>Feature sequence0001 1075 1629 gene locus_tag LOCUS_00010 gene rbr3B 1075 1629 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966861.1 protein_id gnl|my_center|LOCUS_00010 6088 1796 gene locus_tag LOCUS_00020 6088 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 6828 6241 gene locus_tag LOCUS_00030 6828 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 7112 6894 gene locus_tag LOCUS_00040 7112 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 <8387 7300 gene locus_tag LOCUS_00050 <8387 7300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922005.1:fatty acid CoA ligase family protein >Feature sequence0002 968 5284 gene locus_tag LOCUS_00060 968 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 >Feature sequence0003 <1 3876 gene locus_tag LOCUS_00070 <1 3876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein 4183 5850 gene locus_tag LOCUS_00080 4183 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5874 6719 gene locus_tag LOCUS_00090 5874 6719 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939227.1 protein_id gnl|my_center|LOCUS_00090 >Feature sequence0004 1032 7 gene locus_tag LOCUS_00100 gene pdxA 1032 7 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121619.1 protein_id gnl|my_center|LOCUS_00100 1303 2049 gene locus_tag LOCUS_00110 1303 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 3481 2207 gene locus_tag LOCUS_00120 3481 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 4327 3614 gene locus_tag LOCUS_00130 4327 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 4718 5974 gene locus_tag LOCUS_00140 4718 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 >Feature sequence0005 2729 2046 gene locus_tag LOCUS_00150 2729 2046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123055.1 protein_id gnl|my_center|LOCUS_00150 4053 2872 gene locus_tag LOCUS_00160 4053 2872 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123043.1 protein_id gnl|my_center|LOCUS_00160 4408 4647 gene locus_tag LOCUS_00170 4408 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 <7280 4809 gene locus_tag LOCUS_00180 <7280 4809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333812.1:DNA-directed RNA polymerase subunit beta' >Feature sequence0006 2904 1171 gene locus_tag LOCUS_00190 2904 1171 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121117.1 protein_id gnl|my_center|LOCUS_00190 3498 4700 gene locus_tag LOCUS_00200 3498 4700 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_00200 6957 4834 gene locus_tag LOCUS_00210 6957 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 >Feature sequence0007 1056 244 gene locus_tag LOCUS_00220 1056 244 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967893.1 protein_id gnl|my_center|LOCUS_00220 2470 1148 gene locus_tag LOCUS_00230 2470 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 4587 3202 gene locus_tag LOCUS_00240 gene noeA 4587 3202 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127582344.1 protein_id gnl|my_center|LOCUS_00240 4818 4594 gene locus_tag LOCUS_00250 4818 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 6172 4997 gene locus_tag LOCUS_00260 6172 4997 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_00260 >Feature sequence0008 3751 4017 gene locus_tag LOCUS_00270 gene rpsO 3751 4017 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329975.1 protein_id gnl|my_center|LOCUS_00270 4336 6474 gene locus_tag LOCUS_00280 gene pnp 4336 6474 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037246149.1 protein_id gnl|my_center|LOCUS_00280 >Feature sequence0009 483 1070 gene locus_tag LOCUS_00290 483 1070 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229526.1 protein_id gnl|my_center|LOCUS_00290 1086 1685 gene locus_tag LOCUS_00300 gene atpH 1086 1685 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816489.1 protein_id gnl|my_center|LOCUS_00300 1754 3259 gene locus_tag LOCUS_00310 gene atpA 1754 3259 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334261.1 protein_id gnl|my_center|LOCUS_00310 3352 4224 gene locus_tag LOCUS_00320 gene atpG 3352 4224 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122671.1 protein_id gnl|my_center|LOCUS_00320 4329 5771 gene locus_tag LOCUS_00330 gene atpD 4329 5771 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122672.1 protein_id gnl|my_center|LOCUS_00330 5868 6254 gene locus_tag LOCUS_00340 5868 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence0010 1842 433 gene locus_tag LOCUS_00350 1842 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 2908 1844 gene locus_tag LOCUS_00360 2908 1844 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_00360 3830 2889 gene locus_tag LOCUS_00370 3830 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 5891 3933 gene locus_tag LOCUS_00380 gene uvrB 5891 3933 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329492.1 protein_id gnl|my_center|LOCUS_00380 >Feature sequence0011 528 1511 gene locus_tag LOCUS_00390 gene hpnH 528 1511 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941345.1 protein_id gnl|my_center|LOCUS_00390 2095 1589 gene locus_tag LOCUS_00400 2095 1589 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328025.1 protein_id gnl|my_center|LOCUS_00400 3643 2567 gene locus_tag LOCUS_00410 3643 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326644.1 protein_id gnl|my_center|LOCUS_00410 <6308 3910 gene locus_tag LOCUS_00420 <6308 3910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922147.1:primosomal protein N' >Feature sequence0012 27 1151 gene locus_tag LOCUS_00430 gene prfB 27 1151 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146392543.1 protein_id gnl|my_center|LOCUS_00430 1815 5843 gene locus_tag LOCUS_00440 1815 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 >Feature sequence0013 3578 921 gene locus_tag LOCUS_00450 gene clpB 3578 921 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922205.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence0014 3 752 gene locus_tag LOCUS_00460 3 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 821 1993 gene locus_tag LOCUS_00470 821 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2024 2548 gene locus_tag LOCUS_00480 2024 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2912 3499 gene locus_tag LOCUS_00490 gene lexA 2912 3499 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615546.1 protein_id gnl|my_center|LOCUS_00490 4780 3602 gene locus_tag LOCUS_00500 4780 3602 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_00500 5336 4917 gene locus_tag LOCUS_00510 gene rpsI 5336 4917 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122781.1 protein_id gnl|my_center|LOCUS_00510 5819 5382 gene locus_tag LOCUS_00520 gene rplM 5819 5382 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence0015 <1 1154 gene locus_tag LOCUS_00530 <1 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109168.1:putative DNA binding domain-containing protein 2539 1223 gene locus_tag LOCUS_00540 2539 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 3331 2552 gene locus_tag LOCUS_00550 3331 2552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332037.1 protein_id gnl|my_center|LOCUS_00550 4236 3406 gene locus_tag LOCUS_00560 4236 3406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815039.1 protein_id gnl|my_center|LOCUS_00560 4903 4457 gene locus_tag LOCUS_00570 4903 4457 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_00570 5312 4896 gene locus_tag LOCUS_00580 5312 4896 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458951.1 protein_id gnl|my_center|LOCUS_00580 <6097 5512 gene locus_tag LOCUS_00590 <6097 5512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103673.1:ATP-binding protein >Feature sequence0016 1390 161 gene locus_tag LOCUS_00600 1390 161 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764578.1 protein_id gnl|my_center|LOCUS_00600 2478 3173 gene locus_tag LOCUS_00610 2478 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 3627 4877 gene locus_tag LOCUS_00620 3627 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 5150 5067 gene locus_tag LOCUS_t00010 5150 5067 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0017 1328 1059 gene locus_tag LOCUS_00630 1328 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 2680 1457 gene locus_tag LOCUS_00640 gene xseA 2680 1457 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119437.1 protein_id gnl|my_center|LOCUS_00640 3222 2677 gene locus_tag LOCUS_00650 3222 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 4561 3416 gene locus_tag LOCUS_00660 4561 3416 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922223.1 protein_id gnl|my_center|LOCUS_00660 5356 4580 gene locus_tag LOCUS_00670 5356 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 <6053 5396 gene locus_tag LOCUS_00680 <6053 5396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338728.1:DUF1559 domain-containing protein >Feature sequence0018 <1 507 gene locus_tag LOCUS_00690 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117868.1:BtaA family protein 615 1589 gene locus_tag LOCUS_00700 gene trpS 615 1589 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120916.1 protein_id gnl|my_center|LOCUS_00700 1639 2634 gene locus_tag LOCUS_00710 gene dusB 1639 2634 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334998.1 protein_id gnl|my_center|LOCUS_00710 3650 2646 gene locus_tag LOCUS_00720 3650 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 4426 5421 gene locus_tag LOCUS_00730 4426 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769801.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0019 1762 254 gene locus_tag LOCUS_00740 gene glpK 1762 254 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_00740 2082 2408 gene locus_tag LOCUS_00750 2082 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 2444 3550 gene locus_tag LOCUS_00760 2444 3550 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_00760 3694 5208 gene locus_tag LOCUS_00770 gene proS 3694 5208 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921836.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence0020 1149 121 gene locus_tag LOCUS_00780 1149 121 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_00780 2337 1273 gene locus_tag LOCUS_00790 2337 1273 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_00790 2974 3531 gene locus_tag LOCUS_00800 2974 3531 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_00800 3547 4494 gene locus_tag LOCUS_00810 3547 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 5400 4513 gene locus_tag LOCUS_00820 gene folP 5400 4513 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491579.1 protein_id gnl|my_center|LOCUS_00820 <5979 5408 gene locus_tag LOCUS_00830 <5979 5408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081335.1:DEAD/DEAH box helicase family protein >Feature sequence0021 1829 1065 gene locus_tag LOCUS_00840 gene fecE 1829 1065 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266549.1 protein_id gnl|my_center|LOCUS_00840 2978 1953 gene locus_tag LOCUS_00850 2978 1953 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615578.1 protein_id gnl|my_center|LOCUS_00850 3123 3305 gene locus_tag LOCUS_00860 3123 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 3600 5177 gene locus_tag LOCUS_00870 3600 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 >Feature sequence0022 388 1461 gene locus_tag LOCUS_00880 388 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 1468 1833 gene locus_tag LOCUS_00890 1468 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 1989 3047 gene locus_tag LOCUS_00900 1989 3047 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122217.1 protein_id gnl|my_center|LOCUS_00900 3114 4778 gene locus_tag LOCUS_00910 3114 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615466.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence0023 23 1192 gene locus_tag LOCUS_00920 23 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 1189 2064 gene locus_tag LOCUS_00930 1189 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2125 2427 gene locus_tag LOCUS_00940 2125 2427 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000263130.1 protein_id gnl|my_center|LOCUS_00940 2417 2752 gene locus_tag LOCUS_00950 2417 2752 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460590.1 protein_id gnl|my_center|LOCUS_00950 3526 2906 gene locus_tag LOCUS_00960 3526 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 4087 5250 gene locus_tag LOCUS_00970 4087 5250 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391447.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence0024 1965 130 gene locus_tag LOCUS_00980 gene mnmG 1965 130 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427787.1 protein_id gnl|my_center|LOCUS_00980 5598 2296 gene locus_tag LOCUS_00990 5598 2296 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 protein_id gnl|my_center|LOCUS_00990 >Feature sequence0025 1607 978 gene locus_tag LOCUS_01000 1607 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 2880 2056 gene locus_tag LOCUS_01010 2880 2056 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_01010 3193 5220 gene locus_tag LOCUS_01020 3193 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5373 5445 gene locus_tag LOCUS_t00020 5373 5445 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0026 595 1677 gene locus_tag LOCUS_01030 595 1677 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921437.1 protein_id gnl|my_center|LOCUS_01030 1772 2428 gene locus_tag LOCUS_01040 gene cmk 1772 2428 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849400.1 protein_id gnl|my_center|LOCUS_01040 2525 3595 gene locus_tag LOCUS_01050 gene mtnA 2525 3595 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_01050 5221 3968 gene locus_tag LOCUS_01060 5221 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence0027 288 572 gene locus_tag LOCUS_01070 288 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 630 899 gene locus_tag LOCUS_01080 630 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1303 2676 gene locus_tag LOCUS_01090 1303 2676 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694115.1 protein_id gnl|my_center|LOCUS_01090 2680 4035 gene locus_tag LOCUS_01100 2680 4035 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418132.1 protein_id gnl|my_center|LOCUS_01100 4028 4882 gene locus_tag LOCUS_01110 4028 4882 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816934.1 protein_id gnl|my_center|LOCUS_01110 4882 5514 gene locus_tag LOCUS_01120 4882 5514 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208714.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence0028 1084 614 gene locus_tag LOCUS_01130 1084 614 CDS product 3-hydroxyacyl-ACP dehydratase FabZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922123.1 protein_id gnl|my_center|LOCUS_01130 1873 1169 gene locus_tag LOCUS_01140 1873 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4752 2023 gene locus_tag LOCUS_01150 gene topA 4752 2023 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812879.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence0029 123 677 gene locus_tag LOCUS_01160 123 677 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327091.1 protein_id gnl|my_center|LOCUS_01160 1163 2110 gene locus_tag LOCUS_01170 1163 2110 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089239.1 protein_id gnl|my_center|LOCUS_01170 3130 2138 gene locus_tag LOCUS_01180 3130 2138 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926960.1 protein_id gnl|my_center|LOCUS_01180 4447 3194 gene locus_tag LOCUS_01190 4447 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence0030 2096 996 gene locus_tag LOCUS_01200 2096 996 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329383.1 protein_id gnl|my_center|LOCUS_01200 3895 2180 gene locus_tag LOCUS_01210 3895 2180 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922562.1 protein_id gnl|my_center|LOCUS_01210 4327 5229 gene locus_tag LOCUS_01220 4327 5229 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence0031 276 1964 gene locus_tag LOCUS_01230 276 1964 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_01230 1961 3178 gene locus_tag LOCUS_01240 1961 3178 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120976.1 protein_id gnl|my_center|LOCUS_01240 3269 5248 gene locus_tag LOCUS_01250 3269 5248 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence0032 686 1690 gene locus_tag LOCUS_01260 686 1690 CDS product NrpR regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546211.1 protein_id gnl|my_center|LOCUS_01260 1753 3594 gene locus_tag LOCUS_01270 1753 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence0033 1334 1996 gene locus_tag LOCUS_01280 1334 1996 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_01280 2002 3405 gene locus_tag LOCUS_01290 2002 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 <5344 3407 gene locus_tag LOCUS_01300 <5344 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325559.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence0034 1026 337 gene locus_tag LOCUS_01310 1026 337 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_01310 2150 1422 gene locus_tag LOCUS_01320 2150 1422 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931881.1 protein_id gnl|my_center|LOCUS_01320 2613 4730 gene locus_tag LOCUS_01330 gene dnaX 2613 4730 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921981.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence0035 595 2109 gene locus_tag LOCUS_01340 595 2109 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157579517.1 protein_id gnl|my_center|LOCUS_01340 3359 2904 gene locus_tag LOCUS_01350 gene folK 3359 2904 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_01350 4686 3607 gene locus_tag LOCUS_01360 4686 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 >Feature sequence0036 2019 2255 gene locus_tag LOCUS_01370 2019 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2473 3531 gene locus_tag LOCUS_01380 2473 3531 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922921.1 protein_id gnl|my_center|LOCUS_01380 4201 3968 gene locus_tag LOCUS_01390 4201 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 5184 4504 gene locus_tag LOCUS_01400 5184 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence0037 1491 2699 gene locus_tag LOCUS_01410 1491 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 3594 2794 gene locus_tag LOCUS_01420 3594 2794 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020696.1 protein_id gnl|my_center|LOCUS_01420 >Feature sequence0038 127 366 gene locus_tag LOCUS_01430 127 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 382 1134 gene locus_tag LOCUS_01440 gene kdsB 382 1134 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123860.1 protein_id gnl|my_center|LOCUS_01440 1320 2654 gene locus_tag LOCUS_01450 1320 2654 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_01450 3542 2754 gene locus_tag LOCUS_01460 3542 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 <5247 3567 gene locus_tag LOCUS_01470 <5247 3567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324338.1:1,4-alpha-glucan branching protein GlgB >Feature sequence0039 >Feature sequence0040 203 1954 gene locus_tag LOCUS_01480 gene ptsP 203 1954 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328922.1 protein_id gnl|my_center|LOCUS_01480 2103 3053 gene locus_tag LOCUS_01490 2103 3053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331193.1 protein_id gnl|my_center|LOCUS_01490 3050 4591 gene locus_tag LOCUS_01500 3050 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence0041 1661 954 gene locus_tag LOCUS_01510 1661 954 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_01510 2935 1793 gene locus_tag LOCUS_01520 2935 1793 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262953.1 protein_id gnl|my_center|LOCUS_01520 4116 2995 gene locus_tag LOCUS_01530 4116 2995 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123411.1 protein_id gnl|my_center|LOCUS_01530 <5209 4165 gene locus_tag LOCUS_01540 <5209 4165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007338728.1:DUF1559 domain-containing protein >Feature sequence0042 134 1462 gene locus_tag LOCUS_01550 134 1462 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_01550 2981 1650 gene locus_tag LOCUS_01560 2981 1650 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123393.1 protein_id gnl|my_center|LOCUS_01560 3650 3084 gene locus_tag LOCUS_01570 3650 3084 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921444.1 protein_id gnl|my_center|LOCUS_01570 3918 4307 gene locus_tag LOCUS_01580 3918 4307 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350530.1 protein_id gnl|my_center|LOCUS_01580 >Feature sequence0043 380 946 gene locus_tag LOCUS_01590 380 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 943 3576 gene locus_tag LOCUS_01600 943 3576 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_01600 3593 4504 gene locus_tag LOCUS_01610 gene miaA 3593 4504 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118401.