>Feature sequence01 194 721 gene locus_tag LOCUS_00010 194 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 815 1030 gene locus_tag LOCUS_00020 815 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1157 2191 gene locus_tag LOCUS_00030 1157 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3636 2179 gene locus_tag LOCUS_00040 3636 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4670 3702 gene locus_tag LOCUS_00050 4670 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4749 5738 gene locus_tag LOCUS_00060 4749 5738 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_00060 6172 6408 gene locus_tag LOCUS_00070 6172 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6526 6708 gene locus_tag LOCUS_00080 6526 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6719 8500 gene locus_tag LOCUS_00090 6719 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8504 8818 gene locus_tag LOCUS_00100 8504 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 8748 9269 gene locus_tag LOCUS_00110 8748 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 9281 10024 gene locus_tag LOCUS_00120 9281 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10021 11253 gene locus_tag LOCUS_00130 10021 11253 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963437.1 protein_id gnl|my_center|LOCUS_00130 12169 11237 gene locus_tag LOCUS_00140 12169 11237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744700.1 protein_id gnl|my_center|LOCUS_00140 12920 12180 gene locus_tag LOCUS_00150 12920 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14040 12922 gene locus_tag LOCUS_00160 gene fbp 14040 12922 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_00160 15345 14062 gene locus_tag LOCUS_00170 15345 14062 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_00170 15477 16283 gene locus_tag LOCUS_00180 15477 16283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 16365 17009 gene locus_tag LOCUS_00190 gene hpt 16365 17009 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_00190 18260 17010 gene locus_tag LOCUS_00200 18260 17010 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_00200 18943 18257 gene locus_tag LOCUS_00210 gene mtnP 18943 18257 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879284.1 protein_id gnl|my_center|LOCUS_00210 19851 18958 gene locus_tag LOCUS_00220 19851 18958 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330368.1 protein_id gnl|my_center|LOCUS_00220 20073 23285 gene locus_tag LOCUS_00230 20073 23285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23305 24441 gene locus_tag LOCUS_00240 23305 24441 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_00240 24584 24510 gene locus_tag LOCUS_t00010 24584 24510 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25324 24629 gene locus_tag LOCUS_00250 gene uppS 25324 24629 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762103.1 protein_id gnl|my_center|LOCUS_00250 25529 25317 gene locus_tag LOCUS_00260 25529 25317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25523 25699 gene locus_tag LOCUS_00270 25523 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 25755 26102 gene locus_tag LOCUS_00280 25755 26102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27227 26316 gene locus_tag LOCUS_00290 27227 26316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27955 27224 gene locus_tag LOCUS_00300 gene nadE 27955 27224 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_00300 29184 27952 gene locus_tag LOCUS_00310 gene rbcL 29184 27952 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_00310 29281 29859 gene locus_tag LOCUS_00320 29281 29859 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_00320 30177 29971 gene locus_tag LOCUS_00330 30177 29971 CDS product archaeal histone A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867469.1 protein_id gnl|my_center|LOCUS_00330 30322 31935 gene locus_tag LOCUS_00340 30322 31935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31941 32657 gene locus_tag LOCUS_00350 31941 32657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00350 32676 33452 gene locus_tag LOCUS_00360 32676 33452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33532 33602 gene locus_tag LOCUS_t00020 33532 33602 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 33700 34131 gene locus_tag LOCUS_00370 33700 34131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 34296 34156 gene locus_tag LOCUS_00380 34296 34156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 34474 35958 gene locus_tag LOCUS_00390 34474 35958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021937.1 protein_id gnl|my_center|LOCUS_00390 36291 38291 gene locus_tag LOCUS_00400 36291 38291 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_00400 38365 39846 gene locus_tag LOCUS_00410 38365 39846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40660 39848 gene locus_tag LOCUS_00420 40660 39848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 40979 40701 gene locus_tag LOCUS_00430 40979 40701 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869747.1 protein_id gnl|my_center|LOCUS_00430 41241 41056 gene locus_tag LOCUS_00440 41241 41056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 41864 41280 gene locus_tag LOCUS_00450 41864 41280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 41915 42436 gene locus_tag LOCUS_00460 41915 42436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 42608 43513 gene locus_tag LOCUS_00470 42608 43513 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_00470 43600 43908 gene locus_tag LOCUS_00480 43600 43908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 44136 43948 gene locus_tag LOCUS_00490 44136 43948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 44468 45109 gene locus_tag LOCUS_00500 44468 45109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 45406 45095 gene locus_tag LOCUS_00510 45406 45095 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_00510 45519 46175 gene locus_tag LOCUS_00520 gene rnhB 45519 46175 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_00520 46175 46654 gene locus_tag LOCUS_00530 46175 46654 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024447.1 protein_id gnl|my_center|LOCUS_00530 48456 46651 gene locus_tag LOCUS_00540 48456 46651 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_00540 49911 48514 gene locus_tag LOCUS_00550 gene cysS 49911 48514 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_00550 51327 49930 gene locus_tag LOCUS_00560 51327 49930 CDS product lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679156.1 protein_id gnl|my_center|LOCUS_00560 51392 52675 gene locus_tag LOCUS_00570 51392 52675 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_00570 52747 53436 gene locus_tag LOCUS_00580 52747 53436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 53433 54692 gene locus_tag LOCUS_00590 53433 54692 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986909.1 protein_id gnl|my_center|LOCUS_00590 54815 55237 