUS_04840 144781 145095 gene locus_tag LOCUS_04850 gene cbeA 144781 145095 CDS product type IV toxin-antitoxin system cytoskeleton bundling-enhancing antitoxin CbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285620.1 protein_id gnl|my_center|LOCUS_04850 145126 145467 gene locus_tag LOCUS_04860 gene ykfI 145126 145467 CDS product type IV toxin-antitoxin system toxin YkfI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854672.1 protein_id gnl|my_center|LOCUS_04860 145582 146415 gene locus_tag LOCUS_04870 145582 146415 CDS product DUF4942 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034461534.1 protein_id gnl|my_center|LOCUS_04870 146468 146740 gene locus_tag LOCUS_04880 146468 146740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 146744 147019 gene locus_tag LOCUS_04890 146744 147019 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024325581.1 protein_id gnl|my_center|LOCUS_04890 147133 147930 gene locus_tag LOCUS_04900 147133 147930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 148259 148666 gene locus_tag LOCUS_04910 148259 148666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence04 3437 1023 gene locus_tag LOCUS_04920 3437 1023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561899.1 protein_id gnl|my_center|LOCUS_04920 4120 3434 gene locus_tag LOCUS_04930 4120 3434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110573.1 protein_id gnl|my_center|LOCUS_04930 4058 4714 gene locus_tag LOCUS_04940 gene tesA 4058 4714 CDS product multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297298.1 protein_id gnl|my_center|LOCUS_04940 4704 5513 gene locus_tag LOCUS_04950 gene ybbO 4704 5513 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148959.1 protein_id gnl|my_center|LOCUS_04950 5574 6428 gene locus_tag LOCUS_04960 gene cnoX 5574 6428 CDS product chaperedoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295322.1 protein_id gnl|my_center|LOCUS_04960 7270 6491 gene locus_tag LOCUS_04970 gene fetB 7270 6491 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295323.1 protein_id gnl|my_center|LOCUS_04970 7934 7257 gene locus_tag LOCUS_04980 gene fetA 7934 7257 CDS product iron ABC transporter ATP-binding protein FetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157535.1 protein_id gnl|my_center|LOCUS_04980 8080 8997 gene locus_tag LOCUS_04990 8080 8997 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 protein_id gnl|my_center|LOCUS_04990 8994 9452 gene locus_tag LOCUS_05000 8994 9452 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970323.1 protein_id gnl|my_center|LOCUS_05000 9860 9453 gene locus_tag LOCUS_05010 gene cueR 9860 9453 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026747.1 protein_id gnl|my_center|LOCUS_05010 11277 9985 gene locus_tag LOCUS_05020 11277 9985 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982172.1 protein_id gnl|my_center|LOCUS_05020 12212 11280 gene locus_tag LOCUS_05030 gene glsA 12212 11280 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883024.1 protein_id gnl|my_center|LOCUS_05030 12474 14978 gene locus_tag LOCUS_05040 gene copA 12474 14978 CDS product copper-exporting P-type ATPase CopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078268.1 protein_id gnl|my_center|LOCUS_05040 15487 15092 gene locus_tag LOCUS_05050 15487 15092 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617168.1 protein_id gnl|my_center|LOCUS_05050 15571 16365 gene locus_tag LOCUS_05060 15571 16365 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365173.1 protein_id gnl|my_center|LOCUS_05060 16569 17048 gene locus_tag LOCUS_05070 gene ybaK 16569 17048 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000186627.1 protein_id gnl|my_center|LOCUS_05070 18737 17085 gene locus_tag LOCUS_05080 gene ushA 18737 17085 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771766.1 protein_id gnl|my_center|LOCUS_05080 18955 20175 gene locus_tag LOCUS_05090 gene fsr 18955 20175 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251608.1 protein_id gnl|my_center|LOCUS_05090 20413 22089 gene locus_tag LOCUS_05100 gene ybaL 20413 22089 CDS product YbaL family putative K(+) efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000546229.1 protein_id gnl|my_center|LOCUS_05100 23476 22172 gene locus_tag LOCUS_05110 gene gsk 23476 22172 CDS product inosine/guanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671574.1 protein_id gnl|my_center|LOCUS_05110 23628 24587 gene locus_tag LOCUS_05120 gene aes 23628 24587 CDS product acetyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801832.1 protein_id gnl|my_center|LOCUS_05120 25546 24584 gene locus_tag LOCUS_05130 gene hemH 25546 24584 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250088.1 protein_id gnl|my_center|LOCUS_05130 26426 25782 gene locus_tag LOCUS_05140 gene adk 26426 25782 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001220233.1 protein_id gnl|my_center|LOCUS_05140 28481 26607 gene locus_tag LOCUS_05150 gene htpG 28481 26607 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678201.1 protein_id gnl|my_center|LOCUS_05150 29196 28591 gene locus_tag LOCUS_05160 gene recR 29196 28591 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195025.1 protein_id gnl|my_center|LOCUS_05160 29525 29196 gene locus_tag LOCUS_05170 29525 29196 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_05170 31509 29578 gene locus_tag LOCUS_05180 gene dnaX 31509 29578 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122013.1 protein_id gnl|my_center|LOCUS_05180 32189 31638 gene locus_tag LOCUS_05190 gene apt 32189 31638 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 protein_id gnl|my_center|LOCUS_05190 32719 32342 gene locus_tag LOCUS_05200 32719 32342 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188905.1 protein_id gnl|my_center|LOCUS_05200 32789 33316 gene locus_tag LOCUS_05210 gene priC 32789 33316 CDS product primosomal replication protein N'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844874.1 protein_id gnl|my_center|LOCUS_05210 33330 33491 gene locus_tag LOCUS_05220 gene rsmS 33330 33491 CDS product pleiotropic regulatory protein RsmS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051146.1 protein_id gnl|my_center|LOCUS_05220 37065 33703 gene locus_tag LOCUS_05230 gene mscK 37065 33703 CDS product mechanosensitive channel MscK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177732.1 protein_id gnl|my_center|LOCUS_05230 37840 37193 gene locus_tag LOCUS_05240 gene acrR 37840 37193 CDS product multidrug efflux transporter transcriptional repressor AcrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101737.1 protein_id gnl|my_center|LOCUS_05240 38090 39175 gene locus_tag LOCUS_05250 gene acrA 38090 39175 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386618.1 protein_id gnl|my_center|LOCUS_05250 39198 42347 gene locus_tag LOCUS_05260 gene acrB 39198 42347 CDS product efflux RND transporter permease AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132469.1 protein_id gnl|my_center|LOCUS_05260 42893 43267 gene locus_tag LOCUS_05270 gene tomB 42893 43267 CDS product Hha toxicity modulator TomB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344800.1 protein_id gnl|my_center|LOCUS_05270 43281 43511 gene locus_tag LOCUS_05280 43281 43511 CDS product HHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291435.1 protein_id gnl|my_center|LOCUS_05280 43682 44233 gene locus_tag LOCUS_05290 gene maa 43682 44233 CDS product maltose O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102564.1 protein_id gnl|my_center|LOCUS_05290 44349 44819 gene locus_tag LOCUS_05300 44349 44819 CDS product YlaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136192.1 protein_id gnl|my_center|LOCUS_05300 44983 46533 gene locus_tag LOCUS_05310 gene pdeB 44983 46533 CDS product cyclic-guanylate-specific phosphodiesterase PdeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299455.1 protein_id gnl|my_center|LOCUS_05310 46928 46575 gene locus_tag LOCUS_05320 46928 46575 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878140.1 protein_id gnl|my_center|LOCUS_05320 47307 47618 gene locus_tag LOCUS_05330 gene atl 47307 47618 CDS product DNA base-flipping protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300427.1 protein_id gnl|my_center|LOCUS_05330 48221 47649 gene locus_tag LOCUS_05340 48221 47649 CDS product YbaY family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779831.1 protein_id gnl|my_center|LOCUS_05340 48439 49299 gene locus_tag LOCUS_05350 gene tesB 48439 49299 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075876.1 protein_id gnl|my_center|LOCUS_05350 50633 49347 gene locus_tag LOCUS_05360 gene amtB 50633 49347 CDS product ammonium transporter AmtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685029.1 protein_id gnl|my_center|LOCUS_05360 51001 50663 gene locus_tag LOCUS_05370 gene glnK 51001 50663 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780338.1 protein_id gnl|my_center|LOCUS_05370 52963 51182 gene locus_tag LOCUS_05380 52963 51182 CDS product SmdB family multidrug efflux ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256174.1 protein_id gnl|my_center|LOCUS_05380 54728 52956 gene locus_tag LOCUS_05390 54728 52956 CDS product SmdA family multidrug ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235599.1 protein_id gnl|my_center|LOCUS_05390 55216 54758 gene locus_tag LOCUS_05400 gene decR 55216 54758 CDS product DNA-binding transcriptional regulator DecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884589.1 protein_id gnl|my_center|LOCUS_05400 56187 55369 gene locus_tag LOCUS_05410 gene cof 56187 55369 CDS product HMP-PP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113027.1 protein_id gnl|my_center|LOCUS_05410 56287 57987 gene locus_tag LOCUS_05420 56287 57987 CDS product SgrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238226.1 protein_id gnl|my_center|LOCUS_05420 58052 58747 gene locus_tag LOCUS_05430 gene queC 58052 58747 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817229.1 protein_id gnl|my_center|LOCUS_05430 59197 58799 gene locus_tag LOCUS_05440 gene fadM 59197 58799 CDS product long-chain acyl-CoA thioesterase FadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194534.1 protein_id gnl|my_center|LOCUS_05440 59662 59291 gene locus_tag LOCUS_05450 59662 59291 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680312.1 protein_id gnl|my_center|LOCUS_05450 61684 59813 gene locus_tag LOCUS_05460 gene ppiD 61684 59813 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969372.1 protein_id gnl|my_center|LOCUS_05460 62148 61876 gene locus_tag LOCUS_05470 gene hupB 62148 61876 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043542.1 protein_id gnl|my_center|LOCUS_05470 64711 62357 gene locus_tag LOCUS_05480 gene lon 64711 62357 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295325.1 protein_id gnl|my_center|LOCUS_05480 66173 64899 gene locus_tag LOCUS_05490 gene clpX 66173 64899 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130305.1 protein_id gnl|my_center|LOCUS_05490 66922 66299 gene locus_tag LOCUS_05500 gene clpP 66922 66299 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122253.1 protein_id gnl|my_center|LOCUS_05500 68466 67168 gene locus_tag LOCUS_05510 gene tig 68466 67168 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198384.1 protein_id gnl|my_center|LOCUS_05510 69127 68810 gene locus_tag LOCUS_05520 gene bolA 69127 68810 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973448.1 protein_id gnl|my_center|LOCUS_05520 69432 70010 gene locus_tag LOCUS_05530 69432 70010 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295326.1 protein_id gnl|my_center|LOCUS_05530 70102 71529 gene locus_tag LOCUS_05540 gene ampG 70102 71529 CDS product muropeptide MFS transporter AmpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098438.1 protein_id gnl|my_center|LOCUS_05540 72049 72936 gene locus_tag LOCUS_05550 gene cyoA 72049 72936 CDS product cytochrome o ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239441.1 protein_id gnl|my_center|LOCUS_05550 72958 74949 gene locus_tag LOCUS_05560 gene cyoB 72958 74949 CDS product cytochrome o ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467180.1 protein_id gnl|my_center|LOCUS_05560 75038 75553 gene locus_tag LOCUS_05570 75038 75553 CDS product cytochrome o ubiquinol oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179819.1 protein_id gnl|my_center|LOCUS_05570 75553 75882 gene locus_tag LOCUS_05580 75553 75882 CDS product cytochrome o ubiquinol oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019869.1 protein_id gnl|my_center|LOCUS_05580 75894 76784 gene locus_tag LOCUS_05590 gene cyoE 75894 76784 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971336.1 protein_id gnl|my_center|LOCUS_05590 76969 77280 gene locus_tag LOCUS_05600 76969 77280 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297137.1 protein_id gnl|my_center|LOCUS_05600 77264 77806 gene locus_tag LOCUS_05610 77264 77806 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227784.1 protein_id gnl|my_center|LOCUS_05610 78797 77862 gene locus_tag LOCUS_05620 78797 77862 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297127.1 protein_id gnl|my_center|LOCUS_05620 79205 80569 gene locus_tag LOCUS_05630 79205 80569 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000978.1 protein_id gnl|my_center|LOCUS_05630 81188 80697 gene locus_tag LOCUS_05640 gene yajQ 81188 80697 CDS product nucleotide binding protein YajQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138904.1 protein_id gnl|my_center|LOCUS_05640 81356 82267 gene locus_tag LOCUS_05650 gene panE 81356 82267 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705874.1 protein_id gnl|my_center|LOCUS_05650 82230 82820 gene locus_tag LOCUS_05660 gene yajL 82230 82820 CDS product protein deglycase YajL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276309.1 protein_id gnl|my_center|LOCUS_05660 84322 82874 gene locus_tag LOCUS_05670 gene thiI 84322 82874 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668685.1 protein_id gnl|my_center|LOCUS_05670 84528 84770 gene locus_tag LOCUS_05680 gene xseB 84528 84770 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_05680 84770 85669 gene locus_tag LOCUS_05690 gene ispA 84770 85669 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347217.1 protein_id gnl|my_center|LOCUS_05690 85694 87556 gene locus_tag LOCUS_05700 gene dxs 85694 87556 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006797.1 protein_id gnl|my_center|LOCUS_05700 87611 88585 gene locus_tag LOCUS_05710 gene yajO 87611 88585 CDS product 1-deoxyxylulose-5-phosphate synthase YajO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199800.1 protein_id gnl|my_center|LOCUS_05710 89157 88639 gene locus_tag LOCUS_05720 gene pgpA 89157 88639 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154044.1 protein_id gnl|my_center|LOCUS_05720 90112 89135 gene locus_tag LOCUS_05730 gene thiL 90112 89135 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742107.1 protein_id gnl|my_center|LOCUS_05730 90609 90190 gene locus_tag LOCUS_05740 gene nusB 90609 90190 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801125.1 protein_id gnl|my_center|LOCUS_05740 91099 90629 gene locus_tag LOCUS_05750 gene ribE 91099 90629 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021161.1 protein_id gnl|my_center|LOCUS_05750 92291 91188 gene locus_tag LOCUS_05760 gene ribD 92291 91188 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150468.1 protein_id gnl|my_center|LOCUS_05760 92744 92295 gene locus_tag LOCUS_05770 gene nrdR 92744 92295 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543535.1 protein_id gnl|my_center|LOCUS_05770 92895 93434 gene locus_tag LOCUS_05780 92895 93434 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314529.1 protein_id gnl|my_center|LOCUS_05780 93733 94617 gene locus_tag LOCUS_05790 gene tsx 93733 94617 CDS product nucleoside-specific channel-forming protein Tsx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295328.1 protein_id gnl|my_center|LOCUS_05790 95141 94794 gene locus_tag LOCUS_05800 gene yajD 95141 94794 CDS product HNH nuclease YajD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974813.1 protein_id gnl|my_center|LOCUS_05800 96241 95270 gene locus_tag LOCUS_05810 gene secF 96241 95270 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046637.1 protein_id gnl|my_center|LOCUS_05810 98066 96252 gene locus_tag LOCUS_05820 gene secD 98066 96252 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934822.1 protein_id gnl|my_center|LOCUS_05820 98459 98127 gene locus_tag LOCUS_05830 gene yajC 98459 98127 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007629.1 protein_id gnl|my_center|LOCUS_05830 99609 98482 gene locus_tag LOCUS_05840 99609 98482 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667319.1 protein_id gnl|my_center|LOCUS_05840 100735 99665 gene locus_tag LOCUS_05850 100735 99665 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266503.1 protein_id gnl|my_center|LOCUS_05850 100828 101409 gene locus_tag LOCUS_05860 gene acpH 100828 101409 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009884.1 protein_id gnl|my_center|LOCUS_05860 103231 101414 gene locus_tag LOCUS_05870 gene malZ 103231 101414 CDS product maltodextrin glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297133.1 protein_id gnl|my_center|LOCUS_05870 104760 103387 gene locus_tag LOCUS_05880 gene proY 104760 103387 CDS product proline-specific permease ProY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295329.1 protein_id gnl|my_center|LOCUS_05880 106155 104836 gene locus_tag LOCUS_05890 gene brnQ 106155 104836 CDS product branched-chain amino acid transporter carrier protein BrnQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149639.1 protein_id gnl|my_center|LOCUS_05890 107857 106562 gene locus_tag LOCUS_05900 gene phoR 107857 106562 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893603.1 protein_id gnl|my_center|LOCUS_05900 108604 107915 gene locus_tag LOCUS_05910 gene phoB 108604 107915 CDS product phosphate response regulator transcription factor PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113933.1 protein_id gnl|my_center|LOCUS_05910 108794 109996 gene locus_tag LOCUS_05920 gene sbcD 108794 109996 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221319.1 protein_id gnl|my_center|LOCUS_05920 109993 113136 gene locus_tag LOCUS_05930 gene sbcC 109993 113136 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698907.1 protein_id gnl|my_center|LOCUS_05930 113178 114446 gene locus_tag LOCUS_05940 gene araJ 113178 114446 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196824.1 protein_id gnl|my_center|LOCUS_05940 115497 114589 gene locus_tag LOCUS_05950 gene mak 115497 114589 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219342.1 protein_id gnl|my_center|LOCUS_05950 115556 116533 gene locus_tag LOCUS_05960 gene rdgC 115556 116533 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298537.1 protein_id gnl|my_center|LOCUS_05960 116864 116691 gene locus_tag LOCUS_05970 116864 116691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 117464 117180 gene locus_tag LOCUS_05980 gene ppnP 117464 117180 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941942.1 protein_id gnl|my_center|LOCUS_05980 118213 117536 gene locus_tag LOCUS_05990 118213 117536 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276420.1 protein_id gnl|my_center|LOCUS_05990 118662 118471 gene locus_tag LOCUS_06000 gene yaiA 118662 118471 CDS product protein YaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142439.1 protein_id gnl|my_center|LOCUS_06000 119179 118712 gene locus_tag LOCUS_06010 gene aroL 119179 118712 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193393.1 protein_id gnl|my_center|LOCUS_06010 119877 119419 gene locus_tag LOCUS_06020 119877 119419 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158159.1 protein_id gnl|my_center|LOCUS_06020 119997 120806 gene locus_tag LOCUS_06030 gene proC 119997 120806 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295331.1 protein_id gnl|my_center|LOCUS_06030 121938 120823 gene locus_tag LOCUS_06040 gene adrA 121938 120823 CDS product diguanylate cyclase AdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484048.1 protein_id gnl|my_center|LOCUS_06040 122360 122040 gene locus_tag LOCUS_06050 gene psiF 122360 122040 CDS product phosphate starvation-inducible protein PsiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295332.1 protein_id gnl|my_center|LOCUS_06050 123894 122479 gene locus_tag LOCUS_06060 gene phoA 123894 122479 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814403.1 protein_id gnl|my_center|LOCUS_06060 124255 123995 gene locus_tag LOCUS_06070 gene iraP 124255 123995 CDS product anti-adapter protein IraP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792970.1 protein_id gnl|my_center|LOCUS_06070 124718 125812 gene locus_tag LOCUS_06080 gene ddlA 124718 125812 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413677.1 protein_id gnl|my_center|LOCUS_06080 126048 125836 gene locus_tag LOCUS_06090 126048 125836 CDS product DUF2754 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295334.1 protein_id gnl|my_center|LOCUS_06090 126308 126616 gene locus_tag LOCUS_06100 126308 126616 CDS product YaiY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763151.1 protein_id gnl|my_center|LOCUS_06100 127769 126675 gene locus_tag LOCUS_06110 gene yaiW 127769 126675 CDS product surface-exposed outer membrane lipoprotein YaiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092029.1 protein_id gnl|my_center|LOCUS_06110 129002 127782 gene locus_tag LOCUS_06120 gene sbmA 129002 127782 CDS product peptide antibiotic transporter SbmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001342332.1 protein_id gnl|my_center|LOCUS_06120 129354 130511 gene locus_tag LOCUS_06130 gene ampH 129354 130511 CDS product D-alanyl-D-alanine-carboxypeptidase/endopeptidase AmpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830741.1 protein_id gnl|my_center|LOCUS_06130 131135 130512 gene locus_tag LOCUS_06140 gene iprA 131135 130512 CDS product hydrogen peroxide resistance inhibitor IprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295817.1 protein_id gnl|my_center|LOCUS_06140 134129 131223 gene locus_tag LOCUS_06150 134129 131223 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556441.1 protein_id gnl|my_center|LOCUS_06150 134653 135627 gene locus_tag LOCUS_06160 gene hemB 134653 135627 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295337.1 protein_id gnl|my_center|LOCUS_06160 136584 135733 gene locus_tag LOCUS_06170 gene tauD 136584 135733 CDS product taurine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004044.1 protein_id gnl|my_center|LOCUS_06170 137408 136581 gene locus_tag LOCUS_06180 gene tauC 137408 136581 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114607.1 protein_id gnl|my_center|LOCUS_06180 138172 137405 gene locus_tag LOCUS_06190 gene tauB 138172 137405 CDS product taurine ABC transporter ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939375.1 protein_id gnl|my_center|LOCUS_06190 139147 138185 gene locus_tag LOCUS_06200 gene tauA 139147 138185 CDS product taurine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297135.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence05 439 140 gene locus_tag LOCUS_06210 439 140 CDS product PRD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295165.1 protein_id gnl|my_center|LOCUS_06210 1424 519 gene locus_tag LOCUS_06220 gene yhfZ 1424 519 CDS product GntR family transcriptional regulator YhfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254820.1 protein_id gnl|my_center|LOCUS_06220 2697 1693 gene locus_tag LOCUS_06230 gene trpS 2697 1693 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165553.1 protein_id gnl|my_center|LOCUS_06230 3448 2690 gene locus_tag LOCUS_06240 gene gph 3448 2690 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031729.1 protein_id gnl|my_center|LOCUS_06240 4118 3441 gene locus_tag LOCUS_06250 gene rpe 4118 3441 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816280.1 protein_id gnl|my_center|LOCUS_06250 4852 4136 gene locus_tag LOCUS_06260 gene dam 4852 4136 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742143.1 protein_id gnl|my_center|LOCUS_06260 6365 5079 gene locus_tag LOCUS_06270 gene damX 6365 5079 CDS product cell division protein DamX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343178.1 protein_id gnl|my_center|LOCUS_06270 7545 6457 gene locus_tag LOCUS_06280 gene aroB 7545 6457 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439846.1 protein_id gnl|my_center|LOCUS_06280 8087 7602 gene locus_tag LOCUS_06290 8087 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9762 8524 gene locus_tag LOCUS_06300 gene hofQ 9762 8524 CDS product DNA uptake porin HofQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815976.1 protein_id gnl|my_center|LOCUS_06300 10078 9674 gene locus_tag LOCUS_06310 gene hofP 10078 9674 CDS product DNA utilization protein HofP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264141.1 protein_id gnl|my_center|LOCUS_06310 10508 10068 gene locus_tag LOCUS_06320 gene hofO 10508 10068 CDS product DNA utilization protein HofO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055760.1 protein_id gnl|my_center|LOCUS_06320 11031 10492 gene locus_tag LOCUS_06330 gene hofN 11031 10492 CDS product DNA utilization protein HofN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001069315.1 protein_id gnl|my_center|LOCUS_06330 11810 11031 gene locus_tag LOCUS_06340 gene hofM 11810 11031 CDS product DNA utilization protein HofM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315880.1 protein_id gnl|my_center|LOCUS_06340 11951 14482 gene locus_tag LOCUS_06350 gene mrcA 11951 14482 CDS product peptidoglycan glycosyltransferase/peptidoglycan DD-transpeptidase MrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301905.1 protein_id gnl|my_center|LOCUS_06350 15207 14647 gene locus_tag LOCUS_06360 gene nudE 15207 14647 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045744.1 protein_id gnl|my_center|LOCUS_06360 15527 17662 gene locus_tag LOCUS_06370 gene igaA 15527 17662 CDS product intracellular growth attenuator protein IgaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104539.1 protein_id gnl|my_center|LOCUS_06370 17727 18395 gene locus_tag LOCUS_06380 gene yrfG 17727 18395 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936227.1 protein_id gnl|my_center|LOCUS_06380 18406 18807 gene locus_tag LOCUS_06390 gene hslR 18406 18807 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 protein_id gnl|my_center|LOCUS_06390 18832 19710 gene locus_tag LOCUS_06400 gene hslO 18832 19710 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135574.1 protein_id gnl|my_center|LOCUS_06400 21569 19845 gene locus_tag LOCUS_06410 21569 19845 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370795.1 protein_id gnl|my_center|LOCUS_06410 21948 23570 gene locus_tag LOCUS_06420 gene pckA 21948 23570 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001265681.1 protein_id gnl|my_center|LOCUS_06420 23687 24004 gene locus_tag LOCUS_06430 23687 24004 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493756.1 protein_id gnl|my_center|LOCUS_06430 24063 24359 gene locus_tag LOCUS_06440 gene nadS 24063 24359 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650976.1 protein_id gnl|my_center|LOCUS_06440 25733 24390 gene locus_tag LOCUS_06450 gene envZ 25733 24390 CDS product two-component system sensor histidine kinase EnvZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253696.1 protein_id gnl|my_center|LOCUS_06450 26458 25739 gene locus_tag LOCUS_06460 gene ompR 26458 25739 CDS product two-component system response regulator OmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001157751.1 protein_id gnl|my_center|LOCUS_06460 26686 27162 gene locus_tag LOCUS_06470 gene greB 26686 27162 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856737.1 protein_id gnl|my_center|LOCUS_06470 27259 29580 gene locus_tag LOCUS_06480 27259 29580 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980724.1 protein_id gnl|my_center|LOCUS_06480 30018 30245 gene locus_tag LOCUS_06490 gene feoA 30018 30245 CDS product ferrous iron transporter A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200455.1 protein_id gnl|my_center|LOCUS_06490 30262 32583 gene locus_tag LOCUS_06500 gene feoB 30262 32583 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000737014.1 protein_id gnl|my_center|LOCUS_06500 32583 32819 gene locus_tag LOCUS_06510 gene feoC 32583 32819 CDS product [Fe-S]-dependent transcriptional repressor FeoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295699.1 protein_id gnl|my_center|LOCUS_06510 33022 33315 gene locus_tag LOCUS_06520 33022 33315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06520 33328 33900 gene locus_tag LOCUS_06530 33328 33900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06530 34699 33929 gene locus_tag LOCUS_06540 gene bioH 34699 33929 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060072.1 protein_id gnl|my_center|LOCUS_06540 35040 35420 gene locus_tag LOCUS_06550 35040 35420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 35479 36054 gene locus_tag LOCUS_06560 gene nfuA 35479 36054 CDS product Fe-S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619389.1 protein_id gnl|my_center|LOCUS_06560 36415 37731 gene locus_tag LOCUS_06570 gene gntT 36415 37731 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131758.1 protein_id gnl|my_center|LOCUS_06570 39860 37776 gene locus_tag LOCUS_06580 gene malQ 39860 37776 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444333.1 protein_id gnl|my_center|LOCUS_06580 42263 39870 gene locus_tag LOCUS_06590 gene malP 42263 39870 CDS product maltodextrin phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081909.1 protein_id gnl|my_center|LOCUS_06590 42875 45580 gene locus_tag LOCUS_06600 gene malT 42875 45580 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906970.1 protein_id gnl|my_center|LOCUS_06600 46639 45623 gene locus_tag LOCUS_06610 gene rtcA 46639 45623 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387129.1 protein_id gnl|my_center|LOCUS_06610 47869 46643 gene locus_tag LOCUS_06620 gene rtcB 47869 46643 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105504.1 protein_id gnl|my_center|LOCUS_06620 48058 49656 gene locus_tag LOCUS_06630 gene rtcR 48058 49656 CDS product DNA-binding transcriptional regulator RtcR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232966.1 protein_id gnl|my_center|LOCUS_06630 50396 49638 gene locus_tag LOCUS_06640 50396 49638 CDS product DeoR/GlpR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815099.1 protein_id gnl|my_center|LOCUS_06640 51243 50413 gene locus_tag LOCUS_06650 gene glpG 51243 50413 CDS product rhomboid family intramembrane serine protease GlpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928731.1 protein_id gnl|my_center|LOCUS_06650 51614 51288 gene locus_tag LOCUS_06660 gene glpE 51614 51288 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371928.1 protein_id gnl|my_center|LOCUS_06660 51804 53309 gene locus_tag LOCUS_06670 gene glpD 51804 53309 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448136.1 protein_id gnl|my_center|LOCUS_06670 54738 53971 gene locus_tag LOCUS_06680 54738 53971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183164.1 protein_id gnl|my_center|LOCUS_06680 55451 54741 gene locus_tag LOCUS_06690 55451 54741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424547.1 protein_id gnl|my_center|LOCUS_06690 56971 55466 gene locus_tag LOCUS_06700 56971 55466 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181201.1 protein_id gnl|my_center|LOCUS_06700 59546 57099 gene locus_tag LOCUS_06710 gene glgP 59546 57099 CDS product glycogen phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993449.1 protein_id gnl|my_center|LOCUS_06710 60998 59565 gene locus_tag LOCUS_06720 gene glgA 60998 59565 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197646.1 protein_id gnl|my_center|LOCUS_06720 62293 60998 gene locus_tag LOCUS_06730 gene glgC 62293 60998 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253975.1 protein_id gnl|my_center|LOCUS_06730 64284 62311 gene locus_tag LOCUS_06740 gene glgX 64284 62311 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192523.1 protein_id gnl|my_center|LOCUS_06740 66467 64281 gene locus_tag LOCUS_06750 gene glgB 66467 64281 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283723.1 protein_id gnl|my_center|LOCUS_06750 67843 66740 gene locus_tag LOCUS_06760 gene asd 67843 66740 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799956.1 protein_id gnl|my_center|LOCUS_06760 68036 68629 gene locus_tag LOCUS_06770 gene yhgN 68036 68629 CDS product NAAT family transporter YhgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002544.1 protein_id gnl|my_center|LOCUS_06770 69951 68686 gene locus_tag LOCUS_06780 gene gntU 69951 68686 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210111.1 protein_id gnl|my_center|LOCUS_06780 70518 70030 gene locus_tag LOCUS_06790 gene gntK 70518 70030 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108330.1 protein_id gnl|my_center|LOCUS_06790 71634 70696 gene locus_tag LOCUS_06800 gene gntR 71634 70696 CDS product gluconate operon transcriptional repressor GntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218790.1 protein_id gnl|my_center|LOCUS_06800 72610 71915 gene locus_tag LOCUS_06810 gene yhhW 72610 71915 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639811.1 protein_id gnl|my_center|LOCUS_06810 73770 72733 gene locus_tag LOCUS_06820 73770 72733 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236293.1 protein_id gnl|my_center|LOCUS_06820 73717 73869 gene locus_tag LOCUS_06830 73717 73869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 74103 74591 gene locus_tag LOCUS_06840 gene yhhY 74103 74591 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295206.1 protein_id gnl|my_center|LOCUS_06840 74825 76003 gene locus_tag LOCUS_06850 74825 76003 CDS product Hcp1 family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065894.1 protein_id gnl|my_center|LOCUS_06850 76000 76494 gene locus_tag LOCUS_06860 gene yrhA 76000 76494 CDS product protein YrhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988501.1 protein_id gnl|my_center|LOCUS_06860 76589 76744 gene locus_tag LOCUS_06870 76589 76744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 76944 77228 gene locus_tag LOCUS_06880 76944 77228 CDS product YrhB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634159.1 protein_id gnl|my_center|LOCUS_06880 79008 77266 gene locus_tag LOCUS_06890 gene ggt 79008 77266 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595082.1 protein_id gnl|my_center|LOCUS_06890 79128 79568 gene locus_tag LOCUS_06900 79128 79568 CDS product DUF2756 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825996.1 protein_id gnl|my_center|LOCUS_06900 80298 79555 gene locus_tag LOCUS_06910 gene ugpQ 80298 79555 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073609.1 protein_id gnl|my_center|LOCUS_06910 81365 80295 gene locus_tag LOCUS_06920 gene ugpC 81365 80295 CDS product sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907790.1 protein_id gnl|my_center|LOCUS_06920 82212 81367 gene locus_tag LOCUS_06930 gene ugpE 82212 81367 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572164.1 protein_id gnl|my_center|LOCUS_06930 83096 82209 gene locus_tag LOCUS_06940 gene ugpA 83096 82209 CDS product sn-glycerol-3-phosphate ABC transporter permease UgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099276.1 protein_id gnl|my_center|LOCUS_06940 84510 83194 gene locus_tag LOCUS_06950 gene ugpB 84510 83194 CDS product sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803193.1 protein_id gnl|my_center|LOCUS_06950 85619 84906 gene locus_tag LOCUS_06960 gene livF 85619 84906 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416895.1 protein_id gnl|my_center|LOCUS_06960 86388 85621 gene locus_tag LOCUS_06970 gene livG 86388 85621 CDS product high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082101.1 protein_id gnl|my_center|LOCUS_06970 87662 86385 gene locus_tag LOCUS_06980 gene livM 87662 86385 CDS product branched chain amino acid ABC transporter permease LivM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000803797.1 protein_id gnl|my_center|LOCUS_06980 88585 87659 gene locus_tag LOCUS_06990 gene livH 88585 87659 CDS product high-affinity branched-chain amino acid ABC transporter permease LivH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295111.1 protein_id gnl|my_center|LOCUS_06990 89796 88633 gene locus_tag LOCUS_07000 gene livK 89796 88633 CDS product high-affinity branched-chain amino acid ABC transporter substrate-binding protein LivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827696.1 protein_id gnl|my_center|LOCUS_07000 90166 90549 gene locus_tag LOCUS_07010 gene panM 90166 90549 CDS product aspartate 1-decarboxylase autocleavage activator PanM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778785.1 protein_id gnl|my_center|LOCUS_07010 91851 90748 gene locus_tag LOCUS_07020 gene livJ 91851 90748 CDS product branched chain amino acid ABC transporter substrate-binding protein LivJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021996.1 protein_id gnl|my_center|LOCUS_07020 92977 92123 gene locus_tag LOCUS_07030 gene rpoH 92977 92123 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130217.1 protein_id gnl|my_center|LOCUS_07030 94280 93222 gene locus_tag LOCUS_07040 gene ftsX 94280 93222 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042003.1 protein_id gnl|my_center|LOCUS_07040 94941 94273 gene locus_tag LOCUS_07050 gene ftsE 94941 94273 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617723.1 protein_id gnl|my_center|LOCUS_07050 96440 94944 gene locus_tag LOCUS_07060 gene ftsY 96440 94944 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040676.1 protein_id gnl|my_center|LOCUS_07060 96590 97186 gene locus_tag LOCUS_07070 gene rsmD 96590 97186 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743193.1 protein_id gnl|my_center|LOCUS_07070 97176 97445 gene locus_tag LOCUS_07080 97176 97445 CDS product DUF1145 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295207.1 protein_id gnl|my_center|LOCUS_07080 97807 97448 gene locus_tag LOCUS_07090 97807 97448 CDS product DUF2500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042900.1 protein_id gnl|my_center|LOCUS_07090 97948 98574 gene locus_tag LOCUS_07100 97948 98574 CDS product lysoplasmalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964718.1 protein_id gnl|my_center|LOCUS_07100 98648 100846 gene locus_tag LOCUS_07110 gene zntA 98648 100846 CDS product Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106527.1 protein_id gnl|my_center|LOCUS_07110 101193 100948 gene locus_tag LOCUS_07120 gene tusA 101193 100948 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130621.1 protein_id gnl|my_center|LOCUS_07120 101414 102079 gene locus_tag LOCUS_07130 101414 102079 CDS product 7-cyano-7-deazaguanine/7-aminomethyl-7-deazaguanine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100467.1 protein_id gnl|my_center|LOCUS_07130 102152 102709 gene locus_tag LOCUS_07140 gene dcrB 102152 102709 CDS product phage sensitivity protein DcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001245295.1 protein_id gnl|my_center|LOCUS_07140 103930 102713 gene locus_tag LOCUS_07150 103930 102713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240225.1 protein_id gnl|my_center|LOCUS_07150 104062 105111 gene locus_tag LOCUS_07160 104062 105111 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297848.1 protein_id gnl|my_center|LOCUS_07160 105166 105753 gene locus_tag LOCUS_07170 gene acpT 105166 105753 CDS product 4'-phosphopantetheinyl transferase AcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285784.1 protein_id gnl|my_center|LOCUS_07170 105864 107438 gene locus_tag LOCUS_07180 gene nikA 105864 107438 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953344.1 protein_id gnl|my_center|LOCUS_07180 107438 108382 gene locus_tag LOCUS_07190 gene nikB 107438 108382 CDS product nickel ABC transporter permease subunit NikB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947068.1 protein_id gnl|my_center|LOCUS_07190 108379 109212 gene locus_tag LOCUS_07200 gene nikC 108379 109212 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008963.1 protein_id gnl|my_center|LOCUS_07200 109212 109976 gene locus_tag LOCUS_07210 gene nikD 109212 109976 CDS product nickel import ATP-binding protein NikD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136229.1 protein_id gnl|my_center|LOCUS_07210 109973 110779 gene locus_tag LOCUS_07220 gene nikE 109973 110779 CDS product nickel import ATP-binding protein NikE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173630.1 protein_id gnl|my_center|LOCUS_07220 110785 111186 gene locus_tag LOCUS_07230 gene nikR 110785 111186 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190062.1 protein_id gnl|my_center|LOCUS_07230 111665 111306 gene locus_tag LOCUS_07240 111665 111306 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593555.1 protein_id gnl|my_center|LOCUS_07240 111937 111662 gene locus_tag LOCUS_07250 111937 111662 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 protein_id gnl|my_center|LOCUS_07250 113134 112010 gene locus_tag LOCUS_07260 113134 112010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001314210.1 protein_id gnl|my_center|LOCUS_07260 115869 113134 gene locus_tag LOCUS_07270 gene rbbA 115869 113134 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149156.1 protein_id gnl|my_center|LOCUS_07270 116933 115866 gene locus_tag LOCUS_07280 116933 115866 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361470.1 protein_id gnl|my_center|LOCUS_07280 118921 117299 gene locus_tag LOCUS_07290 118921 117299 CDS product YhiJ/YhiL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001393583.1 protein_id gnl|my_center|LOCUS_07290 120541 119183 gene locus_tag LOCUS_07300 120541 119183 CDS product DUF4049 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069547.