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence0044 1187 612 gene locus_tag LOCUS_01620 gene smpB 1187 612 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 protein_id gnl|my_center|LOCUS_01620 2876 1518 gene locus_tag LOCUS_01630 2876 1518 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921696.1 protein_id gnl|my_center|LOCUS_01630 3410 2979 gene locus_tag LOCUS_01640 3410 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 3869 4585 gene locus_tag LOCUS_01650 3869 4585 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence0045 2174 1203 gene locus_tag LOCUS_01660 2174 1203 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325730.1 protein_id gnl|my_center|LOCUS_01660 2344 2964 gene locus_tag LOCUS_01670 2344 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3099 4061 gene locus_tag LOCUS_01680 gene queG 3099 4061 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986833.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence0046 2230 197 gene locus_tag LOCUS_01690 2230 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3339 2227 gene locus_tag LOCUS_01700 3339 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3877 4086 gene locus_tag LOCUS_01710 3877 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 4092 4526 gene locus_tag LOCUS_01720 4092 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 >Feature sequence0047 3649 5 gene locus_tag LOCUS_01730 3649 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence0048 351 1385 gene locus_tag LOCUS_01740 351 1385 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121388.1 protein_id gnl|my_center|LOCUS_01740 1688 1885 gene locus_tag LOCUS_01750 1688 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3403 1979 gene locus_tag LOCUS_01760 3403 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 4353 3697 gene locus_tag LOCUS_01770 4353 3697 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_01770 <5018 4402 gene locus_tag LOCUS_01780 <5018 4402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007334207.1:tRNA (guanosine(46)-N7)-methyltransferase TrmB >Feature sequence0049 <1 922 gene locus_tag LOCUS_01790 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761572.1:DUF58 domain-containing protein 991 1971 gene locus_tag LOCUS_01800 991 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2100 3182 gene locus_tag LOCUS_01810 2100 3182 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121996.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence0050 409 756 gene locus_tag LOCUS_01820 409 756 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005302630.1 protein_id gnl|my_center|LOCUS_01820 2109 841 gene locus_tag LOCUS_01830 2109 841 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence0051 316 486 gene locus_tag LOCUS_01840 316 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 525 4571 gene locus_tag LOCUS_01850 gene hrpA 525 4571 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072251.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence0052 755 994 gene locus_tag LOCUS_01860 755 994 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_01860 1049 2023 gene locus_tag LOCUS_01870 1049 2023 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803888.1 protein_id gnl|my_center|LOCUS_01870 2113 2391 gene locus_tag LOCUS_01880 2113 2391 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762348.1 protein_id gnl|my_center|LOCUS_01880 2413 3156 gene locus_tag LOCUS_01890 2413 3156 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_01890 3212 3394 gene locus_tag LOCUS_01900 3212 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 3968 3534 gene locus_tag LOCUS_01910 3968 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence0053 <1 1239 gene locus_tag LOCUS_01920 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860739.1:DUF4132 domain-containing protein 3609 1363 gene locus_tag LOCUS_01930 3609 1363 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_01930 3883 3722 gene locus_tag LOCUS_01940 3883 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence0054 1185 1361 gene locus_tag LOCUS_01950 1185 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1624 1534 gene locus_tag LOCUS_t00030 1624 1534 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3290 1794 gene locus_tag LOCUS_01960 3290 1794 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337250.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence0055 2771 165 gene locus_tag LOCUS_01970 2771 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 3292 3366 gene locus_tag LOCUS_t00040 3292 3366 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4679 3348 gene locus_tag LOCUS_01980 4679 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0056 1527 28 gene locus_tag LOCUS_01990 1527 28 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939110.1 protein_id gnl|my_center|LOCUS_01990 2727 1612 gene locus_tag LOCUS_02000 2727 1612 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_02000 3335 4666 gene locus_tag LOCUS_02010 gene glnA 3335 4666 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence0057 1569 1426 gene locus_tag LOCUS_02020 1569 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 4306 2174 gene locus_tag LOCUS_02030 4306 2174 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence0058 3240 2887 gene locus_tag LOCUS_02040 3240 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence0059 2003 1140 gene locus_tag LOCUS_02050 2003 1140 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121390.1 protein_id gnl|my_center|LOCUS_02050 2641 2964 gene locus_tag LOCUS_02060 gene rpsJ 2641 2964 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326795.1 protein_id gnl|my_center|LOCUS_02060 2993 3733 gene locus_tag LOCUS_02070 gene rplC 2993 3733 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121602.1 protein_id gnl|my_center|LOCUS_02070 3864 4502 gene locus_tag LOCUS_02080 gene rplD 3864 4502 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326797.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence0060 495 1583 gene locus_tag LOCUS_02090 gene serC 495 1583 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_02090 3001 1784 gene locus_tag LOCUS_02100 gene metK 3001 1784 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331112.1 protein_id gnl|my_center|LOCUS_02100 <4679 3086 gene locus_tag LOCUS_02110 <4679 3086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326414.1:S1 RNA-binding domain-containing protein >Feature sequence0061 1824 211 gene locus_tag LOCUS_02120 1824 211 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327245.1 protein_id gnl|my_center|LOCUS_02120 2190 3929 gene locus_tag LOCUS_02130 2190 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence0062 798 1979 gene locus_tag LOCUS_02140 798 1979 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496601.1 protein_id gnl|my_center|LOCUS_02140 2096 3160 gene locus_tag LOCUS_02150 2096 3160 CDS product WYL domain-containing transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582487.1 protein_id gnl|my_center|LOCUS_02150 <4665 3262 gene locus_tag LOCUS_02160 <4665 3262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120612.1:trypsin-like peptidase domain-containing protein >Feature sequence0063 <1 3548 gene locus_tag LOCUS_02170 <1 3548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence0064 1744 1541 gene locus_tag LOCUS_02180 gene rpsU 1744 1541 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338941.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence0065 2063 3373 gene locus_tag LOCUS_02190 2063 3373 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_02190 3501 4334 gene locus_tag LOCUS_02200 3501 4334 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324364.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence0066 1628 495 gene locus_tag LOCUS_02210 1628 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2765 1713 gene locus_tag LOCUS_02220 gene hflC 2765 1713 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018795.1 protein_id gnl|my_center|LOCUS_02220 <4609 2936 gene locus_tag LOCUS_02230 <4609 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113078.1:protease modulator HflK >Feature sequence0067 1637 381 gene locus_tag LOCUS_02240 gene lysA 1637 381 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_02240 2328 1765 gene locus_tag LOCUS_02250 2328 1765 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340258.1 protein_id gnl|my_center|LOCUS_02250 2569 4380 gene locus_tag LOCUS_02260 gene rhgW 2569 4380 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence0068 448 263 gene locus_tag LOCUS_02270 448 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 724 470 gene locus_tag LOCUS_02280 724 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1561 740 gene locus_tag LOCUS_02290 1561 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2609 1539 gene locus_tag LOCUS_02300 2609 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2909 2733 gene locus_tag LOCUS_02310 2909 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3810 2971 gene locus_tag LOCUS_02320 3810 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence0069 432 2159 gene locus_tag LOCUS_02330 432 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 2629 3657 gene locus_tag LOCUS_02340 2629 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence0070 515 240 gene locus_tag LOCUS_02350 515 240 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272449.1 protein_id gnl|my_center|LOCUS_02350 860 3583 gene locus_tag LOCUS_02360 860 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 <4476 3743 gene locus_tag LOCUS_02370 <4476 3743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764577.1:YncE family protein >Feature sequence0071 >Feature sequence0072 130 687 gene locus_tag LOCUS_02380 130 687 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020496.1 protein_id gnl|my_center|LOCUS_02380 698 1570 gene locus_tag LOCUS_02390 gene lpxI 698 1570 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922990.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence0073 3499 2039 gene locus_tag LOCUS_02400 3499 2039 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816828.1 protein_id gnl|my_center|LOCUS_02400 4323 3562 gene locus_tag LOCUS_02410 4323 3562 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328032.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence0074 3025 422 gene locus_tag LOCUS_02420 3025 422 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037249708.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence0075 3196 1055 gene locus_tag LOCUS_02430 3196 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3613 3936 gene locus_tag LOCUS_02440 3613 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 >Feature sequence0076 4372 2045 gene locus_tag LOCUS_02450 4372 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 >Feature sequence0077 1938 1369 gene locus_tag LOCUS_02460 gene efp 1938 1369 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814655.1 protein_id gnl|my_center|LOCUS_02460 2374 3051 gene locus_tag LOCUS_02470 2374 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence0078 <1 1686 gene locus_tag LOCUS_02480 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037247075.1:DNA gyrase subunit B 4030 1781 gene locus_tag LOCUS_02490 4030 1781 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence0079 236 1159 gene locus_tag LOCUS_02500 236 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3135 2182 gene locus_tag LOCUS_02510 gene argF 3135 2182 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921923.1 protein_id gnl|my_center|LOCUS_02510 4097 3255 gene locus_tag LOCUS_02520 gene accD 4097 3255 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327662.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence0080 2994 1882 gene locus_tag LOCUS_02530 2994 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 3785 2991 gene locus_tag LOCUS_02540 3785 2991 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121724.1 protein_id gnl|my_center|LOCUS_02540 4159 3896 gene locus_tag LOCUS_02550 gene rpmA 4159 3896 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327901.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence0081 787 1875 gene locus_tag LOCUS_02560 787 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2031 2369 gene locus_tag LOCUS_02570 2031 2369 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442716.1 protein_id gnl|my_center|LOCUS_02570 2427 3656 gene locus_tag LOCUS_02580 2427 3656 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence0082 271 816 gene locus_tag LOCUS_02590 271 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3788 1212 gene locus_tag LOCUS_02600 3788 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099150691.1 protein_id gnl|my_center|LOCUS_02600 4297 3890 gene locus_tag LOCUS_02610 4297 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence0083 135 998 gene locus_tag LOCUS_02620 135 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1000 1722 gene locus_tag LOCUS_02630 1000 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2165 2533 gene locus_tag LOCUS_02640 2165 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence0084 2224 2814 gene locus_tag LOCUS_02650 2224 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3956 2877 gene locus_tag LOCUS_02660 gene mnmA 3956 2877 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120981.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence0085 4059 175 gene locus_tag LOCUS_02670 4059 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence0086 874 131 gene locus_tag LOCUS_02680 gene hisF 874 131 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228686.1 protein_id gnl|my_center|LOCUS_02680 2306 1275 gene locus_tag LOCUS_02690 gene ychF 2306 1275 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393954.1 protein_id gnl|my_center|LOCUS_02690 >Feature sequence0087 1430 465 gene locus_tag LOCUS_02700 1430 465 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_02700 3100 1637 gene locus_tag LOCUS_02710 gene zwf 3100 1637 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335201.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence0088 166 1470 gene locus_tag LOCUS_02720 166 1470 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_02720 1869 2774 gene locus_tag LOCUS_02730 1869 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2857 3810 gene locus_tag LOCUS_02740 2857 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence0089 1706 1329 gene locus_tag LOCUS_02750 1706 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence0090 91 1284 gene locus_tag LOCUS_02760 91 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1543 2616 gene locus_tag LOCUS_02770 gene queA 1543 2616 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120320.1 protein_id gnl|my_center|LOCUS_02770 2613 3245 gene locus_tag LOCUS_02780 2613 3245 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922130.1 protein_id gnl|my_center|LOCUS_02780 3337 3669 gene locus_tag LOCUS_02790 3337 3669 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326964.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence0091 956 219 gene locus_tag LOCUS_02800 956 219 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112685.1 protein_id gnl|my_center|LOCUS_02800 2088 964 gene locus_tag LOCUS_02810 2088 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 3636 2347 gene locus_tag LOCUS_02820 3636 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence0092 <1 1692 gene locus_tag LOCUS_02830 <1 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939361.1:peptide-binding protein 1778 2827 gene locus_tag LOCUS_02840 1778 2827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_02840 2885 2970 gene locus_tag LOCUS_t00050 2885 2970 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0093 >Feature sequence0094 2188 1622 gene locus_tag LOCUS_02850 2188 1622 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814513.1 protein_id gnl|my_center|LOCUS_02850 3421 2246 gene locus_tag LOCUS_02860 3421 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence0095 >Feature sequence0096 1659 52 gene locus_tag LOCUS_02870 1659 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence0097 55 612 gene locus_tag LOCUS_02880 gene pth 55 612 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122535.1 protein_id gnl|my_center|LOCUS_02880 653 1090 gene locus_tag LOCUS_02890 gene rpsF 653 1090 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324824.1 protein_id gnl|my_center|LOCUS_02890 1259 1867 gene locus_tag LOCUS_02900 1259 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1990 2529 gene locus_tag LOCUS_02910 gene rplI 1990 2529 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122533.1 protein_id gnl|my_center|LOCUS_02910 2662 3591 gene locus_tag LOCUS_02920 2662 3591 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence0098 54 1622 gene locus_tag LOCUS_02930 gene purH 54 1622 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122619.1 protein_id gnl|my_center|LOCUS_02930 1910 3940 gene locus_tag LOCUS_02940 1910 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence0099 >Feature sequence0100 1351 491 gene locus_tag LOCUS_02950 1351 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1977 3164 gene locus_tag LOCUS_02960 1977 3164 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122791.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence0101 165 1097 gene locus_tag LOCUS_02970 165 1097 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812010.1 protein_id gnl|my_center|LOCUS_02970 1302 1625 gene locus_tag LOCUS_02980 1302 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1618 1944 gene locus_tag LOCUS_02990 1618 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3843 2959 gene locus_tag LOCUS_03000 gene truB 3843 2959 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120904.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence0102 1484 825 gene locus_tag LOCUS_03010 1484 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2646 1756 gene locus_tag LOCUS_03020 gene argB 2646 1756 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335411.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence0103 2143 857 gene locus_tag LOCUS_03030 gene eno 2143 857 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_03030 3296 2760 gene locus_tag LOCUS_03040 3296 2760 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence0104 2900 1425 gene locus_tag LOCUS_03050 2900 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 <4083 2931 gene locus_tag LOCUS_03060 <4083 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922336.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence0105 504 4004 gene locus_tag LOCUS_03070 504 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence0106 1787 711 gene locus_tag LOCUS_03080 1787 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 1935 2573 gene locus_tag LOCUS_03090 gene nadD 1935 2573 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687035.1 protein_id gnl|my_center|LOCUS_03090 2598 2819 gene locus_tag LOCUS_03100 2598 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence0107 439 2799 gene locus_tag LOCUS_03110 gene ligA 439 2799 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122894.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence0108 3405 2089 gene locus_tag LOCUS_03120 3405 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence0109 2444 945 gene locus_tag LOCUS_03130 2444 945 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122265.1 protein_id gnl|my_center|LOCUS_03130 3681 2626 gene locus_tag LOCUS_03140 gene pqqE 3681 2626 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038063.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence0110 >Feature sequence0111 2041 23 gene locus_tag LOCUS_03150 2041 23 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921710.1 protein_id gnl|my_center|LOCUS_03150 3710 2244 gene locus_tag LOCUS_03160 gene glgA 3710 2244 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121026.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence0112 2498 510 gene locus_tag LOCUS_03170 2498 510 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681239.1 protein_id gnl|my_center|LOCUS_03170 3712 2495 gene locus_tag LOCUS_03180 3712 2495 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence0113 456 1211 gene locus_tag LOCUS_03190 456 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 1304 2653 gene locus_tag LOCUS_03200 gene folC 1304 2653 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582053.1 protein_id gnl|my_center|LOCUS_03200 <3987 2654 gene locus_tag LOCUS_03210 <3987 2654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339839.1:nucleoside permease >Feature sequence0114 472 3702 gene locus_tag LOCUS_03220 472 3702 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615526.1 protein_id gnl|my_center|LOCUS_03220 >Feature sequence0115 <1 798 gene locus_tag LOCUS_03230 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121802.1:glycosyltransferase family 4 protein 916 2007 gene locus_tag LOCUS_03240 916 2007 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence0116 305 1087 gene locus_tag LOCUS_03250 gene trpC 305 1087 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_03250 1084 1683 gene locus_tag LOCUS_03260 1084 1683 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_03260 1816 3006 gene locus_tag LOCUS_03270 gene trpB 1816 3006 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_03270 3067 3843 gene locus_tag LOCUS_03280 gene trpA 3067 3843 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence0117 1233 241 gene locus_tag LOCUS_03290 1233 241 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008666219.1 protein_id gnl|my_center|LOCUS_03290 1489 1416 gene locus_tag LOCUS_t00060 1489 1416 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1856 2974 gene locus_tag LOCUS_03300 1856 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667978.1 protein_id gnl|my_center|LOCUS_03300 >Feature sequence0118 >Feature sequence0119 1000 1314 gene locus_tag LOCUS_03310 gene rplU 1000 1314 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325148.1 protein_id gnl|my_center|LOCUS_03310 2537 1437 gene locus_tag LOCUS_03320 2537 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 <3925 2687 gene locus_tag LOCUS_03330 <3925 2687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206373.1:ankyrin repeat domain-containing protein >Feature sequence0120 49 804 gene locus_tag LOCUS_03340 49 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1506 898 gene locus_tag LOCUS_03350 gene rpsD 1506 898 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846140.