>Feature sequence001 <1 523 gene locus_tag LOCUS_00010 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080208.1:metal-dependent hydrolase 2189 678 gene locus_tag LOCUS_00020 2189 678 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_00020 2666 2208 gene locus_tag LOCUS_00030 2666 2208 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903082.1 protein_id gnl|my_center|LOCUS_00030 3839 2832 gene locus_tag LOCUS_00040 3839 2832 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494482.1 protein_id gnl|my_center|LOCUS_00040 4832 4071 gene locus_tag LOCUS_00050 gene rncS 4832 4071 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_00050 6088 4838 gene locus_tag LOCUS_00060 gene fabF 6088 4838 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412656.1 protein_id gnl|my_center|LOCUS_00060 7126 6170 gene locus_tag LOCUS_00070 7126 6170 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_00070 7455 7222 gene locus_tag LOCUS_00080 gene acpP 7455 7222 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_00080 8250 7504 gene locus_tag LOCUS_00090 gene fabG 8250 7504 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_00090 9226 8252 gene locus_tag LOCUS_00100 gene fabD 9226 8252 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_00100 10256 9267 gene locus_tag LOCUS_00110 10256 9267 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_00110 11334 10303 gene locus_tag LOCUS_00120 gene plsX 11334 10303 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_00120 11905 11342 gene locus_tag LOCUS_00130 gene fapR 11905 11342 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774378.1 protein_id gnl|my_center|LOCUS_00130 12237 12058 gene locus_tag LOCUS_00140 gene rpmF 12237 12058 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_00140 12772 12269 gene locus_tag LOCUS_00150 12772 12269 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_00150 12971 14233 gene locus_tag LOCUS_00160 12971 14233 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869853.1 protein_id gnl|my_center|LOCUS_00160 15055 14414 gene locus_tag LOCUS_00170 15055 14414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140850.1 protein_id gnl|my_center|LOCUS_00170 15650 15159 gene locus_tag LOCUS_00180 gene coaD 15650 15159 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388467.1 protein_id gnl|my_center|LOCUS_00180 16228 15704 gene locus_tag LOCUS_00190 gene rsmD 16228 15704 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_00190 17602 16472 gene locus_tag LOCUS_00200 17602 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 18156 17605 gene locus_tag LOCUS_00210 18156 17605 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080601.1 protein_id gnl|my_center|LOCUS_00210 20309 18153 gene locus_tag LOCUS_00220 20309 18153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20694 20618 gene locus_tag LOCUS_t00010 20694 20618 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22084 20780 gene locus_tag LOCUS_00230 gene brnQ 22084 20780 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246136.1 protein_id gnl|my_center|LOCUS_00230 23463 22243 gene locus_tag LOCUS_00240 gene tyrS 23463 22243 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367412.1 protein_id gnl|my_center|LOCUS_00240 23764 24099 gene locus_tag LOCUS_00250 23764 24099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24233 24309 gene locus_tag LOCUS_t00020 24233 24309 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24969 24583 gene locus_tag LOCUS_00260 24969 24583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25221 24979 gene locus_tag LOCUS_00270 25221 24979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25803 25225 gene locus_tag LOCUS_00280 25803 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26354 25803 gene locus_tag LOCUS_00290 26354 25803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30821 26442 gene locus_tag LOCUS_00300 30821 26442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 40121 31131 gene locus_tag LOCUS_00310 40121 31131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 42271 40133 gene locus_tag LOCUS_00320 42271 40133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 42948 42277 gene locus_tag LOCUS_00330 42948 42277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 43415 42936 gene locus_tag LOCUS_00340 43415 42936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 45678 43408 gene locus_tag LOCUS_00350 45678 43408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46265 45681 gene locus_tag LOCUS_00360 46265 45681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 46732 46328 gene locus_tag LOCUS_00370 46732 46328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47742 46756 gene locus_tag LOCUS_00380 47742 46756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123829849.1 protein_id gnl|my_center|LOCUS_00380 48456 47764 gene locus_tag LOCUS_00390 48456 47764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48762 48463 gene locus_tag LOCUS_00400 48762 48463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50458 48764 gene locus_tag LOCUS_00410 50458 48764 CDS product portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039455.1 protein_id gnl|my_center|LOCUS_00410 50684 50451 gene locus_tag LOCUS_00420 50684 50451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 52022 50697 gene locus_tag LOCUS_00430 52022 50697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52459 52019 gene locus_tag LOCUS_00440 52459 52019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53010 52630 gene locus_tag LOCUS_00450 53010 52630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54119 53121 gene locus_tag LOCUS_00460 54119 53121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54845 54318 gene locus_tag LOCUS_00470 54845 54318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 55071 54847 gene locus_tag LOCUS_00480 55071 54847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56122 55064 gene locus_tag LOCUS_00490 56122 55064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56408 56115 gene locus_tag LOCUS_00500 56408 56115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56679 56374 gene locus_tag LOCUS_00510 56679 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56969 56676 gene locus_tag LOCUS_00520 56969 56676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57202 56981 gene locus_tag LOCUS_00530 57202 56981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 57564 57295 gene locus_tag LOCUS_00540 57564 57295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 57860 57561 gene locus_tag LOCUS_00550 57860 57561 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_00550 58084 57857 gene locus_tag LOCUS_00560 58084 57857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58274 58053 gene locus_tag LOCUS_00570 58274 58053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 58450 58268 gene locus_tag LOCUS_00580 58450 58268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 58588 58791 gene locus_tag LOCUS_00590 58588 58791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 59165 58788 gene locus_tag LOCUS_00600 59165 58788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 59240 59440 gene locus_tag LOCUS_00610 59240 59440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 59631 59431 gene locus_tag LOCUS_00620 59631 59431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 60303 59635 gene locus_tag LOCUS_00630 60303 59635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 60546 60307 gene locus_tag LOCUS_00640 60546 60307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 60805 60566 gene locus_tag LOCUS_00650 60805 60566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 60991 61401 gene locus_tag LOCUS_00660 60991 61401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 61521 62528 gene locus_tag LOCUS_00670 61521 62528 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_00670 62569 63072 gene locus_tag LOCUS_00680 62569 63072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 63607 63122 gene locus_tag LOCUS_00690 63607 63122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 64221 63610 gene locus_tag LOCUS_00700 64221 63610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 64980 64234 gene locus_tag LOCUS_00710 64980 64234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 65276 66484 gene locus_tag LOCUS_00720 65276 66484 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124712897.1 protein_id gnl|my_center|LOCUS_00720 66844 67155 gene locus_tag LOCUS_00730 66844 67155 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_00730 67321 67737 gene locus_tag LOCUS_00740 67321 67737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 67822 68136 gene locus_tag LOCUS_00750 67822 68136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 69189 68245 gene locus_tag LOCUS_00760 69189 68245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 69602 69186 gene locus_tag LOCUS_00770 69602 69186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 70099 69701 gene locus_tag LOCUS_00780 70099 69701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 71038 70178 gene locus_tag LOCUS_00790 71038 70178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 71993 71121 gene locus_tag LOCUS_00800 71993 71121 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841777.1 protein_id gnl|my_center|LOCUS_00800 72395 72054 gene locus_tag LOCUS_00810 72395 72054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 72689 72429 gene locus_tag LOCUS_00820 72689 72429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 73932 72931 gene locus_tag LOCUS_00830 73932 72931 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_00830 74723 74061 gene locus_tag LOCUS_00840 74723 74061 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_00840 74893 75996 gene locus_tag LOCUS_00850 74893 75996 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858929.1 protein_id gnl|my_center|LOCUS_00850 76185 76535 gene locus_tag LOCUS_tm00010 76185 76535 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 77327 76614 gene locus_tag LOCUS_00860 77327 76614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 77598 78314 gene locus_tag LOCUS_00870 77598 78314 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_00870 78317 79075 gene locus_tag LOCUS_00880 78317 79075 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_00880 79307 80134 gene locus_tag LOCUS_00890 79307 80134 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_00890 81797 80334 gene locus_tag LOCUS_00900 81797 80334 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_00900 82391 81822 gene locus_tag LOCUS_00910 82391 81822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 83094 82609 gene locus_tag LOCUS_00920 83094 82609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 83379 83221 gene locus_tag LOCUS_00930 83379 83221 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392798.1 protein_id gnl|my_center|LOCUS_00930 85432 83573 gene locus_tag LOCUS_00940 85432 83573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 86243 85506 gene locus_tag LOCUS_00950 86243 85506 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_00950 86809 86339 gene locus_tag LOCUS_00960 gene smpB 86809 86339 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_00960 89365 86888 gene locus_tag LOCUS_00970 gene rnr 89365 86888 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391084.1 protein_id gnl|my_center|LOCUS_00970 89983 89474 gene locus_tag LOCUS_00980 89983 89474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 90917 90096 gene locus_tag LOCUS_00990 90917 90096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 91486 90998 gene locus_tag LOCUS_01000 91486 90998 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015698.1 protein_id gnl|my_center|LOCUS_01000 93061 91805 gene locus_tag LOCUS_01010 93061 91805 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888596.1 protein_id gnl|my_center|LOCUS_01010 93170 94066 gene locus_tag LOCUS_01020 93170 94066 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_01020 94324 95799 gene locus_tag LOCUS_01030 94324 95799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 96577 95951 gene locus_tag LOCUS_01040 96577 95951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 97128 96727 gene locus_tag LOCUS_01050 97128 96727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 97269 97144 gene locus_tag LOCUS_01060 97269 97144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 99549 97519 gene locus_tag LOCUS_01070 99549 97519 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_01070 99911 99681 gene locus_tag LOCUS_01080 99911 99681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 101433 100141 gene locus_tag LOCUS_01090 gene eno 101433 100141 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_01090 103054 101504 gene locus_tag LOCUS_01100 gene gpmI 103054 101504 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_01100 105004 103079 gene locus_tag LOCUS_01110 105004 103079 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_01110 106093 105089 gene locus_tag LOCUS_01120 gene gap 106093 105089 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811691.1 protein_id gnl|my_center|LOCUS_01120 106932 106441 gene locus_tag LOCUS_01130 gene queF 106932 106441 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_01130 107469 106957 gene locus_tag LOCUS_01140 107469 106957 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_01140 107950 107840 gene locus_tag LOCUS_r00010 107950 107840 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence002 4190 459 gene locus_tag LOCUS_01150 4190 459 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_01150 4928 4209 gene locus_tag LOCUS_01160 4928 4209 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811443.1 protein_id gnl|my_center|LOCUS_01160 6671 4959 gene locus_tag LOCUS_01170 6671 4959 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_01170 7742 6675 gene locus_tag LOCUS_01180 gene ispG 7742 6675 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_01180 8859 7840 gene locus_tag LOCUS_01190 gene rseP 8859 7840 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_01190 10149 8962 gene locus_tag LOCUS_01200 10149 8962 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_01200 11032 10202 gene locus_tag LOCUS_01210 11032 10202 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460414.1 protein_id gnl|my_center|LOCUS_01210 11883 11098 gene locus_tag LOCUS_01220 11883 11098 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_01220 12135 11959 gene locus_tag LOCUS_01230 12135 11959 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_01230 12346 12125 gene locus_tag LOCUS_01240 12346 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 12915 12352 gene locus_tag LOCUS_01250 gene frr 12915 12352 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_01250 13643 12915 gene locus_tag LOCUS_01260 gene pyrH 13643 12915 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_01260 14678 13797 gene locus_tag LOCUS_01270 gene tsf 14678 13797 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_01270 15545 14802 gene locus_tag LOCUS_01280 gene rpsB 15545 14802 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460417.1 protein_id gnl|my_center|LOCUS_01280 17208 15706 gene locus_tag LOCUS_01290 gene thrC 17208 15706 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_01290 17537 19453 gene locus_tag LOCUS_01300 17537 19453 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205965.1 protein_id gnl|my_center|LOCUS_01300 19457 20005 gene locus_tag LOCUS_01310 19457 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 21081 20137 gene locus_tag LOCUS_01320 gene fabK 21081 20137 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460502.1 protein_id gnl|my_center|LOCUS_01320 21596 21171 gene locus_tag LOCUS_01330 21596 21171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 23175 21622 gene locus_tag LOCUS_01340 23175 21622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 24083 23172 gene locus_tag LOCUS_01350 gene murB 24083 23172 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_01350 24420 24085 gene locus_tag LOCUS_01360 24420 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 25531 24482 gene locus_tag LOCUS_01370 25531 24482 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640453.1 protein_id gnl|my_center|LOCUS_01370 26325 25534 gene locus_tag LOCUS_01380 26325 25534 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232495.1 protein_id gnl|my_center|LOCUS_01380 26954 26379 gene locus_tag LOCUS_01390 26954 26379 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460298.1 protein_id gnl|my_center|LOCUS_01390 28516 26951 gene locus_tag LOCUS_01400 28516 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 29272 28559 gene locus_tag LOCUS_01410 29272 28559 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460434.1 protein_id gnl|my_center|LOCUS_01410 30190 29519 gene locus_tag LOCUS_01420 30190 29519 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_01420 34271 30492 gene locus_tag LOCUS_01430 34271 30492 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_01430 35498 34308 gene locus_tag LOCUS_01440 35498 34308 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_01440 36471 35557 gene locus_tag LOCUS_01450 36471 35557 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_01450 36958 36665 gene locus_tag LOCUS_01460 36958 36665 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461672.1 protein_id gnl|my_center|LOCUS_01460 37940 37341 gene locus_tag LOCUS_01470 gene cobC 37940 37341 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_01470 38876 38013 gene locus_tag LOCUS_01480 38876 38013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 39737 38889 gene locus_tag LOCUS_01490 gene cobS 39737 38889 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_01490 40835 39819 gene locus_tag LOCUS_01500 gene cobT 40835 39819 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541537.1 protein_id gnl|my_center|LOCUS_01500 41477 40905 gene locus_tag LOCUS_01510 gene cobU 41477 40905 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460077.1 protein_id gnl|my_center|LOCUS_01510 41722 41495 gene locus_tag LOCUS_01520 41722 41495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 42553 42023 gene locus_tag LOCUS_01530 42553 42023 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_01530 43228 42812 gene locus_tag LOCUS_01540 gene ndk 43228 42812 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_01540 44151 43375 gene locus_tag LOCUS_01550 gene htpX 44151 43375 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_01550 44807 44373 gene locus_tag LOCUS_01560 44807 44373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 46138 44897 gene locus_tag LOCUS_01570 46138 44897 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 protein_id gnl|my_center|LOCUS_01570 46763 46179 gene locus_tag LOCUS_01580 46763 46179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 47678 46791 gene locus_tag LOCUS_01590 gene xerD 47678 46791 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_01590 48116 47853 gene locus_tag LOCUS_01600 gene hfq 48116 47853 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_01600 49160 48243 gene locus_tag LOCUS_01610 gene miaA 49160 48243 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_01610 49952 49161 gene locus_tag LOCUS_01620 49952 49161 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230795.1 protein_id gnl|my_center|LOCUS_01620 52063 49949 gene locus_tag LOCUS_01630 gene mutL 52063 49949 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297134.1 protein_id gnl|my_center|LOCUS_01630 54794 52179 gene locus_tag LOCUS_01640 gene mutS 54794 52179 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_01640 56422 54905 gene locus_tag LOCUS_01650 gene miaB 56422 54905 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811605.1 protein_id gnl|my_center|LOCUS_01650 57487 56567 gene locus_tag LOCUS_01660 57487 56567 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_01660 58226 57480 gene locus_tag LOCUS_01670 58226 57480 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_01670 58614 58354 gene locus_tag LOCUS_01680 58614 58354 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891710.1 protein_id gnl|my_center|LOCUS_01680 59806 58706 gene locus_tag LOCUS_01690 59806 58706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01690 60115 59861 gene locus_tag LOCUS_01700 60115 59861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 60517 61347 gene locus_tag LOCUS_01710 60517 61347 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_01710 62840 61485 gene locus_tag LOCUS_01720 62840 61485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 64423 62954 gene locus_tag LOCUS_01730 64423 62954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 65230 64520 gene locus_tag LOCUS_01740 65230 64520 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530346.1 protein_id gnl|my_center|LOCUS_01740 65472 66404 gene locus_tag LOCUS_01750 65472 66404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 66692 67204 gene locus_tag LOCUS_01760 66692 67204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 67336 69033 gene locus_tag LOCUS_01770 67336 69033 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681029.1 protein_id gnl|my_center|LOCUS_01770 69052 69852 gene locus_tag LOCUS_01780 gene pdxK 69052 69852 CDS product pyridoxine/pyridoxal/pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174258.1 protein_id gnl|my_center|LOCUS_01780 71127 70084 gene locus_tag LOCUS_01790 71127 70084 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984070.1 protein_id gnl|my_center|LOCUS_01790 71820 71329 gene locus_tag LOCUS_01800 71820 71329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 73389 72184 gene locus_tag LOCUS_01810 73389 72184 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_01810 75043 73541 gene locus_tag LOCUS_01820 75043 73541 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948950.1 protein_id gnl|my_center|LOCUS_01820 76239 75160 gene locus_tag LOCUS_01830 76239 75160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 76733 76356 gene locus_tag LOCUS_01840 76733 76356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 77404 76907 gene locus_tag LOCUS_01850 77404 76907 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_01850 77764 78435 gene locus_tag LOCUS_01860 77764 78435 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811192.1 protein_id gnl|my_center|LOCUS_01860 78404 79714 gene locus_tag LOCUS_01870 gene hemA 78404 79714 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_01870 79686 80606 gene locus_tag LOCUS_01880 gene hemC 79686 80606 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349245.1 protein_id gnl|my_center|LOCUS_01880 80892 82412 gene locus_tag LOCUS_01890 gene cobA 80892 82412 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_01890 82565 83548 gene locus_tag LOCUS_01900 gene hemB 82565 83548 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_01900 83680 84978 gene locus_tag LOCUS_01910 gene hemL 83680 84978 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392758.1 protein_id gnl|my_center|LOCUS_01910 85910 85077 gene locus_tag LOCUS_01920 85910 85077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 86439 85981 gene locus_tag LOCUS_01930 86439 85981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 87065 86787 gene locus_tag LOCUS_01940 87065 86787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01940 87253 87011 gene locus_tag LOCUS_01950 87253 87011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01950 89281 87755 gene locus_tag LOCUS_01960 89281 87755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 90249 89293 gene locus_tag LOCUS_01970 90249 89293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 90630 90451 gene locus_tag LOCUS_01980 90630 90451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 91668 90760 gene locus_tag LOCUS_01990 91668 90760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 92404 92760 gene locus_tag LOCUS_02000 92404 92760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 >Feature sequence003 <1 3036 gene locus_tag LOCUS_02010 <1 3036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980934.1:iron-regulated protein FrpC 3068 3376 gene locus_tag LOCUS_02020 3068 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 3376 3558 gene locus_tag LOCUS_02030 3376 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3627 5972 gene locus_tag LOCUS_02040 3627 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 6012 7295 gene locus_tag LOCUS_02050 6012 7295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 7457 7648 gene locus_tag LOCUS_02060 7457 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 8068 9567 gene locus_tag LOCUS_02070 8068 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9590 10600 gene locus_tag LOCUS_02080 9590 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 10585 11265 gene locus_tag LOCUS_02090 10585 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 11412 11714 gene locus_tag LOCUS_02100 11412 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 11893 12507 gene locus_tag LOCUS_02110 11893 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12998 13831 gene locus_tag LOCUS_02120 12998 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 14053 15210 gene locus_tag LOCUS_02130 14053 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 15261 15917 gene locus_tag LOCUS_02140 15261 15917 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_02140 16053 16829 gene locus_tag LOCUS_02150 16053 16829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 16884 18320 gene locus_tag LOCUS_02160 16884 18320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 18448 18639 gene locus_tag LOCUS_02170 18448 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18755 20077 gene locus_tag LOCUS_02180 18755 20077 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_02180 20301 20516 gene locus_tag LOCUS_02190 20301 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 21144 21425 gene locus_tag LOCUS_02200 21144 21425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 21418 22503 gene locus_tag LOCUS_02210 21418 22503 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533549.1 protein_id gnl|my_center|LOCUS_02210 22700 24241 gene locus_tag LOCUS_02220 22700 24241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 24735 26018 gene locus_tag LOCUS_02230 24735 26018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_02230 26018 26608 gene locus_tag LOCUS_02240 26018 26608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 26714 27058 gene locus_tag LOCUS_02250 26714 27058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 27322 30840 gene locus_tag LOCUS_02260 27322 30840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 30990 31478 gene locus_tag LOCUS_02270 30990 31478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 31478 31984 gene locus_tag LOCUS_02280 31478 31984 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700389.1 protein_id gnl|my_center|LOCUS_02280 32227 33144 gene locus_tag LOCUS_02290 32227 33144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 33195 33271 gene locus_tag LOCUS_t00030 33195 33271 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 34980 33352 gene locus_tag LOCUS_02300 34980 33352 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_02300 35102 36286 gene locus_tag LOCUS_02310 35102 36286 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179313.1 protein_id gnl|my_center|LOCUS_02310 36535 36972 gene locus_tag LOCUS_02320 36535 36972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 37230 39128 gene locus_tag LOCUS_02330 37230 39128 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_02330 40046 39219 gene locus_tag LOCUS_02340 gene amrS 40046 39219 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081949.1 protein_id gnl|my_center|LOCUS_02340 41526 40135 gene locus_tag LOCUS_02350 gene amrA 41526 40135 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964729.1 protein_id gnl|my_center|LOCUS_02350 41748 43574 gene locus_tag LOCUS_02360 41748 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 45572 43851 gene locus_tag LOCUS_02370 45572 43851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 45984 53213 gene locus_tag LOCUS_02380 45984 53213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 54505 53288 gene locus_tag LOCUS_02390 54505 53288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 55499 55170 gene locus_tag LOCUS_02400 55499 55170 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295896.1 protein_id gnl|my_center|LOCUS_02400 56292 55591 gene locus_tag LOCUS_02410 56292 55591 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454563.1 protein_id gnl|my_center|LOCUS_02410 56521 57771 gene locus_tag LOCUS_02420 56521 57771 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_02420 57856 58944 gene locus_tag LOCUS_02430 gene serC 57856 58944 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256881.1 protein_id gnl|my_center|LOCUS_02430 59060 60202 gene locus_tag LOCUS_02440 59060 60202 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761737.1 protein_id gnl|my_center|LOCUS_02440 60307 61269 gene locus_tag LOCUS_02450 60307 61269 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589805.1 protein_id gnl|my_center|LOCUS_02450 61872 61396 gene locus_tag LOCUS_02460 61872 61396 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_02460 61998 63134 gene locus_tag LOCUS_02470 61998 63134 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_02470 64823 63303 gene locus_tag LOCUS_02480 gene ppx 64823 63303 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963940.1 protein_id gnl|my_center|LOCUS_02480 65233 66786 gene locus_tag LOCUS_02490 65233 66786 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814148.1 protein_id gnl|my_center|LOCUS_02490 66783 69080 gene locus_tag LOCUS_02500 66783 69080 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_02500 69227 69532 gene locus_tag LOCUS_02510 69227 69532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 69553 69629 gene locus_tag LOCUS_t00040 69553 69629 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 69945 70187 gene locus_tag LOCUS_02520 69945 70187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 70184 70588 gene locus_tag LOCUS_02530 70184 70588 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_02530 70978 71232 gene locus_tag LOCUS_02540 70978 71232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 71225 71698 gene locus_tag LOCUS_02550 71225 71698 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_02550 72959 72165 gene locus_tag LOCUS_02560 72959 72165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence004 425 1693 gene locus_tag LOCUS_02570 gene murA 425 1693 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_02570 1793 2815 gene locus_tag LOCUS_02580 1793 2815 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393848.1 protein_id gnl|my_center|LOCUS_02580 2973 4316 gene locus_tag LOCUS_02590 2973 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4510 6195 gene locus_tag LOCUS_02600 4510 6195 CDS product SpoIVB peptidase S55 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869562.1 protein_id gnl|my_center|LOCUS_02600 6309 7085 gene locus_tag LOCUS_02610 6309 7085 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_02610 7096 7860 gene locus_tag LOCUS_02620 7096 7860 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_02620 7857 9137 gene locus_tag LOCUS_02630 7857 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9298 10749 gene locus_tag LOCUS_02640 9298 10749 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_02640 11095 15414 gene locus_tag LOCUS_02650 11095 15414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15431 16063 gene locus_tag LOCUS_02660 15431 16063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 16243 16785 gene locus_tag LOCUS_02670 16243 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16887 18860 gene locus_tag LOCUS_02680 16887 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 18887 20143 gene locus_tag LOCUS_02690 18887 20143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 20243 20734 gene locus_tag LOCUS_02700 20243 20734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 20794 21759 gene locus_tag LOCUS_02710 20794 21759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 21811 22218 gene locus_tag LOCUS_02720 21811 22218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 22388 23419 gene locus_tag LOCUS_02730 gene lpxD 22388 23419 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_02730 23462 24352 gene locus_tag LOCUS_02740 23462 24352 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869059.1 protein_id gnl|my_center|LOCUS_02740 24516 25496 gene locus_tag LOCUS_02750 24516 25496 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_02750 25533 26732 gene locus_tag LOCUS_02760 25533 26732 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_02760 26729 27559 gene locus_tag LOCUS_02770 gene lpxC 26729 27559 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_02770 27559 27996 gene locus_tag LOCUS_02780 gene fabZ 27559 27996 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_02780 28306 29109 gene locus_tag LOCUS_02790 gene lpxA 28306 29109 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_02790 29280 30104 gene locus_tag LOCUS_02800 gene lpxI 29280 30104 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_02800 30245 31414 gene locus_tag LOCUS_02810 gene lpxB 30245 31414 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_02810 31431 33167 gene locus_tag LOCUS_02820 31431 33167 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_02820 33177 35768 gene locus_tag LOCUS_02830 33177 35768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 35837 36571 gene locus_tag LOCUS_02840 gene kdsB 35837 36571 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_02840 36594 37412 gene locus_tag LOCUS_02850 gene kdsA 36594 37412 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_02850 37506 38480 gene locus_tag LOCUS_02860 37506 38480 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_02860 38648 39217 gene locus_tag LOCUS_02870 38648 39217 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_02870 39217 40119 gene locus_tag LOCUS_02880 39217 40119 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938962.1 protein_id gnl|my_center|LOCUS_02880 40103 40675 gene locus_tag LOCUS_02890 40103 40675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 40662 41543 gene locus_tag LOCUS_02900 40662 41543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 41540 42259 gene locus_tag LOCUS_02910 gene lptB 41540 42259 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_02910 42270 43361 gene locus_tag LOCUS_02920 42270 43361 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_02920 43438 44637 gene locus_tag LOCUS_02930 43438 44637 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583194.1 protein_id gnl|my_center|LOCUS_02930 44654 45154 gene locus_tag LOCUS_02940 gene ruvX 44654 45154 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_02940 45205 45837 gene locus_tag LOCUS_02950 45205 45837 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108450.1 protein_id gnl|my_center|LOCUS_02950 46068 46155 gene locus_tag LOCUS_t00050 46068 46155 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46285 47241 gene locus_tag LOCUS_02960 46285 47241 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_02960 47349 48254 gene locus_tag LOCUS_02970 47349 48254 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931393.1 protein_id gnl|my_center|LOCUS_02970 48417 48728 gene locus_tag LOCUS_02980 gene rplU 48417 48728 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_02980 48759 49097 gene locus_tag LOCUS_02990 48759 49097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 49090 49386 gene locus_tag LOCUS_03000 gene rpmA 49090 49386 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_03000 50698 49436 gene locus_tag LOCUS_03010 50698 49436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 51335 50874 gene locus_tag LOCUS_03020 51335 50874 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_03020 51999 56537 gene locus_tag LOCUS_03030 51999 56537 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812165.1 protein_id gnl|my_center|LOCUS_03030 56680 57069 gene locus_tag LOCUS_03040 56680 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 57395 58081 gene locus_tag LOCUS_03050 57395 58081 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533247.1 protein_id gnl|my_center|LOCUS_03050 58310 59131 gene locus_tag LOCUS_03060 58310 59131 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422952.1 protein_id gnl|my_center|LOCUS_03060 59128 59649 gene locus_tag LOCUS_03070 59128 59649 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454155.1 protein_id gnl|my_center|LOCUS_03070 61071 59956 gene locus_tag LOCUS_03080 gene potD 61071 59956 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772500.