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07300 120425 120715 gene locus_tag LOCUS_07310 120425 120715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 121156 122208 gene locus_tag LOCUS_07320 121156 122208 CDS product DUF2776 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028905.1 protein_id gnl|my_center|LOCUS_07320 123726 122524 gene locus_tag LOCUS_07330 123726 122524 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439170.1 protein_id gnl|my_center|LOCUS_07330 123958 125457 gene locus_tag LOCUS_07340 gene pitA 123958 125457 CDS product inorganic phosphate transporter PitA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902780.1 protein_id gnl|my_center|LOCUS_07340 125863 125528 gene locus_tag LOCUS_07350 gene uspB 125863 125528 CDS product universal stress protein UspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626187.1 protein_id gnl|my_center|LOCUS_07350 126254 126688 gene locus_tag LOCUS_07360 gene uspA 126254 126688 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323571.1 protein_id gnl|my_center|LOCUS_07360 127051 126872 gene locus_tag LOCUS_07370 127051 126872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 127024 128475 gene locus_tag LOCUS_07380 gene dtpB 127024 128475 CDS product dipeptide/tripeptide permease DtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098652.1 protein_id gnl|my_center|LOCUS_07380 129276 128524 gene locus_tag LOCUS_07390 gene rsmJ 129276 128524 CDS product 16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686620.1 protein_id gnl|my_center|LOCUS_07390 131324 129282 gene locus_tag LOCUS_07400 gene prlC 131324 129282 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298719.1 protein_id gnl|my_center|LOCUS_07400 131527 132369 gene locus_tag LOCUS_07410 gene rlmJ 131527 132369 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954225.1 protein_id gnl|my_center|LOCUS_07410 132441 133793 gene locus_tag LOCUS_07420 gene gorA 132441 133793 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160808.1 protein_id gnl|my_center|LOCUS_07420 133996 133847 gene locus_tag LOCUS_07430 133996 133847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 133958 134131 gene locus_tag LOCUS_07440 133958 134131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059235695.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence06 360 1505 gene locus_tag LOCUS_07450 360 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07450 1518 2300 gene locus_tag LOCUS_07460 1518 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871667.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07460 3415 2516 gene locus_tag LOCUS_07470 gene nhaR 3415 2516 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062888.1 protein_id gnl|my_center|LOCUS_07470 4647 3481 gene locus_tag LOCUS_07480 gene nhaA 4647 3481 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681360.1 protein_id gnl|my_center|LOCUS_07480 5233 5385 gene locus_tag LOCUS_07490 gene mokC 5233 5385 CDS product type I toxin-antitoxin system toxin MokC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809168.1 protein_id gnl|my_center|LOCUS_07490 6619 5489 gene locus_tag LOCUS_07500 gene dnaJ 6619 5489 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_07500 8624 6708 gene locus_tag LOCUS_07510 gene dnaK 8624 6708 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516135.1 protein_id gnl|my_center|LOCUS_07510 9001 9405 gene locus_tag LOCUS_07520 9001 9405 CDS product DUF2541 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843559.1 protein_id gnl|my_center|LOCUS_07520 9431 10144 gene locus_tag LOCUS_07530 gene msyB 9431 10144 CDS product acidic protein MsyB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102379.1 protein_id gnl|my_center|LOCUS_07530 10293 10859 gene locus_tag LOCUS_07540 gene satP 10293 10859 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528538.1 protein_id gnl|my_center|LOCUS_07540 11481 10894 gene locus_tag LOCUS_07550 gene mog 11481 10894 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295414.1 protein_id gnl|my_center|LOCUS_07550 12549 11596 gene locus_tag LOCUS_07560 gene tal 12549 11596 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130189.1 protein_id gnl|my_center|LOCUS_07560 12828 14258 gene locus_tag LOCUS_07570 12828 14258 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112597.1 protein_id gnl|my_center|LOCUS_07570 14328 15104 gene locus_tag LOCUS_07580 gene yaaA 14328 15104 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906203.1 protein_id gnl|my_center|LOCUS_07580 15414 15253 gene locus_tag LOCUS_07590 15414 15253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 17053 15767 gene locus_tag LOCUS_07600 gene thrC 17053 15767 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781063.1 protein_id gnl|my_center|LOCUS_07600 17986 17054 gene locus_tag LOCUS_07610 gene thrB 17986 17054 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241660.1 protein_id gnl|my_center|LOCUS_07610 20450 17988 gene locus_tag LOCUS_07620 gene thrA 20450 17988 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264697.1 protein_id gnl|my_center|LOCUS_07620 21496 20810 gene locus_tag LOCUS_07630 21496 20810 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223177.1 protein_id gnl|my_center|LOCUS_07630 22132 22848 gene locus_tag LOCUS_07640 gene arcA 22132 22848 CDS product two-component system response regulator ArcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194358.1 protein_id gnl|my_center|LOCUS_07640 24260 22908 gene locus_tag LOCUS_07650 gene creD 24260 22908 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920337.1 protein_id gnl|my_center|LOCUS_07650 25742 24318 gene locus_tag LOCUS_07660 gene creC 25742 24318 CDS product two-component system sensor histidine kinase CreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219611.1 protein_id gnl|my_center|LOCUS_07660 26431 25742 gene locus_tag LOCUS_07670 gene creB 26431 25742 CDS product two-component system response regulator CreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188679.1 protein_id gnl|my_center|LOCUS_07670 26917 26444 gene locus_tag LOCUS_07680 gene creA 26917 26444 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875487.1 protein_id gnl|my_center|LOCUS_07680 27128 27997 gene locus_tag LOCUS_07690 gene robA 27128 27997 CDS product MDR efflux pump AcrAB transcriptional activator RobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371666.1 protein_id gnl|my_center|LOCUS_07690 28641 27994 gene locus_tag LOCUS_07700 gene gpmB 28641 27994 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942344.1 protein_id gnl|my_center|LOCUS_07700 28684 29214 gene locus_tag LOCUS_07710 gene yjjX 28684 29214 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001341279.1 protein_id gnl|my_center|LOCUS_07710 29625 29299 gene locus_tag LOCUS_07720 gene trpR 29625 29299 CDS product trp operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068679.1 protein_id gnl|my_center|LOCUS_07720 31652 29715 gene locus_tag LOCUS_07730 gene sltY 31652 29715 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409453.1 protein_id gnl|my_center|LOCUS_07730 31863 33530 gene locus_tag LOCUS_07740 gene ettA 31863 33530 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046749.1 protein_id gnl|my_center|LOCUS_07740 35069 33837 gene locus_tag LOCUS_07750 gene nadR 35069 33837 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093810.1 protein_id gnl|my_center|LOCUS_07750 36472 35090 gene locus_tag LOCUS_07760 gene radA 36472 35090 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029698.1 protein_id gnl|my_center|LOCUS_07760 37489 36521 gene locus_tag LOCUS_07770 gene serB 37489 36521 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132955.1 protein_id gnl|my_center|LOCUS_07770 37595 38239 gene locus_tag LOCUS_07780 37595 38239 CDS product YtjB family periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124615.1 protein_id gnl|my_center|LOCUS_07780 38267 39283 gene locus_tag LOCUS_07790 gene lplA 38267 39283 CDS product lipoate--protein ligase LplA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105898.1 protein_id gnl|my_center|LOCUS_07790 39315 39464 gene locus_tag LOCUS_07800 39315 39464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07800 40458 39739 gene locus_tag LOCUS_07810 gene deoD 40458 39739 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224877.1 protein_id gnl|my_center|LOCUS_07810 41761 40538 gene locus_tag LOCUS_07820 gene deoB 41761 40538 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816471.1 protein_id gnl|my_center|LOCUS_07820 43135 41813 gene locus_tag LOCUS_07830 gene deoA 43135 41813 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477811.1 protein_id gnl|my_center|LOCUS_07830 44041 43262 gene locus_tag LOCUS_07840 gene deoC 44041 43262 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295412.1 protein_id gnl|my_center|LOCUS_07840 44299 45849 gene locus_tag LOCUS_07850 44299 45849 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143253.1 protein_id gnl|my_center|LOCUS_07850 45980 46684 gene locus_tag LOCUS_07860 45980 46684 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088391.1 protein_id gnl|my_center|LOCUS_07860 47579 46797 gene locus_tag LOCUS_07870 47579 46797 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000563014.1 protein_id gnl|my_center|LOCUS_07870 48649 47576 gene locus_tag LOCUS_07880 48649 47576 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299799.1 protein_id gnl|my_center|LOCUS_07880 48932 48771 gene locus_tag LOCUS_07890 48932 48771 CDS product DUF1328 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176651.1 protein_id gnl|my_center|LOCUS_07890 49664 49059 gene locus_tag LOCUS_07900 gene osmY 49664 49059 CDS product molecular chaperone OsmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295748.1 protein_id gnl|my_center|LOCUS_07900 51646 50057 gene locus_tag LOCUS_07910 gene prfC 51646 50057 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000175940.1 protein_id gnl|my_center|LOCUS_07910 52414 51737 gene locus_tag LOCUS_07920 gene yjjG 52414 51737 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870703.1 protein_id gnl|my_center|LOCUS_07920 52875 52429 gene locus_tag LOCUS_07930 gene rimI 52875 52429 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_07930 53257 52844 gene locus_tag LOCUS_07940 gene holD 53257 52844 CDS product DNA polymerase III subunit psi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204018.1 protein_id gnl|my_center|LOCUS_07940 53360 54391 gene locus_tag LOCUS_07950 gene rsmC 53360 54391 CDS product 16S rRNA (guanine(1207)-N(2))-methyltransferase RsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272330.1 protein_id gnl|my_center|LOCUS_07950 54692 54778 gene locus_tag LOCUS_t00120 54692 54778 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55053 54817 gene locus_tag LOCUS_07960 55053 54817 CDS product DUF1435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350368.1 protein_id gnl|my_center|LOCUS_07960 55194 55982 gene locus_tag LOCUS_07970 gene fhuF 55194 55982 CDS product siderophore-iron reductase FhuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331556.1 protein_id gnl|my_center|LOCUS_07970 56643 56020 gene locus_tag LOCUS_07980 gene bglJ 56643 56020 CDS product DNA-binding transcriptional activator BglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301727.1 protein_id gnl|my_center|LOCUS_07980 57380 56655 gene locus_tag LOCUS_07990 57380 56655 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936635.1 protein_id gnl|my_center|LOCUS_07990 57945 58769 gene locus_tag LOCUS_08000 57945 58769 CDS product threonine/serine exporter ThrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307560.1 protein_id gnl|my_center|LOCUS_08000 58760 59233 gene locus_tag LOCUS_08010 58760 59233 CDS product threonine/serine exporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538176.1 protein_id gnl|my_center|LOCUS_08010 59341 59880 gene locus_tag LOCUS_08020 gene dnaT 59341 59880 CDS product primosomal protein DnaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098818.1 protein_id gnl|my_center|LOCUS_08020 59883 60620 gene locus_tag LOCUS_08030 gene dnaC 59883 60620 CDS product DNA replication protein DnaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799911.1 protein_id gnl|my_center|LOCUS_08030 60672 61163 gene locus_tag LOCUS_08040 gene yjjA 60672 61163 CDS product DUF2501 domain-containing protein YjjA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001308243.1 protein_id gnl|my_center|LOCUS_08040 61417 63708 gene locus_tag LOCUS_08050 gene opgB 61417 63708 CDS product phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292674.1 protein_id gnl|my_center|LOCUS_08050 64869 63847 gene locus_tag LOCUS_08060 gene lgoD 64869 63847 CDS product L-galactonate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106033.1 protein_id gnl|my_center|LOCUS_08060 65008 65922 gene locus_tag LOCUS_08070 65008 65922 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091572.1 protein_id gnl|my_center|LOCUS_08070 66137 67498 gene locus_tag LOCUS_08080 66137 67498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410144.1 protein_id gnl|my_center|LOCUS_08080 69202 67547 gene locus_tag LOCUS_08090 gene tsr 69202 67547 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919536.1 protein_id gnl|my_center|LOCUS_08090 69767 69321 gene locus_tag LOCUS_08100 gene hpaR 69767 69321 CDS product homoprotocatechuate degradation operon regulator HpaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543916.1 protein_id gnl|my_center|LOCUS_08100 70039 71328 gene locus_tag LOCUS_08110 gene hpaG 70039 71328 CDS product 4-hydroxyphenylacetate degradation bifunctional isomerase/decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000679076.1 protein_id gnl|my_center|LOCUS_08110 71325 72791 gene locus_tag LOCUS_08120 gene hpaE 71325 72791 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_08120 72793 73644 gene locus_tag LOCUS_08130 gene hpaD 72793 73644 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516990.1 protein_id gnl|my_center|LOCUS_08130 73654 74034 gene locus_tag LOCUS_08140 73654 74034 CDS product 5-carboxymethyl-2-hydroxymuconate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001119868.1 protein_id gnl|my_center|LOCUS_08140 74102 74905 gene locus_tag LOCUS_08150 gene hpaH 74102 74905 CDS product 2-oxo-hepta-3-ene-1,7-dioic acid hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459750.1 protein_id gnl|my_center|LOCUS_08150 74916 75704 gene locus_tag LOCUS_08160 gene hpaI 74916 75704 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431692.1 protein_id gnl|my_center|LOCUS_08160 75879 77255 gene locus_tag LOCUS_08170 gene hpaX 75879 77255 CDS product 4-hydroxyphenylacetate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285769.1 protein_id gnl|my_center|LOCUS_08170 77265 78155 gene locus_tag LOCUS_08180 gene hpaA 77265 78155 CDS product 4-hydroxyphenylacetate catabolism regulatory protein HpaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205639.1 protein_id gnl|my_center|LOCUS_08180 78406 79968 gene locus_tag LOCUS_08190 gene hpaB 78406 79968 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801481.1 protein_id gnl|my_center|LOCUS_08190 79986 80498 gene locus_tag LOCUS_08200 79986 80498 CDS product 4-hydroxyphenylacetate 3-monooxygenase reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175460.1 protein_id gnl|my_center|LOCUS_08200 80876 83041 gene locus_tag LOCUS_08210 gene btsT 80876 83041 CDS product pyruvate/proton symporter BtsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117680.1 protein_id gnl|my_center|LOCUS_08210 83091 83294 gene locus_tag LOCUS_08220 83091 83294 CDS product YbdD/YjiX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467859.1 protein_id gnl|my_center|LOCUS_08220 83305 84261 gene locus_tag LOCUS_08230 gene yjiA 83305 84261 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068090.1 protein_id gnl|my_center|LOCUS_08230 86879 84339 gene locus_tag LOCUS_08240 86879 84339 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206901.1 protein_id gnl|my_center|LOCUS_08240 87426 87277 gene locus_tag LOCUS_08250 87426 87277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 87572 88984 gene locus_tag LOCUS_08260 87572 88984 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199300.1 protein_id gnl|my_center|LOCUS_08260 90170 89226 gene locus_tag LOCUS_08270 90170 89226 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181149.1 protein_id gnl|my_center|LOCUS_08270 90637 91869 gene locus_tag LOCUS_08280 gene mdtM 90637 91869 CDS product multidrug efflux MFS transporter MdtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136983.1 protein_id gnl|my_center|LOCUS_08280 91943 93190 gene locus_tag LOCUS_08290 91943 93190 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037419.1 protein_id gnl|my_center|LOCUS_08290 93306 94457 gene locus_tag LOCUS_08300 93306 94457 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298064.1 protein_id gnl|my_center|LOCUS_08300 94467 95234 gene locus_tag LOCUS_08310 gene yjiL 94467 95234 CDS product putative 2-hydroxyacyl-CoA dehydratase activator YjiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222495.1 protein_id gnl|my_center|LOCUS_08310 95231 95488 gene locus_tag LOCUS_08320 95231 95488 CDS product DUF3343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657676.1 protein_id gnl|my_center|LOCUS_08320 95553 96413 gene locus_tag LOCUS_08330 95553 96413 CDS product YjiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253426.1 protein_id gnl|my_center|LOCUS_08330 96481 97659 gene locus_tag LOCUS_08340 96481 97659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141192.1 protein_id gnl|my_center|LOCUS_08340 98225 97776 gene locus_tag LOCUS_08350 98225 97776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08350 98475 99158 gene locus_tag LOCUS_08360 98475 99158 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295597.1 protein_id gnl|my_center|LOCUS_08360 99155 99616 gene locus_tag LOCUS_08370 99155 99616 CDS product YjiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211971.1 protein_id gnl|my_center|LOCUS_08370 99629 100801 gene locus_tag LOCUS_08380 gene iadA 99629 100801 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568432.1 protein_id gnl|my_center|LOCUS_08380 100866 101777 gene locus_tag LOCUS_08390 gene hypT 100866 101777 CDS product hypochlorite stress DNA-binding transcriptional regulator HypT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340758.1 protein_id gnl|my_center|LOCUS_08390 102021 101770 gene locus_tag LOCUS_08400 102021 101770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 102835 103665 gene locus_tag LOCUS_08410 102835 103665 CDS product DUF2686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062596.1 protein_id gnl|my_center|LOCUS_08410 104579 103806 gene locus_tag LOCUS_08420 gene uxuR 104579 103806 CDS product Uxu operon transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833679.1 protein_id gnl|my_center|LOCUS_08420 106254 104794 gene locus_tag LOCUS_08430 106254 104794 CDS product fructuronate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208185.1 protein_id gnl|my_center|LOCUS_08430 107519 106335 gene locus_tag LOCUS_08440 gene uxuA 107519 106335 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438591.1 protein_id gnl|my_center|LOCUS_08440 107859 109202 gene locus_tag LOCUS_08450 gene gntP 107859 109202 CDS product gluconate permease GntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558251.1 protein_id gnl|my_center|LOCUS_08450 110348 109446 gene locus_tag LOCUS_08460 gene fimH 110348 109446 CDS product type 1 fimbria D-mannose specific adhesin FimH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832247.1 protein_id gnl|my_center|LOCUS_08460 110871 110368 gene locus_tag LOCUS_08470 gene fimG 110871 110368 CDS product type 1 fimbria minor subunit FimG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872005.1 protein_id gnl|my_center|LOCUS_08470 111414 110884 gene locus_tag LOCUS_08480 gene fimF 111414 110884 CDS product type 1 fimbria minor subunit FimF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244826.1 protein_id gnl|my_center|LOCUS_08480 114060 111424 gene locus_tag LOCUS_08490 gene fimD 114060 111424 CDS product fimbrial usher FimD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120940.1 protein_id gnl|my_center|LOCUS_08490 114852 114127 gene locus_tag LOCUS_08500 gene fimC 114852 114127 CDS product type 1 fimbria chaperone FimC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066560.1 protein_id gnl|my_center|LOCUS_08500 115386 114889 gene locus_tag LOCUS_08510 115386 114889 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824114.1 protein_id gnl|my_center|LOCUS_08510 116041 115493 gene locus_tag LOCUS_08520 gene fimA 116041 115493 CDS product type 1 fimbrial major subunit FimA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695529.1 protein_id gnl|my_center|LOCUS_08520 117117 116521 gene locus_tag LOCUS_08530 gene fimE 117117 116521 CDS product type 1 fimbria switch DNA invertase FimE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044711.1 protein_id gnl|my_center|LOCUS_08530 119654 120370 gene locus_tag LOCUS_08540 gene nanC 119654 120370 CDS product N-acetylneuraminic acid outer membrane channel NanC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295734.1 protein_id gnl|my_center|LOCUS_08540 120390 121496 gene locus_tag LOCUS_08550 gene nanM 120390 121496 CDS product N-acetylneuraminate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309184.1 protein_id gnl|my_center|LOCUS_08550 121534 122541 gene locus_tag LOCUS_08560 121534 122541 CDS product 9-O-acetyl-N-acetylneuraminic acid deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991438.1 protein_id gnl|my_center|LOCUS_08560 122753 123625 gene locus_tag LOCUS_08570 122753 123625 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168589.1 protein_id gnl|my_center|LOCUS_08570 123795 125870 gene locus_tag LOCUS_08580 123795 125870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 125863 127206 gene locus_tag LOCUS_08590 125863 127206 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209167.1 protein_id gnl|my_center|LOCUS_08590 127203 127589 gene locus_tag LOCUS_08600 127203 127589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 127640 129787 gene locus_tag LOCUS_08610 127640 129787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 129787 131241 gene locus_tag LOCUS_08620 129787 131241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 131277 132563 gene locus_tag LOCUS_08630 131277 132563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence07 724 68 gene locus_tag LOCUS_08640 724 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2236 1973 gene locus_tag LOCUS_08650 gene rpsT 2236 1973 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_08650 2619 3506 gene locus_tag LOCUS_08660 gene ribF 2619 3506 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767329.1 protein_id gnl|my_center|LOCUS_08660 3549 6365 gene locus_tag LOCUS_08670 gene ileS 3549 6365 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286857.1 protein_id gnl|my_center|LOCUS_08670 6365 6859 gene locus_tag LOCUS_08680 gene lspA 6365 6859 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083369.1 protein_id gnl|my_center|LOCUS_08680 6947 7396 gene locus_tag LOCUS_08690 gene fkpB 6947 7396 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004655.1 protein_id gnl|my_center|LOCUS_08690 7398 8348 gene locus_tag LOCUS_08700 gene ispH 7398 8348 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166389.1 protein_id gnl|my_center|LOCUS_08700 8414 9328 gene locus_tag LOCUS_08710 gene rihC 8414 9328 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239142.1 protein_id gnl|my_center|LOCUS_08710 9495 10316 gene locus_tag LOCUS_08720 gene dapB 9495 10316 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543605.1 protein_id gnl|my_center|LOCUS_08720 10525 10358 gene locus_tag LOCUS_08730 10525 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 10772 11920 gene locus_tag LOCUS_08740 gene carA 10772 11920 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597260.1 protein_id gnl|my_center|LOCUS_08740 11938 15159 gene locus_tag LOCUS_08750 gene carB 11938 15159 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126376.1 protein_id gnl|my_center|LOCUS_08750 15385 15167 gene locus_tag LOCUS_08760 15385 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196529.1 protein_id gnl|my_center|LOCUS_08760 15420 15815 gene locus_tag LOCUS_08770 gene caiF 15420 15815 CDS product carnitine metabolism transcriptional regulator CaiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333120.1 protein_id gnl|my_center|LOCUS_08770 16491 15901 gene locus_tag LOCUS_08780 gene caiE 16491 15901 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122876.1 protein_id gnl|my_center|LOCUS_08780 17282 16497 gene locus_tag LOCUS_08790 gene caiD 17282 16497 CDS product crotonobetainyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004397.1 protein_id gnl|my_center|LOCUS_08790 18944 17391 gene locus_tag LOCUS_08800 gene caiC 18944 17391 CDS product crotonobetaine/carnitine-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386575.1 protein_id gnl|my_center|LOCUS_08800 20235 19018 gene locus_tag LOCUS_08810 gene caiB 20235 19018 CDS product L-carnitine CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349932.1 protein_id gnl|my_center|LOCUS_08810 21506 20364 gene locus_tag LOCUS_08820 gene caiA 21506 20364 CDS product crotonobetainyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347117.1 protein_id gnl|my_center|LOCUS_08820 22877 21537 gene locus_tag LOCUS_08830 gene caiT 22877 21537 CDS product L-carnitine/gamma-butyrobetaine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787109.1 protein_id gnl|my_center|LOCUS_08830 23525 24295 gene locus_tag LOCUS_08840 23525 24295 CDS product electron transfer flavoprotein FixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331240.1 protein_id gnl|my_center|LOCUS_08840 24310 25251 gene locus_tag LOCUS_08850 24310 25251 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091525.1 protein_id gnl|my_center|LOCUS_08850 25302 26588 gene locus_tag LOCUS_08860 25302 26588 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287715.1 protein_id gnl|my_center|LOCUS_08860 26585 26872 gene locus_tag LOCUS_08870 gene fixX 26585 26872 CDS product ferredoxin-like protein FixX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203747.1 protein_id gnl|my_center|LOCUS_08870 26930 28261 gene locus_tag LOCUS_08880 26930 28261 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183198.1 protein_id gnl|my_center|LOCUS_08880 28369 28899 gene locus_tag LOCUS_08890 gene kefF 28369 28899 CDS product glutathione-regulated potassium-efflux system oxidoreductase KefF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600725.1 protein_id gnl|my_center|LOCUS_08890 28892 30754 gene locus_tag LOCUS_08900 gene kefC 28892 30754 CDS product glutathione-regulated potassium-efflux system protein KefC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377194.1 protein_id gnl|my_center|LOCUS_08900 30835 31425 gene locus_tag LOCUS_08910 gene folA 30835 31425 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301983.1 protein_id gnl|my_center|LOCUS_08910 32345 31503 gene locus_tag LOCUS_08920 gene apaH 32345 31503 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257186.1 protein_id gnl|my_center|LOCUS_08920 32729 32352 gene locus_tag LOCUS_08930 gene apaG 32729 32352 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610901.1 protein_id gnl|my_center|LOCUS_08930 33553 32732 gene locus_tag LOCUS_08940 gene rsmA 33553 32732 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065381.1 protein_id gnl|my_center|LOCUS_08940 34539 33550 gene locus_tag LOCUS_08950 gene pdxA 34539 33550 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241259.1 protein_id gnl|my_center|LOCUS_08950 35825 34539 gene locus_tag LOCUS_08960 gene surA 35825 34539 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800457.1 protein_id gnl|my_center|LOCUS_08960 38232 35878 gene locus_tag LOCUS_08970 gene lptD 38232 35878 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746151.1 protein_id gnl|my_center|LOCUS_08970 38487 39302 gene locus_tag LOCUS_08980 gene djlA 38487 39302 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200573.1 protein_id gnl|my_center|LOCUS_08980 40078 39419 gene locus_tag LOCUS_08990 gene rluA 40078 39419 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525176.1 protein_id gnl|my_center|LOCUS_08990 42996 40090 gene locus_tag LOCUS_09000 gene rapA 42996 40090 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117011.1 protein_id gnl|my_center|LOCUS_09000 45512 43161 gene locus_tag LOCUS_09010 gene polB 45512 43161 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000035654.1 protein_id gnl|my_center|LOCUS_09010 46282 45587 gene locus_tag LOCUS_09020 gene araD 46282 45587 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888666.1 protein_id gnl|my_center|LOCUS_09020 47953 46451 gene locus_tag LOCUS_09030 gene araA 47953 46451 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151734.1 protein_id gnl|my_center|LOCUS_09030 49664 47964 gene locus_tag LOCUS_09040 gene araB 49664 47964 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951795.1 protein_id gnl|my_center|LOCUS_09040 49952 50881 gene locus_tag LOCUS_09050 gene araC 49952 50881 CDS product arabinose operon transcriptional regulator AraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300811.1 protein_id gnl|my_center|LOCUS_09050 50967 51731 gene locus_tag LOCUS_09060 50967 51731 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148402.1 protein_id gnl|my_center|LOCUS_09060 52543 51845 gene locus_tag LOCUS_09070 gene thiQ 52543 51845 CDS product thiamine ABC transporter ATP-binding protein ThiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916310.1 protein_id gnl|my_center|LOCUS_09070 54137 52527 gene locus_tag LOCUS_09080 gene thiP 54137 52527 CDS product thiamine/thiamine pyrophosphate ABC transporter permease ThiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235706.1 protein_id gnl|my_center|LOCUS_09080 55096 54113 gene locus_tag LOCUS_09090 gene thiB 55096 54113 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053588.1 protein_id gnl|my_center|LOCUS_09090 56915 55260 gene locus_tag LOCUS_09100 gene sgrR 56915 55260 CDS product DNA-binding transcriptional regulator SgrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138624.1 protein_id gnl|my_center|LOCUS_09100 57004 57135 gene locus_tag LOCUS_09110 gene sgrT 57004 57135 CDS product glucose uptake inhibitor SgrT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248770.1 protein_id gnl|my_center|LOCUS_09110 57113 57364 gene locus_tag LOCUS_09120 57113 57364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 57255 58415 gene locus_tag LOCUS_09130 gene setA 57255 58415 CDS product sugar efflux transporter SetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637846.1 protein_id gnl|my_center|LOCUS_09130 59069 58464 gene locus_tag LOCUS_09140 gene leuD 59069 58464 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818228.1 protein_id gnl|my_center|LOCUS_09140 60480 59080 gene locus_tag LOCUS_09150 gene leuC 60480 59080 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140652.1 protein_id gnl|my_center|LOCUS_09150 61574 60483 gene locus_tag LOCUS_09160 gene leuB 61574 60483 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042353.1 protein_id gnl|my_center|LOCUS_09160 63145 61574 gene locus_tag LOCUS_09170 gene leuA 63145 61574 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082846.1 protein_id gnl|my_center|LOCUS_09170 63966 64928 gene locus_tag LOCUS_09180 gene leuO 63966 64928 CDS product transcriptional regulator LeuO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001395589.1 protein_id gnl|my_center|LOCUS_09180 65246 66970 gene locus_tag LOCUS_09190 gene ilvI 65246 66970 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425657.1 protein_id gnl|my_center|LOCUS_09190 66943 67464 gene locus_tag LOCUS_09200 gene ilvN 66943 67464 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252744.1 protein_id gnl|my_center|LOCUS_09200 67644 68648 gene locus_tag LOCUS_09210 gene cra 67644 68648 CDS product catabolite repressor/activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762401.1 protein_id gnl|my_center|LOCUS_09210 69250 69708 gene locus_tag LOCUS_09220 gene mraZ 69250 69708 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295770.1 protein_id gnl|my_center|LOCUS_09220 69710 70651 gene locus_tag LOCUS_09230 gene rsmH 69710 70651 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970479.1 protein_id gnl|my_center|LOCUS_09230 70648 71013 gene locus_tag LOCUS_09240 gene ftsL 70648 71013 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625658.1 protein_id gnl|my_center|LOCUS_09240 71029 72795 gene locus_tag LOCUS_09250 gene ftsI 71029 72795 CDS product peptidoglycan glycosyltransferase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642196.1 protein_id gnl|my_center|LOCUS_09250 72782 74269 gene locus_tag LOCUS_09260 gene murE 72782 74269 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785141.1 protein_id gnl|my_center|LOCUS_09260 74266 75624 gene locus_tag LOCUS_09270 gene murF 74266 75624 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626688.1 protein_id gnl|my_center|LOCUS_09270 75618 76700 gene locus_tag LOCUS_09280 gene mraY 75618 76700 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964131.1 protein_id gnl|my_center|LOCUS_09280 76703 78019 gene locus_tag LOCUS_09290 gene murD 76703 78019 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796468.1 protein_id gnl|my_center|LOCUS_09290 78019 79263 gene locus_tag LOCUS_09300 gene ftsW 78019 79263 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295532.1 protein_id gnl|my_center|LOCUS_09300 79284 80327 gene locus_tag LOCUS_09310 gene murG 79284 80327 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016559.1 protein_id gnl|my_center|LOCUS_09310 80381 81856 gene locus_tag LOCUS_09320 gene murC 80381 81856 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096048.1 protein_id gnl|my_center|LOCUS_09320 81849 82769 gene locus_tag LOCUS_09330 gene ddlB 81849 82769 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130056.1 protein_id gnl|my_center|LOCUS_09330 82771 83601 gene locus_tag LOCUS_09340 gene ftsQ 82771 83601 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075744.1 protein_id gnl|my_center|LOCUS_09340 83598 84860 gene locus_tag LOCUS_09350 gene ftsA 83598 84860 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588474.1 protein_id gnl|my_center|LOCUS_09350 84921 86072 gene locus_tag LOCUS_09360 gene ftsZ 84921 86072 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462776.1 protein_id gnl|my_center|LOCUS_09360 86173 87090 gene locus_tag LOCUS_09370 gene lpxC 86173 87090 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595482.1 protein_id gnl|my_center|LOCUS_09370 87246 87833 gene locus_tag LOCUS_09380 gene secM 87246 87833 CDS product secA translation cis-regulator SecM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014321.1 protein_id gnl|my_center|LOCUS_09380 87895 90600 gene locus_tag LOCUS_09390 gene secA 87895 90600 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905789.1 protein_id gnl|my_center|LOCUS_09390 90660 91049 gene locus_tag LOCUS_09400 gene mutT 90660 91049 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736013.1 protein_id gnl|my_center|LOCUS_09400 91346 91149 gene locus_tag LOCUS_09410 gene yacG 91346 91149 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005042.1 protein_id gnl|my_center|LOCUS_09410 92099 91356 gene locus_tag LOCUS_09420 gene zapD 92099 91356 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194734.1 protein_id gnl|my_center|LOCUS_09420 92719 92099 gene locus_tag LOCUS_09430 gene coaE 92719 92099 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269520.1 protein_id gnl|my_center|LOCUS_09430 92944 93987 gene locus_tag LOCUS_09440 gene guaC 92944 93987 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217338.1 protein_id gnl|my_center|LOCUS_09440 95224 94022 gene locus_tag LOCUS_09450 gene hofC 95224 94022 CDS product protein transport protein HofC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157234.1 protein_id gnl|my_center|LOCUS_09450 96599 95214 gene locus_tag LOCUS_09460 gene gspE 96599 95214 CDS product type II secretion system protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025173.1 protein_id gnl|my_center|LOCUS_09460 97049 96609 gene locus_tag LOCUS_09470 gene ppdD 97049 96609 CDS product prepilin peptidase-dependent pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360895.1 protein_id gnl|my_center|LOCUS_09470 98145 97252 gene locus_tag LOCUS_09480 gene nadC 98145 97252 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135174.1 protein_id gnl|my_center|LOCUS_09480 98233 98784 gene locus_tag LOCUS_09490 gene ampD 98233 98784 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923721.1 protein_id gnl|my_center|LOCUS_09490 98781 99635 gene locus_tag LOCUS_09500 gene ampE 98781 99635 CDS product beta-lactamase regulator AmpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172005.1 protein_id gnl|my_center|LOCUS_09500 101051 99678 gene locus_tag LOCUS_09510 gene aroP 101051 99678 CDS product aromatic amino acid transporter AroP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969915.1 protein_id gnl|my_center|LOCUS_09510 101592 102356 gene locus_tag LOCUS_09520 gene pdhR 101592 102356 CDS product pyruvate dehydrogenase complex transcriptional repressor PdhR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331776.1 protein_id gnl|my_center|LOCUS_09520 102517 105180 gene locus_tag LOCUS_09530 gene aceE 102517 105180 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003820.1 protein_id gnl|my_center|LOCUS_09530 105195 107087 gene locus_tag LOCUS_09540 gene aceF 105195 107087 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963564.1 protein_id gnl|my_center|LOCUS_09540 107412 108836 gene locus_tag LOCUS_09550 gene lpdA 107412 108836 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102485.1 protein_id gnl|my_center|LOCUS_09550 110565 108907 gene locus_tag LOCUS_09560 110565 108907 CDS product DUF3300 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784502.1 protein_id gnl|my_center|LOCUS_09560 111019 113616 gene locus_tag LOCUS_09570 gene acnB 111019 113616 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307570.1 protein_id gnl|my_center|LOCUS_09570 113791 114153 gene locus_tag LOCUS_09580 gene yacL 113791 114153 CDS product protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384306.1 protein_id gnl|my_center|LOCUS_09580 114985 114191 gene locus_tag LOCUS_09590 gene speD 114985 114191 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734287.1 protein_id gnl|my_center|LOCUS_09590 115867 115001 gene locus_tag LOCUS_09600 gene speE 115867 115001 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818411.1 protein_id gnl|my_center|LOCUS_09600 116299 115973 gene locus_tag LOCUS_09610 116299 115973 CDS product YacC family pilotin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295568.1 protein_id gnl|my_center|LOCUS_09610 116486 118036 gene locus_tag LOCUS_09620 gene cueO 116486 118036 CDS product multicopper oxidase CueO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189647.1 protein_id gnl|my_center|LOCUS_09620 120473 118083 gene locus_tag LOCUS_09630 gene gcd 120473 118083 CDS product quinoprotein glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349940.1 protein_id gnl|my_center|LOCUS_09630 120679 121215 gene locus_tag LOCUS_09640 gene hpt 120679 121215 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683335.1 protein_id gnl|my_center|LOCUS_09640 121918 121256 gene locus_tag LOCUS_09650 gene can 121918 121256 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651599.1 protein_id gnl|my_center|LOCUS_09650 122027 122953 gene locus_tag LOCUS_09660 122027 122953 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150637.1 protein_id gnl|my_center|LOCUS_09660 122950 123720 gene locus_tag LOCUS_09670 122950 123720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972203.