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence0121 1380 436 gene locus_tag LOCUS_03360 1380 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2354 1377 gene locus_tag LOCUS_03370 2354 1377 CDS product bile acid:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881394.1 protein_id gnl|my_center|LOCUS_03370 3835 2354 gene locus_tag LOCUS_03380 3835 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0122 1553 180 gene locus_tag LOCUS_03390 gene thrC 1553 180 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_03390 <3907 2057 gene locus_tag LOCUS_03400 <3907 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546043.1:ATP-dependent chaperone ClpB >Feature sequence0123 3560 1785 gene locus_tag LOCUS_03410 gene asnB 3560 1785 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence0124 993 1961 gene locus_tag LOCUS_03420 993 1961 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334964.1 protein_id gnl|my_center|LOCUS_03420 >Feature sequence0125 2491 3060 gene locus_tag LOCUS_03430 2491 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329453.1 protein_id gnl|my_center|LOCUS_03430 >Feature sequence0126 2029 974 gene locus_tag LOCUS_03440 gene galT 2029 974 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_03440 3466 2144 gene locus_tag LOCUS_03450 3466 2144 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324174.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence0127 94 1062 gene locus_tag LOCUS_03460 94 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1070 1882 gene locus_tag LOCUS_03470 gene fabG 1070 1882 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_03470 2589 1993 gene locus_tag LOCUS_03480 2589 1993 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_03480 <3860 2739 gene locus_tag LOCUS_03490 <3860 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327204.1:pitrilysin family protein >Feature sequence0128 261 1217 gene locus_tag LOCUS_03500 261 1217 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435072.1 protein_id gnl|my_center|LOCUS_03500 1623 3014 gene locus_tag LOCUS_03510 1623 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3772 3161 gene locus_tag LOCUS_03520 3772 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328467.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence0129 470 36 gene locus_tag LOCUS_03530 470 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3561 649 gene locus_tag LOCUS_03540 3561 649 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence0130 <1 1823 gene locus_tag LOCUS_03550 <1 1823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein 3402 2302 gene locus_tag LOCUS_03560 3402 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence0131 >Feature sequence0132 917 219 gene locus_tag LOCUS_03570 917 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3152 1164 gene locus_tag LOCUS_03580 3152 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence0133 98 2134 gene locus_tag LOCUS_03590 98 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 3167 2466 gene locus_tag LOCUS_03600 3167 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence0134 2196 646 gene locus_tag LOCUS_03610 2196 646 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328924.1 protein_id gnl|my_center|LOCUS_03610 3157 2390 gene locus_tag LOCUS_03620 3157 2390 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121928.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence0135 243 1274 gene locus_tag LOCUS_03630 243 1274 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_03630 1360 3216 gene locus_tag LOCUS_03640 1360 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence0136 1338 3194 gene locus_tag LOCUS_03650 1338 3194 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence0137 >Feature sequence0138 >Feature sequence0139 2341 326 gene locus_tag LOCUS_03660 2341 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2950 2435 gene locus_tag LOCUS_03670 2950 2435 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896616.1 protein_id gnl|my_center|LOCUS_03670 <3731 3186 gene locus_tag LOCUS_03680 <3731 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000651373.1:leucyl/phenylalanyl-tRNA--protein transferase >Feature sequence0140 765 100 gene locus_tag LOCUS_03690 765 100 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326130.1 protein_id gnl|my_center|LOCUS_03690 1127 2065 gene locus_tag LOCUS_03700 gene lsrF 1127 2065 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_03700 2955 2203 gene locus_tag LOCUS_03710 2955 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 <3729 3112 gene locus_tag LOCUS_03720 <3729 3112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582647.1:MoxR family ATPase >Feature sequence0141 3489 907 gene locus_tag LOCUS_03730 3489 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence0142 190 702 gene locus_tag LOCUS_03740 190 702 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_03740 3243 1117 gene locus_tag LOCUS_03750 3243 1117 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117861.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence0143 86 2422 gene locus_tag LOCUS_03760 86 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 2691 3401 gene locus_tag LOCUS_03770 2691 3401 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922652.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence0144 2783 2220 gene locus_tag LOCUS_03780 2783 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3699 2878 gene locus_tag LOCUS_03790 gene pfkA 3699 2878 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838402.1 protein_id gnl|my_center|LOCUS_03790 >Feature sequence0145 885 139 gene locus_tag LOCUS_03800 885 139 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707832.1 protein_id gnl|my_center|LOCUS_03800 3358 1073 gene locus_tag LOCUS_03810 3358 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence0146 824 2215 gene locus_tag LOCUS_03820 824 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332518.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence0147 435 1571 gene locus_tag LOCUS_03830 435 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3646 1586 gene locus_tag LOCUS_03840 3646 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence0148 >Feature sequence0149 660 1397 gene locus_tag LOCUS_03850 660 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 2111 3298 gene locus_tag LOCUS_03860 2111 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence0150 2670 841 gene locus_tag LOCUS_03870 2670 841 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764577.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence0151 3326 594 gene locus_tag LOCUS_03880 3326 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence0152 787 3108 gene locus_tag LOCUS_03890 787 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence0153 569 1033 gene locus_tag LOCUS_03900 569 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1849 2856 gene locus_tag LOCUS_03910 1849 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2872 3438 gene locus_tag LOCUS_03920 2872 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence0154 244 1917 gene locus_tag LOCUS_03930 244 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 <3602 1986 gene locus_tag LOCUS_03940 <3602 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein >Feature sequence0155 2848 1169 gene locus_tag LOCUS_03950 gene ettA 2848 1169 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence0156 2529 619 gene locus_tag LOCUS_03960 gene nuoF 2529 619 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_03960 3142 2633 gene locus_tag LOCUS_03970 gene nuoE 3142 2633 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0157 >Feature sequence0158 611 1282 gene locus_tag LOCUS_03980 611 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence0159 939 43 gene locus_tag LOCUS_03990 gene xerD 939 43 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921953.1 protein_id gnl|my_center|LOCUS_03990 1036 2181 gene locus_tag LOCUS_04000 1036 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 3189 2212 gene locus_tag LOCUS_04010 3189 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence0160 1270 281 gene locus_tag LOCUS_04020 1270 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2397 1624 gene locus_tag LOCUS_04030 gene hisN 2397 1624 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921412.1 protein_id gnl|my_center|LOCUS_04030 2691 3194 gene locus_tag LOCUS_04040 2691 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence0161 667 2940 gene locus_tag LOCUS_04050 667 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence0162 390 662 gene locus_tag LOCUS_04060 gene rpsS 390 662 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326800.1 protein_id gnl|my_center|LOCUS_04060 715 1071 gene locus_tag LOCUS_04070 gene rplV 715 1071 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121604.1 protein_id gnl|my_center|LOCUS_04070 1129 1851 gene locus_tag LOCUS_04080 gene rpsC 1129 1851 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326802.1 protein_id gnl|my_center|LOCUS_04080 1892 2206 gene locus_tag LOCUS_04090 1892 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2263 2472 gene locus_tag LOCUS_04100 gene rpmC 2263 2472 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326804.1 protein_id gnl|my_center|LOCUS_04100 2546 2833 gene locus_tag LOCUS_04110 gene rpsQ 2546 2833 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812390.1 protein_id gnl|my_center|LOCUS_04110 2919 3287 gene locus_tag LOCUS_04120 gene rplN 2919 3287 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326806.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence0163 328 993 gene locus_tag LOCUS_04130 328 993 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_04130 2688 1369 gene locus_tag LOCUS_04140 2688 1369 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_04140 3106 2681 gene locus_tag LOCUS_04150 3106 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence0164 1121 255 gene locus_tag LOCUS_04160 1121 255 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_04160 1485 1964 gene locus_tag LOCUS_04170 gene ruvX 1485 1964 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331673.1 protein_id gnl|my_center|LOCUS_04170 2442 2684 gene locus_tag LOCUS_04180 2442 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence0165 <1 536 gene locus_tag LOCUS_04190 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437073.1:YgiQ family radical SAM protein 776 2566 gene locus_tag LOCUS_04200 776 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence0166 >Feature sequence0167 <3503 2843 gene locus_tag LOCUS_04210 <3503 2843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004438834.1:ThuA domain-containing protein >Feature sequence0168 <1 1657 gene locus_tag LOCUS_04220 <1 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922030.1:HlyD family efflux transporter periplasmic adaptor subunit 1774 2541 gene locus_tag LOCUS_04230 1774 2541 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121188.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence0169 <1 3356 gene locus_tag LOCUS_04240 <1 3356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083434976.1:isoleucine--tRNA ligase >Feature sequence0170 <3488 443 gene locus_tag LOCUS_04250 <3488 443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921467.1:choice-of-anchor I family protein >Feature sequence0171 1916 429 gene locus_tag LOCUS_04260 gene hemY 1916 429 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071740655.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0172 1975 47 gene locus_tag LOCUS_04270 1975 47 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_04270 2321 3313 gene locus_tag LOCUS_04280 2321 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence0173 396 779 gene locus_tag LOCUS_04290 gene rpsM 396 779 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123828.1 protein_id gnl|my_center|LOCUS_04290 891 1271 gene locus_tag LOCUS_04300 gene rpsK 891 1271 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328401.1 protein_id gnl|my_center|LOCUS_04300 1417 2415 gene locus_tag LOCUS_04310 1417 2415 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328400.1 protein_id gnl|my_center|LOCUS_04310 2521 3150 gene locus_tag LOCUS_04320 2521 3150 CDS product L17 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123829.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence0174 1893 343 gene locus_tag LOCUS_04330 1893 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3074 1908 gene locus_tag LOCUS_04340 3074 1908 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence0175 637 1743 gene locus_tag LOCUS_04350 637 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123623.1 protein_id gnl|my_center|LOCUS_04350 1730 3181 gene locus_tag LOCUS_04360 1730 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence0176 316 86 gene locus_tag LOCUS_04370 316 86 CDS product MTH895/ArsE family thioredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060920.1 protein_id gnl|my_center|LOCUS_04370 1739 348 gene locus_tag LOCUS_04380 1739 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 2344 3216 gene locus_tag LOCUS_04390 2344 3216 CDS product phosphatidylinositol-specific phospholipase C/glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122695.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence0177 3338 2529 gene locus_tag LOCUS_04400 3338 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence0178 <1 2794 gene locus_tag LOCUS_04410 <1 2794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121109.1:9-O-acetylesterase >Feature sequence0179 <1 2135 gene locus_tag LOCUS_04420 <1 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881287.1:GspE/PulE family protein 2132 3049 gene locus_tag LOCUS_04430 2132 3049 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767195.1 protein_id gnl|my_center|LOCUS_04430 3196 3270 gene locus_tag LOCUS_t00070 3196 3270 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0180 3179 1764 gene locus_tag LOCUS_04440 3179 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence0181 1547 2776 gene locus_tag LOCUS_04450 1547 2776 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121115.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence0182 2754 2682 gene locus_tag LOCUS_t00080 2754 2682 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0183 >Feature sequence0184 1795 2820 gene locus_tag LOCUS_04460 1795 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615992.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence0185 1242 1604 gene locus_tag LOCUS_04470 1242 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 1764 1940 gene locus_tag LOCUS_04480 1764 1940 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064219.1 protein_id gnl|my_center|LOCUS_04480 2281 2745 gene locus_tag LOCUS_04490 2281 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence0186 2001 703 gene locus_tag LOCUS_04500 2001 703 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922459.1 protein_id gnl|my_center|LOCUS_04500 3178 2483 gene locus_tag LOCUS_04510 3178 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence0187 >Feature sequence0188 1748 423 gene locus_tag LOCUS_04520 1748 423 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119759.1 protein_id gnl|my_center|LOCUS_04520 2214 1990 gene locus_tag LOCUS_04530 2214 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence0189 175 696 gene locus_tag LOCUS_04540 175 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 814 2379 gene locus_tag LOCUS_04550 814 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence0190 212 352 gene locus_tag LOCUS_04560 212 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3075 532 gene locus_tag LOCUS_04570 3075 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0191 <1 513 gene locus_tag LOCUS_04580 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876951.1:peptidylprolyl isomerase 738 1160 gene locus_tag LOCUS_04590 738 1160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324235.1 protein_id gnl|my_center|LOCUS_04590 1287 3320 gene locus_tag LOCUS_04600 1287 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence0192 <1 691 gene locus_tag LOCUS_04610 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328238.1:preprotein translocase subunit SecA 780 1814 gene locus_tag LOCUS_04620 780 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04620 >Feature sequence0193 939 2201 gene locus_tag LOCUS_04630 939 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2597 3220 gene locus_tag LOCUS_04640 2597 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence0194 <1 642 gene locus_tag LOCUS_04650 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933918.1:cyclase family protein 1545 1766 gene locus_tag LOCUS_04660 1545 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence0195 726 1592 gene locus_tag LOCUS_04670 726 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3172 1691 gene locus_tag LOCUS_04680 3172 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence0196 <3329 2018 gene locus_tag LOCUS_04690 <3329 2018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228977.1:threonine--tRNA ligase >Feature sequence0197 843 1646 gene locus_tag LOCUS_04700 843 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2075 2587 gene locus_tag LOCUS_04710 gene coaD 2075 2587 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122863.1 protein_id gnl|my_center|LOCUS_04710 <3323 2617 gene locus_tag LOCUS_04720 <3323 2617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211204934.1:site-specific DNA-methyltransferase >Feature sequence0198 2807 489 gene locus_tag LOCUS_04730 2807 489 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921470.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence0199 <3321 4 gene locus_tag LOCUS_04740 <3321 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007339602.1:BamA/TamA family outer membrane protein >Feature sequence0200 1236 490 gene locus_tag LOCUS_04750 1236 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2899 1520 gene locus_tag LOCUS_04760 2899 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence0201 >Feature sequence0202 1370 720 gene locus_tag LOCUS_04770 1370 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 1894 1367 gene locus_tag LOCUS_04780 1894 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2845 2066 gene locus_tag LOCUS_04790 gene panB 2845 2066 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence0203 1111 830 gene locus_tag LOCUS_04800 gene rpsR 1111 830 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236620859.1 protein_id gnl|my_center|LOCUS_04800 1431 2030 gene locus_tag LOCUS_04810 1431 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence0204 >Feature sequence0205 1915 311 gene locus_tag LOCUS_04820 1915 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2593 1952 gene locus_tag LOCUS_04830 2593 1952 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060787.1 protein_id gnl|my_center|LOCUS_04830 <3298 2618 gene locus_tag LOCUS_04840 <3298 2618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015148.1:mycolate reductase >Feature sequence0206 2951 2130 gene locus_tag LOCUS_04850 2951 2130 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326598.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence0207 >Feature sequence0208 1525 557 gene locus_tag LOCUS_04860 1525 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2109 1546 gene locus_tag LOCUS_04870 2109 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence0209 <1 1155 gene locus_tag LOCUS_04880 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942654.1:cysteine desulfurase NifS 2280 1183 gene locus_tag LOCUS_04890 2280 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2677 2309 gene locus_tag LOCUS_04900 2677 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 <3283 2756 gene locus_tag LOCUS_04910 <3283 2756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332509.1:ATPase, T2SS/T4P/T4SS family >Feature sequence0210 3236 1812 gene locus_tag LOCUS_04920 3236 1812 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence0211 754 1512 gene locus_tag LOCUS_04930 754 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2440 1517 gene locus_tag LOCUS_04940 2440 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence0212 <1 1324 gene locus_tag LOCUS_04950 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein 1632 2048 gene locus_tag LOCUS_04960 1632 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2065 3141 gene locus_tag LOCUS_04970 2065 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence0213 >Feature sequence0214 <1 1814 gene locus_tag LOCUS_04980 <1 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047812952.1:TIGR03960 family B12-binding radical SAM protein 3152 2193 gene locus_tag LOCUS_04990 3152 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence0215 885 1376 gene locus_tag LOCUS_05000 885 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1342 1953 gene locus_tag LOCUS_05010 1342 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence0216 760 95 gene locus_tag LOCUS_05020 760 95 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142113.1 protein_id gnl|my_center|LOCUS_05020 1263 841 gene locus_tag LOCUS_05030 1263 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 2110 1241 gene locus_tag LOCUS_05040 2110 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336109.