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence005 1073 351 gene locus_tag LOCUS_03090 1073 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1867 1112 gene locus_tag LOCUS_03100 1867 1112 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_03100 2151 1864 gene locus_tag LOCUS_03110 2151 1864 CDS product DUF3781 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438776.1 protein_id gnl|my_center|LOCUS_03110 3446 2163 gene locus_tag LOCUS_03120 3446 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 3983 3537 gene locus_tag LOCUS_03130 3983 3537 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_03130 4227 4003 gene locus_tag LOCUS_03140 4227 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 4575 4255 gene locus_tag LOCUS_03150 4575 4255 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_03150 4999 4625 gene locus_tag LOCUS_03160 4999 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5294 5073 gene locus_tag LOCUS_03170 5294 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6005 5400 gene locus_tag LOCUS_03180 6005 5400 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287520.1 protein_id gnl|my_center|LOCUS_03180 9466 6389 gene locus_tag LOCUS_03190 9466 6389 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202280.1 protein_id gnl|my_center|LOCUS_03190 11426 9483 gene locus_tag LOCUS_03200 11426 9483 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_03200 12841 11438 gene locus_tag LOCUS_03210 12841 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 14135 13035 gene locus_tag LOCUS_03220 14135 13035 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_03220 14883 14233 gene locus_tag LOCUS_03230 14883 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 18109 14888 gene locus_tag LOCUS_03240 18109 14888 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401853.1 protein_id gnl|my_center|LOCUS_03240 19270 18377 gene locus_tag LOCUS_03250 19270 18377 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461645.1 protein_id gnl|my_center|LOCUS_03250 20590 19520 gene locus_tag LOCUS_03260 20590 19520 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108350.1 protein_id gnl|my_center|LOCUS_03260 22503 20671 gene locus_tag LOCUS_03270 22503 20671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 23437 22598 gene locus_tag LOCUS_03280 23437 22598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 23959 23477 gene locus_tag LOCUS_03290 gene ybaK 23959 23477 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_03290 24244 23984 gene locus_tag LOCUS_03300 24244 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 24726 24343 gene locus_tag LOCUS_03310 24726 24343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 25297 24761 gene locus_tag LOCUS_03320 25297 24761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 25755 25315 gene locus_tag LOCUS_03330 25755 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 26185 25757 gene locus_tag LOCUS_03340 26185 25757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 27100 26228 gene locus_tag LOCUS_03350 27100 26228 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_03350 28058 27156 gene locus_tag LOCUS_03360 28058 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 28980 28324 gene locus_tag LOCUS_03370 28980 28324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 30810 29065 gene locus_tag LOCUS_03380 30810 29065 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044710.1 protein_id gnl|my_center|LOCUS_03380 31069 30860 gene locus_tag LOCUS_03390 31069 30860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 31433 31074 gene locus_tag LOCUS_03400 31433 31074 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_03400 32307 31531 gene locus_tag LOCUS_03410 32307 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 32846 32361 gene locus_tag LOCUS_03420 32846 32361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 34103 32898 gene locus_tag LOCUS_03430 34103 32898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 35518 34211 gene locus_tag LOCUS_03440 35518 34211 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112138.1 protein_id gnl|my_center|LOCUS_03440 36028 35549 gene locus_tag LOCUS_03450 36028 35549 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_03450 37424 36570 gene locus_tag LOCUS_03460 37424 36570 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_03460 38883 37639 gene locus_tag LOCUS_03470 38883 37639 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392227.1 protein_id gnl|my_center|LOCUS_03470 40073 38871 gene locus_tag LOCUS_03480 gene mtnA 40073 38871 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_03480 40548 40186 gene locus_tag LOCUS_03490 40548 40186 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_03490 41393 40581 gene locus_tag LOCUS_03500 gene mtnP 41393 40581 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_03500 42164 41538 gene locus_tag LOCUS_03510 42164 41538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 42869 42225 gene locus_tag LOCUS_03520 42869 42225 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393503.1 protein_id gnl|my_center|LOCUS_03520 43956 42895 gene locus_tag LOCUS_03530 gene orr 43956 42895 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_03530 44615 44001 gene locus_tag LOCUS_03540 44615 44001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 45803 44691 gene locus_tag LOCUS_03550 45803 44691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 46850 45912 gene locus_tag LOCUS_03560 46850 45912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 47773 46949 gene locus_tag LOCUS_03570 47773 46949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 49396 47828 gene locus_tag LOCUS_03580 49396 47828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 50252 49464 gene locus_tag LOCUS_03590 50252 49464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 51134 50346 gene locus_tag LOCUS_03600 51134 50346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 51361 52668 gene locus_tag LOCUS_03610 51361 52668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 54535 52859 gene locus_tag LOCUS_03620 54535 52859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 57735 54616 gene locus_tag LOCUS_03630 57735 54616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 60887 57732 gene locus_tag LOCUS_03640 60887 57732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 <61479 60874 gene locus_tag LOCUS_03650 <61479 60874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210078.1:nucleoside triphosphate pyrophosphatase >Feature sequence006 2662 1502 gene locus_tag LOCUS_03660 gene mutY 2662 1502 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171406.1 protein_id gnl|my_center|LOCUS_03660 3605 2748 gene locus_tag LOCUS_03670 gene hexR 3605 2748 CDS product transcriptional regulator HexR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096857.1 protein_id gnl|my_center|LOCUS_03670 5412 3715 gene locus_tag LOCUS_03680 5412 3715 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_03680 6905 5670 gene locus_tag LOCUS_03690 6905 5670 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_03690 7424 7041 gene locus_tag LOCUS_03700 7424 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 8122 7490 gene locus_tag LOCUS_03710 8122 7490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 8469 8317 gene locus_tag LOCUS_03720 8469 8317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8687 8469 gene locus_tag LOCUS_03730 8687 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 9050 8826 gene locus_tag LOCUS_03740 9050 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 9244 9894 gene locus_tag LOCUS_03750 9244 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 10136 10768 gene locus_tag LOCUS_03760 10136 10768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10765 11715 gene locus_tag LOCUS_03770 10765 11715 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_03770 13002 11794 gene locus_tag LOCUS_03780 13002 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 13206 13904 gene locus_tag LOCUS_03790 13206 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 15400 14072 gene locus_tag LOCUS_03800 15400 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 16897 15416 gene locus_tag LOCUS_03810 16897 15416 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_03810 18055 16979 gene locus_tag LOCUS_03820 gene wecB 18055 16979 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_03820 19503 18175 gene locus_tag LOCUS_03830 19503 18175 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 protein_id gnl|my_center|LOCUS_03830 20678 19626 gene locus_tag LOCUS_03840 20678 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 22080 20947 gene locus_tag LOCUS_03850 22080 20947 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_03850 22655 22080 gene locus_tag LOCUS_03860 22655 22080 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03860 23749 22652 gene locus_tag LOCUS_03870 23749 22652 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_03870 24824 23736 gene locus_tag LOCUS_03880 gene wecB 24824 23736 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_03880 25997 24912 gene locus_tag LOCUS_03890 25997 24912 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_03890 26463 25984 gene locus_tag LOCUS_03900 26463 25984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 27008 27175 gene locus_tag LOCUS_03910 27008 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 28650 27433 gene locus_tag LOCUS_03920 gene wlbE 28650 27433 CDS product O-antigen biosynthesis protein WlbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807109.1 protein_id gnl|my_center|LOCUS_03920 29342 28650 gene locus_tag LOCUS_03930 29342 28650 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922186.1 protein_id gnl|my_center|LOCUS_03930 30731 29361 gene locus_tag LOCUS_03940 30731 29361 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001134501.1 protein_id gnl|my_center|LOCUS_03940 31025 30855 gene locus_tag LOCUS_03950 31025 30855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 32363 31068 gene locus_tag LOCUS_03960 32363 31068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 33564 32569 gene locus_tag LOCUS_03970 33564 32569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 34871 33561 gene locus_tag LOCUS_03980 34871 33561 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_03980 35998 34904 gene locus_tag LOCUS_03990 35998 34904 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_03990 36434 36024 gene locus_tag LOCUS_04000 36434 36024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 36807 36427 gene locus_tag LOCUS_04010 36807 36427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 37344 36808 gene locus_tag LOCUS_04020 37344 36808 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858190.1 protein_id gnl|my_center|LOCUS_04020 38405 37365 gene locus_tag LOCUS_04030 gene gmd 38405 37365 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_04030 39392 38430 gene locus_tag LOCUS_04040 39392 38430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 40675 39431 gene locus_tag LOCUS_04050 40675 39431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 41756 40740 gene locus_tag LOCUS_04060 41756 40740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 42890 41871 gene locus_tag LOCUS_04070 42890 41871 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868771.1 protein_id gnl|my_center|LOCUS_04070 44022 42907 gene locus_tag LOCUS_04080 44022 42907 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870019.1 protein_id gnl|my_center|LOCUS_04080 45220 44069 gene locus_tag LOCUS_04090 45220 44069 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039964.1 protein_id gnl|my_center|LOCUS_04090 46535 45303 gene locus_tag LOCUS_04100 46535 45303 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107235.1 protein_id gnl|my_center|LOCUS_04100 48087 46798 gene locus_tag LOCUS_04110 gene larA 48087 46798 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_04110 48975 48307 gene locus_tag LOCUS_04120 48975 48307 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_04120 50376 48979 gene locus_tag LOCUS_04130 50376 48979 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_04130 52141 50369 gene locus_tag LOCUS_04140 52141 50369 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_04140 52479 52153 gene locus_tag LOCUS_04150 52479 52153 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_04150 53486 52494 gene locus_tag LOCUS_04160 53486 52494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 54096 53488 gene locus_tag LOCUS_04170 54096 53488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 54589 54113 gene locus_tag LOCUS_04180 54589 54113 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_04180 56489 54630 gene locus_tag LOCUS_04190 56489 54630 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_04190 56796 56491 gene locus_tag LOCUS_04200 56796 56491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 57851 57048 gene locus_tag LOCUS_04210 gene murI 57851 57048 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392055.1 protein_id gnl|my_center|LOCUS_04210 58829 57936 gene locus_tag LOCUS_04220 58829 57936 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082969.1 protein_id gnl|my_center|LOCUS_04220 60580 58841 gene locus_tag LOCUS_04230 60580 58841 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 protein_id gnl|my_center|LOCUS_04230 <61234 60670 gene locus_tag LOCUS_04240 <61234 60670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459569.1:response regulator transcription factor >Feature sequence007 598 1488 gene locus_tag LOCUS_04250 gene ttdA 598 1488 CDS product L(+)-tartrate dehydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045349.1 protein_id gnl|my_center|LOCUS_04250 1488 2114 gene locus_tag LOCUS_04260 gene ttdB 1488 2114 CDS product L(+)-tartrate dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162405.1 protein_id gnl|my_center|LOCUS_04260 2829 4091 gene locus_tag LOCUS_04270 2829 4091 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_04270 5573 4254 gene locus_tag LOCUS_04280 5573 4254 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_04280 5971 5771 gene locus_tag LOCUS_04290 5971 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6283 6032 gene locus_tag LOCUS_04300 6283 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6896 6213 gene locus_tag LOCUS_04310 6896 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 7943 7140 gene locus_tag LOCUS_04320 7943 7140 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_04320 8740 8327 gene locus_tag LOCUS_04330 8740 8327 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_04330 9769 8837 gene locus_tag LOCUS_04340 gene hslO 9769 8837 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930751.1 protein_id gnl|my_center|LOCUS_04340 10364 9903 gene locus_tag LOCUS_04350 gene ribE 10364 9903 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_04350 11727 10492 gene locus_tag LOCUS_04360 11727 10492 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392434.1 protein_id gnl|my_center|LOCUS_04360 12493 11762 gene locus_tag LOCUS_04370 12493 11762 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_04370 13698 12592 gene locus_tag LOCUS_04380 gene ribD 13698 12592 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_04380 14769 14125 gene locus_tag LOCUS_04390 gene rpe 14769 14125 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_04390 15656 14766 gene locus_tag LOCUS_04400 gene rsgA 15656 14766 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723063.1 protein_id gnl|my_center|LOCUS_04400 18181 15650 gene locus_tag LOCUS_04410 18181 15650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 18914 18171 gene locus_tag LOCUS_04420 18914 18171 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723065.1 protein_id gnl|my_center|LOCUS_04420 20022 18994 gene locus_tag LOCUS_04430 gene rlmN 20022 18994 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000450546.1 protein_id gnl|my_center|LOCUS_04430 21466 20120 gene locus_tag LOCUS_04440 gene rsmB 21466 20120 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_04440 22310 21516 gene locus_tag LOCUS_04450 22310 21516 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_04450 23343 22405 gene locus_tag LOCUS_04460 gene fmt 23343 22405 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232070.1 protein_id gnl|my_center|LOCUS_04460 23820 23347 gene locus_tag LOCUS_04470 gene def 23820 23347 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460527.1 protein_id gnl|my_center|LOCUS_04470 26364 23974 gene locus_tag LOCUS_04480 gene priA 26364 23974 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_04480 27041 26445 gene locus_tag LOCUS_04490 27041 26445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 28302 27199 gene locus_tag LOCUS_04500 28302 27199 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393062.1 protein_id gnl|my_center|LOCUS_04500 29524 28304 gene locus_tag LOCUS_04510 29524 28304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 29810 30490 gene locus_tag LOCUS_04520 29810 30490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 30588 32000 gene locus_tag LOCUS_04530 30588 32000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 33213 32098 gene locus_tag LOCUS_04540 33213 32098 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_04540 33925 33254 gene locus_tag LOCUS_04550 33925 33254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 34842 34021 gene locus_tag LOCUS_04560 34842 34021 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028237.1 protein_id gnl|my_center|LOCUS_04560 35474 34941 gene locus_tag LOCUS_04570 35474 34941 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583237.1 protein_id gnl|my_center|LOCUS_04570 36939 35563 gene locus_tag LOCUS_04580 36939 35563 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869440.1 protein_id gnl|my_center|LOCUS_04580 37979 37119 gene locus_tag LOCUS_04590 37979 37119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 38360 39400 gene locus_tag LOCUS_04600 38360 39400 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114147.1 protein_id gnl|my_center|LOCUS_04600 39461 39964 gene locus_tag LOCUS_04610 39461 39964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 39942 41927 gene locus_tag LOCUS_04620 39942 41927 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_04620 43063 42029 gene locus_tag LOCUS_04630 gene trpS 43063 42029 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048270.1 protein_id gnl|my_center|LOCUS_04630 44717 43176 gene locus_tag LOCUS_04640 44717 43176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 44942 45832 gene locus_tag LOCUS_04650 gene rarD 44942 45832 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000535550.1 protein_id gnl|my_center|LOCUS_04650 47252 45951 gene locus_tag LOCUS_04660 gene larA 47252 45951 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_04660 48762 47464 gene locus_tag LOCUS_04670 gene larA 48762 47464 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461442.1 protein_id gnl|my_center|LOCUS_04670 50377 48917 gene locus_tag LOCUS_04680 50377 48917 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_04680 51887 50427 gene locus_tag LOCUS_04690 51887 50427 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812211.1 protein_id gnl|my_center|LOCUS_04690 53356 51899 gene locus_tag LOCUS_04700 53356 51899 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_04700 54815 53475 gene locus_tag LOCUS_04710 gene trkA 54815 53475 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_04710 55194 55084 gene locus_tag LOCUS_r00020 55194 55084 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence008 639 1535 gene locus_tag LOCUS_04720 639 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1980 2771 gene locus_tag LOCUS_04730 1980 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4195 2786 gene locus_tag LOCUS_04740 4195 2786 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_04740 4851 4516 gene locus_tag LOCUS_04750 4851 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 5893 5270 gene locus_tag LOCUS_04760 5893 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 6073 6312 gene locus_tag LOCUS_04770 6073 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6375 6563 gene locus_tag LOCUS_04780 6375 6563 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214976.1 protein_id gnl|my_center|LOCUS_04780 6578 6970 gene locus_tag LOCUS_04790 6578 6970 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_04790 7294 8589 gene locus_tag LOCUS_04800 7294 8589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399445.1 protein_id gnl|my_center|LOCUS_04800 9874 8660 gene locus_tag LOCUS_04810 9874 8660 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_04810 10352 10657 gene locus_tag LOCUS_04820 10352 10657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 10740 10937 gene locus_tag LOCUS_04830 10740 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 11103 11642 gene locus_tag LOCUS_04840 11103 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 11760 12461 gene locus_tag LOCUS_04850 11760 12461 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_04850 12558 14153 gene locus_tag LOCUS_04860 12558 14153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 15546 14491 gene locus_tag LOCUS_04870 15546 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173689.1 protein_id gnl|my_center|LOCUS_04870 15756 18287 gene locus_tag LOCUS_04880 gene clpB 15756 18287 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_04880 18514 18365 gene locus_tag LOCUS_04890 18514 18365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 19299 20006 gene locus_tag LOCUS_04900 19299 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 20595 22607 gene locus_tag LOCUS_04910 20595 22607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 22638 23363 gene locus_tag LOCUS_04920 22638 23363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 23501 24562 gene locus_tag LOCUS_04930 23501 24562 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173870.1 protein_id gnl|my_center|LOCUS_04930 24562 25137 gene locus_tag LOCUS_04940 24562 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 25152 26012 gene locus_tag LOCUS_04950 25152 26012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 26069 26707 gene locus_tag LOCUS_04960 26069 26707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 26770 28413 gene locus_tag LOCUS_04970 26770 28413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 28486 30543 gene locus_tag LOCUS_04980 28486 30543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 30584 31885 gene locus_tag LOCUS_04990 30584 31885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 32013 32906 gene locus_tag LOCUS_05000 32013 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 33013 33747 gene locus_tag LOCUS_05010 33013 33747 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948285.1 protein_id gnl|my_center|LOCUS_05010 34023 34700 gene locus_tag LOCUS_05020 34023 34700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 34848 35558 gene locus_tag LOCUS_05030 34848 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 35618 36670 gene locus_tag LOCUS_05040 35618 36670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 36706 37413 gene locus_tag LOCUS_05050 36706 37413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 37809 37489 gene locus_tag LOCUS_05060 37809 37489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 37876 39423 gene locus_tag LOCUS_05070 gene istA 37876 39423 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015262274.1 protein_id gnl|my_center|LOCUS_05070 39429 40205 gene locus_tag LOCUS_05080 gene istB 39429 40205 CDS product IS21-like element ISRsp2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167668023.1 protein_id gnl|my_center|LOCUS_05080 40713 41489 gene locus_tag LOCUS_05090 40713 41489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 41490 41858 gene locus_tag LOCUS_05100 41490 41858 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679605.1 protein_id gnl|my_center|LOCUS_05100 41875 43464 gene locus_tag LOCUS_05110 41875 43464 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_05110 43516 44613 gene locus_tag LOCUS_05120 43516 44613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 44633 45250 gene locus_tag LOCUS_05130 44633 45250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 45367 45966 gene locus_tag LOCUS_05140 45367 45966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 45947 46639 gene locus_tag LOCUS_05150 gene tsaB 45947 46639 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_05150 46734 47216 gene locus_tag LOCUS_05160 gene rimI 46734 47216 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_05160 47298 48314 gene locus_tag LOCUS_05170 gene tsaD 47298 48314 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_05170 48782 49084 gene locus_tag LOCUS_05180 gene groES 48782 49084 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_05180 49180 50802 gene locus_tag LOCUS_05190 gene groL 49180 50802 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence009 571 4272 gene locus_tag LOCUS_05200 571 4272 CDS product bifunctional glycogen debranching protein GlgX/4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460009.1 protein_id gnl|my_center|LOCUS_05200 4953 6332 gene locus_tag LOCUS_05210 4953 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 6373 7098 gene locus_tag LOCUS_05220 6373 7098 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_05220 7217 7501 gene locus_tag LOCUS_05230 gene rpsF 7217 7501 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_05230 7529 7981 gene locus_tag LOCUS_05240 gene ssb 7529 7981 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815182.1 protein_id gnl|my_center|LOCUS_05240 8003 8233 gene locus_tag LOCUS_05250 gene rpsR 8003 8233 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_05250 8537 9475 gene locus_tag LOCUS_05260 8537 9475 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_05260 9572 10858 gene locus_tag LOCUS_05270 gene serS 9572 10858 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963350.1 protein_id gnl|my_center|LOCUS_05270 10973 12076 gene locus_tag LOCUS_05280 10973 12076 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_05280 12093 12881 gene locus_tag LOCUS_05290 12093 12881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 13304 14617 gene locus_tag LOCUS_05300 gene thiC 13304 14617 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_05300 15962 14673 gene locus_tag LOCUS_05310 15962 14673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 16440 18446 gene locus_tag LOCUS_05320 gene htpG 16440 18446 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943026.1 protein_id gnl|my_center|LOCUS_05320 18522 19298 gene locus_tag LOCUS_05330 18522 19298 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878031.1 protein_id gnl|my_center|LOCUS_05330 19442 19517 gene locus_tag LOCUS_t00060 19442 19517 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19785 23525 gene locus_tag LOCUS_05340 19785 23525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 23571 23646 gene locus_tag LOCUS_t00070 23571 23646 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23925 24440 gene locus_tag LOCUS_05350 23925 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 24460 25200 gene locus_tag LOCUS_05360 24460 25200 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_05360 25768 26103 gene locus_tag LOCUS_05370 25768 26103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 26146 26292 gene locus_tag LOCUS_05380 26146 26292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 26491 26844 gene locus_tag LOCUS_05390 26491 26844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 26861 26986 gene locus_tag LOCUS_05400 26861 26986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 27022 27528 gene locus_tag LOCUS_05410 27022 27528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 27553 27972 gene locus_tag LOCUS_05420 27553 27972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 28350 27988 gene locus_tag LOCUS_05430 28350 27988 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_05430 28655 28386 gene locus_tag LOCUS_05440 28655 28386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 29083 29478 gene locus_tag LOCUS_05450 29083 29478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 30602 29514 gene locus_tag LOCUS_05460 30602 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 31132 31992 gene locus_tag LOCUS_05470 31132 31992 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679604.1 protein_id gnl|my_center|LOCUS_05470 32717 33625 gene locus_tag LOCUS_05480 32717 33625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 33686 34405 gene locus_tag LOCUS_05490 33686 34405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 34477 34806 gene locus_tag LOCUS_05500 34477 34806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 34803 36260 gene locus_tag LOCUS_05510 gene hxsB 34803 36260 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_05510 36247 37365 gene locus_tag LOCUS_05520 gene hxsC 36247 37365 CDS product His-Xaa-Ser system radical SAM maturase HxsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457560.1 protein_id gnl|my_center|LOCUS_05520 37689 37408 gene locus_tag LOCUS_05530 37689 37408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 37893 38306 gene locus_tag LOCUS_05540 gene mutT 37893 38306 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_05540 41665 38420 gene locus_tag LOCUS_05550 41665 38420 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149495417.1 protein_id gnl|my_center|LOCUS_05550 42968 41724 gene locus_tag LOCUS_05560 42968 41724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 44157 42952 gene locus_tag LOCUS_05570 44157 42952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 44488 45714 gene locus_tag LOCUS_05580 44488 45714 CDS product HNH endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986608.1 protein_id gnl|my_center|LOCUS_05580 46008 46877 gene locus_tag LOCUS_05590 gene dinD 46008 46877 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_05590 47055 47819 gene locus_tag LOCUS_05600 47055 47819 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263037.