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence08 682 239 gene locus_tag LOCUS_09680 682 239 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236960.1 protein_id gnl|my_center|LOCUS_09680 839 1768 gene locus_tag LOCUS_09690 gene metA 839 1768 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122782.1 protein_id gnl|my_center|LOCUS_09690 2037 3638 gene locus_tag LOCUS_09700 gene aceB 2037 3638 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138905.1 protein_id gnl|my_center|LOCUS_09700 3668 4972 gene locus_tag LOCUS_09710 gene aceA 3668 4972 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857856.1 protein_id gnl|my_center|LOCUS_09710 5156 6892 gene locus_tag LOCUS_09720 gene aceK 5156 6892 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137214.1 protein_id gnl|my_center|LOCUS_09720 7172 6861 gene locus_tag LOCUS_09730 7172 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 8434 7214 gene locus_tag LOCUS_09740 8434 7214 CDS product ShET2/EspL2 family type III secretion system effector toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000632888.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 9575 8751 gene locus_tag LOCUS_09750 gene iclR 9575 8751 CDS product glyoxylate bypass operon transcriptional repressor IclR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226403.1 protein_id gnl|my_center|LOCUS_09750 9775 13458 gene locus_tag LOCUS_09760 gene metH 9775 13458 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096011.1 protein_id gnl|my_center|LOCUS_09760 13678 15309 gene locus_tag LOCUS_09770 13678 15309 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956830.1 protein_id gnl|my_center|LOCUS_09770 16089 15400 gene locus_tag LOCUS_09780 gene pepE 16089 15400 CDS product dipeptidase PepE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421763.1 protein_id gnl|my_center|LOCUS_09780 16301 17173 gene locus_tag LOCUS_09790 gene rluF 16301 17173 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936361.1 protein_id gnl|my_center|LOCUS_09790 17446 17174 gene locus_tag LOCUS_09800 17446 17174 CDS product DUF3811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207635.1 protein_id gnl|my_center|LOCUS_09800 17976 19103 gene locus_tag LOCUS_09810 17976 19103 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592029.1 protein_id gnl|my_center|LOCUS_09810 19136 19900 gene locus_tag LOCUS_09820 19136 19900 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130548.1 protein_id gnl|my_center|LOCUS_09820 20862 19936 gene locus_tag LOCUS_09830 20862 19936 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212693.1 protein_id gnl|my_center|LOCUS_09830 22356 21007 gene locus_tag LOCUS_09840 gene lysC 22356 21007 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290316.1 protein_id gnl|my_center|LOCUS_09840 22881 24530 gene locus_tag LOCUS_09850 gene pgi 22881 24530 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789986.1 protein_id gnl|my_center|LOCUS_09850 24885 25127 gene locus_tag LOCUS_09860 24885 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 25241 25879 gene locus_tag LOCUS_09870 25241 25879 CDS product YjbF family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296632.1 protein_id gnl|my_center|LOCUS_09870 25876 26613 gene locus_tag LOCUS_09880 25876 26613 CDS product capsule biosynthesis GfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595558.1 protein_id gnl|my_center|LOCUS_09880 26613 28709 gene locus_tag LOCUS_09890 26613 28709 CDS product YjbH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745776.1 protein_id gnl|my_center|LOCUS_09890 29304 29714 gene locus_tag LOCUS_09900 gene psiE 29304 29714 CDS product phosphate-starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202902.1 protein_id gnl|my_center|LOCUS_09900 31233 29758 gene locus_tag LOCUS_09910 gene xylE 31233 29758 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097274.1 protein_id gnl|my_center|LOCUS_09910 32495 31605 gene locus_tag LOCUS_09920 gene malG 32495 31605 CDS product maltose ABC transporter permease MalG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252058.1 protein_id gnl|my_center|LOCUS_09920 34054 32510 gene locus_tag LOCUS_09930 gene malF 34054 32510 CDS product maltose ABC transporter permease MalF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297290.1 protein_id gnl|my_center|LOCUS_09930 35398 34208 gene locus_tag LOCUS_09940 gene malE 35398 34208 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695387.1 protein_id gnl|my_center|LOCUS_09940 35763 36878 gene locus_tag LOCUS_09950 gene malK 35763 36878 CDS product maltose/maltodextrin ABC transporter ATP-binding protein MalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179165.1 protein_id gnl|my_center|LOCUS_09950 36950 38290 gene locus_tag LOCUS_09960 gene lamB 36950 38290 CDS product maltoporin LamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973658.1 protein_id gnl|my_center|LOCUS_09960 38533 39453 gene locus_tag LOCUS_09970 gene malM 38533 39453 CDS product maltose operon protein MalM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783444.1 protein_id gnl|my_center|LOCUS_09970 39682 39876 gene locus_tag LOCUS_09980 39682 39876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623309.1 protein_id gnl|my_center|LOCUS_09980 39967 41262 gene locus_tag LOCUS_09990 39967 41262 CDS product SopA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579094.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09990 41485 41982 gene locus_tag LOCUS_10000 gene ubiC 41485 41982 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305723.1 protein_id gnl|my_center|LOCUS_10000 41995 42867 gene locus_tag LOCUS_10010 gene ubiA 41995 42867 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455228.1 protein_id gnl|my_center|LOCUS_10010 45505 43022 gene locus_tag LOCUS_10020 gene plsB 45505 43022 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141711.1 protein_id gnl|my_center|LOCUS_10020 45616 45984 gene locus_tag LOCUS_10030 gene dgkA 45616 45984 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002907.1 protein_id gnl|my_center|LOCUS_10030 46094 46702 gene locus_tag LOCUS_10040 gene lexA 46094 46702 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_10040 46775 48100 gene locus_tag LOCUS_10050 gene dinF 46775 48100 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001128149.1 protein_id gnl|my_center|LOCUS_10050 48216 48425 gene locus_tag LOCUS_10060 48216 48425 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030593.1 protein_id gnl|my_center|LOCUS_10060 48982 48467 gene locus_tag LOCUS_10070 gene zur 48982 48467 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295691.1 protein_id gnl|my_center|LOCUS_10070 49300 50316 gene locus_tag LOCUS_10080 49300 50316 CDS product DUF2713 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912582.1 protein_id gnl|my_center|LOCUS_10080 50775 51716 gene locus_tag LOCUS_10090 gene dusA 50775 51716 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298868.1 protein_id gnl|my_center|LOCUS_10090 51850 52092 gene locus_tag LOCUS_10100 gene pspG 51850 52092 CDS product envelope stress response protein PspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891404.1 protein_id gnl|my_center|LOCUS_10100 53241 52258 gene locus_tag LOCUS_10110 53241 52258 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235522.1 protein_id gnl|my_center|LOCUS_10110 53324 54739 gene locus_tag LOCUS_10120 gene dnaB 53324 54739 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918363.1 protein_id gnl|my_center|LOCUS_10120 54792 55871 gene locus_tag LOCUS_10130 gene alr 54792 55871 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147328.1 protein_id gnl|my_center|LOCUS_10130 56124 57317 gene locus_tag LOCUS_10140 gene tyrB 56124 57317 CDS product aromatic amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486985.1 protein_id gnl|my_center|LOCUS_10140 57436 57615 gene locus_tag LOCUS_10150 57436 57615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 58022 57642 gene locus_tag LOCUS_10160 58022 57642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069596.1 protein_id gnl|my_center|LOCUS_10160 58425 59138 gene locus_tag LOCUS_10170 gene aphA 58425 59138 CDS product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226923.1 protein_id gnl|my_center|LOCUS_10170 59249 59665 gene locus_tag LOCUS_10180 59249 59665 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270383.1 protein_id gnl|my_center|LOCUS_10180 59669 60025 gene locus_tag LOCUS_10190 59669 60025 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155657.1 protein_id gnl|my_center|LOCUS_10190 62882 60060 gene locus_tag LOCUS_10200 gene uvrA 62882 60060 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357740.1 protein_id gnl|my_center|LOCUS_10200 63136 63672 gene locus_tag LOCUS_10210 gene ssb1 63136 63672 CDS product single-stranded DNA-binding protein SSB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168299.1 protein_id gnl|my_center|LOCUS_10210 64052 63771 gene locus_tag LOCUS_10220 64052 63771 CDS product YjcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295689.1 protein_id gnl|my_center|LOCUS_10220 64482 66068 gene locus_tag LOCUS_10230 gene pdeC 64482 66068 CDS product c-di-GMP phosphodiesterase PdeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019536.1 protein_id gnl|my_center|LOCUS_10230 66394 66071 gene locus_tag LOCUS_10240 gene soxS 66394 66071 CDS product superoxide response transcriptional regulator SoxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019358.1 protein_id gnl|my_center|LOCUS_10240 66480 66944 gene locus_tag LOCUS_10250 gene soxR 66480 66944 CDS product redox-sensitive transcriptional activator SoxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412428.1 protein_id gnl|my_center|LOCUS_10250 67490 68839 gene locus_tag LOCUS_10260 gene ghxP 67490 68839 CDS product guanine/hypoxanthine transporter GhxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106882.1 protein_id gnl|my_center|LOCUS_10260 68990 70639 gene locus_tag LOCUS_10270 68990 70639 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402207.1 protein_id gnl|my_center|LOCUS_10270 72085 70793 gene locus_tag LOCUS_10280 72085 70793 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270143.1 protein_id gnl|my_center|LOCUS_10280 73912 72263 gene locus_tag LOCUS_10290 gene actP 73912 72263 CDS product cation/acetate symporter ActP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832573.1 protein_id gnl|my_center|LOCUS_10290 74223 73909 gene locus_tag LOCUS_10300 74223 73909 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296646.1 protein_id gnl|my_center|LOCUS_10300 76381 74423 gene locus_tag LOCUS_10310 gene acs 76381 74423 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078239.1 protein_id gnl|my_center|LOCUS_10310 76884 78209 gene locus_tag LOCUS_10320 gene nrfA 76884 78209 CDS product ammonia-forming nitrite reductase cytochrome c552 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196875.1 protein_id gnl|my_center|LOCUS_10320 78254 78820 gene locus_tag LOCUS_10330 gene nrfB 78254 78820 CDS product cytochrome c nitrite reductase pentaheme subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295391.1 protein_id gnl|my_center|LOCUS_10330 78817 79488 gene locus_tag LOCUS_10340 gene nrfC 78817 79488 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220281.1 protein_id gnl|my_center|LOCUS_10340 79485 80441 gene locus_tag LOCUS_10350 gene nrfD 79485 80441 CDS product cytochrome c nitrite reductase subunit NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195171.1 protein_id gnl|my_center|LOCUS_10350 80497 82179 gene locus_tag LOCUS_10360 80497 82179 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071524619.1 protein_id gnl|my_center|LOCUS_10360 82172 82555 gene locus_tag LOCUS_10370 gene nrfF 82172 82555 CDS product heme lyase NrfEFG subunit NrfF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032546.1 protein_id gnl|my_center|LOCUS_10370 82552 83148 gene locus_tag LOCUS_10380 gene nrfG 82552 83148 CDS product heme lyase NrfEFG subunit NrfG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662608.1 protein_id gnl|my_center|LOCUS_10380 83490 84803 gene locus_tag LOCUS_10390 gene gltP 83490 84803 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000835799.1 protein_id gnl|my_center|LOCUS_10390 85570 84881 gene locus_tag LOCUS_10400 gene yjcO 85570 84881 CDS product Sel1 family TPR-like repeat protein YjcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719886.1 protein_id gnl|my_center|LOCUS_10400 87811 85664 gene locus_tag LOCUS_10410 gene fdhF 87811 85664 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300547.1 transl_except (pos:complement(87392..87394),aa:Sec) note codon on position 140 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_10410 89475 88009 gene locus_tag LOCUS_10420 gene mdtP 89475 88009 CDS product multidrug efflux transporter outer membrane subunit MdtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610574.1 protein_id gnl|my_center|LOCUS_10420 91523 89472 gene locus_tag LOCUS_10430 gene mdtO 91523 89472 CDS product multidrug efflux transporter permease subunit MdtO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275193.1 protein_id gnl|my_center|LOCUS_10430 92554 91523 gene locus_tag LOCUS_10440 gene mdtN 92554 91523 CDS product multidrug efflux transporter periplasmic adaptor subunit MdtN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446354.1 protein_id gnl|my_center|LOCUS_10440 92848 92573 gene locus_tag LOCUS_10450 92848 92573 CDS product YtcA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001356044.1 protein_id gnl|my_center|LOCUS_10450 95042 93057 gene locus_tag LOCUS_10460 gene yjcS 95042 93057 CDS product alkyl sulfatase YjcS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307516.1 protein_id gnl|my_center|LOCUS_10460 96244 95315 gene locus_tag LOCUS_10470 gene alsK 96244 95315 CDS product allose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171687.1 protein_id gnl|my_center|LOCUS_10470 96923 96228 gene locus_tag LOCUS_10480 gene alsE 96923 96228 CDS product D-allulose-6-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311314.1 protein_id gnl|my_center|LOCUS_10480 97914 96934 gene locus_tag LOCUS_10490 gene alsC 97914 96934 CDS product D-allose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000507106.1 protein_id gnl|my_center|LOCUS_10490 99425 97893 gene locus_tag LOCUS_10500 gene alsA 99425 97893 CDS product D-allose ABC transporter ATP-binding protein AlsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235257.1 protein_id gnl|my_center|LOCUS_10500 100487 99552 gene locus_tag LOCUS_10510 gene alsB 100487 99552 CDS product D-allose transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361478.1 protein_id gnl|my_center|LOCUS_10510 101436 100546 gene locus_tag LOCUS_10520 gene alsR 101436 100546 CDS product als operon DNA-binding transcriptional repressor AlsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083216.1 protein_id gnl|my_center|LOCUS_10520 101795 102244 gene locus_tag LOCUS_10530 gene rpiB 101795 102244 CDS product bifunctional allose-6-phosphate isomerase/ribose-5-phosphate isomerase RpiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716794.1 protein_id gnl|my_center|LOCUS_10530 102313 102642 gene locus_tag LOCUS_10540 102313 102642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 <103442 102789 gene locus_tag LOCUS_10550 <103442 102789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000059926.1:phosphonate metabolism protein PhnP >Feature sequence09 64 140 gene locus_tag LOCUS_t00130 64 140 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 149 224 gene locus_tag LOCUS_t00140 149 224 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1159 320 gene locus_tag LOCUS_10560 gene hdfR 1159 320 CDS product HTH-type transcriptional regulator HdfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379246.1 protein_id gnl|my_center|LOCUS_10560 1278 1616 gene locus_tag LOCUS_10570 gene maoP 1278 1616 CDS product macrodomain Ori organization protein MaoP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841001.1 protein_id gnl|my_center|LOCUS_10570 3161 1641 gene locus_tag LOCUS_10580 3161 1641 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058976.1 protein_id gnl|my_center|LOCUS_10580 3752 5398 gene locus_tag LOCUS_10590 gene ilvG 3752 5398 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012602.1 protein_id gnl|my_center|LOCUS_10590 5395 5658 gene locus_tag LOCUS_10600 gene ilvM 5395 5658 CDS product acetolactate synthase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983255.1 protein_id gnl|my_center|LOCUS_10600 5678 6607 gene locus_tag LOCUS_10610 gene ilvE 5678 6607 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208520.1 protein_id gnl|my_center|LOCUS_10610 6672 8522 gene locus_tag LOCUS_10620 gene ilvD 6672 8522 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127391.1 protein_id gnl|my_center|LOCUS_10620 8525 10069 gene locus_tag LOCUS_10630 gene ilvA 8525 10069 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785599.1 protein_id gnl|my_center|LOCUS_10630 10956 10066 gene locus_tag LOCUS_10640 gene ilvY 10956 10066 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365791.1 protein_id gnl|my_center|LOCUS_10640 11106 12581 gene locus_tag LOCUS_10650 gene ilvC 11106 12581 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024951.1 protein_id gnl|my_center|LOCUS_10650 12949 12668 gene locus_tag LOCUS_10660 gene ppiC 12949 12668 CDS product peptidylprolyl isomerase PpiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140251.1 protein_id gnl|my_center|LOCUS_10660 13597 13148 gene locus_tag LOCUS_10670 13597 13148 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996694.1 protein_id gnl|my_center|LOCUS_10670 13814 15835 gene locus_tag LOCUS_10680 gene rep 13814 15835 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238869.1 protein_id gnl|my_center|LOCUS_10680 17366 15882 gene locus_tag LOCUS_10690 gene gppA 17366 15882 CDS product guanosine-5'-triphosphate,3'-diphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295254.1 protein_id gnl|my_center|LOCUS_10690 18765 17500 gene locus_tag LOCUS_10700 gene rhlB 18765 17500 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047499.1 protein_id gnl|my_center|LOCUS_10700 18896 19225 gene locus_tag LOCUS_10710 gene trxA 18896 19225 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305383.1 protein_id gnl|my_center|LOCUS_10710 19552 20811 gene locus_tag LOCUS_10720 gene rho 19552 20811 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054527.1 protein_id gnl|my_center|LOCUS_10720 20821 21039 gene locus_tag LOCUS_10730 20821 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127070.1 protein_id gnl|my_center|LOCUS_10730 21051 22154 gene locus_tag LOCUS_10740 gene wecA 21051 22154 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001050960.1 protein_id gnl|my_center|LOCUS_10740 22166 23212 gene locus_tag LOCUS_10750 gene wzzE 22166 23212 CDS product ECA polysaccharide chain length modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295256.1 protein_id gnl|my_center|LOCUS_10750 23268 24398 gene locus_tag LOCUS_10760 gene wecB 23268 24398 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866672.1 protein_id gnl|my_center|LOCUS_10760 24395 25657 gene locus_tag LOCUS_10770 gene wecC 24395 25657 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006621.1 protein_id gnl|my_center|LOCUS_10770 25657 26724 gene locus_tag LOCUS_10780 gene rffG 25657 26724 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226604.1 protein_id gnl|my_center|LOCUS_10780 26743 27624 gene locus_tag LOCUS_10790 gene rfbA 26743 27624 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676056.1 protein_id gnl|my_center|LOCUS_10790 27602 28276 gene locus_tag LOCUS_10800 gene rffC 27602 28276 CDS product dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145196.1 protein_id gnl|my_center|LOCUS_10800 28281 29411 gene locus_tag LOCUS_10810 gene rffA 28281 29411 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612044.1 protein_id gnl|my_center|LOCUS_10810 29413 30663 gene locus_tag LOCUS_10820 gene wzxE 29413 30663 CDS product lipid III flippase WzxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050265.1 protein_id gnl|my_center|LOCUS_10820 30660 31739 gene locus_tag LOCUS_10830 gene rffT 30660 31739 CDS product TDP-N-acetylfucosamine:lipid II N-acetylfucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217240.1 protein_id gnl|my_center|LOCUS_10830 31736 33088 gene locus_tag LOCUS_10840 gene wzyE 31736 33088 CDS product ECA oligosaccharide polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055132.1 protein_id gnl|my_center|LOCUS_10840 33091 33831 gene locus_tag LOCUS_10850 gene wecG 33091 33831 CDS product lipopolysaccharide N-acetylmannosaminouronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064038.1 protein_id gnl|my_center|LOCUS_10850 34022 35407 gene locus_tag LOCUS_10860 34022 35407 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774731.1 protein_id gnl|my_center|LOCUS_10860 35510 35586 gene locus_tag LOCUS_t00150 35510 35586 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35645 35720 gene locus_tag LOCUS_t00160 35645 35720 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 35741 35827 gene locus_tag LOCUS_t00170 35741 35827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 35870 35946 gene locus_tag LOCUS_t00180 35870 35946 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36093 37328 gene locus_tag LOCUS_10870 36093 37328 CDS product anaerobic sulfatase maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941543.1 protein_id gnl|my_center|LOCUS_10870 39448 38252 gene locus_tag LOCUS_10880 gene hemY 39448 38252 CDS product protoheme IX biogenesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921791.1 protein_id gnl|my_center|LOCUS_10880 40644 39451 gene locus_tag LOCUS_10890 gene hemX 40644 39451 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138997.1 protein_id gnl|my_center|LOCUS_10890 41406 40666 gene locus_tag LOCUS_10900 gene hemD 41406 40666 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026061.1 protein_id gnl|my_center|LOCUS_10900 42365 41403 gene locus_tag LOCUS_10910 gene hemC 42365 41403 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606154.1 protein_id gnl|my_center|LOCUS_10910 42731 45277 gene locus_tag LOCUS_10920 gene cyaA 42731 45277 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281680.1 protein_id gnl|my_center|LOCUS_10920 45637 45317 gene locus_tag LOCUS_10930 gene cyaY 45637 45317 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999947.1 protein_id gnl|my_center|LOCUS_10930 46998 45685 gene locus_tag LOCUS_10940 46998 45685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014280.1 protein_id gnl|my_center|LOCUS_10940 48473 46995 gene locus_tag LOCUS_10950 48473 46995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300182.1 protein_id gnl|my_center|LOCUS_10950 49844 48534 gene locus_tag LOCUS_10960 49844 48534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014280.1 protein_id gnl|my_center|LOCUS_10960 51205 49841 gene locus_tag LOCUS_10970 51205 49841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300182.1 protein_id gnl|my_center|LOCUS_10970 52209 51655 gene locus_tag LOCUS_10980 52209 51655 CDS product DUF3304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522559.1 protein_id gnl|my_center|LOCUS_10980 52559 52762 gene locus_tag LOCUS_10990 52559 52762 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799884.1 protein_id gnl|my_center|LOCUS_10990 52799 53623 gene locus_tag LOCUS_11000 gene dapF 52799 53623 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160654.1 protein_id gnl|my_center|LOCUS_11000 53620 54327 gene locus_tag LOCUS_11010 53620 54327 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812796.1 protein_id gnl|my_center|LOCUS_11010 54324 55220 gene locus_tag LOCUS_11020 gene xerC 54324 55220 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130691.1 protein_id gnl|my_center|LOCUS_11020 55220 55936 gene locus_tag LOCUS_11030 gene yigB 55220 55936 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213584.1 protein_id gnl|my_center|LOCUS_11030 56020 58182 gene locus_tag LOCUS_11040 gene uvrD 56020 58182 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383406.1 protein_id gnl|my_center|LOCUS_11040 59093 58329 gene locus_tag LOCUS_11050 59093 58329 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951164.1 protein_id gnl|my_center|LOCUS_11050 59463 60413 gene locus_tag LOCUS_11060 gene corA 59463 60413 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947159.1 protein_id gnl|my_center|LOCUS_11060 60946 60467 gene locus_tag LOCUS_11070 60946 60467 CDS product DUF943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837563.1 protein_id gnl|my_center|LOCUS_11070 61791 60943 gene locus_tag LOCUS_11080 61791 60943 CDS product DUF3289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059699.1 protein_id gnl|my_center|LOCUS_11080 61927 62124 gene locus_tag LOCUS_11090 61927 62124 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315926.1 protein_id gnl|my_center|LOCUS_11090 62750 63049 gene locus_tag LOCUS_11100 62750 63049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526434.1 protein_id gnl|my_center|LOCUS_11100 63983 63096 gene locus_tag LOCUS_11110 gene rarD 63983 63096 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339103.1 protein_id gnl|my_center|LOCUS_11110 64502 64035 gene locus_tag LOCUS_11120 gene yigI 64502 64035 CDS product acyl-CoA thioesterase YigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277142.1 protein_id gnl|my_center|LOCUS_11120 64667 65536 gene locus_tag LOCUS_11130 gene pldA 64667 65536 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259700.1 protein_id gnl|my_center|LOCUS_11130 65663 67498 gene locus_tag LOCUS_11140 gene recQ 65663 67498 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099855.1 protein_id gnl|my_center|LOCUS_11140 67568 68182 gene locus_tag LOCUS_11150 gene rhtC 67568 68182 CDS product threonine export protein RhtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928824.1 protein_id gnl|my_center|LOCUS_11150 68864 68244 gene locus_tag LOCUS_11160 gene rhtB 68864 68244 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171707.1 protein_id gnl|my_center|LOCUS_11160 68975 69997 gene locus_tag LOCUS_11170 gene pldB 68975 69997 CDS product lysophospholipase L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487654.1 protein_id gnl|my_center|LOCUS_11170 70005 70805 gene locus_tag LOCUS_11180 gene yigL 70005 70805 CDS product sugar/pyridoxal phosphate phosphatase YigL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285348.1 protein_id gnl|my_center|LOCUS_11180 70881 71780 gene locus_tag LOCUS_11190 gene bioP 70881 71780 CDS product biotin transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196238.1 protein_id gnl|my_center|LOCUS_11190 72621 71668 gene locus_tag LOCUS_11200 gene metR 72621 71668 CDS product HTH-type transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573621.1 protein_id gnl|my_center|LOCUS_11200 72739 75000 gene locus_tag LOCUS_11210 gene metE 72739 75000 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153961.1 protein_id gnl|my_center|LOCUS_11210 75855 75040 gene locus_tag LOCUS_11220 75855 75040 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562775.1 protein_id gnl|my_center|LOCUS_11220 76117 76878 gene locus_tag LOCUS_11230 gene udp 76117 76878 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045180.1 protein_id gnl|my_center|LOCUS_11230 77018 78445 gene locus_tag LOCUS_11240 gene rmuC 77018 78445 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347714.1 protein_id gnl|my_center|LOCUS_11240 78540 79295 gene locus_tag LOCUS_11250 gene ubiE 78540 79295 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_11250 79309 79914 gene locus_tag LOCUS_11260 gene ubiJ 79309 79914 CDS product ubiquinone biosynthesis protein UbiJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295259.1 protein_id gnl|my_center|LOCUS_11260 79911 81551 gene locus_tag LOCUS_11270 gene ubiB 79911 81551 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187530.1 protein_id gnl|my_center|LOCUS_11270 81630 81899 gene locus_tag LOCUS_11280 gene tatA 81630 81899 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295260.1 protein_id gnl|my_center|LOCUS_11280 81903 82418 gene locus_tag LOCUS_11290 gene tatB 81903 82418 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459594.1 protein_id gnl|my_center|LOCUS_11290 82421 83197 gene locus_tag LOCUS_11300 gene tatC 82421 83197 CDS product Sec-independent protein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109942.1 protein_id gnl|my_center|LOCUS_11300 83239 84021 gene locus_tag LOCUS_11310 gene tatD 83239 84021 CDS product 3'-5' ssDNA/RNA exonuclease TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299486.1 protein_id gnl|my_center|LOCUS_11310 84506 84018 gene locus_tag LOCUS_11320 gene rfaH 84506 84018 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192396.1 protein_id gnl|my_center|LOCUS_11320 84673 86166 gene locus_tag LOCUS_11330 gene ubiD 84673 86166 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339804.1 protein_id gnl|my_center|LOCUS_11330 86212 86913 gene locus_tag LOCUS_11340 gene fre 86212 86913 CDS product NAD(P)H-flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209826.1 protein_id gnl|my_center|LOCUS_11340 88268 87105 gene locus_tag LOCUS_11350 gene fadA 88268 87105 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438788.1 protein_id gnl|my_center|LOCUS_11350 90467 88278 gene locus_tag LOCUS_11360 gene fadB 90467 88278 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965943.1 protein_id gnl|my_center|LOCUS_11360 90657 91988 gene locus_tag LOCUS_11370 gene pepQ 90657 91988 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444561.1 protein_id gnl|my_center|LOCUS_11370 92060 92602 gene locus_tag LOCUS_11380 92060 92602 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296979.1 protein_id gnl|my_center|LOCUS_11380 92641 94092 gene locus_tag LOCUS_11390 gene trkH 92641 94092 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545677.1 protein_id gnl|my_center|LOCUS_11390 94104 94649 gene locus_tag LOCUS_11400 gene hemG 94104 94649 CDS product menaquinone-dependent protoporphyrinogen IX dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853969.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence10 <1 839 gene locus_tag LOCUS_11410 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000014967.1:RHS element core protein 851 1312 gene locus_tag LOCUS_11420 851 1312 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642490.1 protein_id gnl|my_center|LOCUS_11420 1637 1930 gene locus_tag LOCUS_11430 1637 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2019 2456 gene locus_tag LOCUS_11440 2019 2456 CDS product Imm57 family immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326561.1 protein_id gnl|my_center|LOCUS_11440 4052 2916 gene locus_tag LOCUS_11450 4052 2916 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364939.1 protein_id gnl|my_center|LOCUS_11450 4417 4055 gene locus_tag LOCUS_11460 4417 4055 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000479626.1 protein_id gnl|my_center|LOCUS_11460 4954 6867 gene locus_tag LOCUS_11470 gene mtlA 4954 6867 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093247.1 protein_id gnl|my_center|LOCUS_11470 6962 8110 gene locus_tag LOCUS_11480 gene mtlD 6962 8110 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645424.1 protein_id gnl|my_center|LOCUS_11480 8110 8697 gene locus_tag LOCUS_11490 gene mtlR 8110 8697 CDS product mannitol operon repressor MtlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228271.1 protein_id gnl|my_center|LOCUS_11490 8918 8709 gene locus_tag LOCUS_11500 gene yibT 8918 8709 CDS product protein YibT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517100.1 protein_id gnl|my_center|LOCUS_11500 9203 9565 gene locus_tag LOCUS_11510 9203 9565 CDS product YibL family ribosome-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665680.1 protein_id gnl|my_center|LOCUS_11510 10109 10792 gene locus_tag LOCUS_11520 10109 10792 CDS product DUF3251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049544.1 protein_id gnl|my_center|LOCUS_11520 10836 15686 gene locus_tag LOCUS_11530 gene ehaG 10836 15686 CDS product trimeric autotransporter adhesin EhaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033221.1 protein_id gnl|my_center|LOCUS_11530 16055 17710 gene locus_tag LOCUS_11540 gene lldP 16055 17710 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297977.1 protein_id gnl|my_center|LOCUS_11540 17710 18486 gene locus_tag LOCUS_11550 gene lldR 17710 18486 CDS product transcriptional regulator LldR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297449.1 protein_id gnl|my_center|LOCUS_11550 18483 19673 gene locus_tag LOCUS_11560 gene lldD 18483 19673 CDS product quinone-dependent L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586964.1 protein_id gnl|my_center|LOCUS_11560 19859 20332 gene locus_tag LOCUS_11570 gene trmL 19859 20332 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932342.1 protein_id gnl|my_center|LOCUS_11570 21206 20385 gene locus_tag LOCUS_11580 gene cysE 21206 20385 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277561.1 protein_id gnl|my_center|LOCUS_11580 22305 21286 gene locus_tag LOCUS_11590 gene gpsA 22305 21286 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_11590 22772 22305 gene locus_tag LOCUS_11600 gene secB 22772 22305 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003382.1 protein_id gnl|my_center|LOCUS_11600 23086 22835 gene locus_tag LOCUS_11610 gene grxC 23086 22835 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024392.1 protein_id gnl|my_center|LOCUS_11610 23658 23227 gene locus_tag LOCUS_11620 23658 23227 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001368341.1 protein_id gnl|my_center|LOCUS_11620 23903 25447 gene locus_tag LOCUS_11630 gene gpmM 23903 25447 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116565.1 protein_id gnl|my_center|LOCUS_11630 25481 26740 gene locus_tag LOCUS_11640 gene envC 25481 26740 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001214147.1 protein_id gnl|my_center|LOCUS_11640 26744 27703 gene locus_tag LOCUS_11650 26744 27703 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483856.1 protein_id gnl|my_center|LOCUS_11650 28724 27690 gene locus_tag LOCUS_11660 gene waaH 28724 27690 CDS product UDP-glucuronate:LPS(HepIII) glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982100.1 protein_id gnl|my_center|LOCUS_11660 29988 28963 gene locus_tag LOCUS_11670 gene tdh 29988 28963 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646014.1 protein_id gnl|my_center|LOCUS_11670 31194 29998 gene locus_tag LOCUS_11680 gene kbl 31194 29998 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 protein_id gnl|my_center|LOCUS_11680 32326 31469 gene locus_tag LOCUS_11690 gene yibB 32326 31469 CDS product protein YibB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842823.1 protein_id gnl|my_center|LOCUS_11690 32630 33562 gene locus_tag LOCUS_11700 gene rfaD 32630 33562 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587764.1 protein_id gnl|my_center|LOCUS_11700 33572 34618 gene locus_tag LOCUS_11710 gene rfaF 33572 34618 CDS product ADP-heptose--LPS heptosyltransferase RfaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699219.1 protein_id gnl|my_center|LOCUS_11710 34622 35614 gene locus_tag LOCUS_11720 gene rfaC 34622 35614 CDS product lipopolysaccharide heptosyltransferase RfaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264565.1 protein_id gnl|my_center|LOCUS_11720 36283 36819 gene locus_tag LOCUS_11730 36283 36819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 37997 36855 gene locus_tag LOCUS_11740 37997 36855 CDS product lipopolysaccharide N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227812.1 protein_id gnl|my_center|LOCUS_11740 39019 38006 gene locus_tag LOCUS_11750 39019 38006 CDS product UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346017.1 protein_id gnl|my_center|LOCUS_11750 39751 39044 gene locus_tag LOCUS_11760 gene rfaY 39751 39044 CDS product lipopolysaccharide core heptose(II) kinase RfaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639946.1 protein_id gnl|my_center|LOCUS_11760 40784 39777 gene locus_tag LOCUS_11770 gene waaO 40784 39777 CDS product lipopolysaccharide 3-alpha-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080643.1 protein_id gnl|my_center|LOCUS_11770 41624 40827 gene locus_tag LOCUS_11780 gene rfaP 41624 40827 CDS product lipopolysaccharide core heptose(I) kinase RfaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298957.1 protein_id gnl|my_center|LOCUS_11780 42741 41617 gene locus_tag LOCUS_11790 42741 41617 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634246.1 protein_id gnl|my_center|LOCUS_11790 43742 42738 gene locus_tag LOCUS_11800 gene rfaQ 43742 42738 CDS product lipopolysaccharide core heptosyltransferase RfaQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360402.1 protein_id gnl|my_center|LOCUS_11800 44209 45486 gene locus_tag LOCUS_11810 gene waaA 44209 45486 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891564.1 protein_id gnl|my_center|LOCUS_11810 45494 45973 gene locus_tag LOCUS_11820 gene coaD 45494 45973 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171866.1 protein_id gnl|my_center|LOCUS_11820 46821 46012 gene locus_tag LOCUS_11830 gene mutM 46821 46012 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114533.1 protein_id gnl|my_center|LOCUS_11830 47086 