gene locus_tag LOCUS_00600 54815 55237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 55696 55256 gene locus_tag LOCUS_00610 55696 55256 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867539.1 protein_id gnl|my_center|LOCUS_00610 56494 55811 gene locus_tag LOCUS_00620 56494 55811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 57669 56608 gene locus_tag LOCUS_00630 57669 56608 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_00630 57744 58187 gene locus_tag LOCUS_00640 57744 58187 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868432.1 protein_id gnl|my_center|LOCUS_00640 58658 58197 gene locus_tag LOCUS_00650 58658 58197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 59152 58682 gene locus_tag LOCUS_00660 59152 58682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 59232 60089 gene locus_tag LOCUS_00670 59232 60089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 60086 60985 gene locus_tag LOCUS_00680 60086 60985 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693559.1 protein_id gnl|my_center|LOCUS_00680 62294 61026 gene locus_tag LOCUS_00690 62294 61026 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_00690 62370 63797 gene locus_tag LOCUS_00700 gene guaB 62370 63797 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583116.1 protein_id gnl|my_center|LOCUS_00700 63839 65035 gene locus_tag LOCUS_00710 63839 65035 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880177.1 protein_id gnl|my_center|LOCUS_00710 65079 65375 gene locus_tag LOCUS_00720 65079 65375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 65394 66170 gene locus_tag LOCUS_00730 65394 66170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 66420 67583 gene locus_tag LOCUS_00740 66420 67583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 67641 67877 gene locus_tag LOCUS_00750 67641 67877 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_00750 67894 68070 gene locus_tag LOCUS_00760 67894 68070 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869521.1 protein_id gnl|my_center|LOCUS_00760 68101 68397 gene locus_tag LOCUS_00770 68101 68397 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_00770 68732 68415 gene locus_tag LOCUS_00780 68732 68415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 68851 69066 gene locus_tag LOCUS_00790 68851 69066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 69240 70244 gene locus_tag LOCUS_00800 69240 70244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 70767 70683 gene locus_tag LOCUS_t00030 70767 70683 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 71205 70825 gene locus_tag LOCUS_00810 71205 70825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 71533 71288 gene locus_tag LOCUS_00820 71533 71288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 72192 72407 gene locus_tag LOCUS_00830 72192 72407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 72448 73410 gene locus_tag LOCUS_00840 72448 73410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 74062 73679 gene locus_tag LOCUS_00850 74062 73679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 74301 74636 gene locus_tag LOCUS_00860 74301 74636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 74721 76496 gene locus_tag LOCUS_00870 74721 76496 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_00870 76631 76704 gene locus_tag LOCUS_t00040 76631 76704 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 77674 76811 gene locus_tag LOCUS_00880 77674 76811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 77984 77814 gene locus_tag LOCUS_00890 77984 77814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 78130 77981 gene locus_tag LOCUS_00900 78130 77981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 79594 78449 gene locus_tag LOCUS_00910 79594 78449 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257896.1 protein_id gnl|my_center|LOCUS_00910 81220 79901 gene locus_tag LOCUS_00920 81220 79901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 82914 83411 gene locus_tag LOCUS_00930 82914 83411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 83402 84196 gene locus_tag LOCUS_00940 83402 84196 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890439.1 protein_id gnl|my_center|LOCUS_00940 84533 84201 gene locus_tag LOCUS_00950 84533 84201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 84769 86535 gene locus_tag LOCUS_00960 84769 86535 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060928.1 protein_id gnl|my_center|LOCUS_00960 86532 87467 gene locus_tag LOCUS_00970 86532 87467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 87464 88738 gene locus_tag LOCUS_00980 87464 88738 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_00980 88906 89565 gene locus_tag LOCUS_00990 88906 89565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 89568 90662 gene locus_tag LOCUS_01000 89568 90662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 90665 93691 gene locus_tag LOCUS_01010 90665 93691 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876573.1 protein_id gnl|my_center|LOCUS_01010 93684 94247 gene locus_tag LOCUS_01020 93684 94247 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879203.1 protein_id gnl|my_center|LOCUS_01020 94469 94726 gene locus_tag LOCUS_01030 94469 94726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 96583 94853 gene locus_tag LOCUS_01040 96583 94853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 98102 96708 gene locus_tag LOCUS_01050 98102 96708 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060924.1 protein_id gnl|my_center|LOCUS_01050 98983 98099 gene locus_tag LOCUS_01060 98983 98099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 99411 98989 gene locus_tag LOCUS_01070 99411 98989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 100788 99733 gene locus_tag LOCUS_01080 100788 99733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 101144 101848 gene locus_tag LOCUS_01090 101144 101848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 101854 102015 gene locus_tag LOCUS_01100 101854 102015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 102312 102875 gene locus_tag LOCUS_01110 102312 102875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 104060 104632 gene locus_tag LOCUS_01120 104060 104632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 104917 106131 gene locus_tag LOCUS_01130 104917 106131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 106365 106886 gene locus_tag LOCUS_01140 106365 106886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 107080 107526 gene locus_tag LOCUS_01150 107080 107526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 108372 107542 gene locus_tag LOCUS_01160 108372 107542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 108944 111619 gene locus_tag LOCUS_01170 108944 111619 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_01170 111827 112042 gene locus_tag LOCUS_01180 111827 112042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 112166 112705 