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence010 239 988 gene locus_tag LOCUS_05610 239 988 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869151.1 protein_id gnl|my_center|LOCUS_05610 1141 1992 gene locus_tag LOCUS_05620 gene ssuB 1141 1992 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210036.1 protein_id gnl|my_center|LOCUS_05620 2700 2095 gene locus_tag LOCUS_05630 2700 2095 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940801.1 protein_id gnl|my_center|LOCUS_05630 2932 3909 gene locus_tag LOCUS_05640 2932 3909 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429089.1 protein_id gnl|my_center|LOCUS_05640 4795 4109 gene locus_tag LOCUS_05650 4795 4109 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_05650 6332 4809 gene locus_tag LOCUS_05660 6332 4809 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_05660 7505 6348 gene locus_tag LOCUS_05670 7505 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 8719 7598 gene locus_tag LOCUS_05680 8719 7598 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_05680 11036 8829 gene locus_tag LOCUS_05690 11036 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 12321 11131 gene locus_tag LOCUS_05700 12321 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 13391 12339 gene locus_tag LOCUS_05710 13391 12339 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704392.1 protein_id gnl|my_center|LOCUS_05710 14017 13541 gene locus_tag LOCUS_05720 14017 13541 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_05720 14674 14039 gene locus_tag LOCUS_05730 14674 14039 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861240.1 protein_id gnl|my_center|LOCUS_05730 15807 14842 gene locus_tag LOCUS_05740 15807 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16404 15907 gene locus_tag LOCUS_05750 16404 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 17634 16423 gene locus_tag LOCUS_05760 17634 16423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 17825 17631 gene locus_tag LOCUS_05770 17825 17631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 18447 17878 gene locus_tag LOCUS_05780 18447 17878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19507 18818 gene locus_tag LOCUS_05790 19507 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 21117 19735 gene locus_tag LOCUS_05800 21117 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 22658 21330 gene locus_tag LOCUS_05810 22658 21330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 24415 22802 gene locus_tag LOCUS_05820 gene pckA 24415 22802 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_05820 25721 24738 gene locus_tag LOCUS_05830 25721 24738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 27198 25999 gene locus_tag LOCUS_05840 27198 25999 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424103.1 protein_id gnl|my_center|LOCUS_05840 29737 27305 gene locus_tag LOCUS_05850 gene pheT 29737 27305 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_05850 30783 29752 gene locus_tag LOCUS_05860 gene pheS 30783 29752 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_05860 31838 31446 gene locus_tag LOCUS_05870 31838 31446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 32565 31873 gene locus_tag LOCUS_05880 32565 31873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 32760 33080 gene locus_tag LOCUS_05890 32760 33080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 34133 33195 gene locus_tag LOCUS_05900 34133 33195 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813684.1 protein_id gnl|my_center|LOCUS_05900 34511 34164 gene locus_tag LOCUS_05910 34511 34164 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_05910 34974 34498 gene locus_tag LOCUS_05920 34974 34498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 36024 35161 gene locus_tag LOCUS_05930 36024 35161 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044978750.1 protein_id gnl|my_center|LOCUS_05930 37069 36416 gene locus_tag LOCUS_05940 37069 36416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 37553 38065 gene locus_tag LOCUS_05950 37553 38065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 38933 38094 gene locus_tag LOCUS_05960 38933 38094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 39489 38935 gene locus_tag LOCUS_05970 39489 38935 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003058426.1 protein_id gnl|my_center|LOCUS_05970 40154 39486 gene locus_tag LOCUS_05980 40154 39486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 42482 40155 gene locus_tag LOCUS_05990 42482 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 42987 42508 gene locus_tag LOCUS_06000 42987 42508 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830812.1 protein_id gnl|my_center|LOCUS_06000 43242 43841 gene locus_tag LOCUS_06010 43242 43841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 44759 43950 gene locus_tag LOCUS_06020 44759 43950 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_06020 45182 44826 gene locus_tag LOCUS_06030 gene rplT 45182 44826 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_06030 45408 45211 gene locus_tag LOCUS_06040 gene rpmI 45408 45211 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_06040 45852 45424 gene locus_tag LOCUS_06050 45852 45424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06050 46761 46186 gene locus_tag LOCUS_06060 46761 46186 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_06060 47375 46776 gene locus_tag LOCUS_06070 47375 46776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 47732 47529 gene locus_tag LOCUS_06080 47732 47529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence011 1502 195 gene locus_tag LOCUS_06090 1502 195 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_06090 2210 1782 gene locus_tag LOCUS_06100 gene aroQ 2210 1782 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_06100 2731 2234 gene locus_tag LOCUS_06110 2731 2234 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964216.1 protein_id gnl|my_center|LOCUS_06110 3537 2728 gene locus_tag LOCUS_06120 3537 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4749 3619 gene locus_tag LOCUS_06130 gene pheA 4749 3619 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_06130 5840 4764 gene locus_tag LOCUS_06140 gene aroC 5840 4764 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_06140 7242 5932 gene locus_tag LOCUS_06150 gene aroA 7242 5932 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_06150 8329 7259 gene locus_tag LOCUS_06160 gene aroB 8329 7259 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_06160 9262 8390 gene locus_tag LOCUS_06170 9262 8390 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_06170 10399 9386 gene locus_tag LOCUS_06180 gene aroF 10399 9386 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_06180 12941 10887 gene locus_tag LOCUS_06190 12941 10887 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_06190 14006 13059 gene locus_tag LOCUS_06200 14006 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 15486 13969 gene locus_tag LOCUS_06210 gene rfaE2 15486 13969 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870427.1 protein_id gnl|my_center|LOCUS_06210 17538 15502 gene locus_tag LOCUS_06220 17538 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 18668 17721 gene locus_tag LOCUS_06230 18668 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869991.1 protein_id gnl|my_center|LOCUS_06230 20298 18889 gene locus_tag LOCUS_06240 20298 18889 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_06240 21093 20389 gene locus_tag LOCUS_06250 21093 20389 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_06250 23063 21090 gene locus_tag LOCUS_06260 23063 21090 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419074.1 protein_id gnl|my_center|LOCUS_06260 24253 23153 gene locus_tag LOCUS_06270 gene rodA 24253 23153 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460900.1 protein_id gnl|my_center|LOCUS_06270 26060 24258 gene locus_tag LOCUS_06280 gene mrdA 26060 24258 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06280 26651 26151 gene locus_tag LOCUS_06290 26651 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 27517 26648 gene locus_tag LOCUS_06300 gene mreC 27517 26648 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725674.1 protein_id gnl|my_center|LOCUS_06300 28787 27753 gene locus_tag LOCUS_06310 28787 27753 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_06310 29573 28887 gene locus_tag LOCUS_06320 gene radC 29573 28887 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_06320 30103 29633 gene locus_tag LOCUS_06330 30103 29633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 30520 30227 gene locus_tag LOCUS_06340 30520 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 31033 30533 gene locus_tag LOCUS_06350 31033 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 31883 31317 gene locus_tag LOCUS_06360 31883 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 33475 32210 gene locus_tag LOCUS_06370 33475 32210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 34951 33713 gene locus_tag LOCUS_06380 34951 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 36499 35279 gene locus_tag LOCUS_06390 36499 35279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 37469 36600 gene locus_tag LOCUS_06400 37469 36600 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886474.1 protein_id gnl|my_center|LOCUS_06400 37824 37459 gene locus_tag LOCUS_06410 gene rsfS 37824 37459 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088020.1 protein_id gnl|my_center|LOCUS_06410 39263 37887 gene locus_tag LOCUS_06420 39263 37887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 39971 39351 gene locus_tag LOCUS_06430 gene yqeK 39971 39351 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360010.1 protein_id gnl|my_center|LOCUS_06430 40707 40090 gene locus_tag LOCUS_06440 gene nadD 40707 40090 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_06440 41007 40828 gene locus_tag LOCUS_06450 41007 40828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 42312 41098 gene locus_tag LOCUS_06460 42312 41098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_06460 43003 42302 gene locus_tag LOCUS_06470 43003 42302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_06470 44191 43103 gene locus_tag LOCUS_06480 44191 43103 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941163.1 protein_id gnl|my_center|LOCUS_06480 45168 44353 gene locus_tag LOCUS_06490 45168 44353 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549690.1 protein_id gnl|my_center|LOCUS_06490 46409 45165 gene locus_tag LOCUS_06500 46409 45165 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_06500 <47452 46594 gene locus_tag LOCUS_06510 <47452 46594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392099.1:glutamate 5-kinase >Feature sequence012 2282 144 gene locus_tag LOCUS_06520 2282 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2492 3631 gene locus_tag LOCUS_06530 2492 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3741 4325 gene locus_tag LOCUS_06540 3741 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4418 4699 gene locus_tag LOCUS_06550 4418 4699 CDS product barstar family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964162.1 protein_id gnl|my_center|LOCUS_06550 4825 5448 gene locus_tag LOCUS_06560 4825 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 8757 5626 gene locus_tag LOCUS_06570 8757 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 9114 9428 gene locus_tag LOCUS_06580 9114 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 9477 9710 gene locus_tag LOCUS_06590 9477 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9870 10421 gene locus_tag LOCUS_06600 9870 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 10506 11264 gene locus_tag LOCUS_06610 10506 11264 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_06610 11469 11792 gene locus_tag LOCUS_06620 11469 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 11912 12751 gene locus_tag LOCUS_06630 11912 12751 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921647.1 protein_id gnl|my_center|LOCUS_06630 12758 13879 gene locus_tag LOCUS_06640 12758 13879 CDS product M20 peptidase aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704276.1 protein_id gnl|my_center|LOCUS_06640 13955 14752 gene locus_tag LOCUS_06650 13955 14752 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903503.1 protein_id gnl|my_center|LOCUS_06650 14755 15852 gene locus_tag LOCUS_06660 gene hydE 14755 15852 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393236.1 protein_id gnl|my_center|LOCUS_06660 15968 16402 gene locus_tag LOCUS_06670 gene mscL 15968 16402 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_06670 16450 17679 gene locus_tag LOCUS_06680 16450 17679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17884 18711 gene locus_tag LOCUS_06690 17884 18711 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099728.1 protein_id gnl|my_center|LOCUS_06690 19039 20364 gene locus_tag LOCUS_06700 19039 20364 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_06700 20471 22048 gene locus_tag LOCUS_06710 20471 22048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 22021 22950 gene locus_tag LOCUS_06720 22021 22950 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966616.1 protein_id gnl|my_center|LOCUS_06720 22968 24473 gene locus_tag LOCUS_06730 22968 24473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 24597 27656 gene locus_tag LOCUS_06740 24597 27656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 27649 31257 gene locus_tag LOCUS_06750 27649 31257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 31476 31736 gene locus_tag LOCUS_06760 31476 31736 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025772973.1 protein_id gnl|my_center|LOCUS_06760 31778 32218 gene locus_tag LOCUS_06770 gene ruvX 31778 32218 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_06770 32305 33924 gene locus_tag LOCUS_06780 32305 33924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 34041 34430 gene locus_tag LOCUS_06790 34041 34430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 34576 35592 gene locus_tag LOCUS_06800 gene mltG 34576 35592 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_06800 35738 36916 gene locus_tag LOCUS_06810 35738 36916 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_06810 36987 38057 gene locus_tag LOCUS_06820 gene pepQ 36987 38057 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411056.1 protein_id gnl|my_center|LOCUS_06820 38137 38694 gene locus_tag LOCUS_06830 gene efp 38137 38694 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_06830 38937 39461 gene locus_tag LOCUS_06840 38937 39461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 39556 40092 gene locus_tag LOCUS_06850 39556 40092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 40108 40335 gene locus_tag LOCUS_06860 40108 40335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 40429 40851 gene locus_tag LOCUS_06870 gene nusB 40429 40851 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393030.1 protein_id gnl|my_center|LOCUS_06870 40928 42088 gene locus_tag LOCUS_06880 40928 42088 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861140.1 protein_id gnl|my_center|LOCUS_06880 42192 43724 gene locus_tag LOCUS_06890 gene xseA 42192 43724 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_06890 43849 44115 gene locus_tag LOCUS_06900 43849 44115 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131346.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence013 3207 2080 gene locus_tag LOCUS_06910 gene carA 3207 2080 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_06910 4041 3427 gene locus_tag LOCUS_06920 4041 3427 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_06920 5569 4055 gene locus_tag LOCUS_06930 5569 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7191 5782 gene locus_tag LOCUS_06940 gene purF 7191 5782 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_06940 9161 7356 gene locus_tag LOCUS_06950 9161 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 9969 9397 gene locus_tag LOCUS_06960 9969 9397 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_06960 10469 10867 gene locus_tag LOCUS_06970 10469 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 10931 11884 gene locus_tag LOCUS_06980 10931 11884 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_06980 11950 12135 gene locus_tag LOCUS_06990 11950 12135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12208 13935 gene locus_tag LOCUS_07000 12208 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 14619 14038 gene locus_tag LOCUS_07010 14619 14038 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_07010 14737 14609 gene locus_tag LOCUS_07020 14737 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 14993 16009 gene locus_tag LOCUS_07030 14993 16009 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_07030 16602 17525 gene locus_tag LOCUS_07040 gene metA 16602 17525 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122725.1 protein_id gnl|my_center|LOCUS_07040 17635 18921 gene locus_tag LOCUS_07050 17635 18921 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_07050 18896 19054 gene locus_tag LOCUS_07060 18896 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 19353 23321 gene locus_tag LOCUS_07070 19353 23321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 25532 23598 gene locus_tag LOCUS_07080 25532 23598 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_07080 25893 26366 gene locus_tag LOCUS_07090 25893 26366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 26498 27271 gene locus_tag LOCUS_07100 26498 27271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 27351 28097 gene locus_tag LOCUS_07110 27351 28097 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181587.1 protein_id gnl|my_center|LOCUS_07110 28129 28686 gene locus_tag LOCUS_07120 28129 28686 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_07120 28728 29282 gene locus_tag LOCUS_07130 28728 29282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 29347 30813 gene locus_tag LOCUS_07140 29347 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 31010 31948 gene locus_tag LOCUS_07150 31010 31948 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130718.1 protein_id gnl|my_center|LOCUS_07150 32104 33735 gene locus_tag LOCUS_07160 32104 33735 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023304.1 protein_id gnl|my_center|LOCUS_07160 34011 34835 gene locus_tag LOCUS_07170 gene mutM 34011 34835 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_07170 34897 35661 gene locus_tag LOCUS_07180 34897 35661 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234130.1 protein_id gnl|my_center|LOCUS_07180 35676 36281 gene locus_tag LOCUS_07190 35676 36281 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_07190 36610 37545 gene locus_tag LOCUS_07200 36610 37545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 37572 38924 gene locus_tag LOCUS_07210 gene pcaB 37572 38924 CDS product 3-carboxy-cis,cis-muconate cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090665.1 protein_id gnl|my_center|LOCUS_07210 39854 39141 gene locus_tag LOCUS_07220 39854 39141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 39822 40190 gene locus_tag LOCUS_07230 39822 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 40377 43007 gene locus_tag LOCUS_07240 40377 43007 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_07240 43284 43135 gene locus_tag LOCUS_07250 43284 43135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence014 75 1799 gene locus_tag LOCUS_07260 75 1799 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_07260 1803 2912 gene locus_tag LOCUS_07270 1803 2912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_07270 6038 3120 gene locus_tag LOCUS_07280 6038 3120 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_07280 6566 6396 gene locus_tag LOCUS_07290 6566 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 6952 6575 gene locus_tag LOCUS_07300 6952 6575 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362471.1 protein_id gnl|my_center|LOCUS_07300 7342 7181 gene locus_tag LOCUS_07310 7342 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 7271 7480 gene locus_tag LOCUS_07320 7271 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 7975 7577 gene locus_tag LOCUS_07330 7975 7577 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393073.1 protein_id gnl|my_center|LOCUS_07330 8306 7965 gene locus_tag LOCUS_07340 8306 7965 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869636.1 protein_id gnl|my_center|LOCUS_07340 8728 8652 gene locus_tag LOCUS_t00080 8728 8652 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9619 8906 gene locus_tag LOCUS_07350 9619 8906 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_07350 9997 10365 gene locus_tag LOCUS_07360 9997 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 10944 10501 gene locus_tag LOCUS_07370 gene dtd 10944 10501 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_07370 11923 11093 gene locus_tag LOCUS_07380 11923 11093 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814540.1 protein_id gnl|my_center|LOCUS_07380 12806 12132 gene locus_tag LOCUS_07390 12806 12132 CDS product phosphoserine phosphatase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859193.1 protein_id gnl|my_center|LOCUS_07390 14127 12937 gene locus_tag LOCUS_07400 14127 12937 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_07400 15496 14147 gene locus_tag LOCUS_07410 15496 14147 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_07410 17502 15799 gene locus_tag LOCUS_07420 gene leuA 17502 15799 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963596.1 protein_id gnl|my_center|LOCUS_07420 17693 18985 gene locus_tag LOCUS_07430 17693 18985 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_07430 21820 19178 gene locus_tag LOCUS_07440 21820 19178 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_07440 22568 22035 gene locus_tag LOCUS_07450 22568 22035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 24349 22622 gene locus_tag LOCUS_07460 24349 22622 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105053.1 protein_id gnl|my_center|LOCUS_07460 27522 24376 gene locus_tag LOCUS_07470 27522 24376 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_07470 28695 27535 gene locus_tag LOCUS_07480 28695 27535 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545408.1 protein_id gnl|my_center|LOCUS_07480 30463 28973 gene locus_tag LOCUS_07490 30463 28973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 31385 30573 gene locus_tag LOCUS_07500 31385 30573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 33158 31425 gene locus_tag LOCUS_07510 33158 31425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 34298 33384 gene locus_tag LOCUS_07520 34298 33384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 35451 34378 gene locus_tag LOCUS_07530 gene leuB 35451 34378 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208285.1 protein_id gnl|my_center|LOCUS_07530 36017 35538 gene locus_tag LOCUS_07540 gene leuD 36017 35538 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_07540 37276 36014 gene locus_tag LOCUS_07550 gene leuC 37276 36014 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393737.1 protein_id gnl|my_center|LOCUS_07550 38777 37389 gene locus_tag LOCUS_07560 38777 37389 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_07560 40271 39000 gene locus_tag LOCUS_07570 40271 39000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 41961 40384 gene locus_tag LOCUS_07580 gene serA 41961 40384 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_07580 <43385 42594 gene locus_tag LOCUS_07590 <43385 42594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942899.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence015 1050 439 gene locus_tag LOCUS_07600 1050 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2107 1379 gene locus_tag LOCUS_07610 2107 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2512 2156 gene locus_tag LOCUS_07620 2512 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2849 2571 gene locus_tag LOCUS_07630 2849 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 3423 2878 gene locus_tag LOCUS_07640 3423 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 4200 3490 gene locus_tag LOCUS_07650 4200 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4602 4441 gene locus_tag LOCUS_07660 4602 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4842 4621 gene locus_tag LOCUS_07670 4842 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5094 4870 gene locus_tag LOCUS_07680 5094 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 5869 5174 gene locus_tag LOCUS_07690 5869 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6330 6157 gene locus_tag LOCUS_07700 6330 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6954 7739 gene locus_tag LOCUS_07710 6954 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 7800 8903 gene locus_tag LOCUS_07720 7800 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 8906 9985 gene locus_tag LOCUS_07730 8906 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 10445 10032 gene locus_tag LOCUS_07740 10445 10032 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946967.1 protein_id gnl|my_center|LOCUS_07740 11105 10455 gene locus_tag LOCUS_07750 11105 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12121 11330 gene locus_tag LOCUS_07760 12121 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 13455 12118 gene locus_tag LOCUS_07770 13455 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 13888 13478 gene locus_tag LOCUS_07780 13888 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 14636 13986 gene locus_tag LOCUS_07790 14636 13986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 15376 14726 gene locus_tag LOCUS_07800 15376 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 16101 15427 gene locus_tag LOCUS_07810 16101 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 17233 16172 gene locus_tag LOCUS_07820 17233 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 18199 17315 gene locus_tag LOCUS_07830 18199 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 19137 18232 gene locus_tag LOCUS_07840 19137 18232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 20074 19346 gene locus_tag LOCUS_07850 20074 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 21221 20106 gene locus_tag LOCUS_07860 21221 20106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 21920 21321 gene locus_tag LOCUS_07870 21920 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 23810 21981 gene locus_tag LOCUS_07880 23810 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 24741 24304 gene locus_tag LOCUS_07890 24741 24304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 26290 24830 gene locus_tag LOCUS_07900 26290 24830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 26886 26287 gene locus_tag LOCUS_07910 gene clpP 26886 26287 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 protein_id gnl|my_center|LOCUS_07910 28045 27737 gene locus_tag LOCUS_07920 28045 27737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30903 28459 gene locus_tag LOCUS_07930 gene pcrA 30903 28459 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_07930 32598 31174 gene locus_tag LOCUS_07940 32598 31174 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216257.1 protein_id gnl|my_center|LOCUS_07940 33026 32847 gene locus_tag LOCUS_07950 33026 32847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 34054 33194 gene locus_tag LOCUS_07960 34054 33194 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_07960 34300 34950 gene locus_tag LOCUS_07970 34300 34950 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364337.1 protein_id gnl|my_center|LOCUS_07970 36310 35084 gene locus_tag LOCUS_07980 36310 35084 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_07980 37027 36476 gene locus_tag LOCUS_07990 gene nrdG 37027 36476 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899261.1 protein_id gnl|my_center|LOCUS_07990 39258 37132 gene locus_tag LOCUS_08000 gene nrdD 39258 37132 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_08000 40386 39712 gene locus_tag LOCUS_08010 40386 39712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 41189 40386 gene locus_tag LOCUS_08020 41189 40386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 42049 41186 gene locus_tag LOCUS_08030 42049 41186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence016 23651 21984 gene locus_tag LOCUS_08040 23651 21984 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_08040 24392 23934 gene locus_tag LOCUS_08050 24392 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 25689 24529 gene locus_tag LOCUS_08060 25689 24529 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357628.1 protein_id gnl|my_center|LOCUS_08060 26843 25707 gene locus_tag LOCUS_08070 26843 25707 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_08070 27743 26856 gene locus_tag LOCUS_08080 gene ftsX 27743 26856 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_08080 28419 27727 gene locus_tag LOCUS_08090 gene ftsE 28419 27727 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_08090 29665 28571 gene locus_tag LOCUS_08100 gene csaB 29665 28571 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_08100 31808 29658 gene locus_tag LOCUS_08110 31808 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 32922 31912 gene locus_tag LOCUS_08120 gene prfB 32922 31912 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096948712.1 protein_id gnl|my_center|LOCUS_08120 35680 33140 gene locus_tag LOCUS_08130 gene secA 35680 33140 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_08130 36557 36006 gene locus_tag LOCUS_08140 gene raiA 36557 36006 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_08140 37648 36908 gene locus_tag LOCUS_08150 37648 36908 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_08150 38301 37645 gene locus_tag LOCUS_08160 38301 37645 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462201.1 protein_id gnl|my_center|LOCUS_08160 39355 38585 gene locus_tag LOCUS_08170 39355 38585 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_08170 40300 39485 gene locus_tag LOCUS_08180 40300 39485 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_08180 41284 40478 gene locus_tag LOCUS_08190 41284 40478 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence017 2 244 gene locus_tag LOCUS_08200 2 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 389 1987 gene locus_tag LOCUS_08210 389 1987 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_08210 4707 2164 gene locus_tag LOCUS_08220 4707 2164 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_08220 5270 4755 gene locus_tag LOCUS_08230 gene nrdG 5270 4755 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_08230 5861 6961 gene locus_tag LOCUS_08240 gene coxFIC1 5861 6961 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_08240 7410 14246 gene locus_tag LOCUS_08250 7410 14246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 16061 14520 gene locus_tag LOCUS_08260 16061 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 16483 17550 gene locus_tag LOCUS_08270 16483 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 17647 24768 gene locus_tag LOCUS_08280 17647 24768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 25217 27964 gene locus_tag LOCUS_08290 25217 27964 CDS product autotransporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787412.1 protein_id gnl|my_center|LOCUS_08290 28123 28728 gene locus_tag LOCUS_08300 gene coaE 28123 28728 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816768.1 protein_id gnl|my_center|LOCUS_08300 29536 28931 gene locus_tag LOCUS_08310 29536 28931 CDS product DUF1847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869954.1 protein_id gnl|my_center|LOCUS_08310 30033 29623 gene locus_tag LOCUS_08320 30033 29623 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_08320 30410 30841 gene locus_tag LOCUS_08330 30410 30841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 31615 30962 gene locus_tag LOCUS_08340 31615 30962 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_08340 31683 32396 gene locus_tag LOCUS_08350 31683 32396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 32573 33064 gene locus_tag LOCUS_08360 gene purE 32573 33064 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_08360 33118 34179 gene locus_tag LOCUS_08370 gene purM 33118 34179 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_08370 