46919 gene locus_tag LOCUS_11840 gene rpmG 47086 46919 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051798.1 protein_id gnl|my_center|LOCUS_11840 47343 47107 gene locus_tag LOCUS_11850 gene rpmB 47343 47107 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 protein_id gnl|my_center|LOCUS_11850 48228 47560 gene locus_tag LOCUS_11860 gene radC 48228 47560 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298959.1 protein_id gnl|my_center|LOCUS_11860 48400 49620 gene locus_tag LOCUS_11870 gene coaBC 48400 49620 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050139.1 protein_id gnl|my_center|LOCUS_11870 49598 50056 gene locus_tag LOCUS_11880 gene dut 49598 50056 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_11880 50163 50759 gene locus_tag LOCUS_11890 gene slmA 50163 50759 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311223.1 protein_id gnl|my_center|LOCUS_11890 51437 50796 gene locus_tag LOCUS_11900 gene pyrE 51437 50796 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806161.1 protein_id gnl|my_center|LOCUS_11900 52219 51503 gene locus_tag LOCUS_11910 gene rph 52219 51503 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247093.1 protein_id gnl|my_center|LOCUS_11910 52346 53209 gene locus_tag LOCUS_11920 52346 53209 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621336.1 protein_id gnl|my_center|LOCUS_11920 53430 54254 gene locus_tag LOCUS_11930 gene dinD 53430 54254 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002036.1 protein_id gnl|my_center|LOCUS_11930 54546 55163 gene locus_tag LOCUS_11940 54546 55163 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924289.1 protein_id gnl|my_center|LOCUS_11940 56677 55160 gene locus_tag LOCUS_11950 gene ligB 56677 55160 CDS product NAD-dependent DNA ligase LigB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870052.1 protein_id gnl|my_center|LOCUS_11950 56960 56703 gene locus_tag LOCUS_11960 56960 56703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638625.1 protein_id gnl|my_center|LOCUS_11960 57100 57723 gene locus_tag LOCUS_11970 gene gmk 57100 57723 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295237.1 protein_id gnl|my_center|LOCUS_11970 57778 58053 gene locus_tag LOCUS_11980 gene rpoZ 57778 58053 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135058.1 protein_id gnl|my_center|LOCUS_11980 58072 60180 gene locus_tag LOCUS_11990 gene spoT 58072 60180 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280488.1 protein_id gnl|my_center|LOCUS_11990 60187 60876 gene locus_tag LOCUS_12000 gene trmH 60187 60876 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070177.1 protein_id gnl|my_center|LOCUS_12000 60882 62963 gene locus_tag LOCUS_12010 gene recG 60882 62963 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678442.1 protein_id gnl|my_center|LOCUS_12010 63814 62948 gene locus_tag LOCUS_12020 63814 62948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 65022 63817 gene locus_tag LOCUS_12030 gene gltS 65022 63817 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468836.1 protein_id gnl|my_center|LOCUS_12030 65302 66693 gene locus_tag LOCUS_12040 gene xanP 65302 66693 CDS product xanthine/proton symporter XanP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295238.1 protein_id gnl|my_center|LOCUS_12040 66814 68523 gene locus_tag LOCUS_12050 66814 68523 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307467.1 protein_id gnl|my_center|LOCUS_12050 70894 68576 gene locus_tag LOCUS_12060 gene yicI 70894 68576 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702944.1 protein_id gnl|my_center|LOCUS_12060 72286 70904 gene locus_tag LOCUS_12070 72286 70904 CDS product glycoside-pentoside-hexuronide family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834439.1 protein_id gnl|my_center|LOCUS_12070 72579 72673 gene locus_tag LOCUS_t00190 72579 72673 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 72969 74150 gene locus_tag LOCUS_12080 72969 74150 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218908.1 protein_id gnl|my_center|LOCUS_12080 74426 75055 gene locus_tag LOCUS_12090 74426 75055 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621916.1 protein_id gnl|my_center|LOCUS_12090 75055 76596 gene locus_tag LOCUS_12100 75055 76596 CDS product MASE1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089287.1 protein_id gnl|my_center|LOCUS_12100 76681 77985 gene locus_tag LOCUS_12110 gene uhpC 76681 77985 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543352.1 protein_id gnl|my_center|LOCUS_12110 77982 79013 gene locus_tag LOCUS_12120 77982 79013 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_12120 79082 81160 gene locus_tag LOCUS_12130 79082 81160 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 protein_id gnl|my_center|LOCUS_12130 81172 82218 gene locus_tag LOCUS_12140 gene fbpC 81172 82218 CDS product ferric ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078833.1 protein_id gnl|my_center|LOCUS_12140 83925 82537 gene locus_tag LOCUS_12150 83925 82537 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026220.1 protein_id gnl|my_center|LOCUS_12150 84958 84203 gene locus_tag LOCUS_12160 84958 84203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 85127 85357 gene locus_tag LOCUS_12170 85127 85357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 85563 85970 gene locus_tag LOCUS_12180 85563 85970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 85975 86274 gene locus_tag LOCUS_12190 85975 86274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12190 >Feature sequence11 1743 334 gene locus_tag LOCUS_12200 gene glnG 1743 334 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188776.1 protein_id gnl|my_center|LOCUS_12200 2804 1755 gene locus_tag LOCUS_12210 gene glnL 2804 1755 CDS product nitrogen regulation protein NR(II) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190577.1 protein_id gnl|my_center|LOCUS_12210 4387 2978 gene locus_tag LOCUS_12220 gene glnA 4387 2978 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271717.1 protein_id gnl|my_center|LOCUS_12220 4760 6583 gene locus_tag LOCUS_12230 gene typA 4760 6583 CDS product ribosome-dependent GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570668.1 protein_id gnl|my_center|LOCUS_12230 6800 7510 gene locus_tag LOCUS_12240 6800 7510 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829798.1 protein_id gnl|my_center|LOCUS_12240 7623 8498 gene locus_tag LOCUS_12250 7623 8498 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256396.1 protein_id gnl|my_center|LOCUS_12250 8600 9865 gene locus_tag LOCUS_12260 8600 9865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956320.1 protein_id gnl|my_center|LOCUS_12260 10648 9956 gene locus_tag LOCUS_12270 gene ompL 10648 9956 CDS product porin OmpL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723465.1 protein_id gnl|my_center|LOCUS_12270 12119 10716 gene locus_tag LOCUS_12280 12119 10716 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295267.1 protein_id gnl|my_center|LOCUS_12280 13547 12162 gene locus_tag LOCUS_12290 13547 12162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018376.1 protein_id gnl|my_center|LOCUS_12290 15629 13593 gene locus_tag LOCUS_12300 gene yihQ 15629 13593 CDS product sulfoquinovosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380843.1 protein_id gnl|my_center|LOCUS_12300 16754 15828 gene locus_tag LOCUS_12310 16754 15828 CDS product aldose-1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052655.1 protein_id gnl|my_center|LOCUS_12310 18109 16868 gene locus_tag LOCUS_12320 gene yihS 18109 16868 CDS product sulfoquinovose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870916.1 protein_id gnl|my_center|LOCUS_12320 19004 18126 gene locus_tag LOCUS_12330 gene yihT 19004 18126 CDS product sulfofructosephosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046453.1 protein_id gnl|my_center|LOCUS_12330 19924 19028 gene locus_tag LOCUS_12340 gene yihU 19924 19028 CDS product sulfolactaldehyde 3-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000718893.1 protein_id gnl|my_center|LOCUS_12340 20092 20988 gene locus_tag LOCUS_12350 gene yihV 20092 20988 CDS product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621656.1 protein_id gnl|my_center|LOCUS_12350 21022 21807 gene locus_tag LOCUS_12360 21022 21807 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059678.1 protein_id gnl|my_center|LOCUS_12360 21906 22505 gene locus_tag LOCUS_12370 gene yihX 21906 22505 CDS product glucose-1-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295269.1 protein_id gnl|my_center|LOCUS_12370 22499 23371 gene locus_tag LOCUS_12380 22499 23371 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920762.1 protein_id gnl|my_center|LOCUS_12380 23368 23805 gene locus_tag LOCUS_12390 gene dtd 23368 23805 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560983.1 protein_id gnl|my_center|LOCUS_12390 23850 24791 gene locus_tag LOCUS_12400 gene fabY 23850 24791 CDS product fatty acid biosynthesis protein FabY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080791.1 protein_id gnl|my_center|LOCUS_12400 25763 24855 gene locus_tag LOCUS_12410 25763 24855 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387201.1 protein_id gnl|my_center|LOCUS_12410 25992 26303 gene locus_tag LOCUS_12420 25992 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897305.1 protein_id gnl|my_center|LOCUS_12420 26304 26594 gene locus_tag LOCUS_12430 gene nadS 26304 26594 CDS product NadS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356397.1 protein_id gnl|my_center|LOCUS_12430 27180 27398 gene locus_tag LOCUS_12440 27180 27398 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295676.1 protein_id gnl|my_center|LOCUS_12440 27617 27859 gene locus_tag LOCUS_12450 gene yiiF 27617 27859 CDS product protein YiiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087409.1 protein_id gnl|my_center|LOCUS_12450 29118 28189 gene locus_tag LOCUS_12460 gene fdhE 29118 28189 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027708.1 protein_id gnl|my_center|LOCUS_12460 29750 29115 gene locus_tag LOCUS_12470 gene fdoI 29750 29115 CDS product formate dehydrogenase cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829013.1 protein_id gnl|my_center|LOCUS_12470 30649 29747 gene locus_tag LOCUS_12480 gene fdoH 30649 29747 CDS product formate dehydrogenase O subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331377.1 protein_id gnl|my_center|LOCUS_12480 33712 30662 gene locus_tag LOCUS_12490 gene fdnG 33712 30662 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011310337.1 transl_except (pos:complement(33125..33127),aa:Sec) note codon on position 196 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_12490 33906 34739 gene locus_tag LOCUS_12500 gene fdhD 33906 34739 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753589.1 protein_id gnl|my_center|LOCUS_12500 34892 35932 gene locus_tag LOCUS_12510 34892 35932 CDS product YiiG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387797.1 protein_id gnl|my_center|LOCUS_12510 37730 35982 gene locus_tag LOCUS_12520 37730 35982 CDS product putative frv operon regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931302.1 protein_id gnl|my_center|LOCUS_12520 38800 37730 gene locus_tag LOCUS_12530 38800 37730 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019472.1 protein_id gnl|my_center|LOCUS_12530 40241 38790 gene locus_tag LOCUS_12540 40241 38790 CDS product PTS fructose-like transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446023.1 protein_id gnl|my_center|LOCUS_12540 40698 40252 gene locus_tag LOCUS_12550 40698 40252 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729598.1 protein_id gnl|my_center|LOCUS_12550 41313 40999 gene locus_tag LOCUS_12560 gene rhaM 41313 40999 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619503.1 protein_id gnl|my_center|LOCUS_12560 42147 41323 gene locus_tag LOCUS_12570 gene rhaD 42147 41323 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179764.1 protein_id gnl|my_center|LOCUS_12570 43648 42389 gene locus_tag LOCUS_12580 gene rhaA 43648 42389 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325794.1 protein_id gnl|my_center|LOCUS_12580 45114 43645 gene locus_tag LOCUS_12590 gene rhaB 45114 43645 CDS product rhamnulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144117.1 protein_id gnl|my_center|LOCUS_12590 45402 46238 gene locus_tag LOCUS_12600 gene rhaS 45402 46238 CDS product HTH-type transcriptional activator RhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000217137.1 protein_id gnl|my_center|LOCUS_12600 46312 47160 gene locus_tag LOCUS_12610 gene rhaR 46312 47160 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296618.1 protein_id gnl|my_center|LOCUS_12610 48191 47157 gene locus_tag LOCUS_12620 gene rhaT 48191 47157 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063507.1 protein_id gnl|my_center|LOCUS_12620 48476 49096 gene locus_tag LOCUS_12630 gene sodA 48476 49096 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297064.1 protein_id gnl|my_center|LOCUS_12630 49356 50339 gene locus_tag LOCUS_12640 gene kdgT 49356 50339 CDS product 2-keto-3-deoxygluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166063.1 protein_id gnl|my_center|LOCUS_12640 50488 51162 gene locus_tag LOCUS_12650 gene yiiM 50488 51162 CDS product 6-hydroxyaminopurine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001270270.1 protein_id gnl|my_center|LOCUS_12650 52641 51268 gene locus_tag LOCUS_12660 gene cpxA 52641 51268 CDS product envelope stress sensor histidine kinase CpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580417.1 protein_id gnl|my_center|LOCUS_12660 53336 52638 gene locus_tag LOCUS_12670 gene cpxR 53336 52638 CDS product envelope stress response regulator transcription factor CpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033722.1 protein_id gnl|my_center|LOCUS_12670 53486 53986 gene locus_tag LOCUS_12680 gene cpxP 53486 53986 CDS product cell-envelope stress modulator CpxP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223800.1 protein_id gnl|my_center|LOCUS_12680 54135 55037 gene locus_tag LOCUS_12690 gene fieF 54135 55037 CDS product CDF family cation-efflux transporter FieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076742.1 protein_id gnl|my_center|LOCUS_12690 55218 56180 gene locus_tag LOCUS_12700 gene pfkA 55218 56180 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591795.1 protein_id gnl|my_center|LOCUS_12700 56499 57488 gene locus_tag LOCUS_12710 gene sbp 56499 57488 CDS product sulfate/thiosulfate ABC transporter substrate-binding protein Sbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045689.1 protein_id gnl|my_center|LOCUS_12710 57595 58350 gene locus_tag LOCUS_12720 gene cdh 57595 58350 CDS product CDP-diacylglycerol diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708998.1 protein_id gnl|my_center|LOCUS_12720 59172 58405 gene locus_tag LOCUS_12730 gene tpiA 59172 58405 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216325.1 protein_id gnl|my_center|LOCUS_12730 59879 59280 gene locus_tag LOCUS_12740 59879 59280 CDS product YiiQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802226.1 protein_id gnl|my_center|LOCUS_12740 59980 60420 gene locus_tag LOCUS_12750 59980 60420 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155257.1 protein_id gnl|my_center|LOCUS_12750 60632 60931 gene locus_tag LOCUS_12760 60632 60931 CDS product DUF406 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655986.1 protein_id gnl|my_center|LOCUS_12760 60958 61386 gene locus_tag LOCUS_12770 gene uspD 60958 61386 CDS product universal stress protein UspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323556.1 protein_id gnl|my_center|LOCUS_12770 62137 61391 gene locus_tag LOCUS_12780 gene fpr 62137 61391 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796320.1 protein_id gnl|my_center|LOCUS_12780 63244 62234 gene locus_tag LOCUS_12790 gene glpX 63244 62234 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250644.1 protein_id gnl|my_center|LOCUS_12790 64888 63380 gene locus_tag LOCUS_12800 gene glpK 64888 63380 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136788.1 protein_id gnl|my_center|LOCUS_12800 65756 64911 gene locus_tag LOCUS_12810 gene glpF 65756 64911 CDS product glycerol uptake facilitator protein GlpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084268.1 protein_id gnl|my_center|LOCUS_12810 66187 66426 gene locus_tag LOCUS_12820 gene zapB 66187 66426 CDS product septal ring assembly protein ZapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295521.1 protein_id gnl|my_center|LOCUS_12820 66996 66511 gene locus_tag LOCUS_12830 gene rraA 66996 66511 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872908.1 protein_id gnl|my_center|LOCUS_12830 68015 67089 gene locus_tag LOCUS_12840 gene menA 68015 67089 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139496.1 protein_id gnl|my_center|LOCUS_12840 69413 68082 gene locus_tag LOCUS_12850 gene hslU 69413 68082 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293343.1 protein_id gnl|my_center|LOCUS_12850 69953 69423 gene locus_tag LOCUS_12860 gene hslV 69953 69423 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208242.1 protein_id gnl|my_center|LOCUS_12860 70900 70046 gene locus_tag LOCUS_12870 gene ftsN 70900 70046 CDS product cell division protein FtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068834.1 protein_id gnl|my_center|LOCUS_12870 72122 71097 gene locus_tag LOCUS_12880 gene cytR 72122 71097 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644904.1 protein_id gnl|my_center|LOCUS_12880 74476 72278 gene locus_tag LOCUS_12890 gene priA 74476 72278 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350069.1 protein_id gnl|my_center|LOCUS_12890 74679 74891 gene locus_tag LOCUS_12900 gene rpmE 74679 74891 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710769.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence12 23 475 gene locus_tag LOCUS_12910 23 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 478 798 gene locus_tag LOCUS_12920 478 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2041 1289 gene locus_tag LOCUS_12930 2041 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2924 2028 gene locus_tag LOCUS_12940 2924 2028 CDS product helicase RepA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039730.1 protein_id gnl|my_center|LOCUS_12940 3158 2928 gene locus_tag LOCUS_12950 3158 2928 CDS product AlpA family phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388106.1 protein_id gnl|my_center|LOCUS_12950 4700 3444 gene locus_tag LOCUS_12960 4700 3444 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039727.1 protein_id gnl|my_center|LOCUS_12960 6538 4961 gene locus_tag LOCUS_12970 gene guaA 6538 4961 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138282.1 protein_id gnl|my_center|LOCUS_12970 8073 6607 gene locus_tag LOCUS_12980 gene guaB 8073 6607 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299507.1 protein_id gnl|my_center|LOCUS_12980 8235 9605 gene locus_tag LOCUS_12990 gene xseA 8235 9605 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937933.1 protein_id gnl|my_center|LOCUS_12990 9817 9602 gene locus_tag LOCUS_13000 9817 9602 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301444.1 protein_id gnl|my_center|LOCUS_13000 11358 9886 gene locus_tag LOCUS_13010 gene der 11358 9886 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249410.1 protein_id gnl|my_center|LOCUS_13010 12654 11476 gene locus_tag LOCUS_13020 gene bamB 12654 11476 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177043.1 protein_id gnl|my_center|LOCUS_13020 13285 12665 gene locus_tag LOCUS_13030 gene yfgM 13285 12665 CDS product ancillary SecYEG translocon subunit YfgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409205.1 protein_id gnl|my_center|LOCUS_13030 14577 13303 gene locus_tag LOCUS_13040 gene hisS 14577 13303 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107167.1 protein_id gnl|my_center|LOCUS_13040 15806 14688 gene locus_tag LOCUS_13050 gene ispG 15806 14688 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551807.1 protein_id gnl|my_center|LOCUS_13050 16846 15833 gene locus_tag LOCUS_13060 gene rodZ 16846 15833 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090858.1 protein_id gnl|my_center|LOCUS_13060 18285 17131 gene locus_tag LOCUS_13070 18285 17131 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003317.1 protein_id gnl|my_center|LOCUS_13070 18866 18435 gene locus_tag LOCUS_13080 gene ndk 18866 18435 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963837.1 protein_id gnl|my_center|LOCUS_13080 21327 19015 gene locus_tag LOCUS_13090 gene pbpC 21327 19015 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137711.1 protein_id gnl|my_center|LOCUS_13090 26286 21328 gene locus_tag LOCUS_13100 gene yfhM 26286 21328 CDS product alpha2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736368.1 protein_id gnl|my_center|LOCUS_13100 26493 27338 gene locus_tag LOCUS_13110 gene sseA 26493 27338 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108626.1 protein_id gnl|my_center|LOCUS_13110 28607 27831 gene locus_tag LOCUS_13120 gene sseB 28607 27831 CDS product enhanced serine sensitivity protein SseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295479.1 protein_id gnl|my_center|LOCUS_13120 30032 28749 gene locus_tag LOCUS_13130 gene pepB 30032 28749 CDS product aminopeptidase PepB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133582.1 protein_id gnl|my_center|LOCUS_13130 30410 30210 gene locus_tag LOCUS_13140 gene iscX 30410 30210 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523616.1 protein_id gnl|my_center|LOCUS_13140 30757 30422 gene locus_tag LOCUS_13150 gene fdx 30757 30422 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124469.1 protein_id gnl|my_center|LOCUS_13150 32609 30759 gene locus_tag LOCUS_13160 gene hscA 32609 30759 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196613.1 protein_id gnl|my_center|LOCUS_13160 33141 32626 gene locus_tag LOCUS_13170 gene hscB 33141 32626 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384411.1 protein_id gnl|my_center|LOCUS_13170 33560 33237 gene locus_tag LOCUS_13180 gene iscA 33560 33237 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_13180 33963 33577 gene locus_tag LOCUS_13190 gene iscU 33963 33577 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_13190 35205 33991 gene locus_tag LOCUS_13200 gene iscS 35205 33991 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_13200 35805 35317 gene locus_tag LOCUS_13210 gene iscR 35805 35317 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241357.1 protein_id gnl|my_center|LOCUS_13210 36843 36106 gene locus_tag LOCUS_13220 gene trmJ 36843 36106 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940018.1 protein_id gnl|my_center|LOCUS_13220 36962 37765 gene locus_tag LOCUS_13230 gene suhB 36962 37765 CDS product inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553451.1 protein_id gnl|my_center|LOCUS_13230 37910 38764 gene locus_tag LOCUS_13240 37910 38764 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297705.1 protein_id gnl|my_center|LOCUS_13240 38955 40235 gene locus_tag LOCUS_13250 gene csiE 38955 40235 CDS product stationary phase inducible protein CsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983009.1 protein_id gnl|my_center|LOCUS_13250 41366 40227 gene locus_tag LOCUS_13260 41366 40227 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244193.1 protein_id gnl|my_center|LOCUS_13260 42416 41526 gene locus_tag LOCUS_13270 gene hcaR 42416 41526 CDS product DNA-binding transcriptional regulator HcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423257.1 protein_id gnl|my_center|LOCUS_13270 42552 43913 gene locus_tag LOCUS_13280 42552 43913 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211172.1 protein_id gnl|my_center|LOCUS_13280 43910 44428 gene locus_tag LOCUS_13290 43910 44428 CDS product 3-phenylpropionate/cinnamic acid dioxygenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276072.1 protein_id gnl|my_center|LOCUS_13290 44428 44748 gene locus_tag LOCUS_13300 44428 44748 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080102.1 protein_id gnl|my_center|LOCUS_13300 44745 45557 gene locus_tag LOCUS_13310 gene hcaB 44745 45557 CDS product 3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281372.1 protein_id gnl|my_center|LOCUS_13310 45567 46769 gene locus_tag LOCUS_13320 45567 46769 CDS product phenylpropionate dioxygenase ferredoxin reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660797.1 protein_id gnl|my_center|LOCUS_13320 46866 47288 gene locus_tag LOCUS_13330 46866 47288 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094726.1 protein_id gnl|my_center|LOCUS_13330 48208 47336 gene locus_tag LOCUS_13340 48208 47336 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158547.1 protein_id gnl|my_center|LOCUS_13340 49281 48220 gene locus_tag LOCUS_13350 49281 48220 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700809.1 protein_id gnl|my_center|LOCUS_13350 50345 49347 gene locus_tag LOCUS_13360 50345 49347 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276670.1 protein_id gnl|my_center|LOCUS_13360 51881 50370 gene locus_tag LOCUS_13370 51881 50370 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493470.1 protein_id gnl|my_center|LOCUS_13370 52887 51904 gene locus_tag LOCUS_13380 52887 51904 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124894.1 protein_id gnl|my_center|LOCUS_13380 56265 52984 gene locus_tag LOCUS_13390 56265 52984 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386984.1 protein_id gnl|my_center|LOCUS_13390 56377 57576 gene locus_tag LOCUS_13400 56377 57576 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299519.1 protein_id gnl|my_center|LOCUS_13400 58893 57640 gene locus_tag LOCUS_13410 gene glyA 58893 57640 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_13410 59221 60411 gene locus_tag LOCUS_13420 gene hmpA 59221 60411 CDS product NO-inducible flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883122.1 protein_id gnl|my_center|LOCUS_13420 60794 60456 gene locus_tag LOCUS_13430 gene glnB 60794 60456 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914032.1 protein_id gnl|my_center|LOCUS_13430 62189 60855 gene locus_tag LOCUS_13440 gene glrR 62189 60855 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298983.1 protein_id gnl|my_center|LOCUS_13440 62868 62179 gene locus_tag LOCUS_13450 gene qseG 62868 62179 CDS product two-component system QseEF-associated lipoprotein QseG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215888.1 protein_id gnl|my_center|LOCUS_13450 64439 63057 gene locus_tag LOCUS_13460 gene qseE 64439 63057 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297612.1 protein_id gnl|my_center|LOCUS_13460 68929 65042 gene locus_tag LOCUS_13470 gene purL 68929 65042 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970087.1 protein_id gnl|my_center|LOCUS_13470 69187 70743 gene locus_tag LOCUS_13480 gene mltF 69187 70743 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000734212.1 protein_id gnl|my_center|LOCUS_13480 71243 70740 gene locus_tag LOCUS_13490 gene tadA 71243 70740 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297409.1 protein_id gnl|my_center|LOCUS_13490 71936 71301 gene locus_tag LOCUS_13500 gene yfhb 71936 71301 CDS product phosphatidylglycerophosphatase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190655.1 protein_id gnl|my_center|LOCUS_13500 72073 72993 gene locus_tag LOCUS_13510 72073 72993 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455839.1 protein_id gnl|my_center|LOCUS_13510 73124 73309 gene locus_tag LOCUS_13520 73124 73309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence13 896 186 gene locus_tag LOCUS_13530 gene nlpE 896 186 CDS product envelope stress response activation lipoprotein NlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239154.1 protein_id gnl|my_center|LOCUS_13530 1332 910 gene locus_tag LOCUS_13540 gene arfB 1332 910 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635545.1 protein_id gnl|my_center|LOCUS_13540 1874 1329 gene locus_tag LOCUS_13550 1874 1329 CDS product YaeQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185290.1 protein_id gnl|my_center|LOCUS_13550 2040 2240 gene locus_tag LOCUS_13560 2040 2240 CDS product YaeP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000417058.1 protein_id gnl|my_center|LOCUS_13560 2227 2487 gene locus_tag LOCUS_13570 gene rof 2227 2487 CDS product Rho-binding antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062312.1 protein_id gnl|my_center|LOCUS_13570 3834 2536 gene locus_tag LOCUS_13580 gene tilS 3834 2536 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176578.1 protein_id gnl|my_center|LOCUS_13580 4288 3899 gene locus_tag LOCUS_13590 4288 3899 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901098.1 protein_id gnl|my_center|LOCUS_13590 6486 4345 gene locus_tag LOCUS_13600 gene ldcC 6486 4345 CDS product lysine decarboxylase LdcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020973.1 protein_id gnl|my_center|LOCUS_13600 7544 6585 gene locus_tag LOCUS_13610 gene accA 7544 6585 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055741.1 protein_id gnl|my_center|LOCUS_13610 11039 7557 gene locus_tag LOCUS_13620 gene dnaE 11039 7557 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294757.1 protein_id gnl|my_center|LOCUS_13620 11672 11076 gene locus_tag LOCUS_13630 gene rnhB 11672 11076 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 protein_id gnl|my_center|LOCUS_13630 12817 11669 gene locus_tag LOCUS_13640 gene lpxB 12817 11669 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139667.1 protein_id gnl|my_center|LOCUS_13640 13605 12817 gene locus_tag LOCUS_13650 gene lpxA 13605 12817 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565966.1 protein_id gnl|my_center|LOCUS_13650 14064 13609 gene locus_tag LOCUS_13660 gene fabZ 14064 13609 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210739.1 protein_id gnl|my_center|LOCUS_13660 15194 14169 gene locus_tag LOCUS_13670 gene lpxD 15194 14169 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139279.1 protein_id gnl|my_center|LOCUS_13670 15683 15198 gene locus_tag LOCUS_13680 gene skp 15683 15198 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758956.1 protein_id gnl|my_center|LOCUS_13680 18237 15805 gene locus_tag LOCUS_13690 gene bamA 18237 15805 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240896.1 protein_id gnl|my_center|LOCUS_13690 19619 18267 gene locus_tag LOCUS_13700 gene rseP 19619 18267 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295561.1 protein_id gnl|my_center|LOCUS_13700 20380 19631 gene locus_tag LOCUS_13710 gene cdsA 20380 19631 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922446.1 protein_id gnl|my_center|LOCUS_13710 21190 20501 gene locus_tag LOCUS_13720 gene ispU 21190 20501 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295562.1 protein_id gnl|my_center|LOCUS_13720 22644 21448 gene locus_tag LOCUS_13730 gene ispC 22644 21448 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811923.1 protein_id gnl|my_center|LOCUS_13730 23293 22736 gene locus_tag LOCUS_13740 gene frr 23293 22736 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622418.1 protein_id gnl|my_center|LOCUS_13740 24310 23585 gene locus_tag LOCUS_13750 gene pyrH 24310 23585 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224573.1 protein_id gnl|my_center|LOCUS_13750 25308 24457 gene locus_tag LOCUS_13760 gene tsf 25308 24457 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818114.1 protein_id gnl|my_center|LOCUS_13760 26291 25566 gene locus_tag LOCUS_13770 gene rpsB 26291 25566 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246884.1 protein_id gnl|my_center|LOCUS_13770 26659 27453 gene locus_tag LOCUS_13780 gene map 26659 27453 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018194.1 protein_id gnl|my_center|LOCUS_13780 27515 30187 gene locus_tag LOCUS_13790 gene glnD 27515 30187 CDS product bifunctional uridylyltransferase/uridylyl-removing protein GlnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094571.1 protein_id gnl|my_center|LOCUS_13790 30218 31042 gene locus_tag LOCUS_13800 gene dapD 30218 31042 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186650.1 protein_id gnl|my_center|LOCUS_13800 31354 31740 gene locus_tag LOCUS_13810 31354 31740 CDS product DUF3461 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272188.1 protein_id gnl|my_center|LOCUS_13810 32986 31829 gene locus_tag LOCUS_13820 gene cdaR 32986 31829 CDS product DNA-binding transcriptional regulator CdaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929439.1 protein_id gnl|my_center|LOCUS_13820 34565 33141 gene locus_tag LOCUS_13830 gene degP 34565 33141 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753945.1 protein_id gnl|my_center|LOCUS_13830 36212 34695 gene locus_tag LOCUS_13840 gene dgt 36212 34695 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057067.1 protein_id gnl|my_center|LOCUS_13840 36296 36994 gene locus_tag LOCUS_13850 gene mtnN 36296 36994 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689844.1 protein_id gnl|my_center|LOCUS_13850 36987 37787 gene locus_tag LOCUS_13860 gene btuF 36987 37787 CDS product vitamin B12 ABC transporter substrate-binding protein BtuF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129927.1 protein_id gnl|my_center|LOCUS_13860 37825 38448 gene locus_tag LOCUS_13870 37825 38448 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964221.1 protein_id gnl|my_center|LOCUS_13870 38839 38495 gene locus_tag LOCUS_13880 gene erpA 38839 38495 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295564.1 protein_id gnl|my_center|LOCUS_13880 40342 38921 gene locus_tag LOCUS_13890 gene clcA 40342 38921 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845394.1 protein_id gnl|my_center|LOCUS_13890 40567 41847 gene locus_tag LOCUS_13900 gene hemL 40567 41847 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045290.1 protein_id gnl|my_center|LOCUS_13900 43864 41882 gene locus_tag LOCUS_13910 gene fhuB 43864 41882 CDS product Fe(3+)-hydroxamate ABC transporter permease FhuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044094.1 protein_id gnl|my_center|LOCUS_13910 44751 43861 gene locus_tag LOCUS_13920 gene fhuD 44751 43861 CDS product Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295787.1 protein_id gnl|my_center|LOCUS_13920 45548 44751 gene locus_tag LOCUS_13930 gene fhuC 45548 44751 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158929.1 protein_id gnl|my_center|LOCUS_13930 47842 45599 gene locus_tag LOCUS_13940 gene fhuA 47842 45599 CDS product ferrichrome porin FhuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124438.1 protein_id gnl|my_center|LOCUS_13940 50596 48062 gene locus_tag LOCUS_13950 gene mrcB 50596 48062 CDS product bifunctional glycosyl transferase/transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918166.1 protein_id gnl|my_center|LOCUS_13950 50789 50583 gene locus_tag LOCUS_13960 50789 50583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 53266 50792 gene locus_tag LOCUS_13970 gene hrpB 53266 50792 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938639.1 protein_id gnl|my_center|LOCUS_13970 53295 53825 gene locus_tag LOCUS_13980 gene thpR 53295 53825 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294700.1 protein_id gnl|my_center|LOCUS_13980 53840 54544 gene locus_tag LOCUS_13990 gene sfsA 53840 54544 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000396036.1 protein_id gnl|my_center|LOCUS_13990 54722 55177 gene locus_tag LOCUS_14000 gene dksA 54722 55177 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155227.1 protein_id gnl|my_center|LOCUS_14000 55214 56140 gene locus_tag LOCUS_14010 gene gluQRS 55214 56140 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937432.1 protein_id gnl|my_center|LOCUS_14010 56233 57597 gene locus_tag LOCUS_14020 gene pcnB 56233 57597 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174643.1 protein_id gnl|my_center|LOCUS_14020 57594 58073 gene locus_tag LOCUS_14030 gene folK 57594 58073 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215124.1 protein_id gnl|my_center|LOCUS_14030 58443 59027 gene locus_tag LOCUS_14040 58443 59027 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038438.1 protein_id gnl|my_center|LOCUS_14040 59132 59872 gene locus_tag LOCUS_14050 59132 59872 CDS product fimbrial chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000465930.1 protein_id gnl|my_center|LOCUS_14050 59907 62507 gene locus_tag LOCUS_14060 gene htrE 59907 62507 CDS product Yad fimbria usher protein HtrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153166.1 protein_id gnl|my_center|LOCUS_14060 62524 63093 gene locus_tag LOCUS_14070 62524 63093 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591057.1 protein_id gnl|my_center|LOCUS_14070 63108 63710 gene locus_tag LOCUS_14080 gene yadL 63108 63710 CDS product fimbrial-like protein YadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143205.1 protein_id gnl|my_center|LOCUS_14080 63737 64333 gene locus_tag LOCUS_14090 63737 64333 CDS product fimbrial-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553764.1 protein_id gnl|my_center|LOCUS_14090 64386 65660 gene locus_tag LOCUS_14100 64386 65660 CDS product fimbrial-like adhesin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713138.1 protein_id gnl|my_center|LOCUS_14100 65773 66567 gene locus_tag LOCUS_14110 gene panB 65773 66567 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805455.1 protein_id gnl|my_center|LOCUS_14110 66579 67430 gene locus_tag LOCUS_14120 gene panC 66579 67430 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905383.1 protein_id gnl|my_center|LOCUS_14120 68406 67504 gene locus_tag LOCUS_14130 gene rpnC 68406 67504 CDS product recombination-promoting nuclease RpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339945.1 protein_id gnl|my_center|LOCUS_14130 68680 69060 gene locus_tag LOCUS_14140 gene panD 68680 69060 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621515.1 protein_id gnl|my_center|LOCUS_14140 70293 69064 gene locus_tag LOCUS_14150 70293 69064 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277872.1 protein_id gnl|my_center|LOCUS_14150 70797 70357 gene locus_tag LOCUS_14160 70797 70357 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901989.