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence0217 1979 618 gene locus_tag LOCUS_05050 1979 618 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_05050 3230 2346 gene locus_tag LOCUS_05060 3230 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence0218 >Feature sequence0219 <3234 2525 gene locus_tag LOCUS_05070 <3234 2525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001969726.1:sodium-dependent transporter >Feature sequence0220 3114 1960 gene locus_tag LOCUS_05080 3114 1960 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330953.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence0221 2294 321 gene locus_tag LOCUS_05090 2294 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2649 3218 gene locus_tag LOCUS_05100 2649 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence0222 2540 1062 gene locus_tag LOCUS_05110 2540 1062 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_05110 <3216 2700 gene locus_tag LOCUS_05120 <3216 2700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989618.1:glycosyltransferase family 2 protein >Feature sequence0223 1300 647 gene locus_tag LOCUS_05130 1300 647 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871236.1 protein_id gnl|my_center|LOCUS_05130 2660 1395 gene locus_tag LOCUS_05140 2660 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence0224 >Feature sequence0225 524 3010 gene locus_tag LOCUS_05150 524 3010 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence0226 <3198 1168 gene locus_tag LOCUS_05160 <3198 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262221.1:MFS transporter >Feature sequence0227 >Feature sequence0228 437 970 gene locus_tag LOCUS_05170 437 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 981 2261 gene locus_tag LOCUS_05180 981 2261 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326690.1 protein_id gnl|my_center|LOCUS_05180 <3192 2379 gene locus_tag LOCUS_05190 <3192 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583848.1:DUF814 domain-containing protein >Feature sequence0229 2021 1143 gene locus_tag LOCUS_05200 2021 1143 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615454.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence0230 343 615 gene locus_tag LOCUS_05210 343 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1609 638 gene locus_tag LOCUS_05220 1609 638 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118940.1 protein_id gnl|my_center|LOCUS_05220 1832 2413 gene locus_tag LOCUS_05230 1832 2413 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226951.1 protein_id gnl|my_center|LOCUS_05230 3143 2532 gene locus_tag LOCUS_05240 3143 2532 CDS product YhgN family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174792.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence0231 873 97 gene locus_tag LOCUS_05250 873 97 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403304.1 protein_id gnl|my_center|LOCUS_05250 1780 995 gene locus_tag LOCUS_05260 1780 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2706 1795 gene locus_tag LOCUS_05270 2706 1795 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121766.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence0232 >Feature sequence0233 >Feature sequence0234 <1 618 gene locus_tag LOCUS_05280 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967876.1:multidrug efflux RND transporter permease subunit 879 2294 gene locus_tag LOCUS_05290 879 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence0235 127 801 gene locus_tag LOCUS_05300 127 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2496 1012 gene locus_tag LOCUS_05310 2496 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence0236 1534 464 gene locus_tag LOCUS_05320 gene ricT 1534 464 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615890.1 protein_id gnl|my_center|LOCUS_05320 2222 1611 gene locus_tag LOCUS_05330 2222 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence0237 1424 78 gene locus_tag LOCUS_05340 1424 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 2716 1481 gene locus_tag LOCUS_05350 2716 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence0238 691 476 gene locus_tag LOCUS_05360 691 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1336 2016 gene locus_tag LOCUS_05370 1336 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence0239 >Feature sequence0240 83 742 gene locus_tag LOCUS_05380 83 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 767 2161 gene locus_tag LOCUS_05390 767 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence0241 <1 1178 gene locus_tag LOCUS_05400 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016207.1:ankyrin repeat domain-containing protein 1594 2772 gene locus_tag LOCUS_05410 1594 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence0242 >Feature sequence0243 267 1169 gene locus_tag LOCUS_05420 267 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 1858 1295 gene locus_tag LOCUS_05430 gene pyrE 1858 1295 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231846080.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence0244 >Feature sequence0245 2367 781 gene locus_tag LOCUS_05440 2367 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence0246 782 42 gene locus_tag LOCUS_05450 782 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 1902 808 gene locus_tag LOCUS_05460 1902 808 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878480.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence0247 >Feature sequence0248 <1 1773 gene locus_tag LOCUS_05470 <1 1773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001143843.1:DEAD/DEAH box helicase family protein 2110 2865 gene locus_tag LOCUS_05480 2110 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence0249 149 409 gene locus_tag LOCUS_05490 149 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 420 1256 gene locus_tag LOCUS_05500 420 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0250 961 1752 gene locus_tag LOCUS_05510 961 1752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930637.1 protein_id gnl|my_center|LOCUS_05510 1866 2891 gene locus_tag LOCUS_05520 gene asnA 1866 2891 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence0251 1881 862 gene locus_tag LOCUS_05530 1881 862 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_05530 2828 1965 gene locus_tag LOCUS_05540 2828 1965 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027122.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence0252 <1 752 gene locus_tag LOCUS_05550 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921769.1:cysteine--tRNA ligase 1592 852 gene locus_tag LOCUS_05560 1592 852 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_05560 1749 2015 gene locus_tag LOCUS_05570 1749 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence0253 1461 10 gene locus_tag LOCUS_05580 1461 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence0254 1441 386 gene locus_tag LOCUS_05590 1441 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence0255 >Feature sequence0256 <1 874 gene locus_tag LOCUS_05600 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852963.1:cytochrome c biogenesis protein CcsA 1223 939 gene locus_tag LOCUS_05610 1223 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_05610 2198 1239 gene locus_tag LOCUS_05620 2198 1239 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327421.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence0257 <1 1864 gene locus_tag LOCUS_05630 <1 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107588.1:DUF4838 domain-containing protein >Feature sequence0258 2397 2107 gene locus_tag LOCUS_05640 2397 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence0259 122 1255 gene locus_tag LOCUS_05650 gene ribD 122 1255 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence0260 1495 362 gene locus_tag LOCUS_05660 1495 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence0261 1149 160 gene locus_tag LOCUS_05670 1149 160 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326973.1 protein_id gnl|my_center|LOCUS_05670 1884 1366 gene locus_tag LOCUS_05680 1884 1366 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921991.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence0262 >Feature sequence0263 2749 1007 gene locus_tag LOCUS_05690 2749 1007 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789707.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence0264 >Feature sequence0265 1524 334 gene locus_tag LOCUS_05700 1524 334 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782642.1 protein_id gnl|my_center|LOCUS_05700 <3027 1612 gene locus_tag LOCUS_05710 <3027 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615848.1:peptidyl-prolyl cis-trans isomerase >Feature sequence0266 <1 2858 gene locus_tag LOCUS_05720 <1 2858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922226.1:SdrD B-like domain-containing protein >Feature sequence0267 >Feature sequence0268 <3014 737 gene locus_tag LOCUS_05730 <3014 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035257407.1:autotransporter domain-containing protein >Feature sequence0269 >Feature sequence0270 <3013 690 gene locus_tag LOCUS_05740 <3013 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016392.1:phosphoadenosine phosphosulfate reductase family protein >Feature sequence0271 <3011 981 gene locus_tag LOCUS_05750 <3011 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119060.1:type IV pilus assembly protein PilM >Feature sequence0272 1139 681 gene locus_tag LOCUS_05760 1139 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 <3008 1143 gene locus_tag LOCUS_05770 <3008 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120484.1:translation initiation factor IF-2 >Feature sequence0273 642 2132 gene locus_tag LOCUS_05780 642 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 <3007 2376 gene locus_tag LOCUS_05790 <3007 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393236.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydE >Feature sequence0274 >Feature sequence0275 28 546 gene locus_tag LOCUS_05800 28 546 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_05800 701 2095 gene locus_tag LOCUS_05810 701 2095 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889443.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence0276 2853 2161 gene locus_tag LOCUS_05820 2853 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence0277 2487 1519 gene locus_tag LOCUS_05830 2487 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120295.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence0278 2685 10 gene locus_tag LOCUS_05840 gene acnA 2685 10 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118669.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence0279 580 1371 gene locus_tag LOCUS_05850 580 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1492 2661 gene locus_tag LOCUS_05860 1492 2661 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence0280 1069 338 gene locus_tag LOCUS_05870 1069 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1302 1066 gene locus_tag LOCUS_05880 1302 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1813 1280 gene locus_tag LOCUS_05890 1813 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1963 1814 gene locus_tag LOCUS_05900 1963 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2519 1968 gene locus_tag LOCUS_05910 2519 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0281 1370 252 gene locus_tag LOCUS_05920 gene dnaN 1370 252 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194538.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence0282 754 11 gene locus_tag LOCUS_05930 754 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1178 2695 gene locus_tag LOCUS_05940 1178 2695 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975358.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence0283 975 2489 gene locus_tag LOCUS_05950 975 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence0284 >Feature sequence0285 >Feature sequence0286 >Feature sequence0287 1239 172 gene locus_tag LOCUS_05960 1239 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2538 1258 gene locus_tag LOCUS_05970 2538 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence0288 1 1008 gene locus_tag LOCUS_05980 gene purT 1 1008 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092658.1 protein_id gnl|my_center|LOCUS_05980 2721 1108 gene locus_tag LOCUS_05990 2721 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence0289 491 2230 gene locus_tag LOCUS_06000 491 2230 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence0290 132 2606 gene locus_tag LOCUS_06010 132 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence0291 <1 2890 gene locus_tag LOCUS_06020 <1 2890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921931.1:chromosome segregation protein SMC >Feature sequence0292 377 450 gene locus_tag LOCUS_t00090 377 450 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 590 1888 gene locus_tag LOCUS_06030 590 1888 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871000.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0293 437 147 gene locus_tag LOCUS_06040 437 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2078 573 gene locus_tag LOCUS_06050 gene araA 2078 573 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760642.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence0294 >Feature sequence0295 1043 192 gene locus_tag LOCUS_06060 gene rfbD 1043 192 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0296 >Feature sequence0297 <1 1175 gene locus_tag LOCUS_06070 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001225870.1:YfaP family protein >Feature sequence0298 >Feature sequence0299 2448 451 gene locus_tag LOCUS_06080 2448 451 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203633.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence0300 2635 1448 gene locus_tag LOCUS_06090 2635 1448 CDS product histidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142216.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence0301 1581 1754 gene locus_tag LOCUS_06100 1581 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence0302 306 1547 gene locus_tag LOCUS_06110 306 1547 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence0303 1934 1095 gene locus_tag LOCUS_06120 1934 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339871.1 protein_id gnl|my_center|LOCUS_06120 2604 2014 gene locus_tag LOCUS_06130 gene clpP 2604 2014 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327157.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence0304 970 731 gene locus_tag LOCUS_06140 970 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence0305 >Feature sequence0306 2226 532 gene locus_tag LOCUS_06150 2226 532 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123401.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence0307 2108 726 gene locus_tag LOCUS_06160 2108 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence0308 2143 815 gene locus_tag LOCUS_06170 2143 815 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332711.1 protein_id gnl|my_center|LOCUS_06170 2329 2256 gene locus_tag LOCUS_t00100 2329 2256 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0309 247 1311 gene locus_tag LOCUS_06180 247 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1301 1813 gene locus_tag LOCUS_06190 1301 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1849 2844 gene locus_tag LOCUS_06200 1849 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence0310 277 1446 gene locus_tag LOCUS_06210 277 1446 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670664.1 protein_id gnl|my_center|LOCUS_06210 <2862 1778 gene locus_tag LOCUS_06220 <2862 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938513.1:MATE family efflux transporter >Feature sequence0311 1685 204 gene locus_tag LOCUS_06230 gene hflX 1685 204 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121200.1 protein_id gnl|my_center|LOCUS_06230 2696 1749 gene locus_tag LOCUS_06240 2696 1749 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328412.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence0312 <1 913 gene locus_tag LOCUS_06250 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005781763.1:adenosylhomocysteinase >Feature sequence0313 40 1602 gene locus_tag LOCUS_06260 40 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2576 1620 gene locus_tag LOCUS_06270 2576 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence0314 1569 463 gene locus_tag LOCUS_06280 1569 463 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_06280 2806 1586 gene locus_tag LOCUS_06290 2806 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence0315 >Feature sequence0316 >Feature sequence0317 378 2765 gene locus_tag LOCUS_06300 378 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence0318 1026 157 gene locus_tag LOCUS_06310 1026 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2440 1241 gene locus_tag LOCUS_06320 2440 1241 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225828.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence0319 878 1933 gene locus_tag LOCUS_06330 gene galT 878 1933 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence0320 116 526 gene locus_tag LOCUS_06340 116 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 691 1401 gene locus_tag LOCUS_06350 691 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 <2816 1744 gene locus_tag LOCUS_06360 <2816 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089239.1:ankyrin repeat domain-containing protein >Feature sequence0321 >Feature sequence0322 >Feature sequence0323 165 1448 gene locus_tag LOCUS_06370 165 1448 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence0324 382 1788 gene locus_tag LOCUS_06380 382 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 >Feature sequence0325 383 1507 gene locus_tag LOCUS_06390 383 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2377 1628 gene locus_tag LOCUS_06400 2377 1628 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329364.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence0326 <2796 1534 gene locus_tag LOCUS_06410 <2796 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118102.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence0327 1082 93 gene locus_tag LOCUS_06420 1082 93 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence0328 2061 1045 gene locus_tag LOCUS_06430 2061 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2452 2111 gene locus_tag LOCUS_06440 2452 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence0329 192 1106 gene locus_tag LOCUS_06450 192 1106 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_06450 1437 1114 gene locus_tag LOCUS_06460 1437 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06460 2145 1459 gene locus_tag LOCUS_06470 2145 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06470 >Feature sequence0330 1661 267 gene locus_tag LOCUS_06480 1661 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence0331 422 1711 gene locus_tag LOCUS_06490 gene purD 422 1711 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334006.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence0332 182 1573 gene locus_tag LOCUS_06500 182 1573 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence0333 2778 2218 gene locus_tag LOCUS_06510 2778 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence0334 >Feature sequence0335 >Feature sequence0336 2617 218 gene locus_tag LOCUS_06520 2617 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0337 >Feature sequence0338 582 1631 gene locus_tag LOCUS_06530 582 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1711 2619 gene locus_tag LOCUS_06540 1711 2619 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015663.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence0339 >Feature sequence0340 1418 948 gene locus_tag LOCUS_06550 gene rpsG 1418 948 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326864.1 protein_id gnl|my_center|LOCUS_06550 1906 1532 gene locus_tag LOCUS_06560 gene rpsL 1906 1532 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326865.