34172 34780 gene locus_tag LOCUS_08380 gene purN 34172 34780 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880522.1 protein_id gnl|my_center|LOCUS_08380 34905 35498 gene locus_tag LOCUS_08390 34905 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 35573 36850 gene locus_tag LOCUS_08400 gene purD 35573 36850 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_08400 37116 36916 gene locus_tag LOCUS_08410 37116 36916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 37224 38735 gene locus_tag LOCUS_08420 37224 38735 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423106.1 protein_id gnl|my_center|LOCUS_08420 38856 40511 gene locus_tag LOCUS_08430 38856 40511 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_08430 40672 40803 gene locus_tag LOCUS_08440 40672 40803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08440 40865 41140 gene locus_tag LOCUS_08450 40865 41140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08450 >Feature sequence018 1348 2 gene locus_tag LOCUS_08460 1348 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2484 1345 gene locus_tag LOCUS_08470 2484 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 2782 2510 gene locus_tag LOCUS_08480 2782 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2751 2918 gene locus_tag LOCUS_08490 2751 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5391 3010 gene locus_tag LOCUS_08500 gene topB 5391 3010 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235807.1 protein_id gnl|my_center|LOCUS_08500 5529 5765 gene locus_tag LOCUS_08510 5529 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5835 6059 gene locus_tag LOCUS_08520 5835 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6850 6548 gene locus_tag LOCUS_08530 6850 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9485 6837 gene locus_tag LOCUS_08540 9485 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9717 10262 gene locus_tag LOCUS_08550 9717 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10984 10412 gene locus_tag LOCUS_08560 10984 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 10944 11099 gene locus_tag LOCUS_08570 10944 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11099 11320 gene locus_tag LOCUS_08580 11099 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 12835 11327 gene locus_tag LOCUS_08590 12835 11327 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_08590 13292 12858 gene locus_tag LOCUS_08600 13292 12858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 14378 13380 gene locus_tag LOCUS_08610 14378 13380 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494482.1 protein_id gnl|my_center|LOCUS_08610 14950 14396 gene locus_tag LOCUS_08620 14950 14396 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_08620 15991 15020 gene locus_tag LOCUS_08630 15991 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17052 16027 gene locus_tag LOCUS_08640 gene dmpG 17052 16027 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257235.1 protein_id gnl|my_center|LOCUS_08640 17273 18241 gene locus_tag LOCUS_08650 17273 18241 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966633.1 protein_id gnl|my_center|LOCUS_08650 19394 18342 gene locus_tag LOCUS_08660 gene ansB 19394 18342 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171031.1 protein_id gnl|my_center|LOCUS_08660 20375 19437 gene locus_tag LOCUS_08670 20375 19437 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_08670 20685 21992 gene locus_tag LOCUS_08680 20685 21992 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_08680 22504 22085 gene locus_tag LOCUS_08690 22504 22085 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935469.1 protein_id gnl|my_center|LOCUS_08690 23503 22745 gene locus_tag LOCUS_08700 23503 22745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08700 24292 23504 gene locus_tag LOCUS_08710 24292 23504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_08710 25888 24320 gene locus_tag LOCUS_08720 25888 24320 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901104.1 protein_id gnl|my_center|LOCUS_08720 26859 26002 gene locus_tag LOCUS_08730 26859 26002 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385766.1 protein_id gnl|my_center|LOCUS_08730 27800 26856 gene locus_tag LOCUS_08740 27800 26856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_08740 28692 27940 gene locus_tag LOCUS_08750 28692 27940 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_08750 29653 28958 gene locus_tag LOCUS_08760 29653 28958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 31108 29744 gene locus_tag LOCUS_08770 31108 29744 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_08770 32181 31117 gene locus_tag LOCUS_08780 32181 31117 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_08780 32816 32199 gene locus_tag LOCUS_08790 32816 32199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 33523 32894 gene locus_tag LOCUS_08800 33523 32894 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_08800 34717 33614 gene locus_tag LOCUS_08810 34717 33614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 36037 34868 gene locus_tag LOCUS_08820 36037 34868 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679610.1 protein_id gnl|my_center|LOCUS_08820 36306 37163 gene locus_tag LOCUS_08830 36306 37163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 38162 37254 gene locus_tag LOCUS_08840 38162 37254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence019 2297 447 gene locus_tag LOCUS_08850 gene dnaK 2297 447 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_08850 3110 2430 gene locus_tag LOCUS_08860 gene grpE 3110 2430 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721982.1 protein_id gnl|my_center|LOCUS_08860 4230 3202 gene locus_tag LOCUS_08870 gene hrcA 4230 3202 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_08870 6794 4653 gene locus_tag LOCUS_08880 6794 4653 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_08880 8202 6820 gene locus_tag LOCUS_08890 8202 6820 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978237.1 protein_id gnl|my_center|LOCUS_08890 9472 8255 gene locus_tag LOCUS_08900 gene hemW 9472 8255 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_08900 11350 9545 gene locus_tag LOCUS_08910 gene lepA 11350 9545 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_08910 11519 11782 gene locus_tag LOCUS_08920 gene rpsT 11519 11782 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229989.1 protein_id gnl|my_center|LOCUS_08920 12385 11912 gene locus_tag LOCUS_08930 gene nrdR 12385 11912 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459010.1 protein_id gnl|my_center|LOCUS_08930 13646 12462 gene locus_tag LOCUS_08940 gene ftsZ 13646 12462 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_08940 14067 13738 gene locus_tag LOCUS_08950 14067 13738 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_08950 14903 14064 gene locus_tag LOCUS_08960 14903 14064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 15780 15010 gene locus_tag LOCUS_08970 15780 15010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 16737 15796 gene locus_tag LOCUS_08980 16737 15796 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_08980 18124 16739 gene locus_tag LOCUS_08990 gene murC 18124 16739 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392363.1 protein_id gnl|my_center|LOCUS_08990 19373 18261 gene locus_tag LOCUS_09000 gene murG 19373 18261 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_09000 20807 19452 gene locus_tag LOCUS_09010 gene murD 20807 19452 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_09010 21783 20809 gene locus_tag LOCUS_09020 gene mraY 21783 20809 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_09020 23294 21927 gene locus_tag LOCUS_09030 23294 21927 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_09030 24778 23291 gene locus_tag LOCUS_09040 gene murE 24778 23291 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766313.1 protein_id gnl|my_center|LOCUS_09040 25362 24982 gene locus_tag LOCUS_09050 25362 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 26362 25427 gene locus_tag LOCUS_09060 gene rsmH 26362 25427 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_09060 26801 26373 gene locus_tag LOCUS_09070 gene mraZ 26801 26373 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_09070 27156 27395 gene locus_tag LOCUS_09080 27156 27395 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813569.1 protein_id gnl|my_center|LOCUS_09080 28220 27480 gene locus_tag LOCUS_09090 28220 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 29159 28695 gene locus_tag LOCUS_09100 gene folK 29159 28695 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_09100 30400 29162 gene locus_tag LOCUS_09110 gene folP 30400 29162 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948526.1 protein_id gnl|my_center|LOCUS_09110 31203 30400 gene locus_tag LOCUS_09120 gene folE2 31203 30400 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082504.1 protein_id gnl|my_center|LOCUS_09120 31664 31287 gene locus_tag LOCUS_09130 gene queD 31664 31287 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582987.1 protein_id gnl|my_center|LOCUS_09130 32182 31661 gene locus_tag LOCUS_09140 gene trmL 32182 31661 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_09140 33294 32233 gene locus_tag LOCUS_09150 33294 32233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 33537 34211 gene locus_tag LOCUS_09160 33537 34211 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence020 23048 3438 gene locus_tag LOCUS_09170 23048 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 23808 23458 gene locus_tag LOCUS_09180 23808 23458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 24111 23938 gene locus_tag LOCUS_09190 24111 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 24351 24130 gene locus_tag LOCUS_09200 24351 24130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 24703 24479 gene locus_tag LOCUS_09210 24703 24479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 25490 24849 gene locus_tag LOCUS_09220 25490 24849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 26033 25677 gene locus_tag LOCUS_09230 26033 25677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 26426 27130 gene locus_tag LOCUS_09240 26426 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 27118 28251 gene locus_tag LOCUS_09250 27118 28251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 28342 29421 gene locus_tag LOCUS_09260 28342 29421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 29414 30832 gene locus_tag LOCUS_09270 gene dnaB 29414 30832 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_09270 <33182 30963 gene locus_tag LOCUS_09280 <33182 30963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861232.1:EAL domain-containing protein >Feature sequence021 1223 720 gene locus_tag LOCUS_09290 gene ilvN 1223 720 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810756.1 protein_id gnl|my_center|LOCUS_09290 2958 1603 gene locus_tag LOCUS_09300 2958 1603 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_09300 3797 3021 gene locus_tag LOCUS_09310 3797 3021 CDS product histidinol phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966014.1 protein_id gnl|my_center|LOCUS_09310 4974 3868 gene locus_tag LOCUS_09320 gene ychF 4974 3868 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815179.1 protein_id gnl|my_center|LOCUS_09320 6070 5285 gene locus_tag LOCUS_09330 6070 5285 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_09330 6407 6207 gene locus_tag LOCUS_09340 6407 6207 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_09340 7068 6409 gene locus_tag LOCUS_09350 7068 6409 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_09350 7857 7147 gene locus_tag LOCUS_09360 7857 7147 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_09360 8638 7862 gene locus_tag LOCUS_09370 8638 7862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_09370 9578 8631 gene locus_tag LOCUS_09380 9578 8631 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_09380 10484 9591 gene locus_tag LOCUS_09390 10484 9591 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_09390 11789 10605 gene locus_tag LOCUS_09400 11789 10605 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_09400 12735 12040 gene locus_tag LOCUS_09410 12735 12040 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_09410 13799 12783 gene locus_tag LOCUS_09420 13799 12783 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_09420 14553 13792 gene locus_tag LOCUS_09430 14553 13792 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_09430 15550 14672 gene locus_tag LOCUS_09440 gene noc 15550 14672 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_09440 16444 15665 gene locus_tag LOCUS_09450 gene rsmG 16444 15665 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_09450 18327 16441 gene locus_tag LOCUS_09460 gene mnmG 18327 16441 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_09460 19716 18334 gene locus_tag LOCUS_09470 gene mnmE 19716 18334 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831768.1 protein_id gnl|my_center|LOCUS_09470 20757 19780 gene locus_tag LOCUS_09480 20757 19780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 21511 20792 gene locus_tag LOCUS_09490 21511 20792 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462332.1 protein_id gnl|my_center|LOCUS_09490 21772 21539 gene locus_tag LOCUS_09500 gene yidD 21772 21539 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016065.1 protein_id gnl|my_center|LOCUS_09500 22134 21778 gene locus_tag LOCUS_09510 gene rnpA 22134 21778 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 protein_id gnl|my_center|LOCUS_09510 22543 23904 gene locus_tag LOCUS_09520 gene dnaA 22543 23904 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_09520 24185 25297 gene locus_tag LOCUS_09530 gene dnaN 24185 25297 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486165.1 protein_id gnl|my_center|LOCUS_09530 25301 26431 gene locus_tag LOCUS_09540 gene recF 25301 26431 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288363.1 protein_id gnl|my_center|LOCUS_09540 26432 27262 gene locus_tag LOCUS_09550 26432 27262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 27323 29344 gene locus_tag LOCUS_09560 gene gyrB 27323 29344 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_09560 29415 29726 gene locus_tag LOCUS_09570 29415 29726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 29723 30451 gene locus_tag LOCUS_09580 29723 30451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 30514 33036 gene locus_tag LOCUS_09590 gene gyrA 30514 33036 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815130.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence022 <1 1329 gene locus_tag LOCUS_09600 <1 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460410.1:proline--tRNA ligase 1360 2079 gene locus_tag LOCUS_09610 1360 2079 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811443.1 protein_id gnl|my_center|LOCUS_09610 2099 5833 gene locus_tag LOCUS_09620 2099 5833 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_09620 5991 6467 gene locus_tag LOCUS_09630 5991 6467 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_09630 6483 7556 gene locus_tag LOCUS_09640 6483 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7553 7819 gene locus_tag LOCUS_09650 7553 7819 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_09650 7812 8117 gene locus_tag LOCUS_09660 7812 8117 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041387.1 protein_id gnl|my_center|LOCUS_09660 8784 9086 gene locus_tag LOCUS_09670 8784 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 9086 11104 gene locus_tag LOCUS_09680 9086 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 11150 11488 gene locus_tag LOCUS_09690 gene rbfA 11150 11488 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_09690 11481 12434 gene locus_tag LOCUS_09700 11481 12434 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_09700 12431 13321 gene locus_tag LOCUS_09710 gene truB 12431 13321 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775585.1 protein_id gnl|my_center|LOCUS_09710 13397 14353 gene locus_tag LOCUS_09720 gene ribF 13397 14353 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245551.1 protein_id gnl|my_center|LOCUS_09720 14562 14828 gene locus_tag LOCUS_09730 gene rpsO 14562 14828 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_09730 14948 16345 gene locus_tag LOCUS_09740 14948 16345 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_09740 16356 16883 gene locus_tag LOCUS_09750 gene cobO 16356 16883 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_09750 17000 18331 gene locus_tag LOCUS_09760 gene der 17000 18331 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_09760 18346 18960 gene locus_tag LOCUS_09770 gene plsY 18346 18960 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_09770 19062 19553 gene locus_tag LOCUS_09780 19062 19553 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_09780 19641 20945 gene locus_tag LOCUS_09790 19641 20945 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_09790 20963 21892 gene locus_tag LOCUS_09800 gene thrB 20963 21892 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816738.1 protein_id gnl|my_center|LOCUS_09800 22018 22094 gene locus_tag LOCUS_t00090 22018 22094 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22376 24367 gene locus_tag LOCUS_09810 22376 24367 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387003.1 protein_id gnl|my_center|LOCUS_09810 24541 25293 gene locus_tag LOCUS_09820 24541 25293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 28410 25432 gene locus_tag LOCUS_09830 28410 25432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 28696 29415 gene locus_tag LOCUS_09840 28696 29415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 29479 31089 gene locus_tag LOCUS_09850 29479 31089 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_09850 31093 31830 gene locus_tag LOCUS_09860 31093 31830 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence023 1166 762 gene locus_tag LOCUS_09870 1166 762 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052491.1 protein_id gnl|my_center|LOCUS_09870 1467 1153 gene locus_tag LOCUS_09880 1467 1153 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052490.1 protein_id gnl|my_center|LOCUS_09880 1732 2922 gene locus_tag LOCUS_09890 1732 2922 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_09890 3752 4390 gene locus_tag LOCUS_09900 3752 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 4427 5548 gene locus_tag LOCUS_09910 gene phnA 4427 5548 CDS product phosphonoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061791.1 protein_id gnl|my_center|LOCUS_09910 6219 6794 gene locus_tag LOCUS_09920 6219 6794 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891255.1 protein_id gnl|my_center|LOCUS_09920 6874 7245 gene locus_tag LOCUS_09930 6874 7245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 7421 7496 gene locus_tag LOCUS_t00100 7421 7496 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8075 7836 gene locus_tag LOCUS_09940 8075 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 8344 8419 gene locus_tag LOCUS_t00110 8344 8419 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8995 8492 gene locus_tag LOCUS_09950 8995 8492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 10209 9145 gene locus_tag LOCUS_09960 10209 9145 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 protein_id gnl|my_center|LOCUS_09960 10923 10348 gene locus_tag LOCUS_09970 10923 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 11323 12342 gene locus_tag LOCUS_09980 11323 12342 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_09980 12576 13460 gene locus_tag LOCUS_09990 12576 13460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_09990 13460 14257 gene locus_tag LOCUS_10000 13460 14257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_10000 14390 15334 gene locus_tag LOCUS_10010 14390 15334 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_10010 15649 15722 gene locus_tag LOCUS_t00120 15649 15722 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16770 15856 gene locus_tag LOCUS_10020 16770 15856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 17132 18031 gene locus_tag LOCUS_10030 17132 18031 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_10030 18744 18337 gene locus_tag LOCUS_10040 18744 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 18734 19459 gene locus_tag LOCUS_10050 18734 19459 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811530.1 protein_id gnl|my_center|LOCUS_10050 19492 21387 gene locus_tag LOCUS_10060 19492 21387 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949159.1 protein_id gnl|my_center|LOCUS_10060 21420 22136 gene locus_tag LOCUS_10070 gene trmB 21420 22136 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723580.1 protein_id gnl|my_center|LOCUS_10070 22239 23435 gene locus_tag LOCUS_10080 gene ftsW 22239 23435 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_10080 23435 25459 gene locus_tag LOCUS_10090 23435 25459 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_10090 25563 27233 gene locus_tag LOCUS_10100 25563 27233 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_10100 27333 28163 gene locus_tag LOCUS_10110 gene folD 27333 28163 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_10110 28175 28600 gene locus_tag LOCUS_10120 28175 28600 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460983.1 protein_id gnl|my_center|LOCUS_10120 28774 29625 gene locus_tag LOCUS_10130 28774 29625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 30665 29805 gene locus_tag LOCUS_10140 30665 29805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence024 <1 568 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcacctctcgcgaggtgcgac 1025 735 gene locus_tag LOCUS_10150 gene cas2 1025 735 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_10150 2063 1029 gene locus_tag LOCUS_10160 gene cas1c 2063 1029 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 protein_id gnl|my_center|LOCUS_10160 2590 2060 gene locus_tag LOCUS_10170 gene cas4 2590 2060 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_10170 3608 2709 gene locus_tag LOCUS_10180 gene cas7c 3608 2709 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_10180 3744 3610 gene locus_tag LOCUS_10190 3744 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5412 3847 gene locus_tag LOCUS_10200 gene cas8c 5412 3847 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_10200 6147 5413 gene locus_tag LOCUS_10210 gene cas5c 6147 5413 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922512.1 protein_id gnl|my_center|LOCUS_10210 8510 6150 gene locus_tag LOCUS_10220 8510 6150 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_10220 9960 8995 gene locus_tag LOCUS_10230 9960 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 11415 10126 gene locus_tag LOCUS_10240 11415 10126 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_10240 13438 11654 gene locus_tag LOCUS_10250 13438 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14840 13626 gene locus_tag LOCUS_10260 gene dinB 14840 13626 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_10260 15359 14979 gene locus_tag LOCUS_10270 15359 14979 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679681.1 protein_id gnl|my_center|LOCUS_10270 15569 15393 gene locus_tag LOCUS_10280 15569 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 16136 15675 gene locus_tag LOCUS_10290 16136 15675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 16438 16680 gene locus_tag LOCUS_10300 16438 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 17949 16966 gene locus_tag LOCUS_10310 gene hypE 17949 16966 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880633.1 protein_id gnl|my_center|LOCUS_10310 19064 18030 gene locus_tag LOCUS_10320 gene hypD 19064 18030 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393664.1 protein_id gnl|my_center|LOCUS_10320 19392 19057 gene locus_tag LOCUS_10330 19392 19057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 21836 19383 gene locus_tag LOCUS_10340 gene hypF 21836 19383 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925864.1 protein_id gnl|my_center|LOCUS_10340 22376 21972 gene locus_tag LOCUS_10350 22376 21972 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016827.1 protein_id gnl|my_center|LOCUS_10350 23057 22407 gene locus_tag LOCUS_10360 gene hypB 23057 22407 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225636.1 protein_id gnl|my_center|LOCUS_10360 23484 23107 gene locus_tag LOCUS_10370 gene hypA 23484 23107 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869710.1 protein_id gnl|my_center|LOCUS_10370 24007 23549 gene locus_tag LOCUS_10380 24007 23549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 25172 24087 gene locus_tag LOCUS_10390 25172 24087 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_10390 25668 25174 gene locus_tag LOCUS_10400 25668 25174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 26174 25665 gene locus_tag LOCUS_10410 26174 25665 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_10410 27068 26193 gene locus_tag LOCUS_10420 27068 26193 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_10420 28965 27061 gene locus_tag LOCUS_10430 28965 27061 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937741.1 protein_id gnl|my_center|LOCUS_10430 29595 29137 gene locus_tag LOCUS_10440 29595 29137 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905176.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence025 3030 3959 gene locus_tag LOCUS_10450 3030 3959 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948895.1 protein_id gnl|my_center|LOCUS_10450 5112 4456 gene locus_tag LOCUS_10460 gene yihA 5112 4456 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_10460 6549 5173 gene locus_tag LOCUS_10470 6549 5173 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_10470 8936 6612 gene locus_tag LOCUS_10480 gene lon 8936 6612 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_10480 10128 8950 gene locus_tag LOCUS_10490 gene clpX 10128 8950 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_10490 10835 10245 gene locus_tag LOCUS_10500 gene clpP 10835 10245 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_10500 12241 10943 gene locus_tag LOCUS_10510 gene tig 12241 10943 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_10510 12600 12525 gene locus_tag LOCUS_t00130 12600 12525 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14372 12819 gene locus_tag LOCUS_10520 14372 12819 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_10520 17988 14479 gene locus_tag LOCUS_10530 gene nifJ 17988 14479 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_10530 18252 18773 gene locus_tag LOCUS_10540 18252 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 20121 18952 gene locus_tag LOCUS_10550 20121 18952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 20361 20278 gene locus_tag LOCUS_t00140 20361 20278 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20571 20496 gene locus_tag LOCUS_t00150 20571 20496 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20651 20576 gene locus_tag LOCUS_t00160 20651 20576 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20743 20664 gene locus_tag LOCUS_t00170 20743 20664 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21033 21983 gene locus_tag LOCUS_10560 21033 21983 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810938.1 protein_id gnl|my_center|LOCUS_10560 22582 22139 gene locus_tag LOCUS_10570 22582 22139 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227162.1 protein_id gnl|my_center|LOCUS_10570 23004 22600 gene locus_tag LOCUS_10580 23004 22600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 23566 23084 gene locus_tag LOCUS_10590 23566 23084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 24226 23768 gene locus_tag LOCUS_10600 24226 23768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 24421 25125 gene locus_tag LOCUS_10610 24421 25125 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328113.1 protein_id gnl|my_center|LOCUS_10610 25128 25901 gene locus_tag LOCUS_10620 25128 25901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 26011 27138 gene locus_tag LOCUS_10630 26011 27138 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_10630 27236 28612 gene locus_tag LOCUS_10640 gene dcuC 27236 28612 CDS product anaerobic C4-dicarboxylate transporter DcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467018.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence026 1654 923 gene locus_tag LOCUS_10650 1654 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2585 1881 gene locus_tag LOCUS_10660 2585 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3298 2957 gene locus_tag LOCUS_10670 3298 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3456 4655 gene locus_tag LOCUS_10680 gene nagZ 3456 4655 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_10680 5224 4748 gene locus_tag LOCUS_10690 5224 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6502 5276 gene locus_tag LOCUS_10700 6502 5276 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816160.1 protein_id gnl|my_center|LOCUS_10700 6784 6709 gene locus_tag LOCUS_t00180 6784 6709 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7262 6840 gene locus_tag LOCUS_10710 7262 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 7483 7325 gene locus_tag LOCUS_10720 7483 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8256 7483 gene locus_tag LOCUS_10730 8256 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 8800 9174 gene locus_tag LOCUS_10740 8800 9174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 9290 10498 gene locus_tag LOCUS_10750 gene dpaL 9290 10498 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047950.1 protein_id gnl|my_center|LOCUS_10750 13432 10730 gene locus_tag LOCUS_10760 13432 10730 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_10760 13819 13448 gene locus_tag LOCUS_10770 13819 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 15078 14179 gene locus_tag LOCUS_10780 15078 14179 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433828.1 protein_id gnl|my_center|LOCUS_10780 15541 15143 gene locus_tag LOCUS_10790 15541 15143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 15843 17123 gene locus_tag LOCUS_10800 gene ablA 15843 17123 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_10800 18018 17344 gene locus_tag LOCUS_10810 gene hisIE 18018 17344 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_10810 18776 18018 gene locus_tag LOCUS_10820 gene hisF 18776 18018 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817210.1 protein_id gnl|my_center|LOCUS_10820 19686 18952 gene locus_tag LOCUS_10830 gene hisA 19686 18952 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_10830 20374 19766 gene locus_tag LOCUS_10840 gene hisH 20374 19766 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880441.1 protein_id gnl|my_center|LOCUS_10840 21063 20455 gene locus_tag LOCUS_10850 gene hisB 21063 20455 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964256.1 protein_id gnl|my_center|LOCUS_10850 22261 21047 gene locus_tag LOCUS_10860 gene hisC 22261 21047 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927011.1 protein_id gnl|my_center|LOCUS_10860 23719 22370 gene locus_tag LOCUS_10870 gene hisD 23719 22370 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461463.1 protein_id gnl|my_center|LOCUS_10870 24405 23746 gene locus_tag LOCUS_10880 gene hisG 24405 23746 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817216.1 protein_id gnl|my_center|LOCUS_10880 25653 24481 gene locus_tag LOCUS_10890 gene hisZ 25653 24481 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393533.1 protein_id gnl|my_center|LOCUS_10890 26026 25646 gene locus_tag LOCUS_10900 26026 25646 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_10900 27053 26391 gene locus_tag LOCUS_10910 27053 26391 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_10910 28110 27043 gene locus_tag LOCUS_10920 28110 27043 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388546.