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence14 2559 142 gene locus_tag LOCUS_14170 gene gyrB 2559 142 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072067.1 protein_id gnl|my_center|LOCUS_14170 3658 2585 gene locus_tag LOCUS_14180 gene recF 3658 2585 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060112.1 protein_id gnl|my_center|LOCUS_14180 4758 3658 gene locus_tag LOCUS_14190 gene dnaN 4758 3658 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673464.1 protein_id gnl|my_center|LOCUS_14190 6097 4763 gene locus_tag LOCUS_14200 gene dnaA 6097 4763 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059111.1 protein_id gnl|my_center|LOCUS_14200 6773 6913 gene locus_tag LOCUS_14210 gene rpmH 6773 6913 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831330.1 protein_id gnl|my_center|LOCUS_14210 6963 7289 gene locus_tag LOCUS_14220 gene rnpA 6963 7289 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239730.1 protein_id gnl|my_center|LOCUS_14220 7513 9159 gene locus_tag LOCUS_14230 gene yidC 7513 9159 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378258.1 protein_id gnl|my_center|LOCUS_14230 9265 10629 gene locus_tag LOCUS_14240 gene mnmE 9265 10629 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282346.1 protein_id gnl|my_center|LOCUS_14240 11167 12582 gene locus_tag LOCUS_14250 gene tnaA 11167 12582 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295247.1 protein_id gnl|my_center|LOCUS_14250 12673 13920 gene locus_tag LOCUS_14260 gene tnaB 12673 13920 CDS product low affinity tryptophan permease TnaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131911.1 protein_id gnl|my_center|LOCUS_14260 14053 15228 gene locus_tag LOCUS_14270 gene mdtL 14053 15228 CDS product multidrug efflux MFS transporter MdtL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000085982.1 protein_id gnl|my_center|LOCUS_14270 15194 16162 gene locus_tag LOCUS_14280 gene yidZ 15194 16162 CDS product HTH-type transcriptional regulator YidZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748502.1 protein_id gnl|my_center|LOCUS_14280 16319 17068 gene locus_tag LOCUS_14290 16319 17068 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296581.1 protein_id gnl|my_center|LOCUS_14290 17090 17656 gene locus_tag LOCUS_14300 gene yieF 17090 17656 CDS product class I chromate reductase YieF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291260.1 protein_id gnl|my_center|LOCUS_14300 19047 17710 gene locus_tag LOCUS_14310 gene adeP 19047 17710 CDS product adenine permease AdeP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082693.1 protein_id gnl|my_center|LOCUS_14310 19214 19879 gene locus_tag LOCUS_14320 gene yieH 19214 19879 CDS product 6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078043.1 protein_id gnl|my_center|LOCUS_14320 19946 20419 gene locus_tag LOCUS_14330 19946 20419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116764.1 protein_id gnl|my_center|LOCUS_14330 20468 21055 gene locus_tag LOCUS_14340 gene cbrC 20468 21055 CDS product PF03691 family colicin E2 tolerance protein CbrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193070.1 protein_id gnl|my_center|LOCUS_14340 21839 21117 gene locus_tag LOCUS_14350 21839 21117 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766900.1 protein_id gnl|my_center|LOCUS_14350 23023 21854 gene locus_tag LOCUS_14360 23023 21854 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_14360 24666 23050 gene locus_tag LOCUS_14370 gene bglH 24666 23050 CDS product carbohydrate-specific porin BglH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489881.1 protein_id gnl|my_center|LOCUS_14370 26146 24752 gene locus_tag LOCUS_14380 gene bglB 26146 24752 CDS product 6-phospho-beta-glucosidase BglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643228.1 protein_id gnl|my_center|LOCUS_14380 28042 26165 gene locus_tag LOCUS_14390 gene bglF 28042 26165 CDS product PTS beta-glucoside transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137312.1 protein_id gnl|my_center|LOCUS_14390 29012 28176 gene locus_tag LOCUS_14400 gene bglG 29012 28176 CDS product transcriptional antiterminator BglG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295251.1 protein_id gnl|my_center|LOCUS_14400 30024 29299 gene locus_tag LOCUS_14410 gene phoU 30024 29299 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377786.1 protein_id gnl|my_center|LOCUS_14410 30812 30039 gene locus_tag LOCUS_14420 gene pstB 30812 30039 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063125.1 protein_id gnl|my_center|LOCUS_14420 31793 30903 gene locus_tag LOCUS_14430 gene pstA 31793 30903 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251991.1 protein_id gnl|my_center|LOCUS_14430 32752 31793 gene locus_tag LOCUS_14440 gene pstC 32752 31793 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000741620.1 protein_id gnl|my_center|LOCUS_14440 33879 32839 gene locus_tag LOCUS_14450 gene pstS 33879 32839 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867146.1 protein_id gnl|my_center|LOCUS_14450 35200 34127 gene locus_tag LOCUS_14460 35200 34127 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046023.1 protein_id gnl|my_center|LOCUS_14460 37733 35211 gene locus_tag LOCUS_14470 37733 35211 CDS product fimbrial biogenesis outer membrane usher protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989215.1 protein_id gnl|my_center|LOCUS_14470 38150 37758 gene locus_tag LOCUS_14480 38150 37758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14480 38489 38277 gene locus_tag LOCUS_14490 38489 38277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14490 39109 38537 gene locus_tag LOCUS_14500 39109 38537 CDS product long polar fimbria major subunit LpfA-O113 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827808.1 protein_id gnl|my_center|LOCUS_14500 41240 39411 gene locus_tag LOCUS_14510 gene glmS 41240 39411 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334099.1 protein_id gnl|my_center|LOCUS_14510 42772 41402 gene locus_tag LOCUS_14520 gene glmU 42772 41402 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933736.1 protein_id gnl|my_center|LOCUS_14520 43542 43123 gene locus_tag LOCUS_14530 43542 43123 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251965.1 protein_id gnl|my_center|LOCUS_14530 44945 43563 gene locus_tag LOCUS_14540 gene atpD 44945 43563 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190506.1 protein_id gnl|my_center|LOCUS_14540 45835 44972 gene locus_tag LOCUS_14550 gene atpG 45835 44972 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896498.1 protein_id gnl|my_center|LOCUS_14550 47427 45886 gene locus_tag LOCUS_14560 gene atpA 47427 45886 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176745.1 protein_id gnl|my_center|LOCUS_14560 47973 47440 gene locus_tag LOCUS_14570 gene atpH 47973 47440 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288587.1 protein_id gnl|my_center|LOCUS_14570 48458 47988 gene locus_tag LOCUS_14580 gene atpF 48458 47988 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052217.1 protein_id gnl|my_center|LOCUS_14580 48759 48520 gene locus_tag LOCUS_14590 gene atpE 48759 48520 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429386.1 protein_id gnl|my_center|LOCUS_14590 49621 48806 gene locus_tag LOCUS_14600 gene atpB 49621 48806 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135625.1 protein_id gnl|my_center|LOCUS_14600 50022 49630 gene locus_tag LOCUS_14610 gene atpI 50022 49630 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116695.1 protein_id gnl|my_center|LOCUS_14610 51250 50627 gene locus_tag LOCUS_14620 gene rsmG 51250 50627 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932839.1 protein_id gnl|my_center|LOCUS_14620 53203 51314 gene locus_tag LOCUS_14630 gene mnmG 53203 51314 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_14630 54025 53582 gene locus_tag LOCUS_14640 gene mioC 54025 53582 CDS product FMN-binding protein MioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763731.1 protein_id gnl|my_center|LOCUS_14640 54573 54115 gene locus_tag LOCUS_14650 gene asnC 54573 54115 CDS product transcriptional regulator AsnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432970.1 protein_id gnl|my_center|LOCUS_14650 54725 55717 gene locus_tag LOCUS_14660 gene asnA 54725 55717 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000845133.1 protein_id gnl|my_center|LOCUS_14660 57173 55722 gene locus_tag LOCUS_14670 gene viaA 57173 55722 CDS product ATPase RavA stimulator ViaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956630.1 protein_id gnl|my_center|LOCUS_14670 58663 57167 gene locus_tag LOCUS_14680 gene ravA 58663 57167 CDS product ATPase RavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001315921.1 protein_id gnl|my_center|LOCUS_14680 58886 60754 gene locus_tag LOCUS_14690 gene kup 58886 60754 CDS product low affinity potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000102319.1 protein_id gnl|my_center|LOCUS_14690 60921 61340 gene locus_tag LOCUS_14700 gene rbsD 60921 61340 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715936.1 protein_id gnl|my_center|LOCUS_14700 61348 62853 gene locus_tag LOCUS_14710 gene rbsA 61348 62853 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387753.1 protein_id gnl|my_center|LOCUS_14710 62858 63823 gene locus_tag LOCUS_14720 gene rbsC 62858 63823 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211858.1 protein_id gnl|my_center|LOCUS_14720 63848 64738 gene locus_tag LOCUS_14730 gene rbsB 63848 64738 CDS product ribose ABC transporter substrate-binding protein RbsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056273.1 protein_id gnl|my_center|LOCUS_14730 64849 65793 gene locus_tag LOCUS_14740 gene rbsK 64849 65793 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354235.1 protein_id gnl|my_center|LOCUS_14740 65806 66789 gene locus_tag LOCUS_14750 gene rbsR 65806 66789 CDS product ribose operon transcriptional repressor RbsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224470.1 protein_id gnl|my_center|LOCUS_14750 68182 66755 gene locus_tag LOCUS_14760 gene mdtD 68182 66755 CDS product multidrug transporter subunit MdtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280837.1 protein_id gnl|my_center|LOCUS_14760 68897 68205 gene locus_tag LOCUS_14770 68897 68205 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131164.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence15 3 216 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgttccccgcgccagcggggataaaccggc 1333 296 gene locus_tag LOCUS_14780 gene iap 1333 296 CDS product alkaline phosphatase isozyme conversion aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490426.1 protein_id gnl|my_center|LOCUS_14780 1585 2493 gene locus_tag LOCUS_14790 gene cysD 1585 2493 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372392.1 protein_id gnl|my_center|LOCUS_14790 2495 3922 gene locus_tag LOCUS_14800 gene cysN 2495 3922 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090348.1 protein_id gnl|my_center|LOCUS_14800 3922 4527 gene locus_tag LOCUS_14810 gene cysC 3922 4527 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173673.1 protein_id gnl|my_center|LOCUS_14810 4577 4900 gene locus_tag LOCUS_14820 4577 4900 CDS product DUF3561 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246104.1 protein_id gnl|my_center|LOCUS_14820 4885 5106 gene locus_tag LOCUS_14830 4885 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 5094 5405 gene locus_tag LOCUS_14840 gene ftsB 5094 5405 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517476.1 protein_id gnl|my_center|LOCUS_14840 5424 6134 gene locus_tag LOCUS_14850 gene ispD 5424 6134 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246138.1 protein_id gnl|my_center|LOCUS_14850 6134 6613 gene locus_tag LOCUS_14860 gene ispF 6134 6613 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219242.1 protein_id gnl|my_center|LOCUS_14860 6610 7659 gene locus_tag LOCUS_14870 gene truD 6610 7659 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568924.1 protein_id gnl|my_center|LOCUS_14870 7640 8401 gene locus_tag LOCUS_14880 gene surE 7640 8401 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295182.1 protein_id gnl|my_center|LOCUS_14880 8395 9021 gene locus_tag LOCUS_14890 gene pcm 8395 9021 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254708.1 protein_id gnl|my_center|LOCUS_14890 9161 10300 gene locus_tag LOCUS_14900 gene nlpD 9161 10300 CDS product murein hydrolase activator NlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272590.1 protein_id gnl|my_center|LOCUS_14900 10363 11355 gene locus_tag LOCUS_14910 gene rpoS 10363 11355 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081550.1 protein_id gnl|my_center|LOCUS_14910 11883 11476 gene locus_tag LOCUS_14920 11883 11476 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208070.1 protein_id gnl|my_center|LOCUS_14920 12030 12623 gene locus_tag LOCUS_14930 12030 12623 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767718.1 protein_id gnl|my_center|LOCUS_14930 12623 14050 gene locus_tag LOCUS_14940 12623 14050 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863205.1 protein_id gnl|my_center|LOCUS_14940 14061 14297 gene locus_tag LOCUS_14950 14061 14297 CDS product non-oxidative hydroxyarylic acid decarboxylases subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562982.1 protein_id gnl|my_center|LOCUS_14950 15655 14336 gene locus_tag LOCUS_14960 15655 14336 CDS product GntP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104441.1 protein_id gnl|my_center|LOCUS_14960 16565 15789 gene locus_tag LOCUS_14970 16565 15789 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136918.1 protein_id gnl|my_center|LOCUS_14970 17208 16570 gene locus_tag LOCUS_14980 17208 16570 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278994.1 protein_id gnl|my_center|LOCUS_14980 18467 17205 gene locus_tag LOCUS_14990 18467 17205 CDS product 3-oxo-tetronate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590392.1 protein_id gnl|my_center|LOCUS_14990 19372 18464 gene locus_tag LOCUS_15000 19372 18464 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847985.1 protein_id gnl|my_center|LOCUS_15000 19568 20335 gene locus_tag LOCUS_15010 gene ygbI 19568 20335 CDS product DNA-binding transcriptional repressor YgbI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297141.1 protein_id gnl|my_center|LOCUS_15010 21042 20386 gene locus_tag LOCUS_15020 gene pphB 21042 20386 CDS product protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141350.1 protein_id gnl|my_center|LOCUS_15020 23709 21148 gene locus_tag LOCUS_15030 gene mutS 23709 21148 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272898.1 protein_id gnl|my_center|LOCUS_15030 23996 24349 gene locus_tag LOCUS_15040 23996 24349 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015498.1 protein_id gnl|my_center|LOCUS_15040 26464 24386 gene locus_tag LOCUS_15050 gene flhA 26464 24386 CDS product formate hydrogenlyase transcriptional activator FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297144.1 protein_id gnl|my_center|LOCUS_15050 27548 26538 gene locus_tag LOCUS_15060 gene hypE 27548 26538 CDS product hydrogenase maturation carbamoyl dehydratase HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059931.1 protein_id gnl|my_center|LOCUS_15060 28666 27545 gene locus_tag LOCUS_15070 gene hypD 28666 27545 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212982.1 protein_id gnl|my_center|LOCUS_15070 28938 28666 gene locus_tag LOCUS_15080 gene hypC 28938 28666 CDS product hydrogenase 3 maturation protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334881.1 protein_id gnl|my_center|LOCUS_15080 29801 28929 gene locus_tag LOCUS_15090 gene hypB 29801 28929 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337668.1 protein_id gnl|my_center|LOCUS_15090 30155 29805 gene locus_tag LOCUS_15100 gene hypA 30155 29805 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508457.1 protein_id gnl|my_center|LOCUS_15100 30367 30828 gene locus_tag LOCUS_15110 gene hycA 30367 30828 CDS product formate hydrogenlyase regulator HycA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158056.1 protein_id gnl|my_center|LOCUS_15110 30953 31564 gene locus_tag LOCUS_15120 gene hycB 30953 31564 CDS product formate hydrogenlyase subunit HycB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079181.1 protein_id gnl|my_center|LOCUS_15120 31561 33387 gene locus_tag LOCUS_15130 gene hycC 31561 33387 CDS product formate hydrogenlyase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274388.1 protein_id gnl|my_center|LOCUS_15130 33390 34313 gene locus_tag LOCUS_15140 gene hycD 33390 34313 CDS product formate hydrogenlyase subunit HycD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115223.1 protein_id gnl|my_center|LOCUS_15140 34331 36040 gene locus_tag LOCUS_15150 gene hycE 34331 36040 CDS product formate hydrogenlyase subunit HycE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288134.1 protein_id gnl|my_center|LOCUS_15150 36050 36592 gene locus_tag LOCUS_15160 gene hycF 36050 36592 CDS product formate hydrogenlyase subunit HycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493785.1 protein_id gnl|my_center|LOCUS_15160 36592 37359 gene locus_tag LOCUS_15170 gene hycG 36592 37359 CDS product formate hydrogenlyase subunit HycG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067399.1 protein_id gnl|my_center|LOCUS_15170 37356 37766 gene locus_tag LOCUS_15180 gene hycH 37356 37766 CDS product formate hydrogenlyase assembly protein HycH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291921.1 protein_id gnl|my_center|LOCUS_15180 37759 38229 gene locus_tag LOCUS_15190 gene hycI 37759 38229 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132961.1 protein_id gnl|my_center|LOCUS_15190 39812 38388 gene locus_tag LOCUS_15200 gene ascB 39812 38388 CDS product 6-phospho-beta-glucosidase AscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110331.1 protein_id gnl|my_center|LOCUS_15200 41278 39821 gene locus_tag LOCUS_15210 gene ascF 41278 39821 CDS product PTS cellobiose/arbutin/salicin transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107859.1 protein_id gnl|my_center|LOCUS_15210 41547 42548 gene locus_tag LOCUS_15220 gene ascG 41547 42548 CDS product DNA-binding transcriptional regulator AscG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001374632.1 protein_id gnl|my_center|LOCUS_15220 42697 43224 gene locus_tag LOCUS_15230 gene hydN 42697 43224 CDS product electron transport protein HydN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078777.1 protein_id gnl|my_center|LOCUS_15230 43377 45629 gene locus_tag LOCUS_15240 gene hypF 43377 45629 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107688.1 protein_id gnl|my_center|LOCUS_15240 46890 45757 gene locus_tag LOCUS_15250 gene norW 46890 45757 CDS product NADH:flavorubredoxin reductase NorW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064748.1 protein_id gnl|my_center|LOCUS_15250 48326 46887 gene locus_tag LOCUS_15260 gene norV 48326 46887 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029634.1 protein_id gnl|my_center|LOCUS_15260 48513 50027 gene locus_tag LOCUS_15270 gene norR 48513 50027 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010723.1 protein_id gnl|my_center|LOCUS_15270 50989 50024 gene locus_tag LOCUS_15280 gene gutQ 50989 50024 CDS product arabinose-5-phosphate isomerase GutQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287415.1 protein_id gnl|my_center|LOCUS_15280 51755 50982 gene locus_tag LOCUS_15290 gene srlR 51755 50982 CDS product glucitol operon DNA-binding transcriptional repressor SrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804550.1 protein_id gnl|my_center|LOCUS_15290 52181 51822 gene locus_tag LOCUS_15300 gene gutM 52181 51822 CDS product transcriptional regulator GutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252908.1 protein_id gnl|my_center|LOCUS_15300 53065 52286 gene locus_tag LOCUS_15310 gene srlD 53065 52286 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077358.1 protein_id gnl|my_center|LOCUS_15310 53440 53069 gene locus_tag LOCUS_15320 gene srlB 53440 53069 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216201.1 protein_id gnl|my_center|LOCUS_15320 54410 53451 gene locus_tag LOCUS_15330 gene srlE 54410 53451 CDS product PTS glucitol/sorbitol transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148875.1 protein_id gnl|my_center|LOCUS_15330 54970 54407 gene locus_tag LOCUS_15340 gene srlA 54970 54407 CDS product PTS glucitol/sorbitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573321.1 protein_id gnl|my_center|LOCUS_15340 55226 56311 gene locus_tag LOCUS_15350 gene mltB 55226 56311 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295177.1 protein_id gnl|my_center|LOCUS_15350 56456 56953 gene locus_tag LOCUS_15360 gene pncC 56456 56953 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_15360 57033 58094 gene locus_tag LOCUS_15370 gene recA 57033 58094 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963143.1 protein_id gnl|my_center|LOCUS_15370 58337 58837 gene locus_tag LOCUS_15380 gene recX 58337 58837 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140506.1 protein_id gnl|my_center|LOCUS_15380 58965 61595 gene locus_tag LOCUS_15390 gene alaS 58965 61595 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047179.1 protein_id gnl|my_center|LOCUS_15390 61830 62015 gene locus_tag LOCUS_15400 gene csrA 61830 62015 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906486.1 protein_id gnl|my_center|LOCUS_15400 62331 62423 gene locus_tag LOCUS_t00200 62331 62423 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62427 62503 gene locus_tag LOCUS_t00210 62427 62503 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62518 62447 gene locus_tag LOCUS_t00220 62518 62447 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 62701 62777 gene locus_tag LOCUS_t00230 62701 62777 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 508 74 gene locus_tag LOCUS_15410 gene phnO 508 74 CDS product aminoalkylphosphonate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110490.1 protein_id gnl|my_center|LOCUS_15410 1052 495 gene locus_tag LOCUS_15420 gene phnN 1052 495 CDS product ribose 1,5-bisphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971891.1 protein_id gnl|my_center|LOCUS_15420 2188 1052 gene locus_tag LOCUS_15430 gene phnM 2188 1052 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586282.1 protein_id gnl|my_center|LOCUS_15430 2865 2185 gene locus_tag LOCUS_15440 gene phnL 2865 2185 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611405.1 protein_id gnl|my_center|LOCUS_15440 3734 2976 gene locus_tag LOCUS_15450 gene phnK 3734 2976 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075514.1 protein_id gnl|my_center|LOCUS_15450 4576 3731 gene locus_tag LOCUS_15460 gene phnJ 4576 3731 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002284.1 protein_id gnl|my_center|LOCUS_15460 5633 4569 gene locus_tag LOCUS_15470 gene phnI 5633 4569 CDS product alpha-D-ribose 1-methylphosphonate 5-triphosphate synthase subunit PhnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301782.1 protein_id gnl|my_center|LOCUS_15470 6217 5633 gene locus_tag LOCUS_15480 gene phnH 6217 5633 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171603.1 protein_id gnl|my_center|LOCUS_15480 6666 6214 gene locus_tag LOCUS_15490 gene phnG 6666 6214 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542776.1 protein_id gnl|my_center|LOCUS_15490 7392 6667 gene locus_tag LOCUS_15500 gene phnF 7392 6667 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295387.1 protein_id gnl|my_center|LOCUS_15500 8243 7413 gene locus_tag LOCUS_15510 gene phnE 8243 7413 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193500.1 protein_id gnl|my_center|LOCUS_15510 9314 8298 gene locus_tag LOCUS_15520 gene phnD 9314 8298 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992002.1 protein_id gnl|my_center|LOCUS_15520 10127 9339 gene locus_tag LOCUS_15530 gene phnC 10127 9339 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193391.1 protein_id gnl|my_center|LOCUS_15530 10703 10260 gene locus_tag LOCUS_15540 gene yjdN 10703 10260 CDS product VOC family metalloprotein YjdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131311.1 protein_id gnl|my_center|LOCUS_15540 11198 10863 gene locus_tag LOCUS_15550 11198 10863 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 protein_id gnl|my_center|LOCUS_15550 11600 13828 gene locus_tag LOCUS_15560 gene crfC 11600 13828 CDS product clamp-binding protein CrfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288590.1 protein_id gnl|my_center|LOCUS_15560 13825 14703 gene locus_tag LOCUS_15570 13825 14703 CDS product YjcZ-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169175.1 protein_id gnl|my_center|LOCUS_15570 14967 16469 gene locus_tag LOCUS_15580 gene proP 14967 16469 CDS product glycine betaine/L-proline transporter ProP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296882.1 protein_id gnl|my_center|LOCUS_15580 17746 16646 gene locus_tag LOCUS_15590 gene pmrB 17746 16646 CDS product two-component system sensor histidine kinase PmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052137.1 protein_id gnl|my_center|LOCUS_15590 18415 17747 gene locus_tag LOCUS_15600 gene basR 18415 17747 CDS product two-component system response regulator BasR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697915.1 protein_id gnl|my_center|LOCUS_15600 20025 18412 gene locus_tag LOCUS_15610 gene eptA 20025 18412 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298860.1 protein_id gnl|my_center|LOCUS_15610 21496 20159 gene locus_tag LOCUS_15620 gene adiC 21496 20159 CDS product arginine/agmatine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093154.1 protein_id gnl|my_center|LOCUS_15620 22394 21633 gene locus_tag LOCUS_15630 gene adiY 22394 21633 CDS product DNA-binding transcriptional activator AdiY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217059.1 protein_id gnl|my_center|LOCUS_15630 24989 22719 gene locus_tag LOCUS_15640 gene adiA 24989 22719 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978640.1 protein_id gnl|my_center|LOCUS_15640 26093 25185 gene locus_tag LOCUS_15650 gene melR 26093 25185 CDS product transcriptional regulator MelR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090758.1 protein_id gnl|my_center|LOCUS_15650 26376 27731 gene locus_tag LOCUS_15660 gene melA 26376 27731 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988031.1 protein_id gnl|my_center|LOCUS_15660 27846 29255 gene locus_tag LOCUS_15670 gene melB 27846 29255 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028114.1 protein_id gnl|my_center|LOCUS_15670 30023 29394 gene locus_tag LOCUS_15680 30023 29394 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198752.1 protein_id gnl|my_center|LOCUS_15680 31792 30146 gene locus_tag LOCUS_15690 gene fumB 31792 30146 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066681.1 protein_id gnl|my_center|LOCUS_15690 33210 31870 gene locus_tag LOCUS_15700 gene dcuB 33210 31870 CDS product anaerobic C4-dicarboxylate transporter DcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899522.1 protein_id gnl|my_center|LOCUS_15700 34500 33781 gene locus_tag LOCUS_15710 gene dcuR 34500 33781 CDS product two-component system response regulator DcuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611288.1 protein_id gnl|my_center|LOCUS_15710 36128 34497 gene locus_tag LOCUS_15720 36128 34497 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216477.1 protein_id gnl|my_center|LOCUS_15720 36309 36539 gene locus_tag LOCUS_15730 gene yjdI 36309 36539 CDS product 4Fe-4S mono-cluster protein YjdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371700.1 protein_id gnl|my_center|LOCUS_15730 36551 36823 gene locus_tag LOCUS_15740 36551 36823 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405647.1 protein_id gnl|my_center|LOCUS_15740 37050 37346 gene locus_tag LOCUS_15750 gene ghoS 37050 37346 CDS product type V toxin-antitoxin system endoribonuclease antitoxin GhoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398619.1 protein_id gnl|my_center|LOCUS_15750 37374 37547 gene locus_tag LOCUS_15760 gene ghoT 37374 37547 CDS product type V toxin-antitoxin system toxin GhoT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173343.1 protein_id gnl|my_center|LOCUS_15760 39183 37666 gene locus_tag LOCUS_15770 gene lysS 39183 37666 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295074.1 protein_id gnl|my_center|LOCUS_15770 40877 39420 gene locus_tag LOCUS_15780 gene dtpC 40877 39420 CDS product dipeptide/tripeptide permease DtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856829.1 protein_id gnl|my_center|LOCUS_15780 43083 40936 gene locus_tag LOCUS_15790 gene cadA 43083 40936 CDS product lysine decarboxylase CadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295383.1 protein_id gnl|my_center|LOCUS_15790 44497 43163 gene locus_tag LOCUS_15800 gene cadB 44497 43163 CDS product cadaverine/lysine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092909.1 protein_id gnl|my_center|LOCUS_15800 46400 44862 gene locus_tag LOCUS_15810 gene cadC 46400 44862 CDS product lysine decarboxylation/transport transcriptional activator CadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187182.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence17 1104 238 gene locus_tag LOCUS_15820 gene yghU 1104 238 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295515.1 protein_id gnl|my_center|LOCUS_15820 1309 3168 gene locus_tag LOCUS_15830 gene gss 1309 3168 CDS product bifunctional glutathionylspermidine amidase/synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297309.1 protein_id gnl|my_center|LOCUS_15830 3460 4959 gene locus_tag LOCUS_15840 gene pitB 3460 4959 CDS product inorganic phosphate transporter PitB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000933296.1 protein_id gnl|my_center|LOCUS_15840 5700 5008 gene locus_tag LOCUS_15850 5700 5008 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190781.1 protein_id gnl|my_center|LOCUS_15850 5997 6587 gene locus_tag LOCUS_15860 5997 6587 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076250.1 protein_id gnl|my_center|LOCUS_15860 6619 7377 gene locus_tag LOCUS_15870 6619 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339532.1 protein_id gnl|my_center|LOCUS_15870 7423 8772 gene locus_tag LOCUS_15880 7423 8772 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000896880.1 protein_id gnl|my_center|LOCUS_15880 8772 9596 gene locus_tag LOCUS_15890 8772 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984978.1 protein_id gnl|my_center|LOCUS_15890 9608 10168 gene locus_tag LOCUS_15900 9608 10168 CDS product YtfJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299422.1 protein_id gnl|my_center|LOCUS_15900 10199 11269 gene locus_tag LOCUS_15910 gene lptF 10199 11269 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779661.1 protein_id gnl|my_center|LOCUS_15910 11266 12345 gene locus_tag LOCUS_15920 gene lptG 11266 12345 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296409.1 protein_id gnl|my_center|LOCUS_15920 13553 12381 gene locus_tag LOCUS_15930 13553 12381 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524972.1 protein_id gnl|my_center|LOCUS_15930 13801 13553 gene locus_tag LOCUS_15940 13801 13553 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_15940 14747 13833 gene locus_tag LOCUS_15950 14747 13833 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077177.1 protein_id gnl|my_center|LOCUS_15950 16432 14744 gene locus_tag LOCUS_15960 16432 14744 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001390306.1 protein_id gnl|my_center|LOCUS_15960 16836 17978 gene locus_tag LOCUS_15970 gene yghO 16836 17978 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388786.1 protein_id gnl|my_center|LOCUS_15970 18749 17985 gene locus_tag LOCUS_15980 gene glcC 18749 17985 CDS product transcriptional regulator GlcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297764.1 protein_id gnl|my_center|LOCUS_15980 19000 20499 gene locus_tag LOCUS_15990 gene glcD 19000 20499 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026117.1 protein_id gnl|my_center|LOCUS_15990 20499 21551 gene locus_tag LOCUS_16000 gene glcE 20499 21551 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943059.1 protein_id gnl|my_center|LOCUS_16000 21562 22785 gene locus_tag LOCUS_16010 gene glcF 21562 22785 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194680.1 protein_id gnl|my_center|LOCUS_16010 22790 23194 gene locus_tag LOCUS_16020 22790 23194 CDS product GlcG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853256.1 protein_id gnl|my_center|LOCUS_16020 23216 25387 gene locus_tag LOCUS_16030 gene glcB 23216 25387 CDS product malate synthase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084080.1 protein_id gnl|my_center|LOCUS_16030 25743 27425 gene locus_tag LOCUS_16040 gene glcA 25743 27425 CDS product glycolate permease GlcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259303.1 protein_id gnl|my_center|LOCUS_16040 27760 27551 gene locus_tag LOCUS_16050 27760 27551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 28043 32479 gene locus_tag LOCUS_16060 gene sslE 28043 32479 CDS product lipoprotein metalloprotease SslE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034469.1 protein_id gnl|my_center|LOCUS_16060 32619 33428 gene locus_tag LOCUS_16070 gene pppA 32619 33428 CDS product prepilin peptidase PppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001365924.1 protein_id gnl|my_center|LOCUS_16070 33494 33904 gene locus_tag LOCUS_16080 gene gspS2 33494 33904 CDS product type II secretion system pilot lipoprotein GspS-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324279.1 protein_id gnl|my_center|LOCUS_16080 34063 34881 gene locus_tag LOCUS_16090 gene gspC 34063 34881 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135063.1 protein_id gnl|my_center|LOCUS_16090 34911 36971 gene locus_tag LOCUS_16100 gene gspD 34911 36971 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498829.1 protein_id gnl|my_center|LOCUS_16100 36971 38464 gene locus_tag LOCUS_16110 gene gspE 36971 38464 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249348.1 protein_id gnl|my_center|LOCUS_16110 38464 39687 gene locus_tag LOCUS_16120 gene gspF 38464 39687 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173453.1 protein_id gnl|my_center|LOCUS_16120 39704 40159 gene locus_tag LOCUS_16130 gene gspG 39704 40159 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087296.1 protein_id gnl|my_center|LOCUS_16130 40163 40726 gene locus_tag LOCUS_16140 gene gspH 40163 40726 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115140.1 protein_id gnl|my_center|LOCUS_16140 40723 41094 gene locus_tag LOCUS_16150 gene gspI 40723 41094 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820120.1 protein_id gnl|my_center|LOCUS_16150 41091 41690 gene locus_tag LOCUS_16160 gene gspJ 41091 41690 CDS product type II secretion system minor pseudopilin GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255040.1 protein_id gnl|my_center|LOCUS_16160 41693 42670 gene locus_tag LOCUS_16170 gene gspK 41693 42670 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633238.1 protein_id gnl|my_center|LOCUS_16170 42667 43845 gene locus_tag LOCUS_16180 gene gspL 42667 43845 CDS product type II secretion system protein GspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094962.1 protein_id gnl|my_center|LOCUS_16180 43847 44383 gene locus_tag LOCUS_16190 gene yghD 43847 44383 CDS product GspM family type II secretion system protein YghD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942785.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence18 220 681 gene locus_tag LOCUS_16200 220 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 683 1006 gene locus_tag LOCUS_16210 683 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1290 976 gene locus_tag LOCUS_16220 1290 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16220 1768 1496 gene locus_tag LOCUS_16230 1768 1496 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303397.1 protein_id gnl|my_center|LOCUS_16230 2521 1913 gene locus_tag LOCUS_16240 2521 1913 CDS product YiiX family permuted papain-like enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702307.1 protein_id gnl|my_center|LOCUS_16240 2898 2581 gene locus_tag LOCUS_16250 gene metJ 2898 2581 CDS product met regulon transcriptional regulator MetJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852812.1 protein_id gnl|my_center|LOCUS_16250 3175 4335 gene locus_tag LOCUS_16260 gene metB 3175 4335 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295694.1 protein_id gnl|my_center|LOCUS_16260 4338 6770 gene locus_tag LOCUS_16270 gene metL 4338 6770 CDS product bifunctional aspartate kinase/homoserine dehydrogenase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110772.1 protein_id gnl|my_center|LOCUS_16270 7119 8009 gene locus_tag LOCUS_16280 gene metF 7119 8009 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007523.1 protein_id gnl|my_center|LOCUS_16280 8338 10518 gene locus_tag LOCUS_16290 gene katG 8338 10518 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297636.1 protein_id gnl|my_center|LOCUS_16290 10612 11517 gene locus_tag LOCUS_16300 gene yijE 10612 11517 CDS product cystine transporter YijE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297632.1 protein_id gnl|my_center|LOCUS_16300 12161 11544 gene locus_tag LOCUS_16310 12161 11544 CDS product DUF1287 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647882.1 protein_id gnl|my_center|LOCUS_16310 13539 12436 gene locus_tag LOCUS_16320 gene gldA 13539 12436 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000374004.1 protein_id gnl|my_center|LOCUS_16320 14212 13550 gene locus_tag LOCUS_16330 gene fsa 14212 13550 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424845.1 protein_id gnl|my_center|LOCUS_16330 16725 14224 gene locus_tag LOCUS_16340 gene ptsP 16725 14224 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174077.1 protein_id gnl|my_center|LOCUS_16340 17034 18113 gene locus_tag LOCUS_16350 17034 18113 CDS product PTS fructose transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004446.1 protein_id gnl|my_center|LOCUS_16350 18128 18448 gene locus_tag LOCUS_16360 18128 18448 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_16360 18499 20796 gene locus_tag LOCUS_16370 18499 20796 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184828.1 protein_id gnl|my_center|LOCUS_16370 20762 21640 gene locus_tag LOCUS_16380 20762 21640 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204105.1 protein_id gnl|my_center|LOCUS_16380 21642 21983 gene locus_tag LOCUS_16390 21642 21983 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323849.1 protein_id gnl|my_center|LOCUS_16390 22821 21970 gene locus_tag LOCUS_16400 22821 21970 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274623.1 protein_id gnl|my_center|LOCUS_16400 24703 22970 gene locus_tag LOCUS_16410 24703 22970 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000556306.1 protein_id gnl|my_center|LOCUS_16410 27536 24885 gene locus_tag LOCUS_16420 gene ppc 27536 24885 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005579.1 protein_id gnl|my_center|LOCUS_16420 29039 27888 gene locus_tag LOCUS_16430 gene argE 29039 27888 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309894.1 protein_id gnl|my_center|LOCUS_16430 29193 30197 gene locus_tag LOCUS_16440 gene argC 29193 30197 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935370.1 protein_id gnl|my_center|LOCUS_16440 30208 30981 gene locus_tag LOCUS_16450 gene argB 30208 30981 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295507.1 protein_id gnl|my_center|LOCUS_16450 31042 32415 gene locus_tag LOCUS_16460 gene argH 31042 32415 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230081.1 protein_id gnl|my_center|LOCUS_16460 32913 34127 gene locus_tag LOCUS_16470 32913 34127 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690934.1 protein_id gnl|my_center|LOCUS_16470 34194 35477 gene locus_tag LOCUS_16480 34194 35477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382183.1 protein_id gnl|my_center|LOCUS_16480 35728 36645 gene locus_tag LOCUS_16490 gene oxyR 35728 36645 CDS product DNA-binding transcriptional regulator OxyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025939.1 protein_id gnl|my_center|LOCUS_16490 38028 36628 gene locus_tag LOCUS_16500 gene sthA 38028 36628 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120810.1 protein_id gnl|my_center|LOCUS_16500 38305 39009 gene locus_tag LOCUS_16510 gene fabR 38305 39009 CDS product HTH-type transcriptional repressor FabR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470429.1 protein_id gnl|my_center|LOCUS_16510 39009 39368 gene locus_tag LOCUS_16520 39009 39368 CDS product YijD family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806411.1 protein_id gnl|my_center|LOCUS_16520 40508 39408 gene locus_tag LOCUS_16530 gene trmA 40508 39408 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187022.1 protein_id gnl|my_center|LOCUS_16530 40877 42721 gene locus_tag LOCUS_16540 gene btuB 40877 42721 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591359.1 protein_id gnl|my_center|LOCUS_16540 42666 43523 gene locus_tag LOCUS_16550 gene murI 42666 43523 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201827.