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence0341 <2728 84 gene locus_tag LOCUS_06570 <2728 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001199945.1:leucine--tRNA ligase >Feature sequence0342 >Feature sequence0343 421 1389 gene locus_tag LOCUS_06580 421 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 1393 2487 gene locus_tag LOCUS_06590 1393 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence0344 >Feature sequence0345 >Feature sequence0346 40 1329 gene locus_tag LOCUS_06600 40 1329 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923038.1 protein_id gnl|my_center|LOCUS_06600 1485 2078 gene locus_tag LOCUS_06610 gene tmk 1485 2078 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_06610 <2723 2182 gene locus_tag LOCUS_06620 <2723 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328825.1:YkgJ family cysteine cluster protein >Feature sequence0347 >Feature sequence0348 427 996 gene locus_tag LOCUS_06630 427 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 1126 1293 gene locus_tag LOCUS_06640 1126 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 <2721 1395 gene locus_tag LOCUS_06650 <2721 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005681492.1:FAD-dependent oxidoreductase >Feature sequence0349 <1 1381 gene locus_tag LOCUS_06660 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152948297.1:protease Lon-related BREX system protein BrxL 1413 1625 gene locus_tag LOCUS_06670 1413 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence0350 2714 1239 gene locus_tag LOCUS_06680 2714 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence0351 <1 756 gene locus_tag LOCUS_06690 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007333269.1:DUF4339 domain-containing protein 789 1757 gene locus_tag LOCUS_06700 789 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0352 <1 687 gene locus_tag LOCUS_06710 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391799.1:excinuclease ABC subunit UvrA 748 1713 gene locus_tag LOCUS_06720 748 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 <2707 1834 gene locus_tag LOCUS_06730 <2707 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072398.1:asparaginase >Feature sequence0353 142 393 gene locus_tag LOCUS_06740 142 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1675 554 gene locus_tag LOCUS_06750 gene ispG 1675 554 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118672.1 protein_id gnl|my_center|LOCUS_06750 1938 2171 gene locus_tag LOCUS_06760 1938 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence0354 <1 723 gene locus_tag LOCUS_06770 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122337.1:mu-protocadherin- cell-suface protein 850 1671 gene locus_tag LOCUS_06780 850 1671 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028071.1 protein_id gnl|my_center|LOCUS_06780 2481 1675 gene locus_tag LOCUS_06790 gene hpnD 2481 1675 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417954.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence0355 547 705 gene locus_tag LOCUS_06800 547 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 >Feature sequence0356 <1 911 gene locus_tag LOCUS_06810 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027060.1:twin-arginine translocation signal domain-containing protein 2611 1178 gene locus_tag LOCUS_06820 2611 1178 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121461.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence0357 >Feature sequence0358 753 268 gene locus_tag LOCUS_06830 753 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 2231 948 gene locus_tag LOCUS_06840 2231 948 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence0359 1627 221 gene locus_tag LOCUS_06850 1627 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2274 1846 gene locus_tag LOCUS_06860 2274 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence0360 354 746 gene locus_tag LOCUS_06870 gene gcvH 354 746 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_06870 784 2628 gene locus_tag LOCUS_06880 784 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence0361 2 1855 gene locus_tag LOCUS_06890 2 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0362 1129 98 gene locus_tag LOCUS_06900 1129 98 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_06900 1820 1245 gene locus_tag LOCUS_06910 1820 1245 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_06910 2178 2645 gene locus_tag LOCUS_06920 2178 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence0363 <1 1513 gene locus_tag LOCUS_06930 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765775.1:glycosyl hydrolase >Feature sequence0364 <1 1450 gene locus_tag LOCUS_06940 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021335.1:sodium:solute symporter 1504 2583 gene locus_tag LOCUS_06950 1504 2583 CDS product DUF6528 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332817.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0365 1904 912 gene locus_tag LOCUS_06960 1904 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 <2669 1914 gene locus_tag LOCUS_06970 <2669 1914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921544.1:HD domain-containing protein >Feature sequence0366 <2661 1233 gene locus_tag LOCUS_06980 <2661 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000510777.1:sulfate ABC transporter ATP-binding protein >Feature sequence0367 1747 284 gene locus_tag LOCUS_06990 gene guaB 1747 284 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325011.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence0368 1228 1947 gene locus_tag LOCUS_07000 1228 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence0369 >Feature sequence0370 >Feature sequence0371 >Feature sequence0372 1739 108 gene locus_tag LOCUS_07010 1739 108 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence0373 1280 426 gene locus_tag LOCUS_07020 1280 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence0374 984 1880 gene locus_tag LOCUS_07030 984 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence0375 >Feature sequence0376 303 2063 gene locus_tag LOCUS_07040 303 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence0377 1761 367 gene locus_tag LOCUS_07050 gene argH 1761 367 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037227775.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence0378 >Feature sequence0379 >Feature sequence0380 1645 500 gene locus_tag LOCUS_07060 1645 500 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence0381 1744 497 gene locus_tag LOCUS_07070 gene larC 1744 497 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122655.1 protein_id gnl|my_center|LOCUS_07070 2517 1768 gene locus_tag LOCUS_07080 2517 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence0382 292 915 gene locus_tag LOCUS_07090 292 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1011 2225 gene locus_tag LOCUS_07100 1011 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence0383 2116 1067 gene locus_tag LOCUS_07110 gene hisC 2116 1067 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121508.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence0384 >Feature sequence0385 1044 2171 gene locus_tag LOCUS_07120 1044 2171 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0386 1 1581 gene locus_tag LOCUS_07130 1 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence0387 307 849 gene locus_tag LOCUS_07140 307 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2409 919 gene locus_tag LOCUS_07150 2409 919 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123577.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence0388 347 937 gene locus_tag LOCUS_07160 347 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07160 2234 993 gene locus_tag LOCUS_07170 2234 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence0389 188 1450 gene locus_tag LOCUS_07180 188 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence0390 <2599 968 gene locus_tag LOCUS_07190 <2599 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118530.1:peptidase >Feature sequence0391 <2596 1666 gene locus_tag LOCUS_07200 <2596 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922914.1:porin >Feature sequence0392 162 878 gene locus_tag LOCUS_07210 gene ribE 162 878 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099502.1 protein_id gnl|my_center|LOCUS_07210 2295 1042 gene locus_tag LOCUS_07220 2295 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence0393 889 137 gene locus_tag LOCUS_07230 889 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence0394 377 1114 gene locus_tag LOCUS_07240 377 1114 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121464.1 protein_id gnl|my_center|LOCUS_07240 1144 1965 gene locus_tag LOCUS_07250 1144 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 2162 1959 gene locus_tag LOCUS_07260 2162 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence0395 2231 636 gene locus_tag LOCUS_07270 2231 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence0396 746 934 gene locus_tag LOCUS_07280 746 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence0397 <1 2326 gene locus_tag LOCUS_07290 <1 2326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665250.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence0398 776 9 gene locus_tag LOCUS_07300 776 9 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336892.1 protein_id gnl|my_center|LOCUS_07300 2279 792 gene locus_tag LOCUS_07310 2279 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence0399 727 308 gene locus_tag LOCUS_07320 727 308 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_07320 2513 1023 gene locus_tag LOCUS_07330 2513 1023 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198738.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence0400 753 223 gene locus_tag LOCUS_07340 753 223 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 protein_id gnl|my_center|LOCUS_07340 2334 895 gene locus_tag LOCUS_07350 2334 895 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921382.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence0401 >Feature sequence0402 496 1383 gene locus_tag LOCUS_07360 496 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1476 2195 gene locus_tag LOCUS_07370 1476 2195 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence0403 1514 366 gene locus_tag LOCUS_07380 1514 366 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence0404 >Feature sequence0405 <1 515 gene locus_tag LOCUS_07390 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926807.1:putative DNA modification/repair radical SAM protein 561 1322 gene locus_tag LOCUS_07400 561 1322 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404487.1 protein_id gnl|my_center|LOCUS_07400 1312 2511 gene locus_tag LOCUS_07410 1312 2511 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214278.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence0406 >Feature sequence0407 <1 792 gene locus_tag LOCUS_07420 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705254.1:efflux RND transporter permease subunit >Feature sequence0408 >Feature sequence0409 1137 142 gene locus_tag LOCUS_07430 1137 142 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119981.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence0410 528 2474 gene locus_tag LOCUS_07440 528 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 >Feature sequence0411 745 2100 gene locus_tag LOCUS_07450 745 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2327 2097 gene locus_tag LOCUS_07460 2327 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence0412 251 550 gene locus_tag LOCUS_07470 gene groES 251 550 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330007.1 protein_id gnl|my_center|LOCUS_07470 657 2270 gene locus_tag LOCUS_07480 gene groL 657 2270 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330146.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence0413 >Feature sequence0414 819 403 gene locus_tag LOCUS_07490 819 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence0415 659 1408 gene locus_tag LOCUS_07500 659 1408 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340410.1 protein_id gnl|my_center|LOCUS_07500 1720 2400 gene locus_tag LOCUS_07510 1720 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence0416 511 122 gene locus_tag LOCUS_07520 511 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 916 599 gene locus_tag LOCUS_07530 916 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1249 1176 gene locus_tag LOCUS_t00110 1249 1176 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 <2525 1453 gene locus_tag LOCUS_07540 <2525 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332193.1:carbon starvation protein A >Feature sequence0417 <1 627 gene locus_tag LOCUS_07550 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545206.1:apolipoprotein N-acyltransferase 854 1927 gene locus_tag LOCUS_07560 854 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence0418 846 2237 gene locus_tag LOCUS_07570 846 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence0419 763 143 gene locus_tag LOCUS_07580 763 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 <2509 805 gene locus_tag LOCUS_07590 <2509 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103421.1:type I restriction endonuclease subunit R >Feature sequence0420 2414 1419 gene locus_tag LOCUS_07600 gene yhaM 2414 1419 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726638.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence0421 403 1140 gene locus_tag LOCUS_07610 403 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1180 2082 gene locus_tag LOCUS_07620 1180 2082 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325558.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence0422 364 1677 gene locus_tag LOCUS_07630 364 1677 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328879.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence0423 505 1494 gene locus_tag LOCUS_07640 505 1494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329702.1 protein_id gnl|my_center|LOCUS_07640 1620 2408 gene locus_tag LOCUS_07650 1620 2408 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence0424 119 592 gene locus_tag LOCUS_07660 119 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 671 1675 gene locus_tag LOCUS_07670 671 1675 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence0425 <1 2346 gene locus_tag LOCUS_07680 <1 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583995.1:endo-1,4-beta-xylanase >Feature sequence0426 2203 1163 gene locus_tag LOCUS_07690 2203 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0427 <1 594 gene locus_tag LOCUS_07700 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072012.1:1,4-dihydroxy-2-naphthoate polyprenyltransferase 711 1340 gene locus_tag LOCUS_07710 711 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 <2486 1457 gene locus_tag LOCUS_07720 <2486 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037198907.1:6-phosphofructokinase >Feature sequence0428 >Feature sequence0429 >Feature sequence0430 66 2186 gene locus_tag LOCUS_07730 66 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence0431 1386 1129 gene locus_tag LOCUS_07740 1386 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence0432 >Feature sequence0433 989 1975 gene locus_tag LOCUS_07750 989 1975 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence0434 1408 389 gene locus_tag LOCUS_07760 gene pheS 1408 389 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_07760 1830 2468 gene locus_tag LOCUS_07770 gene cyaB 1830 2468 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250130.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence0435 837 10 gene locus_tag LOCUS_07780 837 10 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118627.1 protein_id gnl|my_center|LOCUS_07780 2333 861 gene locus_tag LOCUS_07790 gene ffh 2333 861 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329358.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence0436 >Feature sequence0437 2057 417 gene locus_tag LOCUS_07800 2057 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence0438 >Feature sequence0439 <1 893 gene locus_tag LOCUS_07810 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463880.1:autotransporter domain-containing protein <2455 1319 gene locus_tag LOCUS_07820 <2455 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922881.1:trypsin-like peptidase domain-containing protein >Feature sequence0440 2079 817 gene locus_tag LOCUS_07830 2079 817 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028853.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence0441 1771 230 gene locus_tag LOCUS_07840 1771 230 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329914.1 protein_id gnl|my_center|LOCUS_07840 <2450 1857 gene locus_tag LOCUS_07850 <2450 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329904.1:carboxy terminal-processing peptidase >Feature sequence0442 >Feature sequence0443 1016 942 gene locus_tag LOCUS_t00120 1016 942 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1170 2261 gene locus_tag LOCUS_07860 gene nadA 1170 2261 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence0444 1645 668 gene locus_tag LOCUS_07870 1645 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 <2442 1657 gene locus_tag LOCUS_07880 <2442 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000257743.1:dihydrolipoamide acetyltransferase family protein >Feature sequence0445 >Feature sequence0446 >Feature sequence0447 1903 353 gene locus_tag LOCUS_07890 1903 353 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117793.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0448 >Feature sequence0449 1157 33 gene locus_tag LOCUS_07900 1157 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1796 1158 gene locus_tag LOCUS_07910 1796 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence0450 <1 1676 gene locus_tag LOCUS_07920 <1 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084771.1:S9 family peptidase >Feature sequence0451 169 1062 gene locus_tag LOCUS_07930 169 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0452 <1 533 gene locus_tag LOCUS_07940 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582595.1:M48 family metallopeptidase 642 2123 gene locus_tag LOCUS_07950 642 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence0453 1896 679 gene locus_tag LOCUS_07960 1896 679 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence0454 >Feature sequence0455 >Feature sequence0456 466 236 gene locus_tag LOCUS_07970 466 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07970 <2415 545 gene locus_tag LOCUS_07980 <2415 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121911.1:alanine--tRNA ligase note possible pseudo, internal stop codon >Feature sequence0457 1795 932 gene locus_tag LOCUS_07990 1795 932 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789703.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence0458 1475 285 gene locus_tag LOCUS_08000 1475 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence0459 <1 898 gene locus_tag LOCUS_08010 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331126.1:NAD-dependent epimerase/dehydratase family protein 1215 988 gene locus_tag LOCUS_08020 1215 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2348 1317 gene locus_tag LOCUS_08030 2348 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence0460 <1 558 gene locus_tag LOCUS_08040 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921368.1:sulfatase-like hydrolase/transferase 2072 1509 gene locus_tag LOCUS_08050 2072 1509 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence0461 >Feature sequence0462 454 378 gene locus_tag LOCUS_t00130 454 378 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0463 1849 695 gene locus_tag LOCUS_08060 1849 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence0464 1556 1011 gene locus_tag LOCUS_08070 1556 1011 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654974.1 protein_id gnl|my_center|LOCUS_08070 <2388 1632 gene locus_tag LOCUS_08080 <2388 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331575.1:glutamate 5-kinase >Feature sequence0465 47 967 gene locus_tag LOCUS_08090 47 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 1133 1753 gene locus_tag LOCUS_08100 1133 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence0466 848 114 gene locus_tag LOCUS_08110 848 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1777 947 gene locus_tag LOCUS_08120 1777 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2298 1774 gene locus_tag LOCUS_08130 2298 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence0467 >Feature sequence0468 >Feature sequence0469 <1 1614 gene locus_tag LOCUS_08140 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005768304.1:cation-translocating P-type ATPase >Feature sequence0470 1323 298 gene locus_tag LOCUS_08150 gene amrS 1323 298 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_08150 2142 1378 gene locus_tag LOCUS_08160 2142 1378 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973102.