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence027 1263 52 gene locus_tag LOCUS_10930 1263 52 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_10930 2134 1370 gene locus_tag LOCUS_10940 gene cobK 2134 1370 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392609.1 protein_id gnl|my_center|LOCUS_10940 2865 2131 gene locus_tag LOCUS_10950 gene cobJ 2865 2131 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_10950 3941 2895 gene locus_tag LOCUS_10960 gene cbiG 3941 2895 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681802.1 protein_id gnl|my_center|LOCUS_10960 4754 3948 gene locus_tag LOCUS_10970 gene cobM 4754 3948 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_10970 5455 4754 gene locus_tag LOCUS_10980 gene cobI 5455 4754 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_10980 6716 5520 gene locus_tag LOCUS_10990 gene cbiD 6716 5520 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861964.1 protein_id gnl|my_center|LOCUS_10990 7253 7897 gene locus_tag LOCUS_11000 7253 7897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 9265 8072 gene locus_tag LOCUS_11010 9265 8072 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438357.1 protein_id gnl|my_center|LOCUS_11010 10484 9513 gene locus_tag LOCUS_11020 10484 9513 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390092.1 protein_id gnl|my_center|LOCUS_11020 11675 10608 gene locus_tag LOCUS_11030 11675 10608 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_11030 12511 11738 gene locus_tag LOCUS_11040 gene codY 12511 11738 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810676.1 protein_id gnl|my_center|LOCUS_11040 13459 12542 gene locus_tag LOCUS_11050 gene xerC 13459 12542 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707683.1 protein_id gnl|my_center|LOCUS_11050 15008 13671 gene locus_tag LOCUS_11060 gene trmFO 15008 13671 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_11060 17291 15048 gene locus_tag LOCUS_11070 gene topA 17291 15048 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813282.1 protein_id gnl|my_center|LOCUS_11070 18500 17394 gene locus_tag LOCUS_11080 gene dprA 18500 17394 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_11080 19799 18621 gene locus_tag LOCUS_11090 19799 18621 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_11090 20059 21267 gene locus_tag LOCUS_11100 gene hydF 20059 21267 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_11100 22099 21500 gene locus_tag LOCUS_11110 22099 21500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 22960 22259 gene locus_tag LOCUS_11120 22960 22259 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_11120 25138 23063 gene locus_tag LOCUS_11130 gene recG 25138 23063 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_11130 25400 25588 gene locus_tag LOCUS_11140 gene rpmB 25400 25588 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_11140 26386 25913 gene locus_tag LOCUS_11150 26386 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 <27697 26561 gene locus_tag LOCUS_11160 <27697 26561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986783.1:ribonuclease Y >Feature sequence028 2664 1279 gene locus_tag LOCUS_11170 gene dnaB 2664 1279 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_11170 3163 2711 gene locus_tag LOCUS_11180 gene rplI 3163 2711 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_11180 5216 3141 gene locus_tag LOCUS_11190 5216 3141 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643610.1 protein_id gnl|my_center|LOCUS_11190 6222 5227 gene locus_tag LOCUS_11200 6222 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7829 6468 gene locus_tag LOCUS_11210 7829 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8064 9026 gene locus_tag LOCUS_11220 gene gluQRS 8064 9026 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_11220 9308 9030 gene locus_tag LOCUS_11230 9308 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9628 10281 gene locus_tag LOCUS_11240 9628 10281 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039553.1 protein_id gnl|my_center|LOCUS_11240 11544 10354 gene locus_tag LOCUS_11250 11544 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 12721 11648 gene locus_tag LOCUS_11260 gene mnmA 12721 11648 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_11260 13334 12753 gene locus_tag LOCUS_11270 13334 12753 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_11270 13859 13422 gene locus_tag LOCUS_11280 13859 13422 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_11280 14540 14142 gene locus_tag LOCUS_11290 14540 14142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 14816 14971 gene locus_tag LOCUS_11300 14816 14971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 15105 15641 gene locus_tag LOCUS_11310 15105 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 17118 15841 gene locus_tag LOCUS_11320 17118 15841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 17495 18028 gene locus_tag LOCUS_11330 17495 18028 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_11330 18058 19167 gene locus_tag LOCUS_11340 18058 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 19248 20519 gene locus_tag LOCUS_11350 19248 20519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 20799 21449 gene locus_tag LOCUS_11360 20799 21449 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_11360 22282 21452 gene locus_tag LOCUS_11370 22282 21452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 23222 22419 gene locus_tag LOCUS_11380 23222 22419 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044986.1 protein_id gnl|my_center|LOCUS_11380 23708 24325 gene locus_tag LOCUS_11390 23708 24325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 25857 24466 gene locus_tag LOCUS_11400 25857 24466 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_11400 26410 25985 gene locus_tag LOCUS_11410 26410 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 26597 26403 gene locus_tag LOCUS_11420 26597 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 <27486 26888 gene locus_tag LOCUS_11430 <27486 26888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392674.1:fibronectin type III domain-containing protein >Feature sequence029 402 1946 gene locus_tag LOCUS_11440 402 1946 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_11440 2038 2454 gene locus_tag LOCUS_11450 2038 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2551 4209 gene locus_tag LOCUS_11460 gene argS 2551 4209 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_11460 4385 6001 gene locus_tag LOCUS_11470 4385 6001 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_11470 6143 7765 gene locus_tag LOCUS_11480 6143 7765 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_11480 7828 11097 gene locus_tag LOCUS_11490 gene mfd 7828 11097 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_11490 11155 12729 gene locus_tag LOCUS_11500 11155 12729 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_11500 12762 14348 gene locus_tag LOCUS_11510 gene mazG 12762 14348 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_11510 14448 14828 gene locus_tag LOCUS_11520 14448 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 14907 15338 gene locus_tag LOCUS_11530 14907 15338 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809726.1 protein_id gnl|my_center|LOCUS_11530 15438 16883 gene locus_tag LOCUS_11540 gene tilS 15438 16883 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_11540 16898 17440 gene locus_tag LOCUS_11550 gene hpt 16898 17440 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_11550 17501 19342 gene locus_tag LOCUS_11560 gene ftsH 17501 19342 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942598.1 protein_id gnl|my_center|LOCUS_11560 19398 20399 gene locus_tag LOCUS_11570 19398 20399 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942580.1 protein_id gnl|my_center|LOCUS_11570 20490 21266 gene locus_tag LOCUS_11580 20490 21266 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_11580 21382 22302 gene locus_tag LOCUS_11590 gene dusB 21382 22302 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_11590 22365 23303 gene locus_tag LOCUS_11600 22365 23303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_11600 23317 24381 gene locus_tag LOCUS_11610 23317 24381 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_11610 24563 25048 gene locus_tag LOCUS_11620 gene greA 24563 25048 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809765.1 protein_id gnl|my_center|LOCUS_11620 25068 26618 gene locus_tag LOCUS_11630 gene lysS 25068 26618 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391699.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence030 6007 5120 gene locus_tag LOCUS_11640 6007 5120 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957176.1 protein_id gnl|my_center|LOCUS_11640 6558 7616 gene locus_tag LOCUS_11650 6558 7616 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_11650 7882 7667 gene locus_tag LOCUS_11660 7882 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 9894 8125 gene locus_tag LOCUS_11670 gene pnbA 9894 8125 CDS product para-nitrobenzyl esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243926.1 protein_id gnl|my_center|LOCUS_11670 11974 10184 gene locus_tag LOCUS_11680 gene aspS 11974 10184 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460332.1 protein_id gnl|my_center|LOCUS_11680 13250 11967 gene locus_tag LOCUS_11690 gene hisS 13250 11967 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_11690 14546 13338 gene locus_tag LOCUS_11700 14546 13338 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599181.1 protein_id gnl|my_center|LOCUS_11700 15243 14629 gene locus_tag LOCUS_11710 15243 14629 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_11710 17498 15240 gene locus_tag LOCUS_11720 17498 15240 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_11720 20001 17632 gene locus_tag LOCUS_11730 gene recJ 20001 17632 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941223.1 protein_id gnl|my_center|LOCUS_11730 20918 20259 gene locus_tag LOCUS_11740 20918 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 21042 21128 gene locus_tag LOCUS_t00190 21042 21128 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22146 21283 gene locus_tag LOCUS_11750 gene dat 22146 21283 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411084.1 protein_id gnl|my_center|LOCUS_11750 22802 22293 gene locus_tag LOCUS_11760 22802 22293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 23046 23306 gene locus_tag LOCUS_11770 23046 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 <26011 23374 gene locus_tag LOCUS_11780 <26011 23374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392382.1:isoleucine--tRNA ligase >Feature sequence031 1194 22 gene locus_tag LOCUS_11790 1194 22 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393979.1 protein_id gnl|my_center|LOCUS_11790 2216 1560 gene locus_tag LOCUS_11800 2216 1560 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434301.1 protein_id gnl|my_center|LOCUS_11800 3230 2439 gene locus_tag LOCUS_11810 3230 2439 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_11810 5522 3231 gene locus_tag LOCUS_11820 5522 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6523 5684 gene locus_tag LOCUS_11830 gene rsmI 6523 5684 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935362.1 protein_id gnl|my_center|LOCUS_11830 7298 6675 gene locus_tag LOCUS_11840 7298 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 8291 7509 gene locus_tag LOCUS_11850 8291 7509 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941299.1 protein_id gnl|my_center|LOCUS_11850 9219 8371 gene locus_tag LOCUS_11860 9219 8371 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_11860 10335 9289 gene locus_tag LOCUS_11870 gene holB 10335 9289 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_11870 10967 10347 gene locus_tag LOCUS_11880 gene tmk 10967 10347 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775041.1 protein_id gnl|my_center|LOCUS_11880 12571 11066 gene locus_tag LOCUS_11890 12571 11066 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_11890 13396 12713 gene locus_tag LOCUS_11900 13396 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 15015 13474 gene locus_tag LOCUS_11910 15015 13474 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436882.1 protein_id gnl|my_center|LOCUS_11910 15331 15188 gene locus_tag LOCUS_11920 15331 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 15551 15351 gene locus_tag LOCUS_11930 15551 15351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 16500 15763 gene locus_tag LOCUS_11940 16500 15763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 17055 16528 gene locus_tag LOCUS_11950 17055 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 18355 17162 gene locus_tag LOCUS_11960 18355 17162 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_11960 22098 18601 gene locus_tag LOCUS_11970 22098 18601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 22601 22104 gene locus_tag LOCUS_11980 22601 22104 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_11980 22710 22576 gene locus_tag LOCUS_11990 22710 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 23636 22773 gene locus_tag LOCUS_12000 23636 22773 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131418.1 protein_id gnl|my_center|LOCUS_12000 23971 23675 gene locus_tag LOCUS_12010 23971 23675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 24392 23997 gene locus_tag LOCUS_12020 24392 23997 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_12020 24867 24481 gene locus_tag LOCUS_12030 24867 24481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence032 553 2646 gene locus_tag LOCUS_12040 553 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4457 2790 gene locus_tag LOCUS_12050 4457 2790 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_12050 5874 4624 gene locus_tag LOCUS_12060 5874 4624 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_12060 7198 5969 gene locus_tag LOCUS_12070 7198 5969 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_12070 9782 7407 gene locus_tag LOCUS_12080 9782 7407 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_12080 10830 9868 gene locus_tag LOCUS_12090 10830 9868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 11115 13286 gene locus_tag LOCUS_12100 11115 13286 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948404.1 protein_id gnl|my_center|LOCUS_12100 16096 13499 gene locus_tag LOCUS_12110 16096 13499 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393214.1 protein_id gnl|my_center|LOCUS_12110 17035 16172 gene locus_tag LOCUS_12120 17035 16172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 18636 17158 gene locus_tag LOCUS_12130 gene gltX 18636 17158 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_12130 21326 18702 gene locus_tag LOCUS_12140 gene alaS 21326 18702 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_12140 24821 21615 gene locus_tag LOCUS_12150 24821 21615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence033 453 3275 gene locus_tag LOCUS_12160 453 3275 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861232.1 protein_id gnl|my_center|LOCUS_12160 3604 4377 gene locus_tag LOCUS_12170 gene artP 3604 4377 CDS product arginine ABC transporter substrate-binding protein ArtP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398706.1 protein_id gnl|my_center|LOCUS_12170 4432 5070 gene locus_tag LOCUS_12180 4432 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 5303 6676 gene locus_tag LOCUS_12190 5303 6676 CDS product EmmdR/YeeO family multidrug/toxin efflux MATE transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224723.1 protein_id gnl|my_center|LOCUS_12190 7822 6845 gene locus_tag LOCUS_12200 7822 6845 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836550.1 protein_id gnl|my_center|LOCUS_12200 8047 9072 gene locus_tag LOCUS_12210 8047 9072 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626531.1 protein_id gnl|my_center|LOCUS_12210 9178 10521 gene locus_tag LOCUS_12220 9178 10521 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_12220 10800 12416 gene locus_tag LOCUS_12230 10800 12416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_12230 12544 13482 gene locus_tag LOCUS_12240 12544 13482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_12240 13487 14317 gene locus_tag LOCUS_12250 13487 14317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_12250 14332 15120 gene locus_tag LOCUS_12260 14332 15120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_12260 15113 16075 gene locus_tag LOCUS_12270 15113 16075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_12270 16469 19897 gene locus_tag LOCUS_12280 16469 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 20043 20834 gene locus_tag LOCUS_12290 20043 20834 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_12290 20887 21921 gene locus_tag LOCUS_12300 20887 21921 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784324.1 protein_id gnl|my_center|LOCUS_12300 22446 22637 gene locus_tag LOCUS_12310 22446 22637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 22704 22913 gene locus_tag LOCUS_12320 22704 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence034 <1 1673 gene locus_tag LOCUS_12330 <1 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965659.1:threonine--tRNA ligase 4726 1781 gene locus_tag LOCUS_12340 4726 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 8174 4947 gene locus_tag LOCUS_12350 8174 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 8418 9101 gene locus_tag LOCUS_12360 8418 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 10902 9217 gene locus_tag LOCUS_12370 10902 9217 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_12370 11041 10874 gene locus_tag LOCUS_12380 11041 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 12019 11075 gene locus_tag LOCUS_12390 12019 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 12912 12016 gene locus_tag LOCUS_12400 gene cdaA 12912 12016 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_12400 14561 13149 gene locus_tag LOCUS_12410 gene argH 14561 13149 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_12410 15790 14561 gene locus_tag LOCUS_12420 15790 14561 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_12420 16960 16019 gene locus_tag LOCUS_12430 gene argF 16960 16019 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808622.1 protein_id gnl|my_center|LOCUS_12430 17196 18200 gene locus_tag LOCUS_12440 17196 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 19145 18600 gene locus_tag LOCUS_12450 19145 18600 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148816.1 protein_id gnl|my_center|LOCUS_12450 20466 19291 gene locus_tag LOCUS_12460 20466 19291 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_12460 20634 20497 gene locus_tag LOCUS_12470 20634 20497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 20812 21705 gene locus_tag LOCUS_12480 20812 21705 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048395.1 protein_id gnl|my_center|LOCUS_12480 22321 23124 gene locus_tag LOCUS_12490 gene nagB 22321 23124 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_12490 23128 23790 gene locus_tag LOCUS_12500 23128 23790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence035 65 592 gene locus_tag LOCUS_12510 65 592 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_12510 659 2071 gene locus_tag LOCUS_12520 gene gltA 659 2071 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_12520 2306 2467 gene locus_tag LOCUS_12530 2306 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 2534 3217 gene locus_tag LOCUS_12540 2534 3217 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_12540 3240 3770 gene locus_tag LOCUS_12550 3240 3770 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_12550 3844 4023 gene locus_tag LOCUS_12560 3844 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 4027 4212 gene locus_tag LOCUS_12570 4027 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4178 5017 gene locus_tag LOCUS_12580 gene tatC 4178 5017 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392793.1 protein_id gnl|my_center|LOCUS_12580 5144 6025 gene locus_tag LOCUS_12590 5144 6025 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_12590 6103 6612 gene locus_tag LOCUS_12600 6103 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6682 7359 gene locus_tag LOCUS_12610 6682 7359 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_12610 7550 7990 gene locus_tag LOCUS_12620 7550 7990 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213348.1 protein_id gnl|my_center|LOCUS_12620 8004 9023 gene locus_tag LOCUS_12630 8004 9023 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_12630 9053 9676 gene locus_tag LOCUS_12640 9053 9676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 9697 10035 gene locus_tag LOCUS_12650 9697 10035 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355924.1 protein_id gnl|my_center|LOCUS_12650 10049 11158 gene locus_tag LOCUS_12660 10049 11158 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097679.1 protein_id gnl|my_center|LOCUS_12660 11247 11924 gene locus_tag LOCUS_12670 11247 11924 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_12670 11972 12445 gene locus_tag LOCUS_12680 11972 12445 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_12680 12714 13673 gene locus_tag LOCUS_12690 12714 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 14135 14398 gene locus_tag LOCUS_12700 14135 14398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 14668 15297 gene locus_tag LOCUS_12710 14668 15297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 15328 16227 gene locus_tag LOCUS_12720 15328 16227 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_12720 17206 16319 gene locus_tag LOCUS_12730 17206 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 17427 18710 gene locus_tag LOCUS_12740 17427 18710 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545236.1 protein_id gnl|my_center|LOCUS_12740 18824 19267 gene locus_tag LOCUS_12750 18824 19267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 19446 20333 gene locus_tag LOCUS_12760 19446 20333 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040419.1 protein_id gnl|my_center|LOCUS_12760 20406 21218 gene locus_tag LOCUS_12770 20406 21218 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850703.1 protein_id gnl|my_center|LOCUS_12770 21362 21814 gene locus_tag LOCUS_12780 21362 21814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 21963 22955 gene locus_tag LOCUS_12790 21963 22955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence036 475 585 gene locus_tag LOCUS_r00030 475 585 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1669 638 gene locus_tag LOCUS_12800 1669 638 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_12800 1997 2740 gene locus_tag LOCUS_12810 1997 2740 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_12810 2849 3397 gene locus_tag LOCUS_12820 gene ruvC 2849 3397 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_12820 3465 4076 gene locus_tag LOCUS_12830 gene ruvA 3465 4076 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229717.1 protein_id gnl|my_center|LOCUS_12830 4100 5149 gene locus_tag LOCUS_12840 gene ruvB 4100 5149 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_12840 5161 5829 gene locus_tag LOCUS_12850 5161 5829 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_12850 5860 7254 gene locus_tag LOCUS_12860 5860 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7336 8382 gene locus_tag LOCUS_12870 gene queA 7336 8382 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_12870 8398 9537 gene locus_tag LOCUS_12880 gene tgt 8398 9537 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001112045.1 protein_id gnl|my_center|LOCUS_12880 9647 9952 gene locus_tag LOCUS_12890 gene yajC 9647 9952 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_12890 9952 10563 gene locus_tag LOCUS_12900 9952 10563 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437817.1 protein_id gnl|my_center|LOCUS_12900 10653 11888 gene locus_tag LOCUS_12910 gene secD 10653 11888 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583952.1 protein_id gnl|my_center|LOCUS_12910 11885 12769 gene locus_tag LOCUS_12920 gene secF 11885 12769 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393192.1 protein_id gnl|my_center|LOCUS_12920 12984 13553 gene locus_tag LOCUS_12930 12984 13553 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141641.1 protein_id gnl|my_center|LOCUS_12930 13646 14656 gene locus_tag LOCUS_12940 13646 14656 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816443.1 protein_id gnl|my_center|LOCUS_12940 14646 15725 gene locus_tag LOCUS_12950 14646 15725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 15834 16736 gene locus_tag LOCUS_12960 gene era 15834 16736 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_12960 16738 18060 gene locus_tag LOCUS_12970 16738 18060 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_12970 18081 18827 gene locus_tag LOCUS_12980 gene recO 18081 18827 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487010.1 protein_id gnl|my_center|LOCUS_12980 19169 20047 gene locus_tag LOCUS_12990 gene glyQ 19169 20047 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392140.1 protein_id gnl|my_center|LOCUS_12990 20047 22101 gene locus_tag LOCUS_13000 gene glyS 20047 22101 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence037 <1 1074 gene locus_tag LOCUS_13010 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467000.1:anaerobic C4-dicarboxylate transporter DcuC 1205 2503 gene locus_tag LOCUS_13020 gene abgA 1205 2503 CDS product p-aminobenzoyl-glutamate hydrolase subunit AbgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444937.1 protein_id gnl|my_center|LOCUS_13020 2697 3926 gene locus_tag LOCUS_13030 2697 3926 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694560.1 protein_id gnl|my_center|LOCUS_13030 4177 4707 gene locus_tag LOCUS_13040 4177 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4808 5791 gene locus_tag LOCUS_13050 4808 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5847 7097 gene locus_tag LOCUS_13060 5847 7097 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903396.1 protein_id gnl|my_center|LOCUS_13060 7197 8990 gene locus_tag LOCUS_13070 7197 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9027 9620 gene locus_tag LOCUS_13080 9027 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 9913 11544 gene locus_tag LOCUS_13090 gene ilvB 9913 11544 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012310511.1 protein_id gnl|my_center|LOCUS_13090 11546 12028 gene locus_tag LOCUS_13100 gene ilvN 11546 12028 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_13100 12223 13935 gene locus_tag LOCUS_13110 12223 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 14179 14517 gene locus_tag LOCUS_13120 14179 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 14728 17943 gene locus_tag LOCUS_13130 gene carB 14728 17943 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_13130 18911 18045 gene locus_tag LOCUS_13140 18911 18045 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_13140 19290 20702 gene locus_tag LOCUS_13150 19290 20702 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461441.1 protein_id gnl|my_center|LOCUS_13150 22421 20898 gene locus_tag LOCUS_13160 22421 20898 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence038 310 1959 gene locus_tag LOCUS_13170 310 1959 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440013.1 protein_id gnl|my_center|LOCUS_13170 2084 2485 gene locus_tag LOCUS_13180 2084 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2541 3344 gene locus_tag LOCUS_13190 2541 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5223 3475 gene locus_tag LOCUS_13200 5223 3475 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863257.1 protein_id gnl|my_center|LOCUS_13200 5364 6050 gene locus_tag LOCUS_13210 5364 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 6068 6967 gene locus_tag LOCUS_13220 6068 6967 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_13220 6986 7249 gene locus_tag LOCUS_13230 6986 7249 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_13230 7246 7881 gene locus_tag LOCUS_13240 gene gmk 7246 7881 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_13240 7994 8182 gene locus_tag LOCUS_13250 7994 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 8209 9432 gene locus_tag LOCUS_13260 gene coaBC 8209 9432 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_13260 9661 10839 gene locus_tag LOCUS_13270 gene metK 9661 10839 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_13270 11067 11720 gene locus_tag LOCUS_13280 11067 11720 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392142.1 protein_id gnl|my_center|LOCUS_13280 11686 12537 gene locus_tag LOCUS_13290 11686 12537 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460836.1 protein_id gnl|my_center|LOCUS_13290 12602 13546 gene locus_tag LOCUS_13300 12602 13546 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816343.1 protein_id gnl|my_center|LOCUS_13300 13774 15570 gene locus_tag LOCUS_13310 gene dnaG 13774 15570 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_13310 15560 18211 gene locus_tag LOCUS_13320 15560 18211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 18429 18353 gene locus_tag LOCUS_t00200 18429 18353 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18744 19058 gene locus_tag LOCUS_13330 18744 19058 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_13330 19126 19824 gene locus_tag LOCUS_13340 19126 19824 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889262.1 protein_id gnl|my_center|LOCUS_13340 19880 20671 gene locus_tag LOCUS_13350 19880 20671 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660853.1 protein_id gnl|my_center|LOCUS_13350 20758 21678 gene locus_tag LOCUS_13360 gene yhaM 20758 21678 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_13360 22008 21778 gene locus_tag LOCUS_13370 22008 21778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence039 843 64 gene locus_tag LOCUS_13380 843 64 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_13380 1838 1026 gene locus_tag LOCUS_13390 1838 1026 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670448.1 protein_id gnl|my_center|LOCUS_13390 3004 1889 gene locus_tag LOCUS_13400 gene rihA 3004 1889 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207533.1 protein_id gnl|my_center|LOCUS_13400 3643 3164 gene locus_tag LOCUS_13410 gene rlmH 3643 3164 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202796170.1 protein_id gnl|my_center|LOCUS_13410 4986 3838 gene locus_tag LOCUS_13420 4986 3838 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542382.1 protein_id gnl|my_center|LOCUS_13420 5788 4964 gene locus_tag LOCUS_13430 5788 4964 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357943.1 protein_id gnl|my_center|LOCUS_13430 6504 5785 gene locus_tag LOCUS_13440 gene deoC 6504 5785 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_13440 6650 8815 gene locus_tag LOCUS_13450 6650 8815 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_13450 10198 9299 gene locus_tag LOCUS_13460 10198 9299 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393843.1 protein_id gnl|my_center|LOCUS_13460 10874 10191 gene locus_tag LOCUS_13470 10874 10191 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435254.1 protein_id gnl|my_center|LOCUS_13470 11215 10958 gene locus_tag LOCUS_13480 11215 10958 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963456.1 protein_id gnl|my_center|LOCUS_13480 11831 11226 gene locus_tag LOCUS_13490 gene recR 11831 11226 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_13490 12174 11833 gene locus_tag LOCUS_13500 12174 11833 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722063.1 protein_id gnl|my_center|LOCUS_13500 14293 12242 gene locus_tag LOCUS_13510 14293 12242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 14816 14556 gene locus_tag LOCUS_13520 14816 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 15385 15296 gene locus_tag LOCUS_t00210 15385 15296 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16354 15515 gene locus_tag LOCUS_13530 16354 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 17857 16454 gene locus_tag LOCUS_13540 17857 16454 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903800.1 protein_id gnl|my_center|LOCUS_13540 19261 17870 gene locus_tag LOCUS_13550 19261 17870 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_13550 21218 19455 gene locus_tag LOCUS_13560 21218 19455 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049572.1 protein_id gnl|my_center|LOCUS_13560 21621 21301 gene locus_tag LOCUS_13570 21621 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence040 311 1564 gene locus_tag LOCUS_13580 311 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1847 3085 gene locus_tag LOCUS_13590 1847 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 3427 5004 gene locus_tag LOCUS_13600 3427 5004 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201884.1 protein_id gnl|my_center|LOCUS_13600 5096 5323 gene locus_tag LOCUS_13610 5096 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 5645 5923 gene locus_tag LOCUS_13620 5645 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6294 7238 gene locus_tag LOCUS_13630 6294 7238 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651842.1 protein_id gnl|my_center|LOCUS_13630 7358 8863 gene locus_tag LOCUS_13640 gene preA 7358 8863 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_13640 9002 10240 gene locus_tag LOCUS_13650 9002 10240 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142216.1 protein_id gnl|my_center|LOCUS_13650 10393 11418 gene locus_tag LOCUS_13660 10393 11418 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_13660 11670 12989 gene locus_tag LOCUS_13670 11670 12989 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214414.1 protein_id gnl|my_center|LOCUS_13670 13072 13806 gene locus_tag LOCUS_13680 gene budA 13072 13806 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966250.1 protein_id gnl|my_center|LOCUS_13680 13946 15115 gene locus_tag LOCUS_13690 13946 15115 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_13690 15112 16068 gene locus_tag LOCUS_13700 15112 16068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 16073 18289 gene locus_tag LOCUS_13710 16073 18289 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_13710 18347 21070 gene locus_tag LOCUS_13720 18347 21070 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_13720 21250 21585 gene locus_tag LOCUS_13730 21250 21585 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence041 817 302 gene locus_tag LOCUS_13740 817 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1317 3275 gene locus_tag LOCUS_13750 1317 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3250 5718 gene locus_tag LOCUS_13760 3250 5718 CDS product restriction endonuclease-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459237.1 protein_id gnl|my_center|LOCUS_13760 6127 5753 gene locus_tag LOCUS_13770 6127 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6379 6188 gene locus_tag LOCUS_13780 6379 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6612 7661 gene locus_tag LOCUS_13790 6612 7661 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_13790 7805 8353 gene locus_tag LOCUS_13800 7805 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 8369 11764 gene locus_tag LOCUS_13810 8369 11764 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808733.1 protein_id gnl|my_center|LOCUS_13810 12200 11958 gene locus_tag LOCUS_13820 12200 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 12463 12212 gene locus_tag LOCUS_13830 12463 12212 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_13830 12739 13314 gene locus_tag LOCUS_13840 12739 13314 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_13840 14352 13522 gene locus_tag LOCUS_13850 14352 13522 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949086.1 protein_id gnl|my_center|LOCUS_13850 15594 14377 gene locus_tag LOCUS_13860 15594 14377 CDS product Tm-1-like ATP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949085.1 protein_id gnl|my_center|LOCUS_13860 15845 16246 gene locus_tag LOCUS_13870 15845 16246 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_13870 16293 17102 gene locus_tag LOCUS_13880 16293 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 17188 18372 gene locus_tag LOCUS_13890 17188 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 18664 19203 gene locus_tag LOCUS_13900 18664 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 19738 19370 gene locus_tag LOCUS_13910 19738 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence042 1831 632 gene locus_tag LOCUS_13920 gene sucC 1831 632 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_13920 3044 1851 gene locus_tag LOCUS_13930 3044 1851 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256088.1 protein_id gnl|my_center|LOCUS_13930 4089 3133 gene locus_tag LOCUS_13940 4089 3133 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256277.1 protein_id gnl|my_center|LOCUS_13940 4425 5558 gene locus_tag LOCUS_13950 4425 5558 CDS product metallo-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977198.1 protein_id gnl|my_center|LOCUS_13950 5607 7004 gene locus_tag LOCUS_13960 5607 7004 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368319.1 protein_id gnl|my_center|LOCUS_13960 7138 7974 gene locus_tag LOCUS_13970 7138 7974 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494199.1 protein_id gnl|my_center|LOCUS_13970 7992 8270 gene locus_tag LOCUS_13980 gene citD 7992 8270 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669237.1 protein_id gnl|my_center|LOCUS_13980 8271 9149 gene locus_tag LOCUS_13990 gene citE 8271 9149 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547014.1 protein_id gnl|my_center|LOCUS_13990 9152 10684 gene locus_tag LOCUS_14000 gene citF 9152 10684 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017113.1 protein_id gnl|my_center|LOCUS_14000 11810 10914 gene locus_tag LOCUS_14010 11810 10914 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398819.1 protein_id gnl|my_center|LOCUS_14010 12835 11957 gene locus_tag LOCUS_14020 12835 11957 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_14020 13834 12953 gene locus_tag LOCUS_14030 13834 12953 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_14030 13993 15069 gene locus_tag LOCUS_14040 13993 15069 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_14040 15845 15153 gene locus_tag LOCUS_14050 15845 15153 CDS product DUF5714 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673563.1 protein_id gnl|my_center|LOCUS_14050 17227 16319 gene locus_tag LOCUS_14060 17227 16319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 17731 17354 gene locus_tag LOCUS_14070 17731 17354 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104772.1 protein_id gnl|my_center|LOCUS_14070 18303 17743 gene locus_tag LOCUS_14080 18303 17743 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705391.1 protein_id gnl|my_center|LOCUS_14080 19042 18410 gene locus_tag LOCUS_14090 19042 18410 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454488.