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence19 1104 334 gene locus_tag LOCUS_16560 gene yafV 1104 334 CDS product 2-oxoglutaramate amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118029.1 protein_id gnl|my_center|LOCUS_16560 1285 1731 gene locus_tag LOCUS_16570 gene ivy 1285 1731 CDS product Ivy family C-type lysozyme inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532698.1 protein_id gnl|my_center|LOCUS_16570 4218 1774 gene locus_tag LOCUS_16580 gene fadE 4218 1774 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973081.1 protein_id gnl|my_center|LOCUS_16580 4458 5036 gene locus_tag LOCUS_16590 gene lpcA 4458 5036 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284050.1 protein_id gnl|my_center|LOCUS_16590 5242 6009 gene locus_tag LOCUS_16600 5242 6009 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333380.1 protein_id gnl|my_center|LOCUS_16600 6720 5980 gene locus_tag LOCUS_16610 gene dpaA 6720 5980 CDS product peptidoglycan meso-diaminopimelic acid protein amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225679.1 protein_id gnl|my_center|LOCUS_16610 7154 6876 gene locus_tag LOCUS_16620 gene yafQ 7154 6876 CDS product type II toxin-antitoxin system mRNA interferase toxin YafQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615980.1 protein_id gnl|my_center|LOCUS_16620 7417 7157 gene locus_tag LOCUS_16630 gene dinJ 7417 7157 CDS product type II toxin-antitoxin system antitoxin DinJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729704.1 protein_id gnl|my_center|LOCUS_16630 7633 8376 gene locus_tag LOCUS_16640 7633 8376 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001389087.1 protein_id gnl|my_center|LOCUS_16640 8789 8433 gene locus_tag LOCUS_16650 8789 8433 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030484.1 protein_id gnl|my_center|LOCUS_16650 9081 8782 gene locus_tag LOCUS_16660 9081 8782 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598758.1 protein_id gnl|my_center|LOCUS_16660 11258 9165 gene locus_tag LOCUS_16670 gene flhA 11258 9165 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140817.1 protein_id gnl|my_center|LOCUS_16670 12381 11242 gene locus_tag LOCUS_16680 12381 11242 CDS product flagellar type III secretion system protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785648.1 protein_id gnl|my_center|LOCUS_16680 13153 12371 gene locus_tag LOCUS_16690 gene fliR 13153 12371 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260504.1 protein_id gnl|my_center|LOCUS_16690 13430 13155 gene locus_tag LOCUS_16700 13430 13155 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 protein_id gnl|my_center|LOCUS_16700 14182 13430 gene locus_tag LOCUS_16710 gene fliP 14182 13430 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830282.1 protein_id gnl|my_center|LOCUS_16710 14550 14179 gene locus_tag LOCUS_16720 14550 14179 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043127.1 protein_id gnl|my_center|LOCUS_16720 15394 14543 gene locus_tag LOCUS_16730 15394 14543 CDS product FliM/FliN family flagellar motor switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922504.1 protein_id gnl|my_center|LOCUS_16730 15781 16767 gene locus_tag LOCUS_16740 15781 16767 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292195.1 protein_id gnl|my_center|LOCUS_16740 16782 17123 gene locus_tag LOCUS_16750 16782 17123 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029087.1 protein_id gnl|my_center|LOCUS_16750 17128 18774 gene locus_tag LOCUS_16760 gene fliF 17128 18774 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993674.1 protein_id gnl|my_center|LOCUS_16760 18752 19762 gene locus_tag LOCUS_16770 18752 19762 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293168.1 protein_id gnl|my_center|LOCUS_16770 19765 20475 gene locus_tag LOCUS_16780 gene fliH 19765 20475 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000151516.1 protein_id gnl|my_center|LOCUS_16780 20468 21805 gene locus_tag LOCUS_16790 gene fliI 20468 21805 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279402.1 protein_id gnl|my_center|LOCUS_16790 21808 22242 gene locus_tag LOCUS_16800 gene fliJ 21808 22242 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248917.1 protein_id gnl|my_center|LOCUS_16800 22245 22640 gene locus_tag LOCUS_16810 22245 22640 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859527.1 protein_id gnl|my_center|LOCUS_16810 25202 22758 gene locus_tag LOCUS_16820 25202 22758 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181816997.1 protein_id gnl|my_center|LOCUS_16820 26310 25381 gene locus_tag LOCUS_16830 26310 25381 CDS product lysine-N-methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191775953.1 protein_id gnl|my_center|LOCUS_16830 26865 26437 gene locus_tag LOCUS_16840 26865 26437 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027804.1 protein_id gnl|my_center|LOCUS_16840 27156 26878 gene locus_tag LOCUS_16850 gene flgM 27156 26878 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705404.1 protein_id gnl|my_center|LOCUS_16850 27974 27237 gene locus_tag LOCUS_16860 gene flgA 27974 27237 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309268.1 protein_id gnl|my_center|LOCUS_16860 28056 28391 gene locus_tag LOCUS_16870 28056 28391 CDS product flagellar biosynthesis protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000512950.1 protein_id gnl|my_center|LOCUS_16870 28394 28825 gene locus_tag LOCUS_16880 gene flgC 28394 28825 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010941.1 protein_id gnl|my_center|LOCUS_16880 28825 29538 gene locus_tag LOCUS_16890 28825 29538 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093678.1 protein_id gnl|my_center|LOCUS_16890 29623 30825 gene locus_tag LOCUS_16900 gene flgE 29623 30825 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119538.1 protein_id gnl|my_center|LOCUS_16900 30825 31562 gene locus_tag LOCUS_16910 30825 31562 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375450.1 protein_id gnl|my_center|LOCUS_16910 31741 32526 gene locus_tag LOCUS_16920 gene flgG 31741 32526 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000990540.1 protein_id gnl|my_center|LOCUS_16920 32798 33463 gene locus_tag LOCUS_16930 gene flgH 32798 33463 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800864.1 protein_id gnl|my_center|LOCUS_16930 33478 34578 gene locus_tag LOCUS_16940 33478 34578 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059224973.1 protein_id gnl|my_center|LOCUS_16940 34578 34877 gene locus_tag LOCUS_16950 34578 34877 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867281.1 protein_id gnl|my_center|LOCUS_16950 35066 36442 gene locus_tag LOCUS_16960 gene flgK 35066 36442 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367245.1 protein_id gnl|my_center|LOCUS_16960 36457 37386 gene locus_tag LOCUS_16970 gene flgL 36457 37386 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266799.1 protein_id gnl|my_center|LOCUS_16970 37403 38380 gene locus_tag LOCUS_16980 37403 38380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001195938.1 protein_id gnl|my_center|LOCUS_16980 39277 38435 gene locus_tag LOCUS_16990 39277 38435 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181672479.1 protein_id gnl|my_center|LOCUS_16990 39763 40677 gene locus_tag LOCUS_17000 gene lafA 39763 40677 CDS product lateral flagellin LafA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949083.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence20 2135 66 gene locus_tag LOCUS_17010 gene glyS 2135 66 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291774.1 protein_id gnl|my_center|LOCUS_17010 3056 2145 gene locus_tag LOCUS_17020 gene glyQ 3056 2145 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168544.1 protein_id gnl|my_center|LOCUS_17020 3450 3151 gene locus_tag LOCUS_17030 3450 3151 CDS product YsaB family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000980111.1 protein_id gnl|my_center|LOCUS_17030 3625 4620 gene locus_tag LOCUS_17040 gene wecH 3625 4620 CDS product O-acetyltransferase WecH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182653.1 protein_id gnl|my_center|LOCUS_17040 5099 4662 gene locus_tag LOCUS_17050 gene yiaA 5099 4662 CDS product inner membrane protein YiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296808.1 protein_id gnl|my_center|LOCUS_17050 5486 5145 gene locus_tag LOCUS_17060 gene yiaB 5486 5145 CDS product inner membrane protein YiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858193.1 protein_id gnl|my_center|LOCUS_17060 7109 5655 gene locus_tag LOCUS_17070 gene xylB 7109 5655 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275386.1 protein_id gnl|my_center|LOCUS_17070 8503 7181 gene locus_tag LOCUS_17080 gene xylA 8503 7181 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149592.1 protein_id gnl|my_center|LOCUS_17080 8869 9861 gene locus_tag LOCUS_17090 gene xylF 8869 9861 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296518.1 protein_id gnl|my_center|LOCUS_17090 9939 11480 gene locus_tag LOCUS_17100 gene xylG 9939 11480 CDS product D-xylose ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146479.1 protein_id gnl|my_center|LOCUS_17100 11458 12639 gene locus_tag LOCUS_17110 gene xylH 11458 12639 CDS product xylose ABC transporter permease XylH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045978.1 protein_id gnl|my_center|LOCUS_17110 12717 13895 gene locus_tag LOCUS_17120 gene xylR 12717 13895 CDS product DNA-binding transcriptional regulator XylR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494484.1 protein_id gnl|my_center|LOCUS_17120 14575 14003 gene locus_tag LOCUS_17130 14575 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 15147 17177 gene locus_tag LOCUS_17140 gene malS 15147 17177 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761268.1 protein_id gnl|my_center|LOCUS_17140 17355 18608 gene locus_tag LOCUS_17150 gene avtA 17355 18608 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144361.1 protein_id gnl|my_center|LOCUS_17150 19233 18760 gene locus_tag LOCUS_17160 19233 18760 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296790.1 protein_id gnl|my_center|LOCUS_17160 20183 19335 gene locus_tag LOCUS_17170 gene yiaJ 20183 19335 CDS product IclR family transcriptional regulator YiaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000514230.1 protein_id gnl|my_center|LOCUS_17170 20384 21382 gene locus_tag LOCUS_17180 gene yiaK 20384 21382 CDS product 3-dehydro-L-gulonate 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869039.1 protein_id gnl|my_center|LOCUS_17180 21394 21861 gene locus_tag LOCUS_17190 21394 21861 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576071.1 protein_id gnl|my_center|LOCUS_17190 21979 22452 gene locus_tag LOCUS_17200 gene yiaM 21979 22452 CDS product 2,3-diketo-L-gulonate TRAP transporter small permease YiaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721664.1 protein_id gnl|my_center|LOCUS_17200 22455 23732 gene locus_tag LOCUS_17210 gene yiaN 22455 23732 CDS product 2,3-diketo-L-gulonate transporter large permease YiaN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279599.1 protein_id gnl|my_center|LOCUS_17210 23745 24731 gene locus_tag LOCUS_17220 gene yiaO 23745 24731 CDS product 2,3-diketo-L-gulonate transporter substrate-binding protein YiaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776892.1 protein_id gnl|my_center|LOCUS_17220 24735 26231 gene locus_tag LOCUS_17230 gene lyxK 24735 26231 CDS product L-xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196081.1 protein_id gnl|my_center|LOCUS_17230 26228 26890 gene locus_tag LOCUS_17240 gene ulaD 26228 26890 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089497.1 protein_id gnl|my_center|LOCUS_17240 26883 27743 gene locus_tag LOCUS_17250 26883 27743 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296811.1 protein_id gnl|my_center|LOCUS_17250 27737 28432 gene locus_tag LOCUS_17260 gene araD 27737 28432 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893142.1 protein_id gnl|my_center|LOCUS_17260 29519 28779 gene locus_tag LOCUS_17270 29519 28779 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906806.1 protein_id gnl|my_center|LOCUS_17270 29643 30617 gene locus_tag LOCUS_17280 29643 30617 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164036.1 protein_id gnl|my_center|LOCUS_17280 31483 30614 gene locus_tag LOCUS_17290 31483 30614 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17290 31749 31432 gene locus_tag LOCUS_17300 31749 31432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 32078 31755 gene locus_tag LOCUS_17310 32078 31755 CDS product DUF3302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478195.1 protein_id gnl|my_center|LOCUS_17310 32192 32404 gene locus_tag LOCUS_17320 32192 32404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332751.1 protein_id gnl|my_center|LOCUS_17320 34161 32623 gene locus_tag LOCUS_17330 gene aldB 34161 32623 CDS product aldehyde dehydrogenase AldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183978.1 protein_id gnl|my_center|LOCUS_17330 35477 34326 gene locus_tag LOCUS_17340 gene yiaY 35477 34326 CDS product L-threonine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168712.1 protein_id gnl|my_center|LOCUS_17340 37511 35667 gene locus_tag LOCUS_17350 gene selB 37511 35667 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582466.1 protein_id gnl|my_center|LOCUS_17350 38899 37508 gene locus_tag LOCUS_17360 gene selA 38899 37508 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206275.1 protein_id gnl|my_center|LOCUS_17360 39605 38997 gene locus_tag LOCUS_17370 39605 38997 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779792.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence21 506 117 gene locus_tag LOCUS_17380 506 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1306 836 gene locus_tag LOCUS_17390 gene ipbA 1306 836 CDS product tyrosine-type DNA invertase IpbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295805.1 protein_id gnl|my_center|LOCUS_17390 2204 2455 gene locus_tag LOCUS_17400 2204 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 4144 2474 gene locus_tag LOCUS_17410 gene betA 4144 2474 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159102.1 protein_id gnl|my_center|LOCUS_17410 5630 4158 gene locus_tag LOCUS_17420 gene betB 5630 4158 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089077.1 protein_id gnl|my_center|LOCUS_17420 6231 5644 gene locus_tag LOCUS_17430 gene betI 6231 5644 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295527.1 protein_id gnl|my_center|LOCUS_17430 6405 8393 gene locus_tag LOCUS_17440 gene betT 6405 8393 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131044.1 protein_id gnl|my_center|LOCUS_17440 8948 8763 gene locus_tag LOCUS_17450 8948 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001328114.1 protein_id gnl|my_center|LOCUS_17450 9268 10356 gene locus_tag LOCUS_17460 gene pdeL 9268 10356 CDS product DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301264.1 protein_id gnl|my_center|LOCUS_17460 11330 10398 gene locus_tag LOCUS_17470 11330 10398 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084388.1 protein_id gnl|my_center|LOCUS_17470 11919 11422 gene locus_tag LOCUS_17480 11919 11422 CDS product DUF1097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013892.1 protein_id gnl|my_center|LOCUS_17480 12177 12782 gene locus_tag LOCUS_17490 12177 12782 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023640.1 protein_id gnl|my_center|LOCUS_17490 12822 13685 gene locus_tag LOCUS_17500 12822 13685 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296901.1 protein_id gnl|my_center|LOCUS_17500 13675 15222 gene locus_tag LOCUS_17510 gene fdrA 13675 15222 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111846.1 protein_id gnl|my_center|LOCUS_17510 15222 16640 gene locus_tag LOCUS_17520 15222 16640 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083455.1 protein_id gnl|my_center|LOCUS_17520 16783 17733 gene locus_tag LOCUS_17530 16783 17733 CDS product carbamate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661672.1 protein_id gnl|my_center|LOCUS_17530 17743 19125 gene locus_tag LOCUS_17540 17743 19125 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662407.1 protein_id gnl|my_center|LOCUS_17540 19394 19834 gene locus_tag LOCUS_17550 19394 19834 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001325907.1 protein_id gnl|my_center|LOCUS_17550 20085 21071 gene locus_tag LOCUS_17560 20085 21071 CDS product autoinducer 2 ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981355.1 protein_id gnl|my_center|LOCUS_17560 21120 22604 gene locus_tag LOCUS_17570 21120 22604 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447335.1 protein_id gnl|my_center|LOCUS_17570 22597 23568 gene locus_tag LOCUS_17580 22597 23568 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818900.1 protein_id gnl|my_center|LOCUS_17580 23565 24521 gene locus_tag LOCUS_17590 23565 24521 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750340.1 protein_id gnl|my_center|LOCUS_17590 24608 25657 gene locus_tag LOCUS_17600 gene yahK 24608 25657 CDS product NADPH-dependent aldehyde reductase YahK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692600.1 protein_id gnl|my_center|LOCUS_17600 25900 26715 gene locus_tag LOCUS_17610 gene yahL 25900 26715 CDS product protein YahL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309286.1 protein_id gnl|my_center|LOCUS_17610 27058 27138 gene locus_tag LOCUS_t00240 27058 27138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 28022 27390 gene locus_tag LOCUS_17620 28022 27390 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976975.1 protein_id gnl|my_center|LOCUS_17620 28208 28483 gene locus_tag LOCUS_17630 gene yahO 28208 28483 CDS product DUF1471 family periplasmic protein YahO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691953.1 protein_id gnl|my_center|LOCUS_17630 30167 28581 gene locus_tag LOCUS_17640 gene prpR 30167 28581 CDS product propionate catabolism operon regulatory protein PrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941076.1 protein_id gnl|my_center|LOCUS_17640 30406 31296 gene locus_tag LOCUS_17650 gene prpB 30406 31296 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052206.1 protein_id gnl|my_center|LOCUS_17650 31341 32510 gene locus_tag LOCUS_17660 gene prpC 31341 32510 CDS product 2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285908.1 protein_id gnl|my_center|LOCUS_17660 32544 33995 gene locus_tag LOCUS_17670 gene prpD 32544 33995 CDS product 2-methylcitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275861.1 protein_id gnl|my_center|LOCUS_17670 34035 35921 gene locus_tag LOCUS_17680 gene prpE 34035 35921 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010271.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence22 3469 1328 gene locus_tag LOCUS_17690 3469 1328 CDS product type VI secretion system tip protein VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103304.1 protein_id gnl|my_center|LOCUS_17690 4197 3679 gene locus_tag LOCUS_17700 4197 3679 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142958.1 protein_id gnl|my_center|LOCUS_17700 4894 5394 gene locus_tag LOCUS_17710 gene tssB 4894 5394 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037389.1 protein_id gnl|my_center|LOCUS_17710 5429 5653 gene locus_tag LOCUS_17720 5429 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123970.1 protein_id gnl|my_center|LOCUS_17720 5704 7179 gene locus_tag LOCUS_17730 gene tssC 5704 7179 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056978.1 protein_id gnl|my_center|LOCUS_17730 7186 7599 gene locus_tag LOCUS_17740 gene tssE 7186 7599 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611748.1 protein_id gnl|my_center|LOCUS_17740 7603 9453 gene locus_tag LOCUS_17750 gene tssF 7603 9453 CDS product type VI secretion system baseplate subunit TssF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393844.1 protein_id gnl|my_center|LOCUS_17750 9417 10361 gene locus_tag LOCUS_17760 gene tssG 9417 10361 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348793.1 protein_id gnl|my_center|LOCUS_17760 10524 11804 gene locus_tag LOCUS_17770 gene tagH 10524 11804 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113725.1 protein_id gnl|my_center|LOCUS_17770 11801 12325 gene locus_tag LOCUS_17780 gene tssJ 11801 12325 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080149.1 protein_id gnl|my_center|LOCUS_17780 12328 13659 gene locus_tag LOCUS_17790 gene tssK 12328 13659 CDS product type VI secretion system baseplate subunit TssK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246434.1 protein_id gnl|my_center|LOCUS_17790 13664 14425 gene locus_tag LOCUS_17800 gene icmH 13664 14425 CDS product type IVB secretion system protein IcmH/DotU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343303.1 protein_id gnl|my_center|LOCUS_17800 14434 17199 gene locus_tag LOCUS_17810 gene tssH 14434 17199 CDS product type VI secretion system ATPase TssH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614374.1 protein_id gnl|my_center|LOCUS_17810 17196 17939 gene locus_tag LOCUS_17820 gene vasI 17196 17939 CDS product type VI secretion system-associated protein VasI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088854.1 protein_id gnl|my_center|LOCUS_17820 17944 19356 gene locus_tag LOCUS_17830 gene tssA 17944 19356 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001240532.1 protein_id gnl|my_center|LOCUS_17830 19375 22899 gene locus_tag LOCUS_17840 gene tssM 19375 22899 CDS product type VI secretion system membrane subunit TssM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122985420.1 protein_id gnl|my_center|LOCUS_17840 22910 24262 gene locus_tag LOCUS_17850 22910 24262 CDS product type VI secretion system ImpA and VasL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087741.1 protein_id gnl|my_center|LOCUS_17850 24286 24768 gene locus_tag LOCUS_17860 24286 24768 CDS product Hcp family type VI secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284200.1 protein_id gnl|my_center|LOCUS_17860 24812 25726 gene locus_tag LOCUS_17870 24812 25726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908057.1 protein_id gnl|my_center|LOCUS_17870 25736 26215 gene locus_tag LOCUS_17880 gene ykfM 25736 26215 CDS product protein YkfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001236649.1 protein_id gnl|my_center|LOCUS_17880 27137 26352 gene locus_tag LOCUS_17890 27137 26352 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086142.1 protein_id gnl|my_center|LOCUS_17890 27544 27468 gene locus_tag LOCUS_t00250 27544 27468 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 28409 27678 gene locus_tag LOCUS_17900 gene dnaQ 28409 27678 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297205.1 protein_id gnl|my_center|LOCUS_17900 28474 28941 gene locus_tag LOCUS_17910 gene rnhA 28474 28941 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917883.1 protein_id gnl|my_center|LOCUS_17910 29660 28938 gene locus_tag LOCUS_17920 29660 28938 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307587.1 protein_id gnl|my_center|LOCUS_17920 29694 30449 gene locus_tag LOCUS_17930 gene gloB 29694 30449 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052751.1 protein_id gnl|my_center|LOCUS_17930 30659 31879 gene locus_tag LOCUS_17940 gene mltD 30659 31879 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644685.1 protein_id gnl|my_center|LOCUS_17940 32697 31927 gene locus_tag LOCUS_17950 32697 31927 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211710.1 protein_id gnl|my_center|LOCUS_17950 33575 32775 gene locus_tag LOCUS_17960 33575 32775 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230983.1 protein_id gnl|my_center|LOCUS_17960 33816 34730 gene locus_tag LOCUS_17970 gene yafC 33816 34730 CDS product DNA-binding transcriptional regulator YafC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648572.1 protein_id gnl|my_center|LOCUS_17970 35530 34727 gene locus_tag LOCUS_17980 gene dkgB 35530 34727 CDS product 2,5-didehydrogluconate reductase DkgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997010.1 protein_id gnl|my_center|LOCUS_17980 35769 35693 gene locus_tag LOCUS_t00260 35769 35693 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 2536 422 gene locus_tag LOCUS_17990 gene fusA 2536 422 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124700.1 protein_id gnl|my_center|LOCUS_17990 3103 2633 gene locus_tag LOCUS_18000 gene rpsG 3103 2633 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138043.1 protein_id gnl|my_center|LOCUS_18000 3574 3200 gene locus_tag LOCUS_18010 gene rpsL 3574 3200 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246815.1 protein_id gnl|my_center|LOCUS_18010 3987 3700 gene locus_tag LOCUS_18020 gene tusB 3987 3700 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903377.1 protein_id gnl|my_center|LOCUS_18020 4354 3995 gene locus_tag LOCUS_18030 gene tusC 4354 3995 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000820720.1 protein_id gnl|my_center|LOCUS_18030 4740 4354 gene locus_tag LOCUS_18040 gene tusD 4740 4354 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209689.1 protein_id gnl|my_center|LOCUS_18040 5462 4740 gene locus_tag LOCUS_18050 5462 4740 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091466.1 protein_id gnl|my_center|LOCUS_18050 6441 5629 gene locus_tag LOCUS_18060 gene fkpA 6441 5629 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838264.1 protein_id gnl|my_center|LOCUS_18060 6662 6880 gene locus_tag LOCUS_18070 6662 6880 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153615.1 protein_id gnl|my_center|LOCUS_18070 7519 6929 gene locus_tag LOCUS_18080 gene slyD 7519 6929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861334.1 protein_id gnl|my_center|LOCUS_18080 7814 7614 gene locus_tag LOCUS_18090 7814 7614 CDS product YheV family putative zinc ribbon protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007730.1 protein_id gnl|my_center|LOCUS_18090 9629 7824 gene locus_tag LOCUS_18100 gene kefB 9629 7824 CDS product glutathione-regulated potassium-efflux system protein KefB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399122.1 protein_id gnl|my_center|LOCUS_18100 10180 9629 gene locus_tag LOCUS_18110 gene kefG 10180 9629 CDS product glutathione-regulated potassium-efflux system ancillary protein KefG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000987657.1 protein_id gnl|my_center|LOCUS_18110 10311 12224 gene locus_tag LOCUS_18120 10311 12224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000634798.1 protein_id gnl|my_center|LOCUS_18120 12224 13246 gene locus_tag LOCUS_18130 12224 13246 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057405.1 protein_id gnl|my_center|LOCUS_18130 13240 13458 gene locus_tag LOCUS_18140 13240 13458 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907085.1 protein_id gnl|my_center|LOCUS_18140 13512 14381 gene locus_tag LOCUS_18150 13512 14381 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274680.1 protein_id gnl|my_center|LOCUS_18150 14840 14436 gene locus_tag LOCUS_18160 14840 14436 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148908.1 protein_id gnl|my_center|LOCUS_18160 15142 15774 gene locus_tag LOCUS_18170 gene crp 15142 15774 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242755.1 protein_id gnl|my_center|LOCUS_18170 15912 17915 gene locus_tag LOCUS_18180 15912 17915 CDS product YccS/YhfK family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484349.1 protein_id gnl|my_center|LOCUS_18180 19202 17982 gene locus_tag LOCUS_18190 gene argD 19202 17982 CDS product bifunctional acetylornithine/succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963784.1 protein_id gnl|my_center|LOCUS_18190 19851 19288 gene locus_tag LOCUS_18200 gene pabA 19851 19288 CDS product aminodeoxychorismate synthase component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601847.1 protein_id gnl|my_center|LOCUS_18200 20485 19883 gene locus_tag LOCUS_18210 20485 19883 CDS product putative adenosine monophosphate-protein transferase Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280623.1 protein_id gnl|my_center|LOCUS_18210 20642 20475 gene locus_tag LOCUS_18220 20642 20475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 21319 20747 gene locus_tag LOCUS_18230 gene ppiA 21319 20747 CDS product peptidylprolyl isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477225.1 protein_id gnl|my_center|LOCUS_18230 21590 22771 gene locus_tag LOCUS_18240 gene tsgA 21590 22771 CDS product MFS transporter TsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185247.1 protein_id gnl|my_center|LOCUS_18240 23033 25576 gene locus_tag LOCUS_18250 gene nirB 23033 25576 CDS product NADPH-nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049213.1 protein_id gnl|my_center|LOCUS_18250 25573 25899 gene locus_tag LOCUS_18260 gene nirD 25573 25899 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084764.1 protein_id gnl|my_center|LOCUS_18260 26026 26832 gene locus_tag LOCUS_18270 gene nirC 26026 26832 CDS product nitrite transporter NirC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493556.1 protein_id gnl|my_center|LOCUS_18270 26851 28224 gene locus_tag LOCUS_18280 gene cysG 26851 28224 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000349855.1 protein_id gnl|my_center|LOCUS_18280 28471 28638 gene locus_tag LOCUS_18290 28471 28638 CDS product YhfL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031834.1 protein_id gnl|my_center|LOCUS_18290 28933 30270 gene locus_tag LOCUS_18300 gene frlA 28933 30270 CDS product fructoselysine/psicoselysine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535505.1 protein_id gnl|my_center|LOCUS_18300 30291 31313 gene locus_tag LOCUS_18310 gene frlB 30291 31313 CDS product fructoselysine 6-phosphate deglycase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295163.1 protein_id gnl|my_center|LOCUS_18310 31363 32193 gene locus_tag LOCUS_18320 gene frlC 31363 32193 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847834.1 protein_id gnl|my_center|LOCUS_18320 32190 32975 gene locus_tag LOCUS_18330 gene frlD 32190 32975 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853346.1 protein_id gnl|my_center|LOCUS_18330 33075 33806 gene locus_tag LOCUS_18340 gene frlR 33075 33806 CDS product DNA-binding transcriptional regulator FrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276847.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence24 2004 325 gene locus_tag LOCUS_18350 gene bcsG 2004 325 CDS product cellulose biosynthesis protein BcsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191596.1 protein_id gnl|my_center|LOCUS_18350 2192 2001 gene locus_tag LOCUS_18360 gene bcsF 2192 2001 CDS product cellulose biosynthesis protein BcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988308.1 protein_id gnl|my_center|LOCUS_18360 3748 2189 gene locus_tag LOCUS_18370 gene bcsE 3748 2189 CDS product cellulose biosynthesis c-di-GMP-binding protein BcsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001204931.1 protein_id gnl|my_center|LOCUS_18370 4033 4221 gene locus_tag LOCUS_18380 gene bcsR 4033 4221 CDS product cellulose biosynthesis protein BcsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063318.1 protein_id gnl|my_center|LOCUS_18380 4233 4985 gene locus_tag LOCUS_18390 gene bcsQ 4233 4985 CDS product cellulose biosynthesis protein BcsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279528.1 protein_id gnl|my_center|LOCUS_18390 4982 7600 gene locus_tag LOCUS_18400 gene bcsA 4982 7600 CDS product UDP-forming cellulose synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025914.1 protein_id gnl|my_center|LOCUS_18400 7611 9950 gene locus_tag LOCUS_18410 gene bcsB 7611 9950 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307454.1 protein_id gnl|my_center|LOCUS_18410 9957 11063 gene locus_tag LOCUS_18420 gene bcsZ 9957 11063 CDS product cellulose synthase complex periplasmic endoglucanase BcsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307453.1 protein_id gnl|my_center|LOCUS_18420 11045 14518 gene locus_tag LOCUS_18430 gene bcsC 11045 14518 CDS product cellulose synthase complex outer membrane protein BcsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225124.1 protein_id gnl|my_center|LOCUS_18430 14639 16588 gene locus_tag LOCUS_18440 gene hmsP 14639 16588 CDS product biofilm formation regulator HmsP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266306.1 protein_id gnl|my_center|LOCUS_18440 16771 18057 gene locus_tag LOCUS_18450 gene dctA 16771 18057 CDS product C4-dicarboxylate transporter DctC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858214.1 protein_id gnl|my_center|LOCUS_18450 18278 19774 gene locus_tag LOCUS_18460 18278 19774 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001163137.1 protein_id gnl|my_center|LOCUS_18460 20799 19870 gene locus_tag LOCUS_18470 gene kdgK 20799 19870 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306595.1 protein_id gnl|my_center|LOCUS_18470 21163 21798 gene locus_tag LOCUS_18480 gene pdeH 21163 21798 CDS product cyclic-guanylate-specific phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295219.1 protein_id gnl|my_center|LOCUS_18480 21868 23928 gene locus_tag LOCUS_18490 21868 23928 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296794.1 protein_id gnl|my_center|LOCUS_18490 25484 24162 gene locus_tag LOCUS_18500 25484 24162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149006.1 protein_id gnl|my_center|LOCUS_18500 26908 25895 gene locus_tag LOCUS_18510 gene yhjD 26908 25895 CDS product inner membrane protein YhjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191257.1 protein_id gnl|my_center|LOCUS_18510 27838 26957 gene locus_tag LOCUS_18520 27838 26957 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357790.1 protein_id gnl|my_center|LOCUS_18520 28376 28978 gene locus_tag LOCUS_18530 28376 28978 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167676.1 protein_id gnl|my_center|LOCUS_18530 30678 29029 gene locus_tag LOCUS_18540 30678 29029 CDS product alpha,alpha-trehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934218.1 protein_id gnl|my_center|LOCUS_18540 31083 32480 gene locus_tag LOCUS_18550 gene ccp 31083 32480 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784821.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence25 922 164 gene locus_tag LOCUS_18560 922 164 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078338.1 protein_id gnl|my_center|LOCUS_18560 2033 930 gene locus_tag LOCUS_18570 2033 930 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299298.1 protein_id gnl|my_center|LOCUS_18570 3242 2043 gene locus_tag LOCUS_18580 3242 2043 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019643.1 protein_id gnl|my_center|LOCUS_18580 4317 3292 gene locus_tag LOCUS_18590 4317 3292 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738579.1 protein_id gnl|my_center|LOCUS_18590 4969 4748 gene locus_tag LOCUS_18600 4969 4748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000825639.1 protein_id gnl|my_center|LOCUS_18600 8326 5222 gene locus_tag LOCUS_18610 gene acrF 8326 5222 CDS product multidrug efflux RND transporter permease subunit AcrF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273212.1 protein_id gnl|my_center|LOCUS_18610 9495 8338 gene locus_tag LOCUS_18620 gene acrE 9495 8338 CDS product multidrug efflux RND transporter periplasmic adaptor subunit AcrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160334.1 protein_id gnl|my_center|LOCUS_18620 9894 10556 gene locus_tag LOCUS_18630 gene acrS 9894 10556 CDS product multidrug efflux transporter transcriptional repressor AcrS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129522.1 protein_id gnl|my_center|LOCUS_18630 11706 10822 gene locus_tag LOCUS_18640 gene yhdJ 11706 10822 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258895.1 protein_id gnl|my_center|LOCUS_18640 12088 11792 gene locus_tag LOCUS_18650 gene fis 12088 11792 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_18650 12959 12114 gene locus_tag LOCUS_18660 gene dusB 12959 12114 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219652.1 protein_id gnl|my_center|LOCUS_18660 14289 13408 gene locus_tag LOCUS_18670 gene prmA 14289 13408 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001145827.1 protein_id gnl|my_center|LOCUS_18670 15752 14301 gene locus_tag LOCUS_18680 gene panF 15752 14301 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001175728.1 protein_id gnl|my_center|LOCUS_18680 15984 15742 gene locus_tag LOCUS_18690 15984 15742 CDS product YhdT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381175.1 protein_id gnl|my_center|LOCUS_18690 17442 16093 gene locus_tag LOCUS_18700 gene accC 17442 16093 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 protein_id gnl|my_center|LOCUS_18700 17923 17453 gene locus_tag LOCUS_18710 gene accB 17923 17453 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_18710 18084 17896 gene locus_tag LOCUS_18720 18084 17896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 19875 18901 gene locus_tag LOCUS_18730 19875 18901 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148478.1 protein_id gnl|my_center|LOCUS_18730 20027 21967 gene locus_tag LOCUS_18740 gene csrD 20027 21967 CDS product RNase E specificity factor CsrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001241469.1 protein_id gnl|my_center|LOCUS_18740 22272 23315 gene locus_tag LOCUS_18750 gene mreB 22272 23315 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913396.1 protein_id gnl|my_center|LOCUS_18750 23381 24484 gene locus_tag LOCUS_18760 gene mreC 23381 24484 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802516.1 protein_id gnl|my_center|LOCUS_18760 24484 24972 gene locus_tag LOCUS_18770 gene mreD 24484 24972 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179409.1 protein_id gnl|my_center|LOCUS_18770 24981 25574 gene locus_tag LOCUS_18780 gene yhdE 24981 25574 CDS product nucleoside triphosphate pyrophosphatase YhdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203096.1 protein_id gnl|my_center|LOCUS_18780 25564 27033 gene locus_tag LOCUS_18790 gene rng 25564 27033 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123197.1 protein_id gnl|my_center|LOCUS_18790 27101 30901 gene locus_tag LOCUS_18800 gene yhdP 27101 30901 CDS product AsmA2 domain-containing protein YhdP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253618.