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence0471 >Feature sequence0472 <1 1958 gene locus_tag LOCUS_08170 <1 1958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015927.1:U32 family peptidase >Feature sequence0473 1950 766 gene locus_tag LOCUS_08180 1950 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence0474 >Feature sequence0475 507 779 gene locus_tag LOCUS_08190 507 779 CDS product DNA-directed RNA polymerase subunit alpha C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326741.1 protein_id gnl|my_center|LOCUS_08190 803 2164 gene locus_tag LOCUS_08200 803 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence0476 >Feature sequence0477 2115 745 gene locus_tag LOCUS_08210 2115 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence0478 1689 1303 gene locus_tag LOCUS_08220 1689 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence0479 <1 771 gene locus_tag LOCUS_08230 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921618.1:S41 family peptidase >Feature sequence0480 >Feature sequence0481 412 1647 gene locus_tag LOCUS_08240 412 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0482 >Feature sequence0483 585 1184 gene locus_tag LOCUS_08250 585 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 <2357 1324 gene locus_tag LOCUS_08260 <2357 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986411.1:NADH-dependent [FeFe] hydrogenase, group A6 >Feature sequence0484 >Feature sequence0485 1804 461 gene locus_tag LOCUS_08270 1804 461 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence0486 444 1178 gene locus_tag LOCUS_08280 444 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1201 1854 gene locus_tag LOCUS_08290 1201 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence0487 >Feature sequence0488 <1 1930 gene locus_tag LOCUS_08300 <1 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002865443.1:ferrous iron transport protein B >Feature sequence0489 >Feature sequence0490 <1 1791 gene locus_tag LOCUS_08310 <1 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119973.1:Na+:solute symporter >Feature sequence0491 >Feature sequence0492 >Feature sequence0493 1246 113 gene locus_tag LOCUS_08320 1246 113 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_08320 1459 1385 gene locus_tag LOCUS_t00140 1459 1385 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0494 296 1189 gene locus_tag LOCUS_08330 296 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1291 1971 gene locus_tag LOCUS_08340 1291 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence0495 >Feature sequence0496 >Feature sequence0497 603 818 gene locus_tag LOCUS_08350 603 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 825 2030 gene locus_tag LOCUS_08360 825 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence0498 <2328 1600 gene locus_tag LOCUS_08370 <2328 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812256.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence0499 1528 437 gene locus_tag LOCUS_08380 1528 437 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_08380 <2327 1697 gene locus_tag LOCUS_08390 <2327 1697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921547.1:DUF1015 domain-containing protein >Feature sequence0500 2144 339 gene locus_tag LOCUS_08400 2144 339 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324371.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence0501 >Feature sequence0502 <1 526 gene locus_tag LOCUS_08410 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803875.1:TIGR04133 family radical SAM/SPASM protein 597 2285 gene locus_tag LOCUS_08420 597 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence0503 598 2037 gene locus_tag LOCUS_08430 598 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence0504 >Feature sequence0505 182 1975 gene locus_tag LOCUS_08440 182 1975 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222877.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence0506 >Feature sequence0507 1546 269 gene locus_tag LOCUS_08450 gene serS 1546 269 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118185.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0508 860 168 gene locus_tag LOCUS_08460 gene tsaB 860 168 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122994.1 protein_id gnl|my_center|LOCUS_08460 1167 1925 gene locus_tag LOCUS_08470 1167 1925 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence0509 2196 1042 gene locus_tag LOCUS_08480 2196 1042 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331729.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence0510 >Feature sequence0511 >Feature sequence0512 1165 1857 gene locus_tag LOCUS_08490 1165 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence0513 944 2248 gene locus_tag LOCUS_08500 944 2248 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0514 >Feature sequence0515 1247 114 gene locus_tag LOCUS_08510 1247 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 <2296 1625 gene locus_tag LOCUS_08520 <2296 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665924.1:alpha/beta hydrolase >Feature sequence0516 <1 1430 gene locus_tag LOCUS_08530 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001070604.1:tetratricopeptide repeat protein 1502 2290 gene locus_tag LOCUS_08540 1502 2290 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340094.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence0517 <2282 1239 gene locus_tag LOCUS_08550 <2282 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957294.1:ankyrin repeat domain-containing protein >Feature sequence0518 >Feature sequence0519 >Feature sequence0520 <1 804 gene locus_tag LOCUS_08560 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804172.1:helicase 1120 1959 gene locus_tag LOCUS_08570 1120 1959 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076054256.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence0521 641 18 gene locus_tag LOCUS_08580 641 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 894 1910 gene locus_tag LOCUS_08590 894 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence0522 1361 183 gene locus_tag LOCUS_08600 gene rsgA 1361 183 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119119.1 protein_id gnl|my_center|LOCUS_08600 1615 1527 gene locus_tag LOCUS_t00150 1615 1527 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0523 >Feature sequence0524 1751 1170 gene locus_tag LOCUS_08610 1751 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0525 1890 106 gene locus_tag LOCUS_08620 1890 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence0526 1146 523 gene locus_tag LOCUS_08630 1146 523 CDS product SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122807.1 protein_id gnl|my_center|LOCUS_08630 2075 1167 gene locus_tag LOCUS_08640 gene ispE 2075 1167 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772104.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence0527 1722 442 gene locus_tag LOCUS_08650 gene lpxB 1722 442 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921562.1 protein_id gnl|my_center|LOCUS_08650 <2269 1719 gene locus_tag LOCUS_08660 <2269 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003148232.1:L-seryl-tRNA(Sec) selenium transferase >Feature sequence0528 <1 563 gene locus_tag LOCUS_08670 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076054256.1:alpha/beta hydrolase >Feature sequence0529 <2265 283 gene locus_tag LOCUS_08680 <2265 283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126622031.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence0530 >Feature sequence0531 799 287 gene locus_tag LOCUS_08690 799 287 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_08690 2073 970 gene locus_tag LOCUS_08700 2073 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence0532 >Feature sequence0533 864 43 gene locus_tag LOCUS_08710 gene map 864 43 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_08710 1427 867 gene locus_tag LOCUS_08720 1427 867 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_08720 <2250 1612 gene locus_tag LOCUS_08730 <2250 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326816.1:preprotein translocase subunit SecY >Feature sequence0534 431 156 gene locus_tag LOCUS_08740 431 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 <2249 583 gene locus_tag LOCUS_08750 <2249 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531631.1:virulence-associated E family protein >Feature sequence0535 519 1982 gene locus_tag LOCUS_08760 gene tig 519 1982 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330527.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence0536 1838 1752 gene locus_tag LOCUS_t00160 1838 1752 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0537 >Feature sequence0538 7 1995 gene locus_tag LOCUS_08770 7 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence0539 <2237 976 gene locus_tag LOCUS_08780 <2237 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165447220.1:S41 family peptidase >Feature sequence0540 35 376 gene locus_tag LOCUS_08790 35 376 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_08790 354 938 gene locus_tag LOCUS_08800 354 938 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817247.1 protein_id gnl|my_center|LOCUS_08800 1432 2172 gene locus_tag LOCUS_08810 1432 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08810 >Feature sequence0541 316 804 gene locus_tag LOCUS_08820 gene purE 316 804 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093510.1 protein_id gnl|my_center|LOCUS_08820 962 1309 gene locus_tag LOCUS_08830 962 1309 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_08830 1386 1991 gene locus_tag LOCUS_08840 gene thpR 1386 1991 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332599.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence0542 <1 667 gene locus_tag LOCUS_08850 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024311533.1:ankyrin repeat domain-containing protein 2085 973 gene locus_tag LOCUS_08860 2085 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2234 2082 gene locus_tag LOCUS_08870 2234 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence0543 1654 605 gene locus_tag LOCUS_08880 1654 605 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118683.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence0544 1594 353 gene locus_tag LOCUS_08890 1594 353 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071664104.1 protein_id gnl|my_center|LOCUS_08890 1824 1591 gene locus_tag LOCUS_08900 1824 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence0545 >Feature sequence0546 >Feature sequence0547 399 1853 gene locus_tag LOCUS_08910 399 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence0548 92 1060 gene locus_tag LOCUS_08920 gene pyrF 92 1060 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_08920 1066 1812 gene locus_tag LOCUS_08930 1066 1812 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121125.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0549 <1 814 gene locus_tag LOCUS_08940 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922668.1:tetratricopeptide repeat protein >Feature sequence0550 724 1536 gene locus_tag LOCUS_08950 724 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 1529 1933 gene locus_tag LOCUS_08960 1529 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence0551 608 994 gene locus_tag LOCUS_08970 608 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1027 1608 gene locus_tag LOCUS_08980 1027 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence0552 329 2068 gene locus_tag LOCUS_08990 329 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence0553 >Feature sequence0554 933 103 gene locus_tag LOCUS_09000 gene cysT 933 103 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928930.1 protein_id gnl|my_center|LOCUS_09000 2149 1070 gene locus_tag LOCUS_09010 2149 1070 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926821.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence0555 187 741 gene locus_tag LOCUS_09020 gene rplE 187 741 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173391575.1 protein_id gnl|my_center|LOCUS_09020 954 1349 gene locus_tag LOCUS_09030 gene rpsH 954 1349 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326810.1 protein_id gnl|my_center|LOCUS_09030 1463 2002 gene locus_tag LOCUS_09040 gene rplF 1463 2002 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121609.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence0556 >Feature sequence0557 >Feature sequence0558 >Feature sequence0559 <1 1214 gene locus_tag LOCUS_09050 <1 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672011.1:lysine--tRNA ligase >Feature sequence0560 1114 41 gene locus_tag LOCUS_09060 gene prfA 1114 41 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328933.1 protein_id gnl|my_center|LOCUS_09060 1625 1374 gene locus_tag LOCUS_09070 gene rpmE 1625 1374 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328932.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence0561 <1 1473 gene locus_tag LOCUS_09080 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327661.1:biosynthetic-type acetolactate synthase large subunit 1839 1546 gene locus_tag LOCUS_09090 1839 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0562 172 765 gene locus_tag LOCUS_09100 172 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence0563 546 1436 gene locus_tag LOCUS_09110 546 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0564 2026 869 gene locus_tag LOCUS_09120 2026 869 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence0565 >Feature sequence0566 1 777 gene locus_tag LOCUS_09130 1 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1540 851 gene locus_tag LOCUS_09140 1540 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2196 1684 gene locus_tag LOCUS_09150 2196 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0567 395 1654 gene locus_tag LOCUS_09160 395 1654 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121351.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence0568 <1 962 gene locus_tag LOCUS_09170 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224065206.1:ATP-binding protein 2127 1270 gene locus_tag LOCUS_09180 2127 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence0569 <2194 1177 gene locus_tag LOCUS_09190 <2194 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921767.1:protein translocase subunit SecD >Feature sequence0570 1037 288 gene locus_tag LOCUS_09200 gene bioD 1037 288 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_09200 2039 1056 gene locus_tag LOCUS_09210 gene bioB 2039 1056 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931746.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0571 470 934 gene locus_tag LOCUS_09220 470 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1020 2042 gene locus_tag LOCUS_09230 1020 2042 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence0572 1 417 gene locus_tag LOCUS_09240 gene nusB 1 417 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326965.1 protein_id gnl|my_center|LOCUS_09240 486 1898 gene locus_tag LOCUS_09250 486 1898 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921402.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence0573 <1 1197 gene locus_tag LOCUS_09260 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121144.1:ABC transporter permease 1732 1412 gene locus_tag LOCUS_09270 1732 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence0574 >Feature sequence0575 534 22 gene locus_tag LOCUS_09280 gene accB 534 22 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328900.1 protein_id gnl|my_center|LOCUS_09280 1665 544 gene locus_tag LOCUS_09290 1665 544 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121913.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence0576 1037 270 gene locus_tag LOCUS_09300 1037 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0577 769 1812 gene locus_tag LOCUS_09310 769 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence0578 831 355 gene locus_tag LOCUS_09320 gene greA 831 355 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339475.1 protein_id gnl|my_center|LOCUS_09320 1338 1015 gene locus_tag LOCUS_09330 1338 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1837 1559 gene locus_tag LOCUS_09340 1837 1559 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329447.1 protein_id gnl|my_center|LOCUS_09340 2126 1917 gene locus_tag LOCUS_09350 2126 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence0579 268 615 gene locus_tag LOCUS_09360 268 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 678 1667 gene locus_tag LOCUS_09370 678 1667 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174949.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence0580 1176 805 gene locus_tag LOCUS_09380 1176 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence0581 947 405 gene locus_tag LOCUS_09390 gene rplJ 947 405 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324458.1 protein_id gnl|my_center|LOCUS_09390 1733 1050 gene locus_tag LOCUS_09400 gene rplA 1733 1050 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324457.1 protein_id gnl|my_center|LOCUS_09400 2170 1814 gene locus_tag LOCUS_09410 gene rplK 2170 1814 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324993.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence0582 >Feature sequence0583 >Feature sequence0584 1051 230 gene locus_tag LOCUS_09420 gene rfbF 1051 230 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_09420 <2164 1165 gene locus_tag LOCUS_09430 <2164 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence0585 1403 54 gene locus_tag LOCUS_09440 1403 54 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392111.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0586 >Feature sequence0587 210 1025 gene locus_tag LOCUS_09450 gene kdsA 210 1025 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_09450 1040 1279 gene locus_tag LOCUS_09460 1040 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1276 1773 gene locus_tag LOCUS_09470 1276 1773 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_09470 1770 1988 gene locus_tag LOCUS_09480 1770 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence0588 >Feature sequence0589 >Feature sequence0590 >Feature sequence0591 1799 792 gene locus_tag LOCUS_09490 1799 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence0592 >Feature sequence0593 611 2008 gene locus_tag LOCUS_09500 611 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence0594 >Feature sequence0595 <1 506 gene locus_tag LOCUS_09510 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765637.1:4Fe-4S binding protein 1987 617 gene locus_tag LOCUS_09520 1987 617 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727454.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0596 <1 624 gene locus_tag LOCUS_09530 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329136.1:ABC transporter ATP-binding protein >Feature sequence0597 1826 414 gene locus_tag LOCUS_09540 1826 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence0598 <2139 1236 gene locus_tag LOCUS_09550 <2139 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013844987.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0599 1708 893 gene locus_tag LOCUS_09560 1708 893 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120828.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0600 <2139 528 gene locus_tag LOCUS_09570 <2139 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082990.1:alpha-N-arabinofuranosidase >Feature sequence0601 <1 572 gene locus_tag LOCUS_09580 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783878.1:RNA polymerase sigma factor 569 1492 gene locus_tag LOCUS_09590 569 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence0602 944 1276 gene locus_tag LOCUS_09600 944 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 <2135 1359 gene locus_tag LOCUS_09610 <2135 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000697190.1:glutamine amidotransferase >Feature sequence0603 >Feature sequence0604 101 871 gene locus_tag LOCUS_09620 gene hisF 101 871 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325161.1 protein_id gnl|my_center|LOCUS_09620 974 2116 gene locus_tag LOCUS_09630 974 2116 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122678.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence0605 >Feature sequence0606 >Feature sequence0607 <2118 1356 gene locus_tag LOCUS_09640 <2118 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119222.1:pseudouridine synthase >Feature sequence0608 161 775 gene locus_tag LOCUS_09650 161 775 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_09650 829 1512 gene locus_tag LOCUS_09660 gene rsxA 829 1512 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence0609 <1 762 gene locus_tag LOCUS_09670 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037228130.1:MotA/TolQ/ExbB proton channel family protein 885 1331 gene locus_tag LOCUS_09680 885 1331 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327446.1 protein_id gnl|my_center|LOCUS_09680 1344 1850 gene locus_tag LOCUS_09690 1344 1850 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327445.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence0610 <1 1251 gene locus_tag LOCUS_09700 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007331929.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence0611 716 3 gene locus_tag LOCUS_09710 716 3 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122304.1 protein_id gnl|my_center|LOCUS_09710 1829 741 gene locus_tag LOCUS_09720 1829 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence0612 >Feature sequence0613 >Feature sequence0614 <2110 1383 gene locus_tag LOCUS_09730 <2110 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118052.1:SLBB domain-containing protein >Feature sequence0615 <1 700 gene locus_tag LOCUS_09740 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945505.1:NADP-specific glutamate dehydrogenase 1041 1367 gene locus_tag LOCUS_09750 1041 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330016.1 protein_id gnl|my_center|LOCUS_09750 1526 1945 gene locus_tag LOCUS_09760 1526 1945 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence0616 464 709 gene locus_tag LOCUS_09770 464 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence0617 1753 53 gene locus_tag LOCUS_09780 1753 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0618 1659 1111 gene locus_tag LOCUS_09790 1659 1111 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence0619 1517 732 gene locus_tag LOCUS_09800 1517 732 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327962.