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence043 494 871 gene locus_tag LOCUS_14100 494 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2172 1006 gene locus_tag LOCUS_14110 2172 1006 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_14110 3040 2177 gene locus_tag LOCUS_14120 gene argB 3040 2177 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_14120 4388 3174 gene locus_tag LOCUS_14130 gene argJ 4388 3174 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_14130 5327 4404 gene locus_tag LOCUS_14140 gene argC 5327 4404 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_14140 8292 5653 gene locus_tag LOCUS_14150 gene ppdK 8292 5653 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14150 10020 8539 gene locus_tag LOCUS_14160 10020 8539 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132414.1 protein_id gnl|my_center|LOCUS_14160 11851 10229 gene locus_tag LOCUS_14170 11851 10229 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_14170 12665 11898 gene locus_tag LOCUS_14180 12665 11898 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 protein_id gnl|my_center|LOCUS_14180 13935 12823 gene locus_tag LOCUS_14190 13935 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 15204 14095 gene locus_tag LOCUS_14200 15204 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 16474 15320 gene locus_tag LOCUS_14210 16474 15320 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071499.1 protein_id gnl|my_center|LOCUS_14210 16658 16957 gene locus_tag LOCUS_14220 16658 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 17901 17083 gene locus_tag LOCUS_14230 17901 17083 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_14230 18517 17891 gene locus_tag LOCUS_14240 18517 17891 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227979.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence044 1179 397 gene locus_tag LOCUS_14250 1179 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2731 1310 gene locus_tag LOCUS_14260 2731 1310 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_14260 4927 2834 gene locus_tag LOCUS_14270 4927 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6093 5038 gene locus_tag LOCUS_14280 6093 5038 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251036.1 protein_id gnl|my_center|LOCUS_14280 8375 6246 gene locus_tag LOCUS_14290 8375 6246 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_14290 8976 8356 gene locus_tag LOCUS_14300 8976 8356 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_14300 9644 8973 gene locus_tag LOCUS_14310 gene cmk 9644 8973 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_14310 10977 9652 gene locus_tag LOCUS_14320 10977 9652 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_14320 11964 11032 gene locus_tag LOCUS_14330 gene rluB 11964 11032 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_14330 12086 11922 gene locus_tag LOCUS_14340 12086 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 12751 12131 gene locus_tag LOCUS_14350 gene scpB 12751 12131 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_14350 13484 12735 gene locus_tag LOCUS_14360 13484 12735 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640597.1 protein_id gnl|my_center|LOCUS_14360 14246 13623 gene locus_tag LOCUS_14370 14246 13623 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_14370 16115 14439 gene locus_tag LOCUS_14380 16115 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 16426 17196 gene locus_tag LOCUS_14390 16426 17196 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895490.1 protein_id gnl|my_center|LOCUS_14390 17295 18533 gene locus_tag LOCUS_14400 17295 18533 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529926.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence045 17 1303 gene locus_tag LOCUS_14410 17 1303 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_14410 1327 2166 gene locus_tag LOCUS_14420 1327 2166 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_14420 2154 3545 gene locus_tag LOCUS_14430 gene gltA 2154 3545 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_14430 3568 4362 gene locus_tag LOCUS_14440 3568 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4475 5107 gene locus_tag LOCUS_14450 4475 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5210 6673 gene locus_tag LOCUS_14460 5210 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 6693 8033 gene locus_tag LOCUS_14470 6693 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8603 9268 gene locus_tag LOCUS_14480 gene lexA 8603 9268 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_14480 10773 9394 gene locus_tag LOCUS_14490 10773 9394 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460292.1 protein_id gnl|my_center|LOCUS_14490 12602 10779 gene locus_tag LOCUS_14500 gene hflX 12602 10779 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965596.1 protein_id gnl|my_center|LOCUS_14500 14225 12618 gene locus_tag LOCUS_14510 14225 12618 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_14510 15492 14203 gene locus_tag LOCUS_14520 15492 14203 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_14520 17033 15630 gene locus_tag LOCUS_14530 gene rimO 17033 15630 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence046 1621 2772 gene locus_tag LOCUS_14540 1621 2772 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_14540 2781 6665 gene locus_tag LOCUS_14550 2781 6665 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_14550 6946 8037 gene locus_tag LOCUS_14560 6946 8037 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_14560 8048 8743 gene locus_tag LOCUS_14570 8048 8743 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_14570 8753 9595 gene locus_tag LOCUS_14580 8753 9595 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_14580 9801 10922 gene locus_tag LOCUS_14590 9801 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 11115 11909 gene locus_tag LOCUS_14600 11115 11909 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437555.1 protein_id gnl|my_center|LOCUS_14600 11920 12120 gene locus_tag LOCUS_14610 11920 12120 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869128.1 protein_id gnl|my_center|LOCUS_14610 12107 13111 gene locus_tag LOCUS_14620 12107 13111 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14620 13123 13326 gene locus_tag LOCUS_14630 13123 13326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 13376 14743 gene locus_tag LOCUS_14640 13376 14743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 15026 15985 gene locus_tag LOCUS_14650 15026 15985 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_14650 15969 17255 gene locus_tag LOCUS_14660 15969 17255 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence047 1515 226 gene locus_tag LOCUS_14670 1515 226 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_14670 2950 1559 gene locus_tag LOCUS_14680 gene rimO 2950 1559 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_14680 3957 2947 gene locus_tag LOCUS_14690 3957 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5857 4022 gene locus_tag LOCUS_14700 5857 4022 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459965.1 protein_id gnl|my_center|LOCUS_14700 6792 5854 gene locus_tag LOCUS_14710 6792 5854 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359020.1 protein_id gnl|my_center|LOCUS_14710 9714 6880 gene locus_tag LOCUS_14720 9714 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 11456 9792 gene locus_tag LOCUS_14730 11456 9792 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_14730 13791 11827 gene locus_tag LOCUS_14740 13791 11827 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_14740 14436 13882 gene locus_tag LOCUS_14750 14436 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 15423 14440 gene locus_tag LOCUS_14760 15423 14440 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_14760 15659 16003 gene locus_tag LOCUS_14770 15659 16003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence048 122 1468 gene locus_tag LOCUS_14780 gene glmM 122 1468 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_14780 4586 1536 gene locus_tag LOCUS_14790 4586 1536 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208007.1 protein_id gnl|my_center|LOCUS_14790 5692 4583 gene locus_tag LOCUS_14800 5692 4583 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969409.1 protein_id gnl|my_center|LOCUS_14800 7727 5781 gene locus_tag LOCUS_14810 7727 5781 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365759.1 protein_id gnl|my_center|LOCUS_14810 9377 7758 gene locus_tag LOCUS_14820 9377 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 9970 9542 gene locus_tag LOCUS_14830 9970 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 <15655 10112 gene locus_tag LOCUS_14840 <15655 10112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086036.1:leukotoxin LktA family filamentous adhesin >Feature sequence049 211 2406 gene locus_tag LOCUS_14850 211 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2548 4620 gene locus_tag LOCUS_14860 2548 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4678 5511 gene locus_tag LOCUS_14870 4678 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5627 6175 gene locus_tag LOCUS_14880 5627 6175 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_14880 7017 6253 gene locus_tag LOCUS_14890 gene sfsA 7017 6253 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_14890 7122 8414 gene locus_tag LOCUS_14900 7122 8414 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14900 8429 9181 gene locus_tag LOCUS_14910 8429 9181 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767556.1 protein_id gnl|my_center|LOCUS_14910 9191 11203 gene locus_tag LOCUS_14920 gene uvrB 9191 11203 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_14920 11288 14131 gene locus_tag LOCUS_14930 gene uvrA 11288 14131 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence050 1857 232 gene locus_tag LOCUS_14940 1857 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2152 5592 gene locus_tag LOCUS_14950 2152 5592 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722699.1 protein_id gnl|my_center|LOCUS_14950 5757 7751 gene locus_tag LOCUS_14960 gene ftsH 5757 7751 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_14960 8013 8873 gene locus_tag LOCUS_14970 gene ispE 8013 8873 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_14970 8870 9586 gene locus_tag LOCUS_14980 8870 9586 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_14980 9596 10417 gene locus_tag LOCUS_14990 9596 10417 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350521.1 protein_id gnl|my_center|LOCUS_14990 10568 11596 gene locus_tag LOCUS_15000 10568 11596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 11771 12727 gene locus_tag LOCUS_15010 11771 12727 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773653.1 protein_id gnl|my_center|LOCUS_15010 12964 13863 gene locus_tag LOCUS_15020 12964 13863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 13966 14595 gene locus_tag LOCUS_15030 gene pth 13966 14595 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence051 47 133 gene locus_tag LOCUS_t00220 47 133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1966 251 gene locus_tag LOCUS_15040 1966 251 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_15040 2638 2057 gene locus_tag LOCUS_15050 2638 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3613 2876 gene locus_tag LOCUS_15060 3613 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4300 3701 gene locus_tag LOCUS_15070 gene coaE 4300 3701 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219305.1 protein_id gnl|my_center|LOCUS_15070 7109 4317 gene locus_tag LOCUS_15080 7109 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 7726 7340 gene locus_tag LOCUS_15090 7726 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 9017 7833 gene locus_tag LOCUS_15100 9017 7833 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_15100 10360 9119 gene locus_tag LOCUS_15110 10360 9119 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_15110 10858 11856 gene locus_tag LOCUS_15120 gene potA 10858 11856 CDS product spermidine/putrescine ABC transporter ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720321.1 protein_id gnl|my_center|LOCUS_15120 11868 12725 gene locus_tag LOCUS_15130 gene potB 11868 12725 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715500.1 protein_id gnl|my_center|LOCUS_15130 12706 13500 gene locus_tag LOCUS_15140 gene potC 12706 13500 CDS product spermidine/putrescine ABC transporter permease PotC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714199.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence052 1890 1204 gene locus_tag LOCUS_15150 1890 1204 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065582.1 protein_id gnl|my_center|LOCUS_15150 3844 1892 gene locus_tag LOCUS_15160 3844 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4738 3953 gene locus_tag LOCUS_15170 4738 3953 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_15170 5662 4838 gene locus_tag LOCUS_15180 gene proC 5662 4838 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_15180 6234 5647 gene locus_tag LOCUS_15190 6234 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 7015 6314 gene locus_tag LOCUS_15200 7015 6314 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_15200 7979 7170 gene locus_tag LOCUS_15210 gene pgeF 7979 7170 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_15210 9822 8095 gene locus_tag LOCUS_15220 9822 8095 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_15220 11384 9900 gene locus_tag LOCUS_15230 gene pap 11384 9900 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_15230 11998 11384 gene locus_tag LOCUS_15240 11998 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 13070 12090 gene locus_tag LOCUS_15250 gene floA 13070 12090 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_15250 13715 13260 gene locus_tag LOCUS_15260 13715 13260 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392728.1 protein_id gnl|my_center|LOCUS_15260 13907 13731 gene locus_tag LOCUS_15270 13907 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence053 1324 392 gene locus_tag LOCUS_15280 1324 392 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_15280 2280 1426 gene locus_tag LOCUS_15290 2280 1426 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055304.1 protein_id gnl|my_center|LOCUS_15290 3038 2370 gene locus_tag LOCUS_15300 3038 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4330 3020 gene locus_tag LOCUS_15310 4330 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 5639 4623 gene locus_tag LOCUS_15320 5639 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 6660 5719 gene locus_tag LOCUS_15330 6660 5719 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860968.1 protein_id gnl|my_center|LOCUS_15330 7061 6744 gene locus_tag LOCUS_15340 7061 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 8125 7181 gene locus_tag LOCUS_15350 8125 7181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 8751 8200 gene locus_tag LOCUS_15360 8751 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 9869 9075 gene locus_tag LOCUS_15370 9869 9075 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_15370 10152 11663 gene locus_tag LOCUS_15380 10152 11663 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439842.1 protein_id gnl|my_center|LOCUS_15380 13389 11848 gene locus_tag LOCUS_15390 gene guaA 13389 11848 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence054 2437 1661 gene locus_tag LOCUS_15400 2437 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2810 3301 gene locus_tag LOCUS_15410 2810 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 4864 3419 gene locus_tag LOCUS_15420 gene gatB 4864 3419 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812379.1 protein_id gnl|my_center|LOCUS_15420 6330 4864 gene locus_tag LOCUS_15430 gene gatA 6330 4864 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_15430 6632 6345 gene locus_tag LOCUS_15440 gene gatC 6632 6345 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_15440 9137 6996 gene locus_tag LOCUS_15450 gene ligA 9137 6996 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812372.1 protein_id gnl|my_center|LOCUS_15450 10625 9213 gene locus_tag LOCUS_15460 10625 9213 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852570.1 protein_id gnl|my_center|LOCUS_15460 11583 10783 gene locus_tag LOCUS_15470 11583 10783 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815405.1 protein_id gnl|my_center|LOCUS_15470 12510 11656 gene locus_tag LOCUS_15480 12510 11656 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948436.1 protein_id gnl|my_center|LOCUS_15480 13030 12584 gene locus_tag LOCUS_15490 13030 12584 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458819.1 protein_id gnl|my_center|LOCUS_15490 13506 13057 gene locus_tag LOCUS_15500 13506 13057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence055 4756 191 gene locus_tag LOCUS_15510 gene gltB 4756 191 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_15510 6178 5036 gene locus_tag LOCUS_15520 6178 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 7686 6175 gene locus_tag LOCUS_15530 7686 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8735 7887 gene locus_tag LOCUS_15540 8735 7887 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439841.1 protein_id gnl|my_center|LOCUS_15540 10076 8952 gene locus_tag LOCUS_15550 10076 8952 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_15550 10491 10703 gene locus_tag LOCUS_15560 10491 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 10773 10991 gene locus_tag LOCUS_15570 10773 10991 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_15570 11091 13238 gene locus_tag LOCUS_15580 gene feoB 11091 13238 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence056 449 1630 gene locus_tag LOCUS_15590 449 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1691 2650 gene locus_tag LOCUS_15600 1691 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 2650 5124 gene locus_tag LOCUS_15610 2650 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5130 7895 gene locus_tag LOCUS_15620 5130 7895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 7892 9763 gene locus_tag LOCUS_15630 7892 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 9802 10878 gene locus_tag LOCUS_15640 9802 10878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 11103 11354 gene locus_tag LOCUS_15650 11103 11354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 11419 11799 gene locus_tag LOCUS_15660 gene rpsL 11419 11799 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393942.1 protein_id gnl|my_center|LOCUS_15660 11859 12329 gene locus_tag LOCUS_15670 gene rpsG 11859 12329 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722012.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence057 321 115 gene locus_tag LOCUS_15680 321 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 696 433 gene locus_tag LOCUS_15690 696 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1144 872 gene locus_tag LOCUS_15700 1144 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1432 1187 gene locus_tag LOCUS_15710 1432 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3138 1498 gene locus_tag LOCUS_15720 3138 1498 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_15720 3485 3198 gene locus_tag LOCUS_15730 3485 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4213 3650 gene locus_tag LOCUS_15740 4213 3650 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964817.1 protein_id gnl|my_center|LOCUS_15740 4631 4885 gene locus_tag LOCUS_15750 4631 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 4882 5187 gene locus_tag LOCUS_15760 4882 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5166 5342 gene locus_tag LOCUS_15770 5166 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5961 5365 gene locus_tag LOCUS_15780 5961 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 6284 7108 gene locus_tag LOCUS_15790 6284 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 7195 7446 gene locus_tag LOCUS_15800 7195 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 8592 7771 gene locus_tag LOCUS_15810 gene budA 8592 7771 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958007.1 protein_id gnl|my_center|LOCUS_15810 9251 8649 gene locus_tag LOCUS_15820 9251 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10892 9375 gene locus_tag LOCUS_15830 10892 9375 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346400.1 protein_id gnl|my_center|LOCUS_15830 11408 10995 gene locus_tag LOCUS_15840 11408 10995 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_15840 11622 11392 gene locus_tag LOCUS_15850 11622 11392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 12944 12117 gene locus_tag LOCUS_15860 12944 12117 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679949.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence058 281 508 gene locus_tag LOCUS_15870 281 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 837 691 gene locus_tag LOCUS_15880 837 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1057 1248 gene locus_tag LOCUS_15890 1057 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1404 1625 gene locus_tag LOCUS_15900 1404 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1644 1811 gene locus_tag LOCUS_15910 1644 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2333 3181 gene locus_tag LOCUS_15920 2333 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3183 3575 gene locus_tag LOCUS_15930 3183 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3871 4281 gene locus_tag LOCUS_15940 3871 4281 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_15940 4454 4378 gene locus_tag LOCUS_t00230 4454 4378 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5102 4560 gene locus_tag LOCUS_15950 5102 4560 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_15950 5420 7174 gene locus_tag LOCUS_15960 5420 7174 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_15960 7294 8250 gene locus_tag LOCUS_15970 7294 8250 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_15970 10085 8355 gene locus_tag LOCUS_15980 10085 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 10353 11774 gene locus_tag LOCUS_15990 gene nagA 10353 11774 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987105.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence059 540 292 gene locus_tag LOCUS_16000 540 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 938 540 gene locus_tag LOCUS_16010 938 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 998 1204 gene locus_tag LOCUS_16020 998 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1277 2857 gene locus_tag LOCUS_16030 1277 2857 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_16030 3051 4634 gene locus_tag LOCUS_16040 3051 4634 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459688.1 protein_id gnl|my_center|LOCUS_16040 4739 5728 gene locus_tag LOCUS_16050 4739 5728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944086.1 protein_id gnl|my_center|LOCUS_16050 5721 6584 gene locus_tag LOCUS_16060 5721 6584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816583.1 protein_id gnl|my_center|LOCUS_16060 6600 7463 gene locus_tag LOCUS_16070 6600 7463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459690.1 protein_id gnl|my_center|LOCUS_16070 7450 8085 gene locus_tag LOCUS_16080 7450 8085 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272311.1 protein_id gnl|my_center|LOCUS_16080 10371 8218 gene locus_tag LOCUS_16090 10371 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 11535 10432 gene locus_tag LOCUS_16100 11535 10432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence060 472 825 gene locus_tag LOCUS_16110 472 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 996 2243 gene locus_tag LOCUS_16120 gene uraA 996 2243 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000198327.1 protein_id gnl|my_center|LOCUS_16120 2727 2392 gene locus_tag LOCUS_16130 2727 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 2926 3141 gene locus_tag LOCUS_16140 2926 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3248 3895 gene locus_tag LOCUS_16150 gene fsa 3248 3895 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_16150 4026 5261 gene locus_tag LOCUS_16160 4026 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5419 5883 gene locus_tag LOCUS_16170 5419 5883 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_16170 6129 7466 gene locus_tag LOCUS_16180 gene rlmD 6129 7466 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_16180 7739 7987 gene locus_tag LOCUS_16190 7739 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8346 8591 gene locus_tag LOCUS_16200 8346 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9094 10752 gene locus_tag LOCUS_16210 9094 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10883 12190 gene locus_tag LOCUS_16220 10883 12190 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533420.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence061 <1 518 gene locus_tag LOCUS_16230 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475978.1:RluA family pseudouridine synthase 653 1204 gene locus_tag LOCUS_16240 gene pyrR 653 1204 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_16240 1332 1787 gene locus_tag LOCUS_16250 1332 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 2341 1889 gene locus_tag LOCUS_16260 2341 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 2564 4714 gene locus_tag LOCUS_16270 2564 4714 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_16270 4865 5527 gene locus_tag LOCUS_16280 4865 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 5564 7006 gene locus_tag LOCUS_16290 5564 7006 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921298.1 protein_id gnl|my_center|LOCUS_16290 7455 7862 gene locus_tag LOCUS_16300 7455 7862 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036371678.1 protein_id gnl|my_center|LOCUS_16300 7928 10492 gene locus_tag LOCUS_16310 7928 10492 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_16310 10485 11849 gene locus_tag LOCUS_16320 gene radA 10485 11849 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_16320 12026 12514 gene locus_tag LOCUS_16330 12026 12514 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence062 4343 309 gene locus_tag LOCUS_16340 4343 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 8129 4362 gene locus_tag LOCUS_16350 gene rpoB 8129 4362 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_16350 8885 8511 gene locus_tag LOCUS_16360 gene rplL 8885 8511 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_16360 9484 8954 gene locus_tag LOCUS_16370 gene rplJ 9484 8954 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393947.1 protein_id gnl|my_center|LOCUS_16370 10392 9688 gene locus_tag LOCUS_16380 gene rplA 10392 9688 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001987630.1 protein_id gnl|my_center|LOCUS_16380 10875 10450 gene locus_tag LOCUS_16390 gene rplK 10875 10450 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 protein_id gnl|my_center|LOCUS_16390 11502 10894 gene locus_tag LOCUS_16400 gene nusG 11502 10894 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_16400 11766 11542 gene locus_tag LOCUS_16410 11766 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 11957 11808 gene locus_tag LOCUS_16420 gene rpmG 11957 11808 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_16420 12198 12122 gene locus_tag LOCUS_t00240 12198 12122 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12280 12205 gene locus_tag LOCUS_t00250 12280 12205 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12366 12291 gene locus_tag LOCUS_t00260 12366 12291 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence063 5539 1964 gene locus_tag LOCUS_16430 5539 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6926 5634 gene locus_tag LOCUS_16440 6926 5634 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_16440 8595 7165 gene locus_tag LOCUS_16450 8595 7165 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461040.1 protein_id gnl|my_center|LOCUS_16450 11535 8941 gene locus_tag LOCUS_16460 11535 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence064 1131 2486 gene locus_tag LOCUS_16470 1131 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3128 2571 gene locus_tag LOCUS_16480 3128 2571 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_16480 4251 3205 gene locus_tag LOCUS_16490 4251 3205 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_16490 4549 5931 gene locus_tag LOCUS_16500 4549 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6048 7418 gene locus_tag LOCUS_16510 6048 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 8902 7769 gene locus_tag LOCUS_16520 8902 7769 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869047.1 protein_id gnl|my_center|LOCUS_16520 10454 9180 gene locus_tag LOCUS_16530 10454 9180 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_16530 11510 11073 gene locus_tag LOCUS_16540 11510 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence065 1 369 gene locus_tag LOCUS_16550 1 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 366 1001 gene locus_tag LOCUS_16560 366 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1112 2086 gene locus_tag LOCUS_16570 gene pfkB 1112 2086 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_16570 2127 4154 gene locus_tag LOCUS_16580 2127 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 4235 4492 gene locus_tag LOCUS_16590 4235 4492 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_16590 4617 6245 gene locus_tag LOCUS_16600 gene ptsP 4617 6245 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_16600 6358 7422 gene locus_tag LOCUS_16610 6358 7422 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964934.1 protein_id gnl|my_center|LOCUS_16610 9442 7568 gene locus_tag LOCUS_16620 gene pepF 9442 7568 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_16620 9539 11359 gene locus_tag LOCUS_16630 9539 11359 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964339.