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence26 452 2041 gene locus_tag LOCUS_18810 gene purH 452 2041 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187566.1 protein_id gnl|my_center|LOCUS_18810 2053 3342 gene locus_tag LOCUS_18820 gene purD 2053 3342 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866800.1 protein_id gnl|my_center|LOCUS_18820 4664 3339 gene locus_tag LOCUS_18830 gene zraR 4664 3339 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148503.1 protein_id gnl|my_center|LOCUS_18830 6037 4661 gene locus_tag LOCUS_18840 gene zraS 6037 4661 CDS product two-component system sensor histidine kinase ZraS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211931.1 protein_id gnl|my_center|LOCUS_18840 6275 6700 gene locus_tag LOCUS_18850 6275 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 7337 6702 gene locus_tag LOCUS_18860 7337 6702 CDS product DUF1481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299291.1 protein_id gnl|my_center|LOCUS_18860 7682 7410 gene locus_tag LOCUS_18870 gene hupA 7682 7410 CDS product DNA-binding protein HU-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044513.1 protein_id gnl|my_center|LOCUS_18870 8459 7869 gene locus_tag LOCUS_18880 8459 7869 CDS product YjaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940106.1 protein_id gnl|my_center|LOCUS_18880 9173 8502 gene locus_tag LOCUS_18890 gene nfi 9173 8502 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362388.1 protein_id gnl|my_center|LOCUS_18890 10247 9183 gene locus_tag LOCUS_18900 gene hemE 10247 9183 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137657.1 protein_id gnl|my_center|LOCUS_18900 11060 10287 gene locus_tag LOCUS_18910 gene nudC 11060 10287 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373940.1 protein_id gnl|my_center|LOCUS_18910 11155 11631 gene locus_tag LOCUS_18920 gene rsd 11155 11631 CDS product sigma D regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934302.1 protein_id gnl|my_center|LOCUS_18920 11864 13759 gene locus_tag LOCUS_18930 gene thiC 11864 13759 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276926.1 protein_id gnl|my_center|LOCUS_18930 13759 14394 gene locus_tag LOCUS_18940 gene thiE 13759 14394 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284600.1 protein_id gnl|my_center|LOCUS_18940 14387 15142 gene locus_tag LOCUS_18950 gene thiF 14387 15142 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999737.1 protein_id gnl|my_center|LOCUS_18950 15126 15326 gene locus_tag LOCUS_18960 gene thiS 15126 15326 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166230.1 protein_id gnl|my_center|LOCUS_18960 15328 16098 gene locus_tag LOCUS_18970 gene thiG 15328 16098 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944103.1 protein_id gnl|my_center|LOCUS_18970 16095 17228 gene locus_tag LOCUS_18980 gene thiH 16095 17228 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847445.1 protein_id gnl|my_center|LOCUS_18980 18177 17638 gene locus_tag LOCUS_18990 18177 17638 CDS product heat-shock protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307500.1 protein_id gnl|my_center|LOCUS_18990 22613 18390 gene locus_tag LOCUS_19000 gene rpoC 22613 18390 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653944.1 protein_id gnl|my_center|LOCUS_19000 26718 22690 gene locus_tag LOCUS_19010 gene rpoB 26718 22690 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263098.1 protein_id gnl|my_center|LOCUS_19010 27403 27038 gene locus_tag LOCUS_19020 gene rplL 27403 27038 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028878.1 protein_id gnl|my_center|LOCUS_19020 27967 27470 gene locus_tag LOCUS_19030 gene rplJ 27967 27470 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207201.1 protein_id gnl|my_center|LOCUS_19030 29084 28380 gene locus_tag LOCUS_19040 gene rplA 29084 28380 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096684.1 protein_id gnl|my_center|LOCUS_19040 29516 29088 gene locus_tag LOCUS_19050 gene rplK 29516 29088 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085926.1 protein_id gnl|my_center|LOCUS_19050 30220 29675 gene locus_tag LOCUS_19060 gene nusG 30220 29675 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287516.1 protein_id gnl|my_center|LOCUS_19060 30605 30222 gene locus_tag LOCUS_19070 gene secE 30605 30222 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275702.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence27 206 838 gene locus_tag LOCUS_19080 206 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19080 977 1249 gene locus_tag LOCUS_19090 977 1249 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001326686.1 protein_id gnl|my_center|LOCUS_19090 1585 2562 gene locus_tag LOCUS_19100 gene glaH 1585 2562 CDS product glutarate dioxygenase GlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993087.1 protein_id gnl|my_center|LOCUS_19100 2582 3850 gene locus_tag LOCUS_19110 gene lhgO 2582 3850 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271909.1 protein_id gnl|my_center|LOCUS_19110 3873 5321 gene locus_tag LOCUS_19120 gene gabD 3873 5321 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772689.1 protein_id gnl|my_center|LOCUS_19120 5335 6615 gene locus_tag LOCUS_19130 gene gabT 5335 6615 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087611.1 protein_id gnl|my_center|LOCUS_19130 6853 8253 gene locus_tag LOCUS_19140 gene gabP 6853 8253 CDS product GABA permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295173.1 protein_id gnl|my_center|LOCUS_19140 8274 8936 gene locus_tag LOCUS_19150 gene csiR 8274 8936 CDS product DNA-binding transcriptional regulator CsiR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156811.1 protein_id gnl|my_center|LOCUS_19150 9386 8937 gene locus_tag LOCUS_19160 gene kbp 9386 8937 CDS product potassium binding protein Kbp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522424.1 protein_id gnl|my_center|LOCUS_19160 9628 9470 gene locus_tag LOCUS_19170 9628 9470 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508177.1 protein_id gnl|my_center|LOCUS_19170 9811 10110 gene locus_tag LOCUS_19180 9811 10110 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137280.1 protein_id gnl|my_center|LOCUS_19180 10120 10644 gene locus_tag LOCUS_19190 gene ygaP 10120 10644 CDS product thiosulfate sulfurtransferase YgaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229458.1 protein_id gnl|my_center|LOCUS_19190 11095 10691 gene locus_tag LOCUS_19200 gene stpA 11095 10691 CDS product DNA-binding protein StpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115383.1 protein_id gnl|my_center|LOCUS_19200 11763 12212 gene locus_tag LOCUS_19210 gene alaE 11763 12212 CDS product L-alanine exporter AlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492656.1 protein_id gnl|my_center|LOCUS_19210 12593 12249 gene locus_tag LOCUS_19220 12593 12249 CDS product DUF2002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281320.1 protein_id gnl|my_center|LOCUS_19220 12745 13074 gene locus_tag LOCUS_19230 12745 13074 CDS product DUF883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295174.1 protein_id gnl|my_center|LOCUS_19230 13322 13567 gene locus_tag LOCUS_19240 gene nrdH 13322 13567 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223227.1 protein_id gnl|my_center|LOCUS_19240 13564 13974 gene locus_tag LOCUS_19250 gene nrdI 13564 13974 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080947.1 protein_id gnl|my_center|LOCUS_19250 13947 16091 gene locus_tag LOCUS_19260 gene nrdE 13947 16091 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246520.1 protein_id gnl|my_center|LOCUS_19260 16101 17060 gene locus_tag LOCUS_19270 gene nrdF 16101 17060 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000777969.1 protein_id gnl|my_center|LOCUS_19270 17415 18617 gene locus_tag LOCUS_19280 gene proV 17415 18617 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein ProV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985494.1 protein_id gnl|my_center|LOCUS_19280 18610 19674 gene locus_tag LOCUS_19290 gene proW 18610 19674 CDS product glycine betaine/L-proline ABC transporter permease ProW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774996.1 protein_id gnl|my_center|LOCUS_19290 19731 20723 gene locus_tag LOCUS_19300 gene proX 19731 20723 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216527.1 protein_id gnl|my_center|LOCUS_19300 21015 22199 gene locus_tag LOCUS_19310 21015 22199 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165699.1 protein_id gnl|my_center|LOCUS_19310 22368 23060 gene locus_tag LOCUS_19320 gene ygaZ 22368 23060 CDS product L-valine exporter subunit YgaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445658.1 protein_id gnl|my_center|LOCUS_19320 23050 23385 gene locus_tag LOCUS_19330 gene ygaH 23050 23385 CDS product L-valine transporter subunit YgaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119763.1 protein_id gnl|my_center|LOCUS_19330 23476 24006 gene locus_tag LOCUS_19340 gene emrR 23476 24006 CDS product multidrug efflux transporter EmrAB transcriptional repressor EmrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378442.1 protein_id gnl|my_center|LOCUS_19340 24133 25305 gene locus_tag LOCUS_19350 gene emrA 24133 25305 CDS product multidrug efflux MFS transporter periplasmic adaptor subunit EmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295175.1 protein_id gnl|my_center|LOCUS_19350 25322 26860 gene locus_tag LOCUS_19360 gene emrB 25322 26860 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295176.1 protein_id gnl|my_center|LOCUS_19360 27439 26924 gene locus_tag LOCUS_19370 gene luxS 27439 26924 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001130210.1 protein_id gnl|my_center|LOCUS_19370 29145 27589 gene locus_tag LOCUS_19380 gene gshA 29145 27589 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611804.1 protein_id gnl|my_center|LOCUS_19380 29646 29218 gene locus_tag LOCUS_19390 29646 29218 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287454.1 protein_id gnl|my_center|LOCUS_19390 30209 29643 gene locus_tag LOCUS_19400 gene yqaB 30209 29643 CDS product fructose-1-phosphate/6-phosphogluconate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273309.1 protein_id gnl|my_center|LOCUS_19400 30566 30490 gene locus_tag LOCUS_t00270 30566 30490 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30841 30765 gene locus_tag LOCUS_t00280 30841 30765 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 1884 919 gene locus_tag LOCUS_19410 1884 919 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813037.1 protein_id gnl|my_center|LOCUS_19410 2268 2011 gene locus_tag LOCUS_19420 gene rpmA 2268 2011 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940595.1 protein_id gnl|my_center|LOCUS_19420 2600 2289 gene locus_tag LOCUS_19430 gene rplU 2600 2289 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271401.1 protein_id gnl|my_center|LOCUS_19430 2859 3830 gene locus_tag LOCUS_19440 gene ispB 2859 3830 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047336.1 protein_id gnl|my_center|LOCUS_19440 4058 4336 gene locus_tag LOCUS_19450 gene sfsB 4058 4336 CDS product DNA-binding transcriptional regulator SfsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445413.1 protein_id gnl|my_center|LOCUS_19450 5643 4384 gene locus_tag LOCUS_19460 gene murA 5643 4384 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357259.1 protein_id gnl|my_center|LOCUS_19460 5967 5698 gene locus_tag LOCUS_19470 gene ibaG 5967 5698 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568740.1 protein_id gnl|my_center|LOCUS_19470 6405 6112 gene locus_tag LOCUS_19480 gene mlaB 6405 6112 CDS product lipid asymmetry maintenance protein MlaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004488.1 protein_id gnl|my_center|LOCUS_19480 7040 6405 gene locus_tag LOCUS_19490 gene mlaC 7040 6405 CDS product phospholipid-binding protein MlaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476487.1 protein_id gnl|my_center|LOCUS_19490 7610 7059 gene locus_tag LOCUS_19500 gene mlaD 7610 7059 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296448.1 protein_id gnl|my_center|LOCUS_19500 8397 7615 gene locus_tag LOCUS_19510 gene mlaE 8397 7615 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925795.1 protein_id gnl|my_center|LOCUS_19510 9214 8405 gene locus_tag LOCUS_19520 gene mlaF 9214 8405 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438245.1 protein_id gnl|my_center|LOCUS_19520 9424 10401 gene locus_tag LOCUS_19530 9424 10401 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922901.1 protein_id gnl|my_center|LOCUS_19530 10415 11401 gene locus_tag LOCUS_19540 gene kdsD 10415 11401 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295557.1 protein_id gnl|my_center|LOCUS_19540 11422 11988 gene locus_tag LOCUS_19550 gene kdsC 11422 11988 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030016.1 protein_id gnl|my_center|LOCUS_19550 11985 12560 gene locus_tag LOCUS_19560 gene lptC 11985 12560 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030537.1 protein_id gnl|my_center|LOCUS_19560 12529 13086 gene locus_tag LOCUS_19570 gene lptA 12529 13086 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669785.1 protein_id gnl|my_center|LOCUS_19570 13093 13818 gene locus_tag LOCUS_19580 gene lptB 13093 13818 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224099.1 protein_id gnl|my_center|LOCUS_19580 13866 15299 gene locus_tag LOCUS_19590 gene rpoN 13866 15299 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809051.1 protein_id gnl|my_center|LOCUS_19590 15322 15609 gene locus_tag LOCUS_19600 gene hpf 15322 15609 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176599.1 protein_id gnl|my_center|LOCUS_19600 15727 16218 gene locus_tag LOCUS_19610 gene ptsN 15727 16218 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183676.1 protein_id gnl|my_center|LOCUS_19610 16264 17118 gene locus_tag LOCUS_19620 gene rapZ 16264 17118 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243741.1 protein_id gnl|my_center|LOCUS_19620 17115 17387 gene locus_tag LOCUS_19630 gene npr 17115 17387 CDS product PTS phosphocarrier protein NPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216791.1 protein_id gnl|my_center|LOCUS_19630 17601 18233 gene locus_tag LOCUS_19640 gene yrbL 17601 18233 CDS product PhoP regulatory network protein YrbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620405.1 protein_id gnl|my_center|LOCUS_19640 18958 18230 gene locus_tag LOCUS_19650 gene mtgA 18958 18230 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047091.1 protein_id gnl|my_center|LOCUS_19650 19608 18955 gene locus_tag LOCUS_19660 gene elbB 19608 18955 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299134.1 protein_id gnl|my_center|LOCUS_19660 22174 19838 gene locus_tag LOCUS_19670 gene arcB 22174 19838 CDS product aerobic respiration two-component sensor histidine kinase ArcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809774.1 protein_id gnl|my_center|LOCUS_19670 23232 22270 gene locus_tag LOCUS_19680 23232 22270 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176896.1 protein_id gnl|my_center|LOCUS_19680 23766 28334 gene locus_tag LOCUS_19690 gene gltB 23766 28334 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213702.1 protein_id gnl|my_center|LOCUS_19690 28347 29765 gene locus_tag LOCUS_19700 gene gltD 28347 29765 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081674.1 protein_id gnl|my_center|LOCUS_19700 >Feature sequence29 192 1508 gene locus_tag LOCUS_19710 gene fliD 192 1508 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609678.1 protein_id gnl|my_center|LOCUS_19710 1531 1923 gene locus_tag LOCUS_19720 gene fliS 1531 1923 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285322.1 protein_id gnl|my_center|LOCUS_19720 1928 2239 gene locus_tag LOCUS_19730 1928 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415004.1 protein_id gnl|my_center|LOCUS_19730 2236 3297 gene locus_tag LOCUS_19740 2236 3297 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001067489.1 protein_id gnl|my_center|LOCUS_19740 3305 3772 gene locus_tag LOCUS_19750 3305 3772 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725259.1 protein_id gnl|my_center|LOCUS_19750 3792 4508 gene locus_tag LOCUS_19760 3792 4508 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938726.1 protein_id gnl|my_center|LOCUS_19760 4521 5384 gene locus_tag LOCUS_19770 gene motA 4521 5384 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169518.1 protein_id gnl|my_center|LOCUS_19770 5519 6310 gene locus_tag LOCUS_19780 gene lafU 5519 6310 CDS product putative lateral flagellar export/assembly protein LafU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232550.1 protein_id gnl|my_center|LOCUS_19780 6381 7436 gene locus_tag LOCUS_19790 gene dinB 6381 7436 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226164.1 protein_id gnl|my_center|LOCUS_19790 7433 7885 gene locus_tag LOCUS_19800 7433 7885 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059855.1 protein_id gnl|my_center|LOCUS_19800 8131 9270 gene locus_tag LOCUS_19810 8131 9270 CDS product RNA ligase RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528869.1 protein_id gnl|my_center|LOCUS_19810 9267 9881 gene locus_tag LOCUS_19820 gene prfH 9267 9881 CDS product peptide chain release factor H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602112.1 protein_id gnl|my_center|LOCUS_19820 11395 9938 gene locus_tag LOCUS_19830 gene pepD 11395 9938 CDS product cytosol nonspecific dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293014.1 protein_id gnl|my_center|LOCUS_19830 11656 12114 gene locus_tag LOCUS_19840 gene gpt 11656 12114 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291990.1 protein_id gnl|my_center|LOCUS_19840 12206 13450 gene locus_tag LOCUS_19850 gene frsA 12206 13450 CDS product esterase FrsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189558.1 protein_id gnl|my_center|LOCUS_19850 13508 13909 gene locus_tag LOCUS_19860 gene crl 13508 13909 CDS product sigma factor-binding protein Crl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174677.1 protein_id gnl|my_center|LOCUS_19860 15003 13948 gene locus_tag LOCUS_19870 gene phoE 15003 13948 CDS product phosphoporin PhoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749863.1 protein_id gnl|my_center|LOCUS_19870 15291 16394 gene locus_tag LOCUS_19880 gene proB 15291 16394 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285288.1 protein_id gnl|my_center|LOCUS_19880 16406 17659 gene locus_tag LOCUS_19890 gene proA 16406 17659 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893256.1 protein_id gnl|my_center|LOCUS_19890 17774 17849 gene locus_tag LOCUS_t00290 17774 17849 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19027 17864 gene locus_tag LOCUS_19900 19027 17864 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051894.1 protein_id gnl|my_center|LOCUS_19900 19559 19254 gene locus_tag LOCUS_19910 gene yfdT 19559 19254 CDS product protein YfdT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206732.1 protein_id gnl|my_center|LOCUS_19910 19921 19559 gene locus_tag LOCUS_19920 19921 19559 CDS product phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242717.1 protein_id gnl|my_center|LOCUS_19920 20448 19912 gene locus_tag LOCUS_19930 gene yfdR 20448 19912 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008178.1 protein_id gnl|my_center|LOCUS_19930 20993 21427 gene locus_tag LOCUS_19940 20993 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016392.1 protein_id gnl|my_center|LOCUS_19940 21605 21399 gene locus_tag LOCUS_19950 21605 21399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549623.1 protein_id gnl|my_center|LOCUS_19950 22637 21945 gene locus_tag LOCUS_19960 22637 21945 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001353346.1 protein_id gnl|my_center|LOCUS_19960 22735 22995 gene locus_tag LOCUS_19970 22735 22995 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191675.1 protein_id gnl|my_center|LOCUS_19970 22988 23539 gene locus_tag LOCUS_19980 gene ymfL 22988 23539 CDS product protein YmfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000515837.1 protein_id gnl|my_center|LOCUS_19980 23715 23894 gene locus_tag LOCUS_19990 23715 23894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 23884 24825 gene locus_tag LOCUS_20000 23884 24825 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000104945.1 protein_id gnl|my_center|LOCUS_20000 24841 25014 gene locus_tag LOCUS_20010 24841 25014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 25065 25316 gene locus_tag LOCUS_20020 25065 25316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 25316 25969 gene locus_tag LOCUS_20030 25316 25969 CDS product phage N-6-adenine-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066917.1 protein_id gnl|my_center|LOCUS_20030 25966 26292 gene locus_tag LOCUS_20040 25966 26292 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000210154.1 protein_id gnl|my_center|LOCUS_20040 26289 26678 gene locus_tag LOCUS_20050 26289 26678 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767129.1 protein_id gnl|my_center|LOCUS_20050 26698 27507 gene locus_tag LOCUS_20060 26698 27507 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061438.1 protein_id gnl|my_center|LOCUS_20060 27515 28504 gene locus_tag LOCUS_20070 27515 28504 CDS product DUF968 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001360050.1 protein_id gnl|my_center|LOCUS_20070 28518 29096 gene locus_tag LOCUS_20080 28518 29096 CDS product DUF1133 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640143.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence30 274 537 gene locus_tag LOCUS_20090 274 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 967 737 gene locus_tag LOCUS_20100 967 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2322 1540 gene locus_tag LOCUS_20110 2322 1540 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295538.1 protein_id gnl|my_center|LOCUS_20110 2625 3545 gene locus_tag LOCUS_20120 gene rbsK 2625 3545 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350265.1 protein_id gnl|my_center|LOCUS_20120 3828 4889 gene locus_tag LOCUS_20130 gene fucP 3828 4889 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998350.1 protein_id gnl|my_center|LOCUS_20130 4901 5914 gene locus_tag LOCUS_20140 4901 5914 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107474.1 protein_id gnl|my_center|LOCUS_20140 8088 6832 gene locus_tag LOCUS_20150 8088 6832 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000345347.1 protein_id gnl|my_center|LOCUS_20150 8388 8101 gene locus_tag LOCUS_20160 8388 8101 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705930.1 protein_id gnl|my_center|LOCUS_20160 8847 8404 gene locus_tag LOCUS_20170 8847 8404 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916805.1 protein_id gnl|my_center|LOCUS_20170 9118 10149 gene locus_tag LOCUS_20180 9118 10149 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416151.1 protein_id gnl|my_center|LOCUS_20180 12218 10989 gene locus_tag LOCUS_20190 12218 10989 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198472.1 protein_id gnl|my_center|LOCUS_20190 12946 12215 gene locus_tag LOCUS_20200 12946 12215 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091664.1 protein_id gnl|my_center|LOCUS_20200 13410 12946 gene locus_tag LOCUS_20210 13410 12946 CDS product 3-hydroxy-fatty acyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020246.1 protein_id gnl|my_center|LOCUS_20210 14576 13407 gene locus_tag LOCUS_20220 14576 13407 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301690.1 protein_id gnl|my_center|LOCUS_20220 15162 14578 gene locus_tag LOCUS_20230 15162 14578 CDS product DUF3261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000597700.1 protein_id gnl|my_center|LOCUS_20230 17408 15159 gene locus_tag LOCUS_20240 17408 15159 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180194.1 protein_id gnl|my_center|LOCUS_20240 18051 17446 gene locus_tag LOCUS_20250 18051 17446 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670562.1 protein_id gnl|my_center|LOCUS_20250 18470 18048 gene locus_tag LOCUS_20260 18470 18048 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930891.1 protein_id gnl|my_center|LOCUS_20260 20150 18474 gene locus_tag LOCUS_20270 20150 18474 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000115628.1 protein_id gnl|my_center|LOCUS_20270 20494 20141 gene locus_tag LOCUS_20280 20494 20141 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703718.1 protein_id gnl|my_center|LOCUS_20280 21839 20481 gene locus_tag LOCUS_20290 21839 20481 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815059.1 protein_id gnl|my_center|LOCUS_20290 22417 21836 gene locus_tag LOCUS_20300 22417 21836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014366.1 protein_id gnl|my_center|LOCUS_20300 22673 22422 gene locus_tag LOCUS_20310 22673 22422 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000139646.1 protein_id gnl|my_center|LOCUS_20310 22942 22685 gene locus_tag LOCUS_20320 22942 22685 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148684.1 protein_id gnl|my_center|LOCUS_20320 23738 22917 gene locus_tag LOCUS_20330 23738 22917 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302735.1 protein_id gnl|my_center|LOCUS_20330 24457 23735 gene locus_tag LOCUS_20340 24457 23735 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301843.1 protein_id gnl|my_center|LOCUS_20340 25556 24498 gene locus_tag LOCUS_20350 25556 24498 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_20350 26010 25621 gene locus_tag LOCUS_20360 26010 25621 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301470.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence31 591 394 gene locus_tag LOCUS_20370 591 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 574 936 gene locus_tag LOCUS_20380 574 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 1169 912 gene locus_tag LOCUS_20390 1169 912 CDS product DUF1488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070563.1 protein_id gnl|my_center|LOCUS_20390 1984 1166 gene locus_tag LOCUS_20400 gene aroE 1984 1166 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451211.1 protein_id gnl|my_center|LOCUS_20400 2561 1989 gene locus_tag LOCUS_20410 gene tsaC 2561 1989 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297709.1 protein_id gnl|my_center|LOCUS_20410 2656 2892 gene locus_tag LOCUS_20420 2656 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 3610 3137 gene locus_tag LOCUS_20430 gene smg 3610 3137 CDS product DUF494 family protein Smg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460680.1 protein_id gnl|my_center|LOCUS_20430 3890 3582 gene locus_tag LOCUS_20440 3890 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20440 4706 4029 gene locus_tag LOCUS_20450 4706 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20450 4836 5345 gene locus_tag LOCUS_20460 gene def 4836 5345 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114984.1 protein_id gnl|my_center|LOCUS_20460 5360 6307 gene locus_tag LOCUS_20470 gene fmt 5360 6307 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004454.1 protein_id gnl|my_center|LOCUS_20470 6353 7642 gene locus_tag LOCUS_20480 gene rsmB 6353 7642 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744779.1 protein_id gnl|my_center|LOCUS_20480 7664 9040 gene locus_tag LOCUS_20490 gene trkA 7664 9040 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691382.1 protein_id gnl|my_center|LOCUS_20490 9170 9580 gene locus_tag LOCUS_20500 gene mscL 9170 9580 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022442.1 protein_id gnl|my_center|LOCUS_20500 9795 9577 gene locus_tag LOCUS_20510 gene arfA 9795 9577 CDS product alternative ribosome-rescue factor ArfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000092696.1 protein_id gnl|my_center|LOCUS_20510 10276 9851 gene locus_tag LOCUS_20520 gene zntR 10276 9851 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285607.1 protein_id gnl|my_center|LOCUS_20520 10655 10287 gene locus_tag LOCUS_20530 10655 10287 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000266486.1 protein_id gnl|my_center|LOCUS_20530 11145 10762 gene locus_tag LOCUS_20540 gene rplQ 11145 10762 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 protein_id gnl|my_center|LOCUS_20540 12175 11186 gene locus_tag LOCUS_20550 gene rpoA 12175 11186 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162094.1 protein_id gnl|my_center|LOCUS_20550 12821 12201 gene locus_tag LOCUS_20560 gene rpsD 12821 12201 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000135224.1 protein_id gnl|my_center|LOCUS_20560 13244 12855 gene locus_tag LOCUS_20570 gene rpsK 13244 12855 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029684.1 protein_id gnl|my_center|LOCUS_20570 13617 13261 gene locus_tag LOCUS_20580 gene rpsM 13617 13261 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090775.1 protein_id gnl|my_center|LOCUS_20580 15243 13912 gene locus_tag LOCUS_20590 gene secY 15243 13912 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118861.1 protein_id gnl|my_center|LOCUS_20590 15685 15251 gene locus_tag LOCUS_20600 gene rplO 15685 15251 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 protein_id gnl|my_center|LOCUS_20600 15868 15689 gene locus_tag LOCUS_20610 gene rpmD 15868 15689 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140433.1 protein_id gnl|my_center|LOCUS_20610 16375 15872 gene locus_tag LOCUS_20620 gene rpsE 16375 15872 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940121.1 protein_id gnl|my_center|LOCUS_20620 16743 16390 gene locus_tag LOCUS_20630 gene rplR 16743 16390 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358960.1 protein_id gnl|my_center|LOCUS_20630 17286 16753 gene locus_tag LOCUS_20640 gene rplF 17286 16753 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091945.1 protein_id gnl|my_center|LOCUS_20640 17691 17299 gene locus_tag LOCUS_20650 gene rpsH 17691 17299 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062611.1 protein_id gnl|my_center|LOCUS_20650 18030 17725 gene locus_tag LOCUS_20660 gene rpsN 18030 17725 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118930.1 protein_id gnl|my_center|LOCUS_20660 18584 18045 gene locus_tag LOCUS_20670 gene rplE 18584 18045 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096200.1 protein_id gnl|my_center|LOCUS_20670 18913 18599 gene locus_tag LOCUS_20680 gene rplX 18913 18599 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729185.1 protein_id gnl|my_center|LOCUS_20680 19295 18924 gene locus_tag LOCUS_20690 gene rplN 19295 18924 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613955.1 protein_id gnl|my_center|LOCUS_20690 19714 19460 gene locus_tag LOCUS_20700 gene rpsQ 19714 19460 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000130100.1 protein_id gnl|my_center|LOCUS_20700 19905 19714 gene locus_tag LOCUS_20710 gene rpmC 19905 19714 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644741.1 protein_id gnl|my_center|LOCUS_20710 20315 19905 gene locus_tag LOCUS_20720 gene rplP 20315 19905 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941212.1 protein_id gnl|my_center|LOCUS_20720 21029 20328 gene locus_tag LOCUS_20730 gene rpsC 21029 20328 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529945.1 protein_id gnl|my_center|LOCUS_20730 21379 21047 gene locus_tag LOCUS_20740 gene rplV 21379 21047 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447529.1 protein_id gnl|my_center|LOCUS_20740 21672 21394 gene locus_tag LOCUS_20750 gene rpsS 21672 21394 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138117.1 protein_id gnl|my_center|LOCUS_20750 22510 21689 gene locus_tag LOCUS_20760 gene rplB 22510 21689 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301864.1 protein_id gnl|my_center|LOCUS_20760 22830 22528 gene locus_tag LOCUS_20770 gene rplW 22830 22528 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617544.1 protein_id gnl|my_center|LOCUS_20770 23432 22827 gene locus_tag LOCUS_20780 gene rplD 23432 22827 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424395.1 protein_id gnl|my_center|LOCUS_20780 24072 23443 gene locus_tag LOCUS_20790 gene rplC 24072 23443 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579833.1 protein_id gnl|my_center|LOCUS_20790 24416 24105 gene locus_tag LOCUS_20800 gene rpsJ 24416 24105 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181004.1 protein_id gnl|my_center|LOCUS_20800 24795 25262 gene locus_tag LOCUS_20810 24795 25262 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340167.1 protein_id gnl|my_center|LOCUS_20810 25735 25259 gene locus_tag LOCUS_20820 gene bfr 25735 25259 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675515.1 protein_id gnl|my_center|LOCUS_20820 26002 25808 gene locus_tag LOCUS_20830 gene bfd 26002 25808 CDS product bacterioferritin-associated ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000289090.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence32 16 126 gene locus_tag LOCUS_r00010 16 126 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 455 1753 gene locus_tag LOCUS_20840 gene kgtP 455 1753 CDS product alpha-ketoglutarate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841103.1 protein_id gnl|my_center|LOCUS_20840 2022 1750 gene locus_tag LOCUS_20850 2022 1750 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300818.1 protein_id gnl|my_center|LOCUS_20850 3477 2119 gene locus_tag LOCUS_20860 gene pssA 3477 2119 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949265.1 protein_id gnl|my_center|LOCUS_20860 6248 3588 gene locus_tag LOCUS_20870 gene pat 6248 3588 CDS product protein lysine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082988.1 protein_id gnl|my_center|LOCUS_20870 6810 6280 gene locus_tag LOCUS_20880 gene tapT 6810 6280 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138184.1 protein_id gnl|my_center|LOCUS_20880 7466 7047 gene locus_tag LOCUS_20890 gene trxC 7466 7047 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 protein_id gnl|my_center|LOCUS_20890 7673 8710 gene locus_tag LOCUS_20900 7673 8710 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997403.1 protein_id gnl|my_center|LOCUS_20900 9447 8758 gene locus_tag LOCUS_20910 gene ung 9447 8758 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262716.1 protein_id gnl|my_center|LOCUS_20910 9752 10135 gene locus_tag LOCUS_20920 gene grcA 9752 10135 CDS product autonomous glycyl radical cofactor GrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627807.1 protein_id gnl|my_center|LOCUS_20920 10778 10191 gene locus_tag LOCUS_20930 gene eamB 10778 10191 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189207.1 protein_id gnl|my_center|LOCUS_20930 10881 11762 gene locus_tag LOCUS_20940 10881 11762 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001386989.1 protein_id gnl|my_center|LOCUS_20940 13305 11971 gene locus_tag LOCUS_20950 gene srmB 13305 11971 CDS product ATP-dependent RNA helicase SrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219193.1 protein_id gnl|my_center|LOCUS_20950 13515 14174 gene locus_tag LOCUS_20960 gene trmN 13515 14174 CDS product tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001298974.1 protein_id gnl|my_center|LOCUS_20960 15781 14159 gene locus_tag LOCUS_20970 gene nadB 15781 14159 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094498.1 protein_id gnl|my_center|LOCUS_20970 16189 16764 gene locus_tag LOCUS_20980 gene rpoE 16189 16764 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295364.1 protein_id gnl|my_center|LOCUS_20980 16797 17447 gene locus_tag LOCUS_20990 gene rseA 16797 17447 CDS product anti-sigma-E factor RseA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001168459.1 protein_id gnl|my_center|LOCUS_20990 17447 18403 gene locus_tag LOCUS_21000 gene rseB 17447 18403 CDS product sigma-E factor regulatory protein RseB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812053.1 protein_id gnl|my_center|LOCUS_21000 18400 18879 gene locus_tag LOCUS_21010 gene rseC 18400 18879 CDS product SoxR-reducing system protein RseC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589070.1 protein_id gnl|my_center|LOCUS_21010 19077 20876 gene locus_tag LOCUS_21020 gene lepA 19077 20876 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790168.1 protein_id gnl|my_center|LOCUS_21020 20892 21866 gene locus_tag LOCUS_21030 gene lepB 20892 21866 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002542.1 protein_id gnl|my_center|LOCUS_21030 22205 22819 gene locus_tag LOCUS_21040 gene rnc 22205 22819 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068343.1 protein_id gnl|my_center|LOCUS_21040 22816 23721 gene locus_tag LOCUS_21050 gene era 22816 23721 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020737.1 protein_id gnl|my_center|LOCUS_21050 23733 24461 gene locus_tag LOCUS_21060 gene recO 23733 24461 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399393.1 protein_id gnl|my_center|LOCUS_21060 24473 25204 gene locus_tag LOCUS_21070 gene pdxJ 24473 25204 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297412.1 protein_id gnl|my_center|LOCUS_21070 25204 25584 gene locus_tag LOCUS_21080 gene acpS 25204 25584 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986029.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence33 <1 757 gene locus_tag LOCUS_21090 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000445164.1:PDDEXK nuclease domain-containing protein 1281 817 gene locus_tag LOCUS_21100 gene nanQ 1281 817 CDS product N-acetylneuraminate anomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000979882.1 protein_id gnl|my_center|LOCUS_21100 2153 1278 gene locus_tag LOCUS_21110 gene nanK 2153 1278 CDS product N-acetylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069526.1 protein_id gnl|my_center|LOCUS_21110 2839 2150 gene locus_tag LOCUS_21120 2839 2150 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054239.1 protein_id gnl|my_center|LOCUS_21120 4377 2887 gene locus_tag LOCUS_21130 gene nanT 4377 2887 CDS product sialic acid transporter NanT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108473.1 protein_id gnl|my_center|LOCUS_21130 5379 4486 gene locus_tag LOCUS_21140 gene nanA 5379 4486 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224714.1 protein_id gnl|my_center|LOCUS_21140 6283 5501 gene locus_tag LOCUS_21150 gene nanR 6283 5501 CDS product transcriptional regulator NanR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523845.1 protein_id gnl|my_center|LOCUS_21150 6672 8039 gene locus_tag LOCUS_21160 gene dcuC 6672 8039 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467000.1 protein_id gnl|my_center|LOCUS_21160 8579 8082 gene locus_tag LOCUS_21170 gene sspB 8579 8082 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366129.1 protein_id gnl|my_center|LOCUS_21170 9223 8585 gene locus_tag LOCUS_21180 gene sspA 9223 8585 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257293.1 protein_id gnl|my_center|LOCUS_21180 10010 9618 gene locus_tag LOCUS_21190 gene rpsI 10010 9618 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_21190 10454 10026 gene locus_tag LOCUS_21200 gene rplM 10454 10026 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_21200 11644 10673 gene locus_tag LOCUS_21210 gene zapE 11644 10673 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192344.1 protein_id gnl|my_center|LOCUS_21210 11988 12392 gene locus_tag LOCUS_21220 gene zapG 11988 12392 CDS product Z-ring associated protein ZapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295270.1 protein_id gnl|my_center|LOCUS_21220 12546 13913 gene locus_tag LOCUS_21230 gene degQ 12546 13913 CDS product serine endoprotease DegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295271.1 protein_id gnl|my_center|LOCUS_21230 14003 15070 gene locus_tag LOCUS_21240 gene degS 14003 15070 CDS product outer membrane-stress sensor serine endopeptidase DegS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497723.1 protein_id gnl|my_center|LOCUS_21240 16071 15133 gene locus_tag LOCUS_21250 gene mdh 16071 15133 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307415.1 protein_id gnl|my_center|LOCUS_21250 16506 16976 gene locus_tag LOCUS_21260 gene argR 16506 16976 CDS product transcriptional regulator ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257846.1 protein_id gnl|my_center|LOCUS_21260 17290 17604 gene locus_tag LOCUS_21270 gene yhcN 17290 17604 CDS product peroxide/acid stress response protein YhcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509740.1 protein_id gnl|my_center|LOCUS_21270 17932 17660 gene locus_tag LOCUS_21280 17932 17660 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029013.1 protein_id gnl|my_center|LOCUS_21280 19991 18024 gene locus_tag LOCUS_21290 gene aaeB 19991 18024 CDS product p-hydroxybenzoic acid efflux pump subunit AaeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510962.1 protein_id gnl|my_center|LOCUS_21290 20929 19997 gene locus_tag LOCUS_21300 gene aaeA 20929 19997 CDS product p-hydroxybenzoic acid efflux pump subunit AaeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854033.1 protein_id gnl|my_center|LOCUS_21300 21209 20937 gene locus_tag LOCUS_21310 gene aaeX 21209 20937 CDS product p-hydroxybenzoic acid efflux pump operon protein AaeX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116614.1 protein_id gnl|my_center|LOCUS_21310 21323 22252 gene locus_tag LOCUS_21320 gene aaeR 21323 22252 CDS product HTH-type transcriptional activator AaeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440317.1 protein_id gnl|my_center|LOCUS_21320 23831 22386 gene locus_tag LOCUS_21330 gene tldD 23831 22386 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055909.