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence0620 >Feature sequence0621 1661 738 gene locus_tag LOCUS_09810 1661 738 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence0622 567 271 gene locus_tag LOCUS_09820 567 271 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883135.1 protein_id gnl|my_center|LOCUS_09820 1859 570 gene locus_tag LOCUS_09830 1859 570 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence0623 2020 584 gene locus_tag LOCUS_09840 2020 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence0624 <2087 873 gene locus_tag LOCUS_09850 <2087 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940678.1:chromosomal replication initiator protein DnaA >Feature sequence0625 >Feature sequence0626 >Feature sequence0627 <1 1689 gene locus_tag LOCUS_09860 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099260976.1:preprotein translocase subunit SecA 1728 2081 gene locus_tag LOCUS_09870 1728 2081 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence0628 <1 1734 gene locus_tag LOCUS_09880 <1 1734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038877.1:AAA family ATPase >Feature sequence0629 81 1637 gene locus_tag LOCUS_09890 81 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence0630 200 1387 gene locus_tag LOCUS_09900 200 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence0631 1992 1177 gene locus_tag LOCUS_09910 1992 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence0632 1654 488 gene locus_tag LOCUS_09920 1654 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence0633 >Feature sequence0634 <1 501 gene locus_tag LOCUS_09930 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939420.1:class II fructose-1,6-bisphosphate aldolase 620 1804 gene locus_tag LOCUS_09940 620 1804 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence0635 >Feature sequence0636 745 1146 gene locus_tag LOCUS_09950 745 1146 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence0637 156 671 gene locus_tag LOCUS_09960 gene ilvN 156 671 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339870.1 protein_id gnl|my_center|LOCUS_09960 755 1912 gene locus_tag LOCUS_09970 755 1912 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931764.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence0638 <1 828 gene locus_tag LOCUS_09980 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326694.1:ABC transporter ATP-binding protein >Feature sequence0639 >Feature sequence0640 >Feature sequence0641 971 1378 gene locus_tag LOCUS_09990 971 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence0642 >Feature sequence0643 >Feature sequence0644 181 254 gene locus_tag LOCUS_t00170 181 254 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 515 1828 gene locus_tag LOCUS_10000 gene xylA 515 1828 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence0645 >Feature sequence0646 <1 991 gene locus_tag LOCUS_10010 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence0647 2 1897 gene locus_tag LOCUS_10020 2 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence0648 1599 706 gene locus_tag LOCUS_10030 1599 706 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000736956.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence0649 <2039 464 gene locus_tag LOCUS_10040 <2039 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038270.1:glycoside hydrolase family 97 protein >Feature sequence0650 >Feature sequence0651 1733 948 gene locus_tag LOCUS_10050 1733 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence0652 81 332 gene locus_tag LOCUS_10060 81 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 329 889 gene locus_tag LOCUS_10070 329 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1288 1674 gene locus_tag LOCUS_10080 1288 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1820 2026 gene locus_tag LOCUS_10090 1820 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence0653 >Feature sequence0654 >Feature sequence0655 >Feature sequence0656 >Feature sequence0657 1253 348 gene locus_tag LOCUS_10100 1253 348 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035472.1 protein_id gnl|my_center|LOCUS_10100 1644 1372 gene locus_tag LOCUS_10110 1644 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence0658 1331 1083 gene locus_tag LOCUS_10120 1331 1083 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_10120 <2027 1525 gene locus_tag LOCUS_10130 <2027 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460500.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence0659 >Feature sequence0660 >Feature sequence0661 2 1561 gene locus_tag LOCUS_10140 2 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0662 >Feature sequence0663 <2014 353 gene locus_tag LOCUS_10150 <2014 353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein >Feature sequence0664 <1 1777 gene locus_tag LOCUS_10160 <1 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118092.1:efflux RND transporter permease subunit >Feature sequence0665 >Feature sequence0666 280 756 gene locus_tag LOCUS_10170 280 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1563 982 gene locus_tag LOCUS_10180 1563 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence0667 109 1023 gene locus_tag LOCUS_10190 109 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence0668 983 786 gene locus_tag LOCUS_10200 983 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1362 1039 gene locus_tag LOCUS_10210 1362 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0669 >Feature sequence0670 498 1031 gene locus_tag LOCUS_10220 498 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1726 1127 gene locus_tag LOCUS_10230 1726 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence0671 856 572 gene locus_tag LOCUS_10240 856 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1208 1573 gene locus_tag LOCUS_10250 1208 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0672 960 1709 gene locus_tag LOCUS_10260 960 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence0673 >Feature sequence0674 >Feature sequence0675 1206 1964 gene locus_tag LOCUS_10270 1206 1964 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120692.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence0676 <1 520 gene locus_tag LOCUS_10280 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393263.1:lipoyl synthase 1544 555 gene locus_tag LOCUS_10290 1544 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1779 1552 gene locus_tag LOCUS_10300 1779 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence0677 1079 450 gene locus_tag LOCUS_10310 1079 450 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121990.1 protein_id gnl|my_center|LOCUS_10310 1615 1064 gene locus_tag LOCUS_10320 1615 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10320 1891 1625 gene locus_tag LOCUS_10330 1891 1625 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326729.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0678 1435 1554 gene locus_tag LOCUS_10340 1435 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence0679 >Feature sequence0680 >Feature sequence0681 >Feature sequence0682 1809 1090 gene locus_tag LOCUS_10350 1809 1090 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439170.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence0683 >Feature sequence0684 1070 48 gene locus_tag LOCUS_10360 1070 48 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence0685 >Feature sequence0686 1103 321 gene locus_tag LOCUS_10370 1103 321 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047817082.1 protein_id gnl|my_center|LOCUS_10370 <1968 1185 gene locus_tag LOCUS_10380 <1968 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922141.1:flagellar biosynthesis protein FlhF >Feature sequence0687 118 720 gene locus_tag LOCUS_10390 118 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1012 1143 gene locus_tag LOCUS_10400 1012 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence0688 581 9 gene locus_tag LOCUS_10410 gene nusG 581 9 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324992.1 protein_id gnl|my_center|LOCUS_10410 1233 715 gene locus_tag LOCUS_10420 gene secE 1233 715 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324991.1 protein_id gnl|my_center|LOCUS_10420 1259 1187 gene locus_tag LOCUS_t00180 1259 1187 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 <1964 1369 gene locus_tag LOCUS_10430 <1964 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121621.1:elongation factor Tu >Feature sequence0689 >Feature sequence0690 <1 616 gene locus_tag LOCUS_10440 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121674.1:formylglycine-generating enzyme family protein 720 1169 gene locus_tag LOCUS_10450 gene rnhA 720 1169 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326294.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence0691 >Feature sequence0692 833 150 gene locus_tag LOCUS_10460 833 150 CDS product aromatic aminobenezylarsenical efflux permease ArsG family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107453.1 protein_id gnl|my_center|LOCUS_10460 1340 834 gene locus_tag LOCUS_10470 1340 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence0693 445 906 gene locus_tag LOCUS_10480 445 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1024 1899 gene locus_tag LOCUS_10490 1024 1899 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809378.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence0694 >Feature sequence0695 >Feature sequence0696 1045 233 gene locus_tag LOCUS_10500 1045 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 <1945 1142 gene locus_tag LOCUS_10510 <1945 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001973414.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence0697 181 26 gene locus_tag LOCUS_10520 181 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 695 1219 gene locus_tag LOCUS_10530 695 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence0698 1316 360 gene locus_tag LOCUS_10540 1316 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence0699 1713 409 gene locus_tag LOCUS_10550 1713 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence0700 <1942 707 gene locus_tag LOCUS_10560 <1942 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922444.1:ATP-binding protein >Feature sequence0701 1201 74 gene locus_tag LOCUS_10570 1201 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence0702 >Feature sequence0703 >Feature sequence0704 >Feature sequence0705 <1 831 gene locus_tag LOCUS_10580 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456582.1:galactokinase 1064 1137 gene locus_tag LOCUS_t00190 1064 1137 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0706 >Feature sequence0707 >Feature sequence0708 1727 969 gene locus_tag LOCUS_10590 1727 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0709 >Feature sequence0710 1454 1386 gene locus_tag LOCUS_r00010 1454 1386 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 57 percent of the 5S ribosomal RNA >Feature sequence0711 >Feature sequence0712 1267 836 gene locus_tag LOCUS_10600 gene rsfS 1267 836 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615413.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence0713 >Feature sequence0714 <1 1421 gene locus_tag LOCUS_10610 <1 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921396.1:Gldg family protein >Feature sequence0715 >Feature sequence0716 >Feature sequence0717 802 20 gene locus_tag LOCUS_10620 gene rsmG 802 20 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334161.1 protein_id gnl|my_center|LOCUS_10620 1111 956 gene locus_tag LOCUS_10630 1111 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1506 1847 gene locus_tag LOCUS_10640 1506 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence0718 >Feature sequence0719 1264 524 gene locus_tag LOCUS_10650 gene ubiE 1264 524 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence0720 1540 446 gene locus_tag LOCUS_10660 1540 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence0721 617 544 gene locus_tag LOCUS_t00200 617 544 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 841 1473 gene locus_tag LOCUS_10670 gene dhaL 841 1473 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389114.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0722 965 333 gene locus_tag LOCUS_10680 965 333 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798635.1 protein_id gnl|my_center|LOCUS_10680 1210 1476 gene locus_tag LOCUS_10690 1210 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence0723 282 560 gene locus_tag LOCUS_10700 282 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence0724 <1915 1334 gene locus_tag LOCUS_10710 <1915 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068399.1:gamma-glutamyl-gamma-aminobutyrate hydrolase family protein >Feature sequence0725 >Feature sequence0726 >Feature sequence0727 240 824 gene locus_tag LOCUS_10720 240 824 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_10720 817 1827 gene locus_tag LOCUS_10730 gene trpD 817 1827 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence0728 >Feature sequence0729 540 1307 gene locus_tag LOCUS_10740 540 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1334 1549 gene locus_tag LOCUS_10750 1334 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence0730 >Feature sequence0731 <1910 1308 gene locus_tag LOCUS_10760 <1910 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123471.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence0732 <1906 411 gene locus_tag LOCUS_10770 <1906 411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089239.1:ankyrin repeat domain-containing protein >Feature sequence0733 >Feature sequence0734 <1 519 gene locus_tag LOCUS_10780 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015666.1:SPFH domain-containing protein >Feature sequence0735 1223 1498 gene locus_tag LOCUS_10790 gene rpsT 1223 1498 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326150.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence0736 <1 811 gene locus_tag LOCUS_10800 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332509.1:ATPase, T2SS/T4P/T4SS family 852 1193 gene locus_tag LOCUS_10810 852 1193 CDS product DUF4145 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289435.1 protein_id gnl|my_center|LOCUS_10810 1355 1708 gene locus_tag LOCUS_10820 1355 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence0737 >Feature sequence0738 512 1183 gene locus_tag LOCUS_10830 gene larB 512 1183 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335257.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence0739 >Feature sequence0740 >Feature sequence0741 845 297 gene locus_tag LOCUS_10840 845 297 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335404.1 protein_id gnl|my_center|LOCUS_10840 1461 976 gene locus_tag LOCUS_10850 gene tsaE 1461 976 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405136.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence0742 >Feature sequence0743 163 1383 gene locus_tag LOCUS_10860 163 1383 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089239.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence0744 >Feature sequence0745 1114 98 gene locus_tag LOCUS_10870 1114 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1499 1254 gene locus_tag LOCUS_10880 1499 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence0746 964 116 gene locus_tag LOCUS_10890 964 116 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_10890 <1878 1007 gene locus_tag LOCUS_10900 <1878 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120381.1:lipid-binding SYLF domain-containing protein >Feature sequence0747 <1877 675 gene locus_tag LOCUS_10910 <1877 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211634420.1:glycoside hydrolase family 32 protein >Feature sequence0748 >Feature sequence0749 364 56 gene locus_tag LOCUS_10920 364 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1837 410 gene locus_tag LOCUS_10930 1837 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence0750 >Feature sequence0751 <1 591 gene locus_tag LOCUS_10940 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861592.1:MBOAT family protein 1397 597 gene locus_tag LOCUS_10950 1397 597 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0752 >Feature sequence0753 <1865 970 gene locus_tag LOCUS_10960 <1865 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083329.1:HAD family hydrolase >Feature sequence0754 <1861 617 gene locus_tag LOCUS_10970 <1861 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047815631.1:DUF4159 domain-containing protein >Feature sequence0755 79 1125 gene locus_tag LOCUS_10980 79 1125 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024667998.1 protein_id gnl|my_center|LOCUS_10980 1185 1424 gene locus_tag LOCUS_10990 1185 1424 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707833.1 protein_id gnl|my_center|LOCUS_10990 1516 1743 gene locus_tag LOCUS_11000 1516 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence0756 885 25 gene locus_tag LOCUS_11010 885 25 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0757 747 151 gene locus_tag LOCUS_11020 747 151 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068495.1 protein_id gnl|my_center|LOCUS_11020 1401 763 gene locus_tag LOCUS_11030 1401 763 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459715.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence0758 <1856 113 gene locus_tag LOCUS_11040 <1856 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966116.1:FecR domain-containing protein >Feature sequence0759 >Feature sequence0760 >Feature sequence0761 249 1364 gene locus_tag LOCUS_11050 249 1364 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence0762 <1 597 gene locus_tag LOCUS_11060 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890720.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase 733 1716 gene locus_tag LOCUS_11070 gene ilvC 733 1716 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000861143.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence0763 >Feature sequence0764 1058 702 gene locus_tag LOCUS_11080 1058 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1609 1178 gene locus_tag LOCUS_11090 1609 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0765 1239 208 gene locus_tag LOCUS_11100 1239 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence0766 <1 1632 gene locus_tag LOCUS_11110 <1 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107320.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit >Feature sequence0767 >Feature sequence0768 484 774 gene locus_tag LOCUS_11120 484 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 771 1670 gene locus_tag LOCUS_11130 771 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence0769 >Feature sequence0770 >Feature sequence0771 >Feature sequence0772 2 640 gene locus_tag LOCUS_11140 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1436 684 gene locus_tag LOCUS_11150 1436 684 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029850.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence0773 32 1150 gene locus_tag LOCUS_11160 32 1150 CDS product DUF1598 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435082.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence0774 >Feature sequence0775 >Feature sequence0776 >Feature sequence0777 1503 43 gene locus_tag LOCUS_11170 1503 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence0778 <1 559 gene locus_tag LOCUS_11180 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922273.1:KpsF/GutQ family sugar-phosphate isomerase >Feature sequence0779 758 1690 gene locus_tag LOCUS_11190 758 1690 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence0780 >Feature sequence0781 >Feature sequence0782 768 1658 gene locus_tag LOCUS_11200 768 1658 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324200.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0783 >Feature sequence0784 1277 453 gene locus_tag LOCUS_11210 1277 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence0785 >Feature sequence0786 1445 621 gene locus_tag LOCUS_11220 1445 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0787 >Feature sequence0788 923 21 gene locus_tag LOCUS_11230 923 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1427 999 gene locus_tag LOCUS_11240 1427 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence0789 418 582 gene locus_tag LOCUS_11250 gene rpmG 418 582 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324504.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence0790 1564 251 gene locus_tag LOCUS_11260 1564 251 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615779.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence0791 2 1081 gene locus_tag LOCUS_11270 2 1081 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence0792 >Feature sequence0793 >Feature sequence0794 1710 1282 gene locus_tag LOCUS_11280 1710 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence0795 <1 1741 gene locus_tag LOCUS_11290 <1 1741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003380455.1:efflux RND transporter permease subunit >Feature sequence0796 1143 466 gene locus_tag LOCUS_11300 gene deoC 1143 466 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970031.