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence066 2505 1276 gene locus_tag LOCUS_16640 2505 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 3224 2577 gene locus_tag LOCUS_16650 gene nth 3224 2577 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_16650 4747 3383 gene locus_tag LOCUS_16660 4747 3383 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_16660 5031 4762 gene locus_tag LOCUS_16670 5031 4762 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_16670 5814 5170 gene locus_tag LOCUS_16680 5814 5170 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_16680 6372 5896 gene locus_tag LOCUS_16690 6372 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 6634 6422 gene locus_tag LOCUS_16700 6634 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 6831 6974 gene locus_tag LOCUS_16710 6831 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 7034 7525 gene locus_tag LOCUS_16720 7034 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 7639 8457 gene locus_tag LOCUS_16730 gene nifH 7639 8457 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023791.1 protein_id gnl|my_center|LOCUS_16730 8773 8459 gene locus_tag LOCUS_16740 8773 8459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8772 9914 gene locus_tag LOCUS_16750 8772 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 9980 11272 gene locus_tag LOCUS_16760 9980 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence067 95 9 gene locus_tag LOCUS_t00270 95 9 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 266 181 gene locus_tag LOCUS_t00280 266 181 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 612 1961 gene locus_tag LOCUS_16770 612 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2072 2554 gene locus_tag LOCUS_16780 2072 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3784 2633 gene locus_tag LOCUS_16790 3784 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4128 4682 gene locus_tag LOCUS_16800 4128 4682 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869609.1 protein_id gnl|my_center|LOCUS_16800 4709 5605 gene locus_tag LOCUS_16810 4709 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 5722 6192 gene locus_tag LOCUS_16820 5722 6192 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_16820 6318 6518 gene locus_tag LOCUS_16830 gene cspC 6318 6518 CDS product cold shock protein CspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001990088.1 protein_id gnl|my_center|LOCUS_16830 6656 8137 gene locus_tag LOCUS_16840 6656 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8296 8676 gene locus_tag LOCUS_16850 8296 8676 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_16850 10448 8892 gene locus_tag LOCUS_16860 10448 8892 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812879.1 protein_id gnl|my_center|LOCUS_16860 10624 11091 gene locus_tag LOCUS_16870 10624 11091 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576052.1 protein_id gnl|my_center|LOCUS_16870 11240 11314 gene locus_tag LOCUS_t00290 11240 11314 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11318 11392 gene locus_tag LOCUS_t00300 11318 11392 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11404 11479 gene locus_tag LOCUS_t00310 11404 11479 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence068 141 66 gene locus_tag LOCUS_t00320 141 66 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1384 269 gene locus_tag LOCUS_16880 1384 269 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_16880 1846 1388 gene locus_tag LOCUS_16890 1846 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2745 2023 gene locus_tag LOCUS_16900 gene sigH 2745 2023 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_16900 3400 2888 gene locus_tag LOCUS_16910 3400 2888 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724086.1 protein_id gnl|my_center|LOCUS_16910 4146 3397 gene locus_tag LOCUS_16920 gene rlmB 4146 3397 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459087.1 protein_id gnl|my_center|LOCUS_16920 4946 4209 gene locus_tag LOCUS_16930 gene thyX 4946 4209 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_16930 5442 4987 gene locus_tag LOCUS_16940 5442 4987 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_16940 6884 5439 gene locus_tag LOCUS_16950 gene cysS 6884 5439 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393961.1 protein_id gnl|my_center|LOCUS_16950 8473 7001 gene locus_tag LOCUS_16960 gene gltX 8473 7001 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810213.1 protein_id gnl|my_center|LOCUS_16960 9052 8570 gene locus_tag LOCUS_16970 gene ispF 9052 8570 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_16970 9837 9121 gene locus_tag LOCUS_16980 gene ispD 9837 9121 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 protein_id gnl|my_center|LOCUS_16980 11036 9834 gene locus_tag LOCUS_16990 11036 9834 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942743.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence069 11 87 gene locus_tag LOCUS_t00330 11 87 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 89 164 gene locus_tag LOCUS_t00340 89 164 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 166 241 gene locus_tag LOCUS_t00350 166 241 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 515 817 gene locus_tag LOCUS_17000 515 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 974 1231 gene locus_tag LOCUS_17010 974 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1239 2360 gene locus_tag LOCUS_17020 1239 2360 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659298.1 protein_id gnl|my_center|LOCUS_17020 2539 3741 gene locus_tag LOCUS_17030 2539 3741 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546785.1 protein_id gnl|my_center|LOCUS_17030 3755 4171 gene locus_tag LOCUS_17040 3755 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 4140 4625 gene locus_tag LOCUS_17050 4140 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4622 5032 gene locus_tag LOCUS_17060 4622 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 5097 5540 gene locus_tag LOCUS_17070 5097 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5675 6499 gene locus_tag LOCUS_17080 5675 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 6792 7589 gene locus_tag LOCUS_17090 gene udp 6792 7589 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163896.1 protein_id gnl|my_center|LOCUS_17090 7679 8134 gene locus_tag LOCUS_17100 gene bcp 7679 8134 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_17100 8159 9421 gene locus_tag LOCUS_17110 gene deoB 8159 9421 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095491.1 protein_id gnl|my_center|LOCUS_17110 9525 10124 gene locus_tag LOCUS_17120 9525 10124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10126 10872 gene locus_tag LOCUS_17130 10126 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 10969 11045 gene locus_tag LOCUS_t00360 10969 11045 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 11050 11125 gene locus_tag LOCUS_t00370 11050 11125 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11130 11205 gene locus_tag LOCUS_t00380 11130 11205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence070 161 1111 gene locus_tag LOCUS_17140 161 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1291 2745 gene locus_tag LOCUS_17150 1291 2745 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015727.1 protein_id gnl|my_center|LOCUS_17150 3101 3265 gene locus_tag LOCUS_17160 3101 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3362 3538 gene locus_tag LOCUS_17170 3362 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 3535 3954 gene locus_tag LOCUS_17180 3535 3954 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272447.1 protein_id gnl|my_center|LOCUS_17180 4059 4487 gene locus_tag LOCUS_17190 4059 4487 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_17190 4540 5247 gene locus_tag LOCUS_17200 4540 5247 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760532.1 protein_id gnl|my_center|LOCUS_17200 5287 6183 gene locus_tag LOCUS_17210 5287 6183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 6456 7484 gene locus_tag LOCUS_17220 gene bioB 6456 7484 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_17220 8396 7590 gene locus_tag LOCUS_17230 gene larE 8396 7590 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_17230 8639 9442 gene locus_tag LOCUS_17240 8639 9442 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242645.1 protein_id gnl|my_center|LOCUS_17240 9588 10778 gene locus_tag LOCUS_17250 gene nifS 9588 10778 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence071 416 1438 gene locus_tag LOCUS_17260 gene trpD 416 1438 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_17260 1572 2474 gene locus_tag LOCUS_17270 gene trpC 1572 2474 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_17270 2562 3206 gene locus_tag LOCUS_17280 2562 3206 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_17280 3227 4411 gene locus_tag LOCUS_17290 gene trpB 3227 4411 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_17290 4404 5189 gene locus_tag LOCUS_17300 gene trpA 4404 5189 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_17300 5377 6759 gene locus_tag LOCUS_17310 5377 6759 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence072 321 103 gene locus_tag LOCUS_17320 gene infA 321 103 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829792.1 protein_id gnl|my_center|LOCUS_17320 984 328 gene locus_tag LOCUS_17330 984 328 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_17330 2255 999 gene locus_tag LOCUS_17340 gene secY 2255 999 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_17340 2698 2258 gene locus_tag LOCUS_17350 gene rplO 2698 2258 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_17350 2903 2718 gene locus_tag LOCUS_17360 gene rpmD 2903 2718 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_17360 3439 2921 gene locus_tag LOCUS_17370 gene rpsE 3439 2921 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_17370 3816 3457 gene locus_tag LOCUS_17380 gene rplR 3816 3457 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_17380 4386 3838 gene locus_tag LOCUS_17390 gene rplF 4386 3838 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_17390 4809 4411 gene locus_tag LOCUS_17400 gene rpsH 4809 4411 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_17400 5024 4839 gene locus_tag LOCUS_17410 5024 4839 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966399.1 protein_id gnl|my_center|LOCUS_17410 5587 5042 gene locus_tag LOCUS_17420 gene rplE 5587 5042 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_17420 5944 5615 gene locus_tag LOCUS_17430 gene rplX 5944 5615 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_17430 6350 5982 gene locus_tag LOCUS_17440 gene rplN 6350 5982 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_17440 6654 6394 gene locus_tag LOCUS_17450 gene rpsQ 6654 6394 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_17450 6881 6687 gene locus_tag LOCUS_17460 gene rpmC 6881 6687 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357691.1 protein_id gnl|my_center|LOCUS_17460 7333 6878 gene locus_tag LOCUS_17470 gene rplP 7333 6878 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_17470 8024 7335 gene locus_tag LOCUS_17480 gene rpsC 8024 7335 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393931.1 protein_id gnl|my_center|LOCUS_17480 8378 8046 gene locus_tag LOCUS_17490 gene rplV 8378 8046 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_17490 8670 8389 gene locus_tag LOCUS_17500 gene rpsS 8670 8389 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_17500 9526 8696 gene locus_tag LOCUS_17510 gene rplB 9526 8696 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_17510 9830 9540 gene locus_tag LOCUS_17520 gene rplW 9830 9540 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393935.1 protein_id gnl|my_center|LOCUS_17520 10459 9830 gene locus_tag LOCUS_17530 gene rplD 10459 9830 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_17530 <11074 10489 gene locus_tag LOCUS_17540 <11074 10489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026184218.1:50S ribosomal protein L3 >Feature sequence073 2054 780 gene locus_tag LOCUS_17550 2054 780 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703620.1 protein_id gnl|my_center|LOCUS_17550 2405 3166 gene locus_tag LOCUS_17560 2405 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3150 5039 gene locus_tag LOCUS_17570 3150 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 5077 5979 gene locus_tag LOCUS_17580 5077 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6075 6896 gene locus_tag LOCUS_17590 6075 6896 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_17590 8574 7060 gene locus_tag LOCUS_17600 gene panF 8574 7060 CDS product sodium/pantothenate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902082.1 protein_id gnl|my_center|LOCUS_17600 8840 8574 gene locus_tag LOCUS_17610 8840 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 9431 10516 gene locus_tag LOCUS_17620 9431 10516 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948950.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence074 286 1194 gene locus_tag LOCUS_17630 gene dapF 286 1194 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765061.1 protein_id gnl|my_center|LOCUS_17630 1417 1854 gene locus_tag LOCUS_17640 1417 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1917 3266 gene locus_tag LOCUS_17650 1917 3266 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968626.1 protein_id gnl|my_center|LOCUS_17650 3343 4122 gene locus_tag LOCUS_17660 3343 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 4342 5724 gene locus_tag LOCUS_17670 4342 5724 CDS product phosphohexose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506571.1 protein_id gnl|my_center|LOCUS_17670 5721 6611 gene locus_tag LOCUS_17680 gene galU 5721 6611 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_17680 6654 7646 gene locus_tag LOCUS_17690 gene galE 6654 7646 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_17690 7724 9724 gene locus_tag LOCUS_17700 7724 9724 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_17700 9827 10285 gene locus_tag LOCUS_17710 gene tadA 9827 10285 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_17710 10374 10462 gene locus_tag LOCUS_t00390 10374 10462 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence075 <1 1607 gene locus_tag LOCUS_17720 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033562369.1:ClC family H(+)/Cl(-) exchange transporter 3092 1818 gene locus_tag LOCUS_17730 3092 1818 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027623.1 protein_id gnl|my_center|LOCUS_17730 3423 4316 gene locus_tag LOCUS_17740 gene murQ 3423 4316 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180252.1 protein_id gnl|my_center|LOCUS_17740 4343 5557 gene locus_tag LOCUS_17750 4343 5557 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549580.1 protein_id gnl|my_center|LOCUS_17750 6594 5773 gene locus_tag LOCUS_17760 6594 5773 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627865.1 protein_id gnl|my_center|LOCUS_17760 7681 6689 gene locus_tag LOCUS_17770 7681 6689 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217921400.1 protein_id gnl|my_center|LOCUS_17770 9103 8051 gene locus_tag LOCUS_17780 9103 8051 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_17780 10893 9214 gene locus_tag LOCUS_17790 10893 9214 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016301.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence076 1060 686 gene locus_tag LOCUS_17800 1060 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1686 1126 gene locus_tag LOCUS_17810 1686 1126 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_17810 2013 1696 gene locus_tag LOCUS_17820 2013 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2426 2010 gene locus_tag LOCUS_17830 2426 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 2728 2423 gene locus_tag LOCUS_17840 2728 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3045 2728 gene locus_tag LOCUS_17850 3045 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 3399 3061 gene locus_tag LOCUS_17860 3399 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 4580 3411 gene locus_tag LOCUS_17870 4580 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 5248 4583 gene locus_tag LOCUS_17880 5248 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 6422 5241 gene locus_tag LOCUS_17890 6422 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8087 6435 gene locus_tag LOCUS_17900 8087 6435 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587519.1 protein_id gnl|my_center|LOCUS_17900 8430 8080 gene locus_tag LOCUS_17910 8430 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 8766 8533 gene locus_tag LOCUS_17920 8766 8533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 9410 8985 gene locus_tag LOCUS_17930 9410 8985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 10269 9526 gene locus_tag LOCUS_17940 10269 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 10495 10226 gene locus_tag LOCUS_17950 10495 10226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 10847 10449 gene locus_tag LOCUS_17960 10847 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence077 <1 610 gene locus_tag LOCUS_17970 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467000.1:anaerobic C4-dicarboxylate transporter DcuC 714 1661 gene locus_tag LOCUS_17980 714 1661 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_17980 1703 2512 gene locus_tag LOCUS_17990 1703 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3612 2731 gene locus_tag LOCUS_18000 gene lgt 3612 2731 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_18000 4823 3930 gene locus_tag LOCUS_18010 4823 3930 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679655.1 protein_id gnl|my_center|LOCUS_18010 5663 5148 gene locus_tag LOCUS_18020 5663 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6917 5922 gene locus_tag LOCUS_18030 6917 5922 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_18030 6997 7602 gene locus_tag LOCUS_18040 6997 7602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 8153 7599 gene locus_tag LOCUS_18050 8153 7599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 9651 8143 gene locus_tag LOCUS_18060 9651 8143 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_18060 10583 9714 gene locus_tag LOCUS_18070 10583 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence078 2090 30 gene locus_tag LOCUS_18080 2090 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 2470 2108 gene locus_tag LOCUS_18090 2470 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4839 3010 gene locus_tag LOCUS_18100 4839 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5223 4858 gene locus_tag LOCUS_18110 5223 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 6003 5278 gene locus_tag LOCUS_18120 6003 5278 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257306.1 protein_id gnl|my_center|LOCUS_18120 6651 6148 gene locus_tag LOCUS_18130 6651 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 8195 6990 gene locus_tag LOCUS_18140 8195 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 9506 9111 gene locus_tag LOCUS_18150 9506 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9735 9472 gene locus_tag LOCUS_18160 9735 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 10052 9756 gene locus_tag LOCUS_18170 10052 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 10209 10042 gene locus_tag LOCUS_18180 10209 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 10646 10410 gene locus_tag LOCUS_18190 10646 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence079 952 509 gene locus_tag LOCUS_18200 952 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 887 1513 gene locus_tag LOCUS_18210 887 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 2606 1848 gene locus_tag LOCUS_18220 2606 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 3288 2722 gene locus_tag LOCUS_18230 3288 2722 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_18230 4149 3304 gene locus_tag LOCUS_18240 4149 3304 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671202.1 protein_id gnl|my_center|LOCUS_18240 4791 4303 gene locus_tag LOCUS_18250 4791 4303 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_18250 5618 4881 gene locus_tag LOCUS_18260 5618 4881 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815943.1 protein_id gnl|my_center|LOCUS_18260 6259 5720 gene locus_tag LOCUS_18270 6259 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 6913 6272 gene locus_tag LOCUS_18280 6913 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392507.1 protein_id gnl|my_center|LOCUS_18280 7411 6989 gene locus_tag LOCUS_18290 7411 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 8210 7524 gene locus_tag LOCUS_18300 gene tsaA 8210 7524 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_18300 9807 8329 gene locus_tag LOCUS_18310 9807 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 <10656 9991 gene locus_tag LOCUS_18320 <10656 9991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039143.1:isocitrate lyase/PEP mutase family protein >Feature sequence080 <1 625 gene locus_tag LOCUS_18330 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929426.1:M14 family metallopeptidase 622 1602 gene locus_tag LOCUS_18340 622 1602 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_18340 1708 2757 gene locus_tag LOCUS_18350 1708 2757 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_18350 2855 4006 gene locus_tag LOCUS_18360 2855 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4064 6712 gene locus_tag LOCUS_18370 4064 6712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 6977 8392 gene locus_tag LOCUS_18380 6977 8392 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_18380 8539 10143 gene locus_tag LOCUS_18390 8539 10143 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence081 <1 1932 gene locus_tag LOCUS_18400 <1 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861232.1:EAL domain-containing protein 2200 3222 gene locus_tag LOCUS_18410 2200 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3623 4819 gene locus_tag LOCUS_18420 3623 4819 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_18420 5029 6852 gene locus_tag LOCUS_18430 gene glmS 5029 6852 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_18430 7014 9101 gene locus_tag LOCUS_18440 7014 9101 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_18440 <10365 9693 gene locus_tag LOCUS_18450 <10365 9693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001126101.1:carbamoyl-phosphate synthase large subunit >Feature sequence082 407 1537 gene locus_tag LOCUS_18460 407 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1612 2727 gene locus_tag LOCUS_18470 1612 2727 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_18470 2999 3436 gene locus_tag LOCUS_18480 gene rpiB 2999 3436 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_18480 3519 4061 gene locus_tag LOCUS_18490 3519 4061 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393868.1 protein_id gnl|my_center|LOCUS_18490 4162 4782 gene locus_tag LOCUS_18500 gene upp 4162 4782 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_18500 4798 5268 gene locus_tag LOCUS_18510 4798 5268 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_18510 5357 6361 gene locus_tag LOCUS_18520 5357 6361 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_18520 6395 7555 gene locus_tag LOCUS_18530 gene wecB 6395 7555 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187374459.1 protein_id gnl|my_center|LOCUS_18530 7862 8137 gene locus_tag LOCUS_18540 7862 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 8134 8553 gene locus_tag LOCUS_18550 8134 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 8558 9286 gene locus_tag LOCUS_18560 gene atpB 8558 9286 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_18560 9362 9616 gene locus_tag LOCUS_18570 9362 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 9668 10150 gene locus_tag LOCUS_18580 gene atpF 9668 10150 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence083 591 785 gene locus_tag LOCUS_18590 591 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 878 1600 gene locus_tag LOCUS_18600 878 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 1925 4108 gene locus_tag LOCUS_18610 1925 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4494 5579 gene locus_tag LOCUS_18620 4494 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 5801 7705 gene locus_tag LOCUS_18630 5801 7705 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_18630 7949 9088 gene locus_tag LOCUS_18640 7949 9088 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_18640 9209 9652 gene locus_tag LOCUS_18650 gene lspA 9209 9652 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460664.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence084 98 520 gene locus_tag LOCUS_18660 98 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 514 861 gene locus_tag LOCUS_18670 gene tnpB 514 861 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748777.1 protein_id gnl|my_center|LOCUS_18670 1004 2659 gene locus_tag LOCUS_18680 1004 2659 CDS product IS66 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461096.1 protein_id gnl|my_center|LOCUS_18680 3222 5264 gene locus_tag LOCUS_18690 3222 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 6147 5725 gene locus_tag LOCUS_18700 6147 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 7457 6144 gene locus_tag LOCUS_18710 7457 6144 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_18710 8484 7483 gene locus_tag LOCUS_18720 8484 7483 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_18720 8729 9613 gene locus_tag LOCUS_18730 8729 9613 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886597.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence085 670 885 gene locus_tag LOCUS_18740 670 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 965 2350 gene locus_tag LOCUS_18750 gene amrA 965 2350 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680398.1 protein_id gnl|my_center|LOCUS_18750 2362 3222 gene locus_tag LOCUS_18760 gene amrS 2362 3222 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459758.1 protein_id gnl|my_center|LOCUS_18760 3322 4005 gene locus_tag LOCUS_18770 3322 4005 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_18770 4126 5688 gene locus_tag LOCUS_18780 4126 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6982 5936 gene locus_tag LOCUS_18790 6982 5936 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003321939.1 protein_id gnl|my_center|LOCUS_18790 7941 6979 gene locus_tag LOCUS_18800 7941 6979 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053138.1 protein_id gnl|my_center|LOCUS_18800 9194 7929 gene locus_tag LOCUS_18810 9194 7929 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188697727.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence086 1 1023 gene locus_tag LOCUS_18820 1 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1444 2601 gene locus_tag LOCUS_18830 1444 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2674 3891 gene locus_tag LOCUS_18840 2674 3891 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_18840 4021 4518 gene locus_tag LOCUS_18850 4021 4518 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_18850 4682 6247 gene locus_tag LOCUS_18860 4682 6247 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438863.1 protein_id gnl|my_center|LOCUS_18860 6349 7548 gene locus_tag LOCUS_18870 gene sucC 6349 7548 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_18870 7553 8476 gene locus_tag LOCUS_18880 gene sucD 7553 8476 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_18880 8644 8829 gene locus_tag LOCUS_18890 8644 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence087 219 1157 gene locus_tag LOCUS_18900 219 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2525 1515 gene locus_tag LOCUS_18910 2525 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2669 3586 gene locus_tag LOCUS_18920 2669 3586 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860663.1 protein_id gnl|my_center|LOCUS_18920 4523 3720 gene locus_tag LOCUS_18930 4523 3720 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_18930 5932 4721 gene locus_tag LOCUS_18940 5932 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 6132 6914 gene locus_tag LOCUS_18950 6132 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 6966 8954 gene locus_tag LOCUS_18960 6966 8954 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence088 620 276 gene locus_tag LOCUS_18970 620 276 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_18970 2121 649 gene locus_tag LOCUS_18980 gene mtaB 2121 649 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_18980 3120 2173 gene locus_tag LOCUS_18990 gene prmA 3120 2173 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872105.1 protein_id gnl|my_center|LOCUS_18990 3883 3149 gene locus_tag LOCUS_19000 3883 3149 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230015.1 protein_id gnl|my_center|LOCUS_19000 5444 4227 gene locus_tag LOCUS_19010 5444 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 6942 5569 gene locus_tag LOCUS_19020 6942 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 7970 7041 gene locus_tag LOCUS_19030 7970 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 <9354 8470 gene locus_tag LOCUS_19040 <9354 8470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816474.1:molecular chaperone DnaJ >Feature sequence089 680 1594 gene locus_tag LOCUS_19050 680 1594 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_19050 1643 2911 gene locus_tag LOCUS_19060 gene hacA 1643 2911 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_19060 2908 3420 gene locus_tag LOCUS_19070 2908 3420 CDS product Isopropylmalate/citramalate isomerase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870790.1 protein_id gnl|my_center|LOCUS_19070 3512 3961 gene locus_tag LOCUS_19080 3512 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4598 4188 gene locus_tag LOCUS_19090 4598 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5176 4676 gene locus_tag LOCUS_19100 gene thpR 5176 4676 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_19100 5585 5205 gene locus_tag LOCUS_19110 5585 5205 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_19110 5782 6255 gene locus_tag LOCUS_19120 5782 6255 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 protein_id gnl|my_center|LOCUS_19120 6844 6347 gene locus_tag LOCUS_19130 6844 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 8288 6999 gene locus_tag LOCUS_19140 8288 6999 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254838.1 protein_id gnl|my_center|LOCUS_19140 8694 8407 gene locus_tag LOCUS_19150 8694 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 >Feature sequence090 1827 1258 gene locus_tag LOCUS_19160 1827 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 2288 1809 gene locus_tag LOCUS_19170 2288 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 4015 2516 gene locus_tag LOCUS_19180 4015 2516 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228115.1 protein_id gnl|my_center|LOCUS_19180 4387 4154 gene locus_tag LOCUS_19190 4387 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 5016 6299 gene locus_tag LOCUS_19200 5016 6299 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_19200 6422 6598 gene locus_tag LOCUS_19210 6422 6598 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392551.1 protein_id gnl|my_center|LOCUS_19210 6609 7892 gene locus_tag LOCUS_19220 6609 7892 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_19220 8045 8311 gene locus_tag LOCUS_19230 8045 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence091 395 1945 gene locus_tag LOCUS_19240 395 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 2867 5131 gene locus_tag LOCUS_19250 2867 5131 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_19250 5131 7329 gene locus_tag LOCUS_19260 gene scpA 5131 7329 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_19260 >Feature sequence092 <1 1014 gene locus_tag LOCUS_19270 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391800.1:excinuclease ABC subunit UvrC 1014 1361 gene locus_tag LOCUS_19280 1014 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1470 2270 gene locus_tag LOCUS_19290 1470 2270 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_19290 2432 3298 gene locus_tag LOCUS_19300 gene rapZ 2432 3298 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_19300 3333 4706 gene locus_tag LOCUS_19310 3333 4706 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462178.1 protein_id gnl|my_center|LOCUS_19310 4732 5670 gene locus_tag LOCUS_19320 gene whiA 4732 5670 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006558.1 protein_id gnl|my_center|LOCUS_19320 5657 6553 gene locus_tag LOCUS_19330 5657 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 6661 6804 gene locus_tag LOCUS_19340 gene scfA 6661 6804 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815210.1 protein_id gnl|my_center|LOCUS_19340 6934 8370 gene locus_tag LOCUS_19350 gene scfB 6934 8370 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence093 <1 1083 gene locus_tag LOCUS_19360 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000057611.1:glucose-1-phosphate adenylyltransferase 1085 2194 gene locus_tag LOCUS_19370 gene glgD 1085 2194 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418641.1 protein_id gnl|my_center|LOCUS_19370 2205 4619 gene locus_tag LOCUS_19380 2205 4619 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_19380 4701 6689 gene locus_tag LOCUS_19390 gene glgB 4701 6689 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence094 1713 442 gene locus_tag LOCUS_19400 1713 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 2678 1716 gene locus_tag LOCUS_19410 gene gyaR 2678 1716 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_19410 3420 2866 gene locus_tag LOCUS_19420 3420 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5502 3658 gene locus_tag LOCUS_19430 5502 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5733 6944 gene locus_tag LOCUS_19440 5733 6944 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_19440 <7929 6993 gene locus_tag LOCUS_19450 <7929 6993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245362.1:adenine deaminase >Feature sequence095 1136 309 gene locus_tag LOCUS_19460 1136 309 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244040.1 protein_id gnl|my_center|LOCUS_19460 1451 1281 gene locus_tag LOCUS_19470 1451 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 2242 1820 gene locus_tag LOCUS_19480 2242 1820 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_19480 2909 6631 gene locus_tag LOCUS_19490 gene cobN 2909 6631 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496657.1 protein_id gnl|my_center|LOCUS_19490 6749 7771 gene locus_tag LOCUS_19500 6749 7771 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461434.