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence34 178 576 gene locus_tag LOCUS_21340 178 576 CDS product YidB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522196.1 protein_id gnl|my_center|LOCUS_21340 691 1503 gene locus_tag LOCUS_21350 gene yidA 691 1503 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000985549.1 protein_id gnl|my_center|LOCUS_21350 2205 1549 gene locus_tag LOCUS_21360 gene yidX 2205 1549 CDS product protein YidX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772934.1 protein_id gnl|my_center|LOCUS_21360 2483 3172 gene locus_tag LOCUS_21370 gene dgoR 2483 3172 CDS product D-galactonate utilization transcriptional regulator DgoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174305.1 protein_id gnl|my_center|LOCUS_21370 3169 4047 gene locus_tag LOCUS_21380 gene dgoK 3169 4047 CDS product 2-dehydro-3-deoxygalactonokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127112.1 protein_id gnl|my_center|LOCUS_21380 4031 4648 gene locus_tag LOCUS_21390 gene dgoA 4031 4648 CDS product 2-dehydro-3-deoxy-6-phosphogalactonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198730.1 protein_id gnl|my_center|LOCUS_21390 4645 5793 gene locus_tag LOCUS_21400 gene dgoD 4645 5793 CDS product galactonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705001.1 protein_id gnl|my_center|LOCUS_21400 5913 7205 gene locus_tag LOCUS_21410 5913 7205 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354284.1 protein_id gnl|my_center|LOCUS_21410 8266 7202 gene locus_tag LOCUS_21420 gene cbrA 8266 7202 CDS product colicin M resistance lipid reductase CbrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001387166.1 protein_id gnl|my_center|LOCUS_21420 8367 9581 gene locus_tag LOCUS_21430 8367 9581 CDS product DUF3748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295245.1 protein_id gnl|my_center|LOCUS_21430 9843 9583 gene locus_tag LOCUS_21440 9843 9583 CDS product YceK/YidQ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313407.1 protein_id gnl|my_center|LOCUS_21440 10221 10634 gene locus_tag LOCUS_21450 gene ibpA 10221 10634 CDS product heat shock chaperone IbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243437.1 protein_id gnl|my_center|LOCUS_21450 10746 11174 gene locus_tag LOCUS_21460 gene ibpB 10746 11174 CDS product heat shock chaperone IbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243431.1 protein_id gnl|my_center|LOCUS_21460 11371 13032 gene locus_tag LOCUS_21470 11371 13032 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001279752.1 protein_id gnl|my_center|LOCUS_21470 13745 13029 gene locus_tag LOCUS_21480 13745 13029 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300779.1 protein_id gnl|my_center|LOCUS_21480 14041 15657 gene locus_tag LOCUS_21490 14041 15657 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952141.1 protein_id gnl|my_center|LOCUS_21490 15657 16295 gene locus_tag LOCUS_21500 15657 16295 CDS product inactive 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311230.1 protein_id gnl|my_center|LOCUS_21500 16295 16471 gene locus_tag LOCUS_21510 16295 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 17361 16468 gene locus_tag LOCUS_21520 17361 16468 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013540.1 protein_id gnl|my_center|LOCUS_21520 17528 19243 gene locus_tag LOCUS_21530 17528 19243 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 protein_id gnl|my_center|LOCUS_21530 19240 20733 gene locus_tag LOCUS_21540 19240 20733 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828483.1 protein_id gnl|my_center|LOCUS_21540 21229 20780 gene locus_tag LOCUS_21550 gene yidI 21229 20780 CDS product protein YidI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511287.1 protein_id gnl|my_center|LOCUS_21550 21339 21686 gene locus_tag LOCUS_21560 21339 21686 CDS product YidH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703959.1 protein_id gnl|my_center|LOCUS_21560 21676 22038 gene locus_tag LOCUS_21570 21676 22038 CDS product DUF202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113432.1 protein_id gnl|my_center|LOCUS_21570 22035 22532 gene locus_tag LOCUS_21580 22035 22532 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000148063.1 protein_id gnl|my_center|LOCUS_21580 23700 22540 gene locus_tag LOCUS_21590 gene emrD 23700 22540 CDS product multidrug efflux MFS transporter EmrD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001306726.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence35 1127 267 gene locus_tag LOCUS_21600 1127 267 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098260.1 protein_id gnl|my_center|LOCUS_21600 1315 1124 gene locus_tag LOCUS_21610 1315 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1418 2923 gene locus_tag LOCUS_21620 1418 2923 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_21620 2935 4860 gene locus_tag LOCUS_21630 gene iolD 2935 4860 CDS product 3D-(3,5/4)-trihydroxycyclohexane-1,2-dione acylhydrolase (decyclizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098258.1 protein_id gnl|my_center|LOCUS_21630 5145 6131 gene locus_tag LOCUS_21640 gene iolG 5145 6131 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098257.1 protein_id gnl|my_center|LOCUS_21640 6163 7092 gene locus_tag LOCUS_21650 6163 7092 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098256.1 protein_id gnl|my_center|LOCUS_21650 7144 8691 gene locus_tag LOCUS_21660 7144 8691 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098255.1 protein_id gnl|my_center|LOCUS_21660 8703 9731 gene locus_tag LOCUS_21670 8703 9731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098254.1 protein_id gnl|my_center|LOCUS_21670 9740 10873 gene locus_tag LOCUS_21680 9740 10873 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098253.1 protein_id gnl|my_center|LOCUS_21680 10886 12790 gene locus_tag LOCUS_21690 gene iolC 10886 12790 CDS product 5-dehydro-2-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098252.1 protein_id gnl|my_center|LOCUS_21690 12802 13692 gene locus_tag LOCUS_21700 gene iolE 12802 13692 CDS product myo-inosose-2 dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098251.1 protein_id gnl|my_center|LOCUS_21700 13702 14523 gene locus_tag LOCUS_21710 gene iolB 13702 14523 CDS product 5-deoxy-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098250.1 protein_id gnl|my_center|LOCUS_21710 15970 15545 gene locus_tag LOCUS_21720 15970 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 16971 16642 gene locus_tag LOCUS_21730 16971 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21730 17514 18686 gene locus_tag LOCUS_21740 gene istA 17514 18686 CDS product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 protein_id gnl|my_center|LOCUS_21740 18686 19483 gene locus_tag LOCUS_21750 gene istB 18686 19483 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_21750 20205 20729 gene locus_tag LOCUS_21760 20205 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21760 21116 21415 gene locus_tag LOCUS_21770 21116 21415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296472.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence36 1018 434 gene locus_tag LOCUS_21780 1018 434 CDS product YmfQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383554.1 protein_id gnl|my_center|LOCUS_21780 2067 1009 gene locus_tag LOCUS_21790 2067 1009 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163406301.1 protein_id gnl|my_center|LOCUS_21790 2479 2054 gene locus_tag LOCUS_21800 2479 2054 CDS product phage GP46 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424732.1 protein_id gnl|my_center|LOCUS_21800 3027 2479 gene locus_tag LOCUS_21810 3027 2479 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259080.1 protein_id gnl|my_center|LOCUS_21810 4106 3027 gene locus_tag LOCUS_21820 4106 3027 CDS product baseplate protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999486.1 protein_id gnl|my_center|LOCUS_21820 5431 4103 gene locus_tag LOCUS_21830 5431 4103 CDS product DNA circularization N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631158.1 protein_id gnl|my_center|LOCUS_21830 5542 5988 gene locus_tag LOCUS_21840 5542 5988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 7853 6021 gene locus_tag LOCUS_21850 7853 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 8264 7995 gene locus_tag LOCUS_21860 8264 7995 CDS product phage tail assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316280.1 protein_id gnl|my_center|LOCUS_21860 8620 8264 gene locus_tag LOCUS_21870 8620 8264 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090992.1 protein_id gnl|my_center|LOCUS_21870 10116 8620 gene locus_tag LOCUS_21880 10116 8620 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155695.1 protein_id gnl|my_center|LOCUS_21880 10270 10100 gene locus_tag LOCUS_21890 10270 10100 CDS product DUF2635 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497751.1 protein_id gnl|my_center|LOCUS_21890 10839 10279 gene locus_tag LOCUS_21900 10839 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779294.1 protein_id gnl|my_center|LOCUS_21900 11342 10836 gene locus_tag LOCUS_21910 11342 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224835.1 protein_id gnl|my_center|LOCUS_21910 11727 11317 gene locus_tag LOCUS_21920 11727 11317 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702391.1 protein_id gnl|my_center|LOCUS_21920 12047 11724 gene locus_tag LOCUS_21930 12047 11724 CDS product head-tail connector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927711.1 protein_id gnl|my_center|LOCUS_21930 12250 12050 gene locus_tag LOCUS_21940 12250 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 13505 12300 gene locus_tag LOCUS_21950 13505 12300 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 protein_id gnl|my_center|LOCUS_21950 14170 13520 gene locus_tag LOCUS_21960 14170 13520 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193633.1 protein_id gnl|my_center|LOCUS_21960 15389 14148 gene locus_tag LOCUS_21970 15389 14148 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466243.1 protein_id gnl|my_center|LOCUS_21970 15571 15389 gene locus_tag LOCUS_21980 gene ymfR 15571 15389 CDS product protein YmfR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605606.1 protein_id gnl|my_center|LOCUS_21980 17316 15583 gene locus_tag LOCUS_21990 17316 15583 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088178.1 protein_id gnl|my_center|LOCUS_21990 17807 17313 gene locus_tag LOCUS_22000 17807 17313 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929175.1 protein_id gnl|my_center|LOCUS_22000 18283 17933 gene locus_tag LOCUS_22010 18283 17933 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135200.1 protein_id gnl|my_center|LOCUS_22010 18696 18376 gene locus_tag LOCUS_22020 gene grlR 18696 18376 CDS product type III secretion system LEE GrlA-binding negative regulator GrlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000605370.1 protein_id gnl|my_center|LOCUS_22020 19335 18943 gene locus_tag LOCUS_22030 19335 18943 CDS product DUF2570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309362.1 protein_id gnl|my_center|LOCUS_22030 19946 19332 gene locus_tag LOCUS_22040 19946 19332 CDS product glycoside hydrolase family 19 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705706.1 protein_id gnl|my_center|LOCUS_22040 20227 19946 gene locus_tag LOCUS_22050 20227 19946 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226307.1 protein_id gnl|my_center|LOCUS_22050 20609 20214 gene locus_tag LOCUS_22060 20609 20214 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294876.1 protein_id gnl|my_center|LOCUS_22060 >Feature sequence37 1008 2696 gene locus_tag LOCUS_22070 gene ilvB 1008 2696 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168480.1 protein_id gnl|my_center|LOCUS_22070 2700 2990 gene locus_tag LOCUS_22080 gene ilvN 2700 2990 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181706.1 protein_id gnl|my_center|LOCUS_22080 3065 3655 gene locus_tag LOCUS_22090 gene uhpA 3065 3655 CDS product transcriptional regulator UhpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633668.1 protein_id gnl|my_center|LOCUS_22090 3655 5157 gene locus_tag LOCUS_22100 gene uhpB 3655 5157 CDS product signal transduction histidine-protein kinase/phosphatase UhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001330988.1 protein_id gnl|my_center|LOCUS_22100 5167 6486 gene locus_tag LOCUS_22110 gene uhpC 5167 6486 CDS product MFS transporter family glucose-6-phosphate receptor UhpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001358267.1 protein_id gnl|my_center|LOCUS_22110 6624 8015 gene locus_tag LOCUS_22120 gene uhpT 6624 8015 CDS product hexose-6-phosphate:phosphate antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000879194.1 protein_id gnl|my_center|LOCUS_22120 9826 8060 gene locus_tag LOCUS_22130 gene adeD 9826 8060 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065695.1 protein_id gnl|my_center|LOCUS_22130 10001 11335 gene locus_tag LOCUS_22140 gene adeQ 10001 11335 CDS product adenine permease AdeQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349999.1 protein_id gnl|my_center|LOCUS_22140 11388 11840 gene locus_tag LOCUS_22150 11388 11840 CDS product DUF1198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295241.1 protein_id gnl|my_center|LOCUS_22150 12051 13241 gene locus_tag LOCUS_22160 gene nepI 12051 13241 CDS product purine ribonucleoside efflux pump NepI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288549.1 protein_id gnl|my_center|LOCUS_22160 13575 13282 gene locus_tag LOCUS_22170 gene yicS 13575 13282 CDS product protein YicS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805509.1 protein_id gnl|my_center|LOCUS_22170 13797 14615 gene locus_tag LOCUS_22180 gene nlpA 13797 14615 CDS product lipoprotein NlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000779426.1 protein_id gnl|my_center|LOCUS_22180 15542 14619 gene locus_tag LOCUS_22190 15542 14619 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535960.1 protein_id gnl|my_center|LOCUS_22190 16837 15653 gene locus_tag LOCUS_22200 16837 15653 CDS product sugar efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172876.1 protein_id gnl|my_center|LOCUS_22200 17863 17633 gene locus_tag LOCUS_22210 17863 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence38 1083 103 gene locus_tag LOCUS_22220 1083 103 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001349546.1 protein_id gnl|my_center|LOCUS_22220 1101 1805 gene locus_tag LOCUS_22230 gene yggS 1101 1805 CDS product pyridoxal phosphate homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000997795.1 protein_id gnl|my_center|LOCUS_22230 1823 2389 gene locus_tag LOCUS_22240 gene yggT 1823 2389 CDS product osmotic shock tolerance protein YggT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094831.1 protein_id gnl|my_center|LOCUS_22240 2386 2676 gene locus_tag LOCUS_22250 gene yggU 2386 2676 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001313260.1 protein_id gnl|my_center|LOCUS_22250 2684 3277 gene locus_tag LOCUS_22260 2684 3277 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174743.1 protein_id gnl|my_center|LOCUS_22260 3270 4406 gene locus_tag LOCUS_22270 gene hemW 3270 4406 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239939.1 protein_id gnl|my_center|LOCUS_22270 5568 4561 gene locus_tag LOCUS_22280 5568 4561 CDS product DUF1202 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745217.1 protein_id gnl|my_center|LOCUS_22280 6731 5685 gene locus_tag LOCUS_22290 gene ansB 6731 5685 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394125.1 protein_id gnl|my_center|LOCUS_22290 7626 6907 gene locus_tag LOCUS_22300 7626 6907 CDS product DUF2884 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984796.1 protein_id gnl|my_center|LOCUS_22300 8136 7810 gene locus_tag LOCUS_22310 8136 7810 CDS product YggL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107564.1 protein_id gnl|my_center|LOCUS_22310 8855 8136 gene locus_tag LOCUS_22320 gene trmB 8855 8136 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786911.1 protein_id gnl|my_center|LOCUS_22320 9016 10068 gene locus_tag LOCUS_22330 gene mutY 9016 10068 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001321419.1 protein_id gnl|my_center|LOCUS_22330 10096 10371 gene locus_tag LOCUS_22340 10096 10371 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091700.1 protein_id gnl|my_center|LOCUS_22340 10433 11515 gene locus_tag LOCUS_22350 gene mltC 10433 11515 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760323.1 protein_id gnl|my_center|LOCUS_22350 11717 12973 gene locus_tag LOCUS_22360 gene nupG 11717 12973 CDS product nucleoside permease NupG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333541.1 protein_id gnl|my_center|LOCUS_22360 15149 13023 gene locus_tag LOCUS_22370 gene speC 15149 13023 CDS product ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839815.1 protein_id gnl|my_center|LOCUS_22370 15556 16263 gene locus_tag LOCUS_22380 15556 16263 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234514.1 protein_id gnl|my_center|LOCUS_22380 16369 16444 gene locus_tag LOCUS_t00300 16369 16444 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 697 464 gene locus_tag LOCUS_22390 697 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124181.1 protein_id gnl|my_center|LOCUS_22390 958 800 gene locus_tag LOCUS_22400 958 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22400 1268 993 gene locus_tag LOCUS_22410 1268 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22410 2906 1998 gene locus_tag LOCUS_22420 2906 1998 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024633.1 protein_id gnl|my_center|LOCUS_22420 3033 4391 gene locus_tag LOCUS_22430 3033 4391 CDS product aromatic acid/H+ symport family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194233.1 protein_id gnl|my_center|LOCUS_22430 4403 5431 gene locus_tag LOCUS_22440 gene gtdA 4403 5431 CDS product gentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000131688.1 protein_id gnl|my_center|LOCUS_22440 5447 6148 gene locus_tag LOCUS_22450 5447 6148 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196038.1 protein_id gnl|my_center|LOCUS_22450 6154 6801 gene locus_tag LOCUS_22460 gene maiA 6154 6801 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781198.1 protein_id gnl|my_center|LOCUS_22460 6816 8009 gene locus_tag LOCUS_22470 6816 8009 CDS product 3-hydroxybenzoate 6-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170147.1 protein_id gnl|my_center|LOCUS_22470 8359 8499 gene locus_tag LOCUS_22480 8359 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 8863 8741 gene locus_tag LOCUS_22490 8863 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 9192 9881 gene locus_tag LOCUS_22500 9192 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 11617 11027 gene locus_tag LOCUS_22510 11617 11027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 11770 11639 gene locus_tag LOCUS_22520 11770 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22520 11848 12012 gene locus_tag LOCUS_22530 11848 12012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 12430 12978 gene locus_tag LOCUS_22540 12430 12978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence40 541 68 gene locus_tag LOCUS_22550 gene mobB 541 68 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907641.1 protein_id gnl|my_center|LOCUS_22550 1122 538 gene locus_tag LOCUS_22560 gene mobA 1122 538 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052174.1 protein_id gnl|my_center|LOCUS_22560 1192 1461 gene locus_tag LOCUS_22570 1192 1461 CDS product YihD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295263.1 protein_id gnl|my_center|LOCUS_22570 1538 2524 gene locus_tag LOCUS_22580 gene srkA 1538 2524 CDS product stress response kinase SrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065520.1 protein_id gnl|my_center|LOCUS_22580 2541 3167 gene locus_tag LOCUS_22590 gene dsbA 2541 3167 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725337.1 protein_id gnl|my_center|LOCUS_22590 3322 4752 gene locus_tag LOCUS_22600 3322 4752 CDS product YdgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001333507.1 protein_id gnl|my_center|LOCUS_22600 5536 4793 gene locus_tag LOCUS_22610 5536 4793 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303740.1 protein_id gnl|my_center|LOCUS_22610 5571 5789 gene locus_tag LOCUS_22620 5571 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 6030 5845 gene locus_tag LOCUS_22630 6030 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010556.1 protein_id gnl|my_center|LOCUS_22630 6089 8875 gene locus_tag LOCUS_22640 gene polA 6089 8875 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250006.1 protein_id gnl|my_center|LOCUS_22640 9889 9257 gene locus_tag LOCUS_22650 gene yihA 9889 9257 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183349.1 protein_id gnl|my_center|LOCUS_22650 10471 10980 gene locus_tag LOCUS_22660 gene yihI 10471 10980 CDS product Der GTPase-activating protein YihI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295266.1 protein_id gnl|my_center|LOCUS_22660 11169 12542 gene locus_tag LOCUS_22670 gene hemN 11169 12542 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116090.1 protein_id gnl|my_center|LOCUS_22670 >Feature sequence41 246 458 gene locus_tag LOCUS_22680 gene hokA 246 458 CDS product type I toxin-antitoxin system toxin HokA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303715.1 protein_id gnl|my_center|LOCUS_22680 858 646 gene locus_tag LOCUS_22690 gene cspA 858 646 CDS product RNA chaperone/antiterminator CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014594.1 protein_id gnl|my_center|LOCUS_22690 1429 1139 gene locus_tag LOCUS_22700 1429 1139 CDS product HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455798.1 protein_id gnl|my_center|LOCUS_22700 1863 2573 gene locus_tag LOCUS_22710 1863 2573 CDS product DUF3053 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602794.1 protein_id gnl|my_center|LOCUS_22710 3597 2623 gene locus_tag LOCUS_22720 gene ghrB 3597 2623 CDS product glyoxylate/hydroxypyruvate reductase GhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805027.1 protein_id gnl|my_center|LOCUS_22720 4360 3701 gene locus_tag LOCUS_22730 4360 3701 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747625.1 protein_id gnl|my_center|LOCUS_22730 4567 6846 gene locus_tag LOCUS_22740 gene bisC 4567 6846 CDS product biotin sulfoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013914.1 protein_id gnl|my_center|LOCUS_22740 7255 6815 gene locus_tag LOCUS_22750 7255 6815 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617478.1 protein_id gnl|my_center|LOCUS_22750 7815 7252 gene locus_tag LOCUS_22760 gene tag 7815 7252 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438953.1 protein_id gnl|my_center|LOCUS_22760 7973 8671 gene locus_tag LOCUS_22770 7973 8671 CDS product autotransporter outer membrane beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296791.1 protein_id gnl|my_center|LOCUS_22770 8900 10108 gene locus_tag LOCUS_22780 8900 10108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189020.1 protein_id gnl|my_center|LOCUS_22780 10432 12123 gene locus_tag LOCUS_22790 gene eptB 10432 12123 CDS product kdo(2)-lipid A phosphoethanolamine 7''-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269228.1 protein_id gnl|my_center|LOCUS_22790 12215 12291 gene locus_tag LOCUS_t00310 12215 12291 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence42 966 82 gene locus_tag LOCUS_22800 gene yghA 966 82 CDS product NADP(+)-dependent aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018760.1 protein_id gnl|my_center|LOCUS_22800 1157 1651 gene locus_tag LOCUS_22810 1157 1651 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439331.1 protein_id gnl|my_center|LOCUS_22810 2731 1691 gene locus_tag LOCUS_22820 gene gpr 2731 1691 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262150.1 protein_id gnl|my_center|LOCUS_22820 2888 3775 gene locus_tag LOCUS_22830 gene yghX 2888 3775 CDS product YghX family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297303.1 protein_id gnl|my_center|LOCUS_22830 3894 4181 gene locus_tag LOCUS_22840 gene yghW 3894 4181 CDS product DUF2623 family protein YghW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059136.1 protein_id gnl|my_center|LOCUS_22840 4370 5488 gene locus_tag LOCUS_22850 gene hybO 4370 5488 CDS product hydrogenase 2 small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145410.1 protein_id gnl|my_center|LOCUS_22850 5491 6477 gene locus_tag LOCUS_22860 gene hybA 5491 6477 CDS product hydrogenase 2 operon protein HybA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081870.1 protein_id gnl|my_center|LOCUS_22860 6467 7645 gene locus_tag LOCUS_22870 gene hybB 6467 7645 CDS product Ni/Fe-hydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017703.1 protein_id gnl|my_center|LOCUS_22870 7642 9345 gene locus_tag LOCUS_22880 gene hybC 7642 9345 CDS product hydrogenase 2 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083065.1 protein_id gnl|my_center|LOCUS_22880 9345 9839 gene locus_tag LOCUS_22890 9345 9839 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221953.1 protein_id gnl|my_center|LOCUS_22890 9832 10320 gene locus_tag LOCUS_22900 gene hybE 9832 10320 CDS product hydrogenase-2 assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134014.1 protein_id gnl|my_center|LOCUS_22900 10313 10654 gene locus_tag LOCUS_22910 gene hypA 10313 10654 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544953.1 protein_id gnl|my_center|LOCUS_22910 10667 10915 gene locus_tag LOCUS_22920 gene hybG 10667 10915 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334896.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence43 532 179 gene locus_tag LOCUS_22930 532 179 CDS product DUF4156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558209.1 protein_id gnl|my_center|LOCUS_22930 2298 670 gene locus_tag LOCUS_22940 gene groL 2298 670 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729117.1 protein_id gnl|my_center|LOCUS_22940 2635 2342 gene locus_tag LOCUS_22950 2635 2342 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026276.1 protein_id gnl|my_center|LOCUS_22950 2911 4167 gene locus_tag LOCUS_22960 gene yjeH 2911 4167 CDS product L-methionine/branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000015837.1 protein_id gnl|my_center|LOCUS_22960 4659 4183 gene locus_tag LOCUS_22970 gene fxsA 4659 4183 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001267448.1 protein_id gnl|my_center|LOCUS_22970 4996 6432 gene locus_tag LOCUS_22980 gene aspA 4996 6432 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069437.1 protein_id gnl|my_center|LOCUS_22980 6550 7851 gene locus_tag LOCUS_22990 gene dcuA 6550 7851 CDS product anaerobic C4-dicarboxylate transporter DcuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000961959.1 protein_id gnl|my_center|LOCUS_22990 7967 8305 gene locus_tag LOCUS_23000 gene cutA 7967 8305 CDS product divalent cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883400.1 protein_id gnl|my_center|LOCUS_23000 8281 9978 gene locus_tag LOCUS_23010 gene dsbD 8281 9978 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068978.1 protein_id gnl|my_center|LOCUS_23010 10015 10590 gene locus_tag LOCUS_23020 10015 10590 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188520.1 protein_id gnl|my_center|LOCUS_23020 10697 10772 gene locus_tag LOCUS_t00320 10697 10772 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence44 157 1416 gene locus_tag LOCUS_23030 gene codB 157 1416 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076236.1 protein_id gnl|my_center|LOCUS_23030 1406 2689 gene locus_tag LOCUS_23040 gene codA 1406 2689 CDS product cytosine/isoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309292.1 protein_id gnl|my_center|LOCUS_23040 3628 2729 gene locus_tag LOCUS_23050 gene cynR 3628 2729 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952470.1 protein_id gnl|my_center|LOCUS_23050 3738 4397 gene locus_tag LOCUS_23060 gene cynT 3738 4397 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658652.1 protein_id gnl|my_center|LOCUS_23060 4428 4898 gene locus_tag LOCUS_23070 gene cynS 4428 4898 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616241.1 protein_id gnl|my_center|LOCUS_23070 4931 6085 gene locus_tag LOCUS_23080 gene cynX 4931 6085 CDS product cyanate transporter CynX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000927955.1 protein_id gnl|my_center|LOCUS_23080 7417 6164 gene locus_tag LOCUS_23090 gene lacY 7417 6164 CDS product lactose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291549.1 protein_id gnl|my_center|LOCUS_23090 <10388 7469 gene locus_tag LOCUS_23100 <10388 7469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000177906.1:beta-galactosidase >Feature sequence45 <1 564 gene locus_tag LOCUS_23110 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000044314.1:acetaldehyde dehydrogenase 561 1574 gene locus_tag LOCUS_23120 gene dmpG 561 1574 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013499.1 protein_id gnl|my_center|LOCUS_23120 1750 2961 gene locus_tag LOCUS_23130 gene mhpT 1750 2961 CDS product 3-(3-hydroxy-phenyl)propionate transporter MhpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107624.1 protein_id gnl|my_center|LOCUS_23130 3063 3602 gene locus_tag LOCUS_23140 3063 3602 CDS product DUF2058 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096705.1 protein_id gnl|my_center|LOCUS_23140 4660 3827 gene locus_tag LOCUS_23150 gene fghA 4660 3827 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000419049.1 protein_id gnl|my_center|LOCUS_23150 5862 4753 gene locus_tag LOCUS_23160 gene frmA 5862 4753 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842102.1 protein_id gnl|my_center|LOCUS_23160 6172 5897 gene locus_tag LOCUS_23170 gene frmR 6172 5897 CDS product formaldehyde-responsive transcriptional repressor FrmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141271.1 protein_id gnl|my_center|LOCUS_23170 7130 6357 gene locus_tag LOCUS_23180 7130 6357 CDS product YaiO family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000596085.1 protein_id gnl|my_center|LOCUS_23180 7572 7132 gene locus_tag LOCUS_23190 7572 7132 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088545487.1 protein_id gnl|my_center|LOCUS_23190 8887 7691 gene locus_tag LOCUS_23200 8887 7691 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860444.1 protein_id gnl|my_center|LOCUS_23200 9514 8897 gene locus_tag LOCUS_23210 9514 8897 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362029.1 protein_id gnl|my_center|LOCUS_23210 >Feature sequence46 754 2361 gene locus_tag LOCUS_23220 gene dppA 754 2361 CDS product dipeptide ABC transporter substrate-binding protein DppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222883.1 protein_id gnl|my_center|LOCUS_23220 2512 3531 gene locus_tag LOCUS_23230 gene dppB 2512 3531 CDS product dipeptide ABC transporter permease DppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938855.1 protein_id gnl|my_center|LOCUS_23230 3541 4443 gene locus_tag LOCUS_23240 gene dppC 3541 4443 CDS product dipeptide ABC transporter permease DppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084677.1 protein_id gnl|my_center|LOCUS_23240 4454 5437 gene locus_tag LOCUS_23250 gene dppD 4454 5437 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196486.1 protein_id gnl|my_center|LOCUS_23250 5434 6438 gene locus_tag LOCUS_23260 gene dppF 5434 6438 CDS product dipeptide ABC transporter ATP-binding subunit DppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107024.1 protein_id gnl|my_center|LOCUS_23260 7739 6468 gene locus_tag LOCUS_23270 7739 6468 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307456.1 protein_id gnl|my_center|LOCUS_23270 8155 8322 gene locus_tag LOCUS_23280 8155 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23280 >Feature sequence47 238 756 gene locus_tag LOCUS_23290 238 756 CDS product YfiR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212391.1 protein_id gnl|my_center|LOCUS_23290 746 1972 gene locus_tag LOCUS_23300 gene dgcN 746 1972 CDS product diguanylate cyclase DgcN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969032.1 protein_id gnl|my_center|LOCUS_23300 1988 2470 gene locus_tag LOCUS_23310 1988 2470 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589828.1 protein_id gnl|my_center|LOCUS_23310 2894 2547 gene locus_tag LOCUS_23320 gene rplS 2894 2547 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065253.1 protein_id gnl|my_center|LOCUS_23320 3703 2936 gene locus_tag LOCUS_23330 gene trmD 3703 2936 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264777.1 protein_id gnl|my_center|LOCUS_23330 4282 3734 gene locus_tag LOCUS_23340 gene rimM 4282 3734 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_23340 4549 4301 gene locus_tag LOCUS_23350 gene rpsP 4549 4301 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256450.1 protein_id gnl|my_center|LOCUS_23350 6159 4798 gene locus_tag LOCUS_23360 gene ffh 6159 4798 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460035.1 protein_id gnl|my_center|LOCUS_23360 6508 6272 gene locus_tag LOCUS_23370 6508 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 6422 7117 gene locus_tag LOCUS_23380 6422 7117 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001338897.1 protein_id gnl|my_center|LOCUS_23380 7162 8424 gene locus_tag LOCUS_23390 7162 8424 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010723175.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence48 773 201 gene locus_tag LOCUS_23400 gene gmhB 773 201 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140174.1 protein_id gnl|my_center|LOCUS_23400 961 1992 gene locus_tag LOCUS_23410 gene metN 961 1992 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593994.1 protein_id gnl|my_center|LOCUS_23410 1985 2638 gene locus_tag LOCUS_23420 1985 2638 CDS product methionine ABC transporter permease MetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294600.1 protein_id gnl|my_center|LOCUS_23420 2678 3493 gene locus_tag LOCUS_23430 gene metQ 2678 3493 CDS product methionine ABC transporter substrate-binding lipoprotein MetQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874224.1 protein_id gnl|my_center|LOCUS_23430 3611 4015 gene locus_tag LOCUS_23440 gene rcsF 3611 4015 CDS product Rcs stress response system protein RcsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202329.1 protein_id gnl|my_center|LOCUS_23440 4012 4719 gene locus_tag LOCUS_23450 4012 4719 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000094011.1 protein_id gnl|my_center|LOCUS_23450 4831 6549 gene locus_tag LOCUS_23460 gene proS 4831 6549 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260712.1 protein_id gnl|my_center|LOCUS_23460 6603 7184 gene locus_tag LOCUS_23470 6603 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23470 7190 7426 gene locus_tag LOCUS_23480 7190 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23480 >Feature sequence49 179 51 gene locus_tag LOCUS_23490 179 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 649 344 gene locus_tag LOCUS_23500 649 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 1847 756 gene locus_tag LOCUS_23510 gene lacI 1847 756 CDS product DNA-binding transcriptional repressor LacI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001307621.1 protein_id gnl|my_center|LOCUS_23510 2748 1915 gene locus_tag LOCUS_23520 2748 1915 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303819.1 protein_id gnl|my_center|LOCUS_23520 2939 4603 gene locus_tag LOCUS_23530 2939 4603 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007420.1 protein_id gnl|my_center|LOCUS_23530 4605 5549 gene locus_tag LOCUS_23540 gene mhpB 4605 5549 CDS product 3-carboxyethylcatechol 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543457.1 protein_id gnl|my_center|LOCUS_23540 5567 6433 gene locus_tag LOCUS_23550 gene mhpC 5567 6433 CDS product 2-hydroxy-6-oxonona-2,4-dienedioate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121898.1 protein_id gnl|my_center|LOCUS_23550 6443 7252 gene locus_tag LOCUS_23560 gene mhpD 6443 7252 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160710.1 protein_id gnl|my_center|LOCUS_23560 >Feature sequence50 541 466 gene locus_tag LOCUS_t00330 541 466 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 622 548 gene locus_tag LOCUS_t00340 622 548 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 823 739 gene locus_tag LOCUS_t00350 823 739 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 907 832 gene locus_tag LOCUS_t00360 907 832 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1293 2219 gene locus_tag LOCUS_23570 gene coaA 1293 2219 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023081.1 protein_id gnl|my_center|LOCUS_23570 3213 2248 gene locus_tag LOCUS_23580 gene birA 3213 2248 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654614.1 protein_id gnl|my_center|LOCUS_23580 4238 3210 gene locus_tag LOCUS_23590 gene murB 4238 3210 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016695.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence51 <1 676 gene locus_tag LOCUS_23600 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000030657.1:cell envelope integrity protein TolA 809 2101 gene locus_tag LOCUS_23610 gene tolB 809 2101 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295307.1 protein_id gnl|my_center|LOCUS_23610 2136 2657 gene locus_tag LOCUS_23620 gene pal 2136 2657 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295306.1 protein_id gnl|my_center|LOCUS_23620 2667 3458 gene locus_tag LOCUS_23630 gene cpoB 2667 3458 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097580.1 protein_id gnl|my_center|LOCUS_23630 3623 3698 gene locus_tag LOCUS_t00370 3623 3698 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3834 3909 gene locus_tag LOCUS_t00380 3834 3909 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3912 3987 gene locus_tag LOCUS_t00390 3912 3987 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4137 4212 gene locus_tag LOCUS_t00400 4137 4212 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4216 4291 gene locus_tag LOCUS_t00410 4216 4291 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4438 4513 gene locus_tag LOCUS_t00420 4438 4513 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence52 409 1296 gene locus_tag LOCUS_23640 409 1296 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006983.1 protein_id gnl|my_center|LOCUS_23640 1364 1726 gene locus_tag LOCUS_23650 1364 1726 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816883.1 protein_id gnl|my_center|LOCUS_23650 1735 3093 gene locus_tag LOCUS_23660 1735 3093 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573503.1 protein_id gnl|my_center|LOCUS_23660 3109 4215 gene locus_tag LOCUS_23670 3109 4215 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence53 409 1287 gene locus_tag LOCUS_23680 409 1287 CDS product phosphotriesterase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007011.1 protein_id gnl|my_center|LOCUS_23680 1298 1651 gene locus_tag LOCUS_23690 1298 1651 CDS product DUF2620 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297518.1 protein_id gnl|my_center|LOCUS_23690 1663 2967 gene locus_tag LOCUS_23700 1663 2967 CDS product YhfT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366862.1 protein_id gnl|my_center|LOCUS_23700 2979 4064 gene locus_tag LOCUS_23710 2979 4064 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847144.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence54 <2470 1217 gene locus_tag LOCUS_23720 <2470 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001297242.1:ornithine decarboxylase SpeF >Feature sequence55 616 230 gene locus_tag LOCUS_23730 616 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 <1831 613 gene locus_tag LOCUS_23740 <1831 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098820.1:contact-dependent inhibition effector 16S rRNA endonuclease