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence0797 <1 933 gene locus_tag LOCUS_11310 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876537.1:deoxyribodipyrimidine photo-lyase 1451 966 gene locus_tag LOCUS_11320 1451 966 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330217.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence0798 >Feature sequence0799 1786 1571 gene locus_tag LOCUS_11330 1786 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence0800 1337 102 gene locus_tag LOCUS_11340 1337 102 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0801 999 283 gene locus_tag LOCUS_11350 999 283 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933474.1 protein_id gnl|my_center|LOCUS_11350 1300 1710 gene locus_tag LOCUS_11360 1300 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence0802 >Feature sequence0803 245 1600 gene locus_tag LOCUS_11370 245 1600 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948598.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0804 <1780 374 gene locus_tag LOCUS_11380 <1780 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence0805 <1 1729 gene locus_tag LOCUS_11390 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026988.1:NPCBM/NEW2 domain-containing protein >Feature sequence0806 <1 810 gene locus_tag LOCUS_11400 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118345.1:nucleoside hydrolase >Feature sequence0807 <1780 266 gene locus_tag LOCUS_11410 <1780 266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325911.1:chaperonin GroEL >Feature sequence0808 >Feature sequence0809 1355 273 gene locus_tag LOCUS_11420 1355 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence0810 <1 1585 gene locus_tag LOCUS_11430 <1 1585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence0811 <1773 274 gene locus_tag LOCUS_11440 <1773 274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007336892.1:BPL-N domain-containing protein >Feature sequence0812 <1 1119 gene locus_tag LOCUS_11450 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764572.1:SMP-30/gluconolactonase/LRE family protein 1253 1534 gene locus_tag LOCUS_11460 1253 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0813 <1 1529 gene locus_tag LOCUS_11470 <1 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072227.1:marine proteobacterial sortase target protein >Feature sequence0814 302 389 gene locus_tag LOCUS_t00210 302 389 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 557 1075 gene locus_tag LOCUS_11480 gene ruvC 557 1075 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120029.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence0815 >Feature sequence0816 <1 880 gene locus_tag LOCUS_11490 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922073.1:VWA domain-containing protein >Feature sequence0817 467 1588 gene locus_tag LOCUS_11500 467 1588 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121166.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence0818 >Feature sequence0819 >Feature sequence0820 726 1721 gene locus_tag LOCUS_11510 726 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence0821 >Feature sequence0822 <1 909 gene locus_tag LOCUS_11520 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922083.1:glutamate--tRNA ligase >Feature sequence0823 820 482 gene locus_tag LOCUS_11530 820 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1087 845 gene locus_tag LOCUS_11540 1087 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0824 27 473 gene locus_tag LOCUS_11550 27 473 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392805.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0825 >Feature sequence0826 >Feature sequence0827 >Feature sequence0828 1426 1503 gene locus_tag LOCUS_t00220 1426 1503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0829 >Feature sequence0830 <1 885 gene locus_tag LOCUS_11560 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921467.1:choice-of-anchor I family protein 1123 1644 gene locus_tag LOCUS_11570 1123 1644 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173401881.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence0831 >Feature sequence0832 1457 183 gene locus_tag LOCUS_11580 1457 183 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence0833 <1 1105 gene locus_tag LOCUS_11590 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120867.1:DNA primase >Feature sequence0834 >Feature sequence0835 636 298 gene locus_tag LOCUS_11600 636 298 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680676.1 protein_id gnl|my_center|LOCUS_11600 <1728 633 gene locus_tag LOCUS_11610 <1728 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948740.1:FAD-dependent oxidoreductase >Feature sequence0836 >Feature sequence0837 >Feature sequence0838 >Feature sequence0839 <1 1446 gene locus_tag LOCUS_11620 <1 1446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117884.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence0840 209 57 gene locus_tag LOCUS_11630 209 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 995 273 gene locus_tag LOCUS_11640 995 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence0841 1489 80 gene locus_tag LOCUS_11650 1489 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence0842 >Feature sequence0843 <1 1576 gene locus_tag LOCUS_11660 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546879.1:carbamoyl-phosphate synthase large subunit >Feature sequence0844 385 1101 gene locus_tag LOCUS_11670 385 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence0845 1546 707 gene locus_tag LOCUS_11680 1546 707 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028851.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence0846 119 298 gene locus_tag LOCUS_11690 119 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 530 904 gene locus_tag LOCUS_11700 530 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence0847 1341 208 gene locus_tag LOCUS_11710 1341 208 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338728.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence0848 >Feature sequence0849 34 1422 gene locus_tag LOCUS_11720 gene mgtE 34 1422 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118267.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence0850 >Feature sequence0851 >Feature sequence0852 <1697 1067 gene locus_tag LOCUS_11730 <1697 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119461.1:DUF1080 domain-containing protein >Feature sequence0853 >Feature sequence0854 <1 1287 gene locus_tag LOCUS_11740 <1 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940999.1:DegQ family serine endoprotease >Feature sequence0855 165 641 gene locus_tag LOCUS_11750 165 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 683 1162 gene locus_tag LOCUS_11760 gene rpsE 683 1162 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326813.1 protein_id gnl|my_center|LOCUS_11760 1162 1659 gene locus_tag LOCUS_11770 gene rplO 1162 1659 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326814.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence0856 >Feature sequence0857 1031 165 gene locus_tag LOCUS_11780 gene hpnC 1031 165 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061007.1 protein_id gnl|my_center|LOCUS_11780 <1693 1170 gene locus_tag LOCUS_11790 <1693 1170 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922341.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence0858 >Feature sequence0859 >Feature sequence0860 >Feature sequence0861 <1 771 gene locus_tag LOCUS_11800 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence0862 305 1321 gene locus_tag LOCUS_11810 gene argC 305 1321 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_11810 1437 1616 gene locus_tag LOCUS_11820 1437 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11820 >Feature sequence0863 >Feature sequence0864 415 1473 gene locus_tag LOCUS_11830 415 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence0865 >Feature sequence0866 >Feature sequence0867 153 1223 gene locus_tag LOCUS_11840 153 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence0868 >Feature sequence0869 >Feature sequence0870 <1 819 gene locus_tag LOCUS_11850 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201778965.1:glutamine-hydrolyzing GMP synthase 942 1283 gene locus_tag LOCUS_11860 942 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence0871 382 197 gene locus_tag LOCUS_11870 382 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence0872 1545 1267 gene locus_tag LOCUS_11880 1545 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence0873 <1672 370 gene locus_tag LOCUS_11890 <1672 370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002309918.1:dihydrolipoyl dehydrogenase >Feature sequence0874 <1 739 gene locus_tag LOCUS_11900 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330043.1:AAA family ATPase 796 1017 gene locus_tag LOCUS_11910 796 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence0875 >Feature sequence0876 >Feature sequence0877 >Feature sequence0878 1499 138 gene locus_tag LOCUS_11920 1499 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence0879 >Feature sequence0880 <1 1053 gene locus_tag LOCUS_11930 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337250.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0881 >Feature sequence0882 >Feature sequence0883 949 1224 gene locus_tag LOCUS_11940 949 1224 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458924.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence0884 1482 352 gene locus_tag LOCUS_11950 gene tgt 1482 352 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778950.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0885 <1 956 gene locus_tag LOCUS_11960 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020696.1:formylglycine-generating enzyme family protein >Feature sequence0886 >Feature sequence0887 >Feature sequence0888 <1 1060 gene locus_tag LOCUS_11970 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546422.1:elongation factor G >Feature sequence0889 <1644 405 gene locus_tag LOCUS_11980 <1644 405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122147.1:prephenate dehydratase >Feature sequence0890 1 516 gene locus_tag LOCUS_11990 1 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <1643 612 gene locus_tag LOCUS_12000 <1643 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193427773.1:transcription-repair coupling factor >Feature sequence0891 2 226 gene locus_tag LOCUS_12010 2 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 234 413 gene locus_tag LOCUS_12020 234 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 410 1009 gene locus_tag LOCUS_12030 410 1009 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0892 >Feature sequence0893 1573 617 gene locus_tag LOCUS_12040 1573 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12040 >Feature sequence0894 <1 1047 gene locus_tag LOCUS_12050 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104543246.1:autotransporter-associated beta strand repeat-containing protein >Feature sequence0895 130 1317 gene locus_tag LOCUS_12060 130 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence0896 >Feature sequence0897 >Feature sequence0898 >Feature sequence0899 >Feature sequence0900 <1 763 gene locus_tag LOCUS_12070 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080010.1:NAD+ synthase >Feature sequence0901 48 1550 gene locus_tag LOCUS_12080 48 1550 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202937.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence0902 >Feature sequence0903 1528 881 gene locus_tag LOCUS_12090 1528 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence0904 >Feature sequence0905 <1614 190 gene locus_tag LOCUS_12100 <1614 190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555683.1:sulfatase-like hydrolase/transferase >Feature sequence0906 >Feature sequence0907 966 436 gene locus_tag LOCUS_12110 966 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence0908 <1612 122 gene locus_tag LOCUS_12120 <1612 122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038821.1:autotransporter BatB >Feature sequence0909 1392 997 gene locus_tag LOCUS_12130 1392 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12130 >Feature sequence0910 <1610 441 gene locus_tag LOCUS_12140 <1610 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000030106.1:Hsp70 family protein >Feature sequence0911 269 1429 gene locus_tag LOCUS_12150 269 1429 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0912 >Feature sequence0913 626 1198 gene locus_tag LOCUS_12160 626 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence0914 1606 35 gene locus_tag LOCUS_12170 1606 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence0915 >Feature sequence0916 1122 460 gene locus_tag LOCUS_12180 1122 460 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071744.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence0917 >Feature sequence0918 >Feature sequence0919 >Feature sequence0920 >Feature sequence0921 >Feature sequence0922 369 1442 gene locus_tag LOCUS_12190 369 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence0923 >Feature sequence0924 260 1558 gene locus_tag LOCUS_12200 260 1558 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence0925 433 741 gene locus_tag LOCUS_12210 433 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence0926 <1597 875 gene locus_tag LOCUS_12220 <1597 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546211.1:NrpR regulatory domain-containing protein >Feature sequence0927 <1 794 gene locus_tag LOCUS_12230 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080424.1:ATP-binding cassette domain-containing protein >Feature sequence0928 <1 230 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatatcagatcgacgattccgtacaacccatagc <1596 547 gene locus_tag LOCUS_12240 <1596 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109367.1:glycosyl hydrolase 53 family protein >Feature sequence0929 242 802 gene locus_tag LOCUS_12250 242 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12250 <1594 1075 gene locus_tag LOCUS_12260 <1594 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921509.1:SDR family oxidoreductase >Feature sequence0930 <1 1177 gene locus_tag LOCUS_12270 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000081335.1:DEAD/DEAH box helicase family protein >Feature sequence0931 >Feature sequence0932 <1593 618 gene locus_tag LOCUS_12280 <1593 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_160648704.1:NAD(P)-dependent oxidoreductase >Feature sequence0933 >Feature sequence0934 1425 415 gene locus_tag LOCUS_12290 1425 415 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence0935 <1591 1025 gene locus_tag LOCUS_12300 <1591 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532876.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 <1 661 gene locus_tag LOCUS_12310 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256896.1:alpha/beta fold hydrolase >Feature sequence0939 <1 1138 gene locus_tag LOCUS_12320 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943760.1:cell wall-binding repeat-containing protein >Feature sequence0940 368 1198 gene locus_tag LOCUS_12330 368 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0941 <1 1014 gene locus_tag LOCUS_12340 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145885.1:rhomboid family intramembrane serine protease >Feature sequence0942 1392 526 gene locus_tag LOCUS_12350 gene lpxC 1392 526 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615542.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence0943 >Feature sequence0944 >Feature sequence0945 25 1350 gene locus_tag LOCUS_12360 25 1350 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12360 >Feature sequence0946 >Feature sequence0947 1454 735 gene locus_tag LOCUS_12370 gene hisA 1454 735 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327023.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence0948 >Feature sequence0949 1572 1351 gene locus_tag LOCUS_12380 1572 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence0950 >Feature sequence0951 <1 804 gene locus_tag LOCUS_12390 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108495.1:sodium:solute symporter 1478 909 gene locus_tag LOCUS_12400 1478 909 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0952 >Feature sequence0953 <1 866 gene locus_tag LOCUS_12410 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963752.1:glycerophosphodiester phosphodiesterase >Feature sequence0954 483 764 gene locus_tag LOCUS_12420 483 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence0955 >Feature sequence0956 >Feature sequence0957 1410 37 gene locus_tag LOCUS_12430 gene gltA 1410 37 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence0958 <1567 158 gene locus_tag LOCUS_12440 <1567 158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121465.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence0959 <1 614 gene locus_tag LOCUS_12450 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118955.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence0960 1070 105 gene locus_tag LOCUS_12460 1070 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence0961 >Feature sequence0962 >Feature sequence0963 1079 558 gene locus_tag LOCUS_12470 1079 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence0964 <1 849 gene locus_tag LOCUS_12480 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076054256.1:alpha/beta hydrolase note possible pseudo, frameshifted >Feature sequence0965 >Feature sequence0966 <1 1094 gene locus_tag LOCUS_12490 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968692.1:type I restriction endonuclease subunit R >Feature sequence0967 1073 441 gene locus_tag LOCUS_12500 gene rpe 1073 441 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118429.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0968 957 445 gene locus_tag LOCUS_12510 957 445 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870310.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 1331 669 gene locus_tag LOCUS_12520 1331 669 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence0972 2 1348 gene locus_tag LOCUS_12530 2 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 895 1503 gene locus_tag LOCUS_12540 895 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 986 867 gene locus_tag LOCUS_12550 986 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence0980 178 1224 gene locus_tag LOCUS_12560 178 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324693.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0981 >Feature sequence0982 >Feature sequence0983 <1 513 gene locus_tag LOCUS_12570 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081403079.1:formylglycine-generating enzyme family protein 1415 510 gene locus_tag LOCUS_12580 1415 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence0984 >Feature sequence0985 849 469 gene locus_tag LOCUS_12590 849 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1088 846 gene locus_tag LOCUS_12600 1088 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence0986 >Feature sequence0987 >Feature sequence0988 <1 551 gene locus_tag LOCUS_12610 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_194032065.1:ankyrin repeat domain-containing protein 1204 860 gene locus_tag LOCUS_12620 1204 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0989 205 1503 gene locus_tag LOCUS_12630 205 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence0990 1314 526 gene locus_tag LOCUS_12640 1314 526 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0991 >Feature sequence0992 916 35 gene locus_tag LOCUS_12650 916 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence0993 >Feature sequence0994 >Feature sequence0995 >Feature sequence0996 >Feature sequence0997 >Feature sequence0998 2 898 gene locus_tag LOCUS_12660 2 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence0999 >Feature sequence1000 >Feature sequence1001 1387 407 gene locus_tag LOCUS_12670 1387 407 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence1002 >Feature sequence1003 >Feature sequence1004 >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 >Feature sequence1008 >Feature sequence1009 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 992 1501 gene locus_tag LOCUS_12680 992 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence1013 1018 1374 gene locus_tag LOCUS_12690 1018 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence1014 >Feature sequence1015 >Feature sequence1016 1200 454 gene locus_tag LOCUS_12700 1200 454 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118760.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence1017 <1 965 gene locus_tag LOCUS_12710 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921373.1:AAA family ATPase >Feature sequence1018 456 791 gene locus_tag LOCUS_12720 456 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence1019 <1504 175 gene locus_tag LOCUS_12730 <1504 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546569.1:sigma-54 dependent transcriptional regulator >Feature sequence1020 >Feature sequence1021 102 296 gene locus_tag LOCUS_12740 102 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 878 537 gene locus_tag LOCUS_12750 gene rplT 878 537 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332030.1 protein_id gnl|my_center|LOCUS_12750 1248 1045 gene locus_tag LOCUS_12760 gene rpmI 1248 1045 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332031.1 protein_id gnl|my_center|LOCUS_12760 1381 1307 gene locus_tag LOCUS_t00230 1381 1307 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38