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence096 1380 832 gene locus_tag LOCUS_19510 1380 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 1557 1405 gene locus_tag LOCUS_19520 1557 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 1771 1541 gene locus_tag LOCUS_19530 1771 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 2966 1815 gene locus_tag LOCUS_19540 2966 1815 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303808.1 protein_id gnl|my_center|LOCUS_19540 3310 4194 gene locus_tag LOCUS_19550 3310 4194 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_19550 4998 4201 gene locus_tag LOCUS_19560 4998 4201 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461363.1 protein_id gnl|my_center|LOCUS_19560 5551 5138 gene locus_tag LOCUS_19570 5551 5138 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_19570 5765 5535 gene locus_tag LOCUS_19580 5765 5535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6526 5876 gene locus_tag LOCUS_19590 6526 5876 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227434.1 protein_id gnl|my_center|LOCUS_19590 7333 6584 gene locus_tag LOCUS_19600 7333 6584 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence097 1037 39 gene locus_tag LOCUS_19610 1037 39 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_19610 1837 1064 gene locus_tag LOCUS_19620 1837 1064 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764454.1 protein_id gnl|my_center|LOCUS_19620 2067 3278 gene locus_tag LOCUS_19630 2067 3278 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399406.1 protein_id gnl|my_center|LOCUS_19630 3358 4716 gene locus_tag LOCUS_19640 3358 4716 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113788.1 protein_id gnl|my_center|LOCUS_19640 4713 5603 gene locus_tag LOCUS_19650 4713 5603 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113786.1 protein_id gnl|my_center|LOCUS_19650 5672 6211 gene locus_tag LOCUS_19660 5672 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 6511 6284 gene locus_tag LOCUS_19670 6511 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 6576 6710 gene locus_tag LOCUS_19680 6576 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 6707 6946 gene locus_tag LOCUS_19690 6707 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence098 646 1578 gene locus_tag LOCUS_19700 gene cysK 646 1578 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_19700 1825 2439 gene locus_tag LOCUS_19710 1825 2439 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_19710 2423 3511 gene locus_tag LOCUS_19720 gene mnmA 2423 3511 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_19720 3598 4746 gene locus_tag LOCUS_19730 3598 4746 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963712.1 protein_id gnl|my_center|LOCUS_19730 4816 5979 gene locus_tag LOCUS_19740 4816 5979 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_19740 6178 7074 gene locus_tag LOCUS_19750 6178 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence099 1356 304 gene locus_tag LOCUS_19760 1356 304 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016300.1 protein_id gnl|my_center|LOCUS_19760 2753 1527 gene locus_tag LOCUS_19770 2753 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 3014 3391 gene locus_tag LOCUS_19780 3014 3391 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_19780 3732 3550 gene locus_tag LOCUS_19790 3732 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 3668 4690 gene locus_tag LOCUS_19800 3668 4690 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948636.1 protein_id gnl|my_center|LOCUS_19800 4850 6649 gene locus_tag LOCUS_19810 4850 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence100 913 521 gene locus_tag LOCUS_19820 gene rpsI 913 521 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_19820 1369 932 gene locus_tag LOCUS_19830 gene rplM 1369 932 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583377.1 protein_id gnl|my_center|LOCUS_19830 1793 2629 gene locus_tag LOCUS_19840 1793 2629 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_19840 2759 3610 gene locus_tag LOCUS_19850 2759 3610 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_19850 3611 4414 gene locus_tag LOCUS_19860 3611 4414 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_19860 4411 5163 gene locus_tag LOCUS_19870 gene truA 4411 5163 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_19870 5577 5239 gene locus_tag LOCUS_19880 gene rplQ 5577 5239 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_19880 6582 5593 gene locus_tag LOCUS_19890 6582 5593 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence101 1206 313 gene locus_tag LOCUS_19900 gene dapA 1206 313 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_19900 2367 1336 gene locus_tag LOCUS_19910 2367 1336 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_19910 3242 2469 gene locus_tag LOCUS_19920 gene dapB 3242 2469 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723017.1 protein_id gnl|my_center|LOCUS_19920 3720 3532 gene locus_tag LOCUS_19930 3720 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 3919 5259 gene locus_tag LOCUS_19940 3919 5259 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_19940 5523 5185 gene locus_tag LOCUS_19950 5523 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 6258 6625 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcacctctcgcgaggtgcgac >Feature sequence102 724 248 gene locus_tag LOCUS_19960 724 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1506 805 gene locus_tag LOCUS_19970 1506 805 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_19970 2422 1730 gene locus_tag LOCUS_19980 gene thiE 2422 1730 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_19980 4585 2600 gene locus_tag LOCUS_19990 gene tkt 4585 2600 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019766.1 protein_id gnl|my_center|LOCUS_19990 6059 5115 gene locus_tag LOCUS_20000 6059 5115 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence103 294 752 gene locus_tag LOCUS_20010 294 752 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_20010 755 1324 gene locus_tag LOCUS_20020 755 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 1454 2296 gene locus_tag LOCUS_20030 1454 2296 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_20030 2334 3299 gene locus_tag LOCUS_20040 2334 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_20040 3683 4507 gene locus_tag LOCUS_20050 gene mutM 3683 4507 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816814.1 protein_id gnl|my_center|LOCUS_20050 4609 4797 gene locus_tag LOCUS_20060 4609 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4819 5481 gene locus_tag LOCUS_20070 4819 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 5629 6180 gene locus_tag LOCUS_20080 5629 6180 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970103.1 protein_id gnl|my_center|LOCUS_20080 >Feature sequence104 69 2156 gene locus_tag LOCUS_20090 69 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2283 2825 gene locus_tag LOCUS_20100 2283 2825 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_20100 2974 3864 gene locus_tag LOCUS_20110 2974 3864 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681313.1 protein_id gnl|my_center|LOCUS_20110 4181 4561 gene locus_tag LOCUS_20120 4181 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 4679 5359 gene locus_tag LOCUS_20130 4679 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence105 2161 1022 gene locus_tag LOCUS_20140 gene apgM2 2161 1022 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase ApgM2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869503.1 protein_id gnl|my_center|LOCUS_20140 3224 2136 gene locus_tag LOCUS_20150 gene cobD 3224 2136 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_20150 4309 3341 gene locus_tag LOCUS_20160 gene cbiB 4309 3341 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_20160 5765 4386 gene locus_tag LOCUS_20170 5765 4386 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861968.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence106 335 165 gene locus_tag LOCUS_20180 335 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 326 1168 gene locus_tag LOCUS_20190 326 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 2409 1288 gene locus_tag LOCUS_20200 gene alr 2409 1288 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_20200 2681 3625 gene locus_tag LOCUS_20210 2681 3625 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_20210 4869 3859 gene locus_tag LOCUS_20220 4869 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence107 1940 279 gene locus_tag LOCUS_20230 1940 279 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525224.1 protein_id gnl|my_center|LOCUS_20230 <5826 1933 gene locus_tag LOCUS_20240 <5826 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921648.1:YDG domain-containing protein >Feature sequence108 3045 439 gene locus_tag LOCUS_20250 3045 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 4670 3387 gene locus_tag LOCUS_20260 4670 3387 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808136.1 protein_id gnl|my_center|LOCUS_20260 5437 4757 gene locus_tag LOCUS_20270 gene pssA 5437 4757 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence109 657 3560 gene locus_tag LOCUS_20280 657 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence110 341 1612 gene locus_tag LOCUS_20290 341 1612 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_20290 1709 3196 gene locus_tag LOCUS_20300 1709 3196 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_20300 3282 4106 gene locus_tag LOCUS_20310 3282 4106 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_20310 4186 5028 gene locus_tag LOCUS_20320 4186 5028 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392700.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence111 821 746 gene locus_tag LOCUS_t00400 821 746 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1414 863 gene locus_tag LOCUS_20330 1414 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2733 1456 gene locus_tag LOCUS_20340 2733 1456 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_20340 4542 2842 gene locus_tag LOCUS_20350 gene ilvB 4542 2842 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944692.1 protein_id gnl|my_center|LOCUS_20350 5573 4677 gene locus_tag LOCUS_20360 gene ilvC 5573 4677 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_20360 >Feature sequence112 <1 888 gene locus_tag LOCUS_20370 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679271.1:NAD(P)-binding protein 882 2591 gene locus_tag LOCUS_20380 882 2591 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_20380 2988 2743 gene locus_tag LOCUS_20390 2988 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 3544 3182 gene locus_tag LOCUS_20400 3544 3182 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_20400 4886 3621 gene locus_tag LOCUS_20410 4886 3621 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_20410 <5536 4966 gene locus_tag LOCUS_20420 <5536 4966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957284.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence113 675 1310 gene locus_tag LOCUS_20430 675 1310 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869173.1 protein_id gnl|my_center|LOCUS_20430 1332 1721 gene locus_tag LOCUS_20440 1332 1721 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816928.1 protein_id gnl|my_center|LOCUS_20440 1803 2903 gene locus_tag LOCUS_20450 1803 2903 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_20450 3347 3619 gene locus_tag LOCUS_20460 3347 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3616 3945 gene locus_tag LOCUS_20470 3616 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 4645 5394 gene locus_tag LOCUS_20480 4645 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence114 1115 147 gene locus_tag LOCUS_20490 1115 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1592 1302 gene locus_tag LOCUS_20500 1592 1302 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_20500 2575 1733 gene locus_tag LOCUS_20510 2575 1733 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_20510 3579 2590 gene locus_tag LOCUS_20520 3579 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 4115 3594 gene locus_tag LOCUS_20530 4115 3594 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_20530 4228 5115 gene locus_tag LOCUS_20540 4228 5115 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958251.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence115 1974 202 gene locus_tag LOCUS_20550 1974 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 4236 2005 gene locus_tag LOCUS_20560 4236 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 5096 4356 gene locus_tag LOCUS_20570 5096 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163851494.1 protein_id gnl|my_center|LOCUS_20570 >Feature sequence116 41 1057 gene locus_tag LOCUS_20580 41 1057 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_20580 1556 2590 gene locus_tag LOCUS_20590 1556 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2631 3371 gene locus_tag LOCUS_20600 gene phnC 2631 3371 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832011.1 protein_id gnl|my_center|LOCUS_20600 3368 4900 gene locus_tag LOCUS_20610 3368 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence117 340 1281 gene locus_tag LOCUS_20620 gene meaB 340 1281 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_20620 1327 1746 gene locus_tag LOCUS_20630 gene mce 1327 1746 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_20630 1861 3393 gene locus_tag LOCUS_20640 1861 3393 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869044.1 protein_id gnl|my_center|LOCUS_20640 3453 3800 gene locus_tag LOCUS_20650 3453 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 3862 4251 gene locus_tag LOCUS_20660 3862 4251 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence118 241 834 gene locus_tag LOCUS_20670 241 834 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_20670 1238 948 gene locus_tag LOCUS_20680 1238 948 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_20680 2306 1353 gene locus_tag LOCUS_20690 2306 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 4139 2748 gene locus_tag LOCUS_20700 4139 2748 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003903975.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence119 1865 852 gene locus_tag LOCUS_20710 1865 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3405 2047 gene locus_tag LOCUS_20720 gene larC 3405 2047 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_20720 4298 3543 gene locus_tag LOCUS_20730 gene larB 4298 3543 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_20730 <4797 4288 gene locus_tag LOCUS_20740 <4797 4288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974031.1:efflux RND transporter permease subunit >Feature sequence120 14 313 gene locus_tag LOCUS_20750 14 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 395 1444 gene locus_tag LOCUS_20760 395 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1447 2160 gene locus_tag LOCUS_20770 1447 2160 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821961.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence121 728 600 gene locus_tag LOCUS_20780 728 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 847 725 gene locus_tag LOCUS_20790 847 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1034 861 gene locus_tag LOCUS_20800 1034 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 1423 1148 gene locus_tag LOCUS_20810 1423 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1722 1925 gene locus_tag LOCUS_20820 1722 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 2290 2000 gene locus_tag LOCUS_20830 2290 2000 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650837.1 protein_id gnl|my_center|LOCUS_20830 2652 2293 gene locus_tag LOCUS_20840 2652 2293 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694481.1 protein_id gnl|my_center|LOCUS_20840 3081 3242 gene locus_tag LOCUS_20850 3081 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 3261 3560 gene locus_tag LOCUS_20860 3261 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 3891 3691 gene locus_tag LOCUS_20870 3891 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 4322 3888 gene locus_tag LOCUS_20880 4322 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence122 1 402 gene locus_tag LOCUS_20890 1 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 636 727 gene locus_tag LOCUS_t00410 636 727 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 980 2656 gene locus_tag LOCUS_20900 980 2656 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_20900 2862 4151 gene locus_tag LOCUS_20910 gene obgE 2862 4151 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence123 74 856 gene locus_tag LOCUS_20920 74 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 875 1435 gene locus_tag LOCUS_20930 875 1435 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705391.1 protein_id gnl|my_center|LOCUS_20930 1848 2813 gene locus_tag LOCUS_20940 1848 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3307 3002 gene locus_tag LOCUS_20950 3307 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3583 3326 gene locus_tag LOCUS_20960 3583 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 3895 4404 gene locus_tag LOCUS_20970 3895 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence124 2546 987 gene locus_tag LOCUS_20980 2546 987 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546376.1 protein_id gnl|my_center|LOCUS_20980 2732 2808 gene locus_tag LOCUS_t00420 2732 2808 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3286 2858 gene locus_tag LOCUS_20990 3286 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 4164 3409 gene locus_tag LOCUS_21000 4164 3409 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974643.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence125 742 53 gene locus_tag LOCUS_21010 742 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 4008 739 gene locus_tag LOCUS_21020 4008 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence126 3726 1699 gene locus_tag LOCUS_21030 3726 1699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 protein_id gnl|my_center|LOCUS_21030 3957 4031 gene locus_tag LOCUS_t00430 3957 4031 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 3294 376 gene locus_tag LOCUS_21040 3294 376 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048254.1 protein_id gnl|my_center|LOCUS_21040 3515 3805 gene locus_tag LOCUS_21050 3515 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence128 1013 357 gene locus_tag LOCUS_21060 1013 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2332 1010 gene locus_tag LOCUS_21070 2332 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3190 2498 gene locus_tag LOCUS_21080 3190 2498 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_21080 3687 3322 gene locus_tag LOCUS_21090 3687 3322 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781331.1 protein_id gnl|my_center|LOCUS_21090 3829 3755 gene locus_tag LOCUS_t00440 3829 3755 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence129 84 1649 gene locus_tag LOCUS_21100 84 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399445.1 protein_id gnl|my_center|LOCUS_21100 2934 1897 gene locus_tag LOCUS_21110 2934 1897 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546390.1 protein_id gnl|my_center|LOCUS_21110 3812 3051 gene locus_tag LOCUS_21120 3812 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence130 389 766 gene locus_tag LOCUS_21130 389 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 891 1199 gene locus_tag LOCUS_21140 gene trxA 891 1199 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_21140 1324 2208 gene locus_tag LOCUS_21150 1324 2208 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_21150 3308 2400 gene locus_tag LOCUS_21160 3308 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 3539 3420 gene locus_tag LOCUS_21170 3539 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence131 2668 1052 gene locus_tag LOCUS_21180 2668 1052 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163066848.1 protein_id gnl|my_center|LOCUS_21180 3008 2787 gene locus_tag LOCUS_21190 3008 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3777 3427 gene locus_tag LOCUS_21200 3777 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence132 23 1561 gene locus_tag LOCUS_21210 23 1561 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861532.1 protein_id gnl|my_center|LOCUS_21210 1812 3458 gene locus_tag LOCUS_21220 1812 3458 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence133 1639 377 gene locus_tag LOCUS_21230 1639 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 3124 1832 gene locus_tag LOCUS_21240 3124 1832 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_21240 <3760 3139 gene locus_tag LOCUS_21250 <3760 3139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460907.1:valine--tRNA ligase >Feature sequence134 290 1189 gene locus_tag LOCUS_21260 290 1189 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_21260 1392 1922 gene locus_tag LOCUS_21270 1392 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2017 2655 gene locus_tag LOCUS_21280 2017 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 2994 3578 gene locus_tag LOCUS_21290 2994 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence135 1754 102 gene locus_tag LOCUS_21300 1754 102 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence136 <1 868 gene locus_tag LOCUS_21310 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000593465.1:chitin disaccharide deacetylase 1083 3161 gene locus_tag LOCUS_21320 1083 3161 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence137 1666 407 gene locus_tag LOCUS_21330 1666 407 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_21330 1922 1785 gene locus_tag LOCUS_21340 1922 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1962 2996 gene locus_tag LOCUS_21350 1962 2996 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_21350 >Feature sequence138 69 1094 gene locus_tag LOCUS_21360 69 1094 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010213957.1 protein_id gnl|my_center|LOCUS_21360 2847 1420 gene locus_tag LOCUS_21370 2847 1420 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272192.1 protein_id gnl|my_center|LOCUS_21370 3071 2943 gene locus_tag LOCUS_21380 3071 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence139 611 60 gene locus_tag LOCUS_21390 611 60 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970103.1 protein_id gnl|my_center|LOCUS_21390 1221 625 gene locus_tag LOCUS_21400 1221 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 1787 1266 gene locus_tag LOCUS_21410 1787 1266 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434028.1 protein_id gnl|my_center|LOCUS_21410 1993 2937 gene locus_tag LOCUS_21420 1993 2937 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027936894.1 protein_id gnl|my_center|LOCUS_21420 >Feature sequence140 >Feature sequence141 1312 1100 gene locus_tag LOCUS_21430 gene yidD 1312 1100 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966997.1 protein_id gnl|my_center|LOCUS_21430 1643 1284 gene locus_tag LOCUS_21440 gene rnpA 1643 1284 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_21440 1832 1695 gene locus_tag LOCUS_21450 gene rpmH 1832 1695 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence142 947 297 gene locus_tag LOCUS_21460 947 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 2101 944 gene locus_tag LOCUS_21470 2101 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 2592 2119 gene locus_tag LOCUS_21480 2592 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence143 210 860 gene locus_tag LOCUS_21490 210 860 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_21490 868 1623 gene locus_tag LOCUS_21500 868 1623 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_21500 1717 2544 gene locus_tag LOCUS_21510 gene larE 1717 2544 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_21510 2836 2762 gene locus_tag LOCUS_t00450 2836 2762 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2921 2848 gene locus_tag LOCUS_t00460 2921 2848 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 60 135 gene locus_tag LOCUS_t00470 60 135 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 310 1113 gene locus_tag LOCUS_21520 310 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1190 2500 gene locus_tag LOCUS_21530 1190 2500 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439092.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence145 >Feature sequence146 295 1422 gene locus_tag LOCUS_21540 295 1422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_21540 >Feature sequence147 2035 599 gene locus_tag LOCUS_21550 gene gndA 2035 599 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295350.1 protein_id gnl|my_center|LOCUS_21550 >Feature sequence148 >Feature sequence149 <1 2136 gene locus_tag LOCUS_21560 <1 2136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003646028.1:phosphoenolpyruvate synthase >Feature sequence150 2069 585 gene locus_tag LOCUS_21570 2069 585 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392040.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence151 <1 1800 gene locus_tag LOCUS_21580 <1 1800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:translational GTPase TypA 2005 2358 gene locus_tag LOCUS_21590 2005 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence152 <2384 1654 gene locus_tag LOCUS_21600 <2384 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003238566.1:succinate--CoA ligase subunit alpha >Feature sequence153 90 716 gene locus_tag LOCUS_21610 90 716 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066132.1 protein_id gnl|my_center|LOCUS_21610 737 1570 gene locus_tag LOCUS_21620 737 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_21620 2201 1716 gene locus_tag LOCUS_21630 2201 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence154 769 1095 gene locus_tag LOCUS_21640 769 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1424 1499 gene locus_tag LOCUS_t00480 1424 1499 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2256 1807 gene locus_tag LOCUS_21650 2256 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 >Feature sequence155 400 1443 gene locus_tag LOCUS_21660 400 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 >Feature sequence156 414 599 gene locus_tag LOCUS_21670 414 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 612 1754 gene locus_tag LOCUS_21680 612 1754 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869713.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence157 >Feature sequence158 206 640 gene locus_tag LOCUS_21690 206 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 613 1551 gene locus_tag LOCUS_21700 613 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21700 >Feature sequence159 233 1480 gene locus_tag LOCUS_21710 233 1480 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070090119.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence160 <1 541 gene locus_tag LOCUS_21720 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812939.1:recombinase RecA 504 1028 gene locus_tag LOCUS_21730 504 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence161 540 82 gene locus_tag LOCUS_21740 gene bcp 540 82 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_21740 1798 554 gene locus_tag LOCUS_21750 1798 554 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence162 <1 687 gene locus_tag LOCUS_21760 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869047.1:sodium ion-translocating decarboxylase subunit beta >Feature sequence163 <1 589 gene locus_tag LOCUS_21770 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392701.1:MBL fold metallo-hydrolase 981 2018 gene locus_tag LOCUS_21780 981 2018 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462087.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence164 <2005 1052 gene locus_tag LOCUS_21790 <2005 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_163066848.1:recombinase family protein >Feature sequence165 <1 720 gene locus_tag LOCUS_21800 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723333.1:ABC transporter substrate-binding protein 808 1836 gene locus_tag LOCUS_21810 808 1836 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence166 1071 565 gene locus_tag LOCUS_21820 1071 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1932 1585 gene locus_tag LOCUS_21830 1932 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence167 494 345 gene locus_tag LOCUS_21840 494 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 1858 791 gene locus_tag LOCUS_21850 gene argH 1858 791 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence168 >Feature sequence169 >Feature sequence170 <1768 829 gene locus_tag LOCUS_21860 <1768 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867978.1:Ldh family oxidoreductase >Feature sequence171 >Feature sequence172 199 561 gene locus_tag LOCUS_21870 gene rpsM 199 561 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_21870 585 977 gene locus_tag LOCUS_21880 gene rpsK 585 977 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101799.1 protein_id gnl|my_center|LOCUS_21880 997 1590 gene locus_tag LOCUS_21890 gene rpsD 997 1590 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence173 537 929 gene locus_tag LOCUS_21900 537 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 986 1120 gene locus_tag LOCUS_21910 986 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1503 1141 gene locus_tag LOCUS_21920 1503 1141 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence174 3 923 gene locus_tag LOCUS_21930 gene tuf 3 923 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_21930 1107 1418 gene locus_tag LOCUS_21940 gene rpsJ 1107 1418 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence175 888 91 gene locus_tag LOCUS_21950 888 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 1433 954 gene locus_tag LOCUS_21960 1433 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence176 587 96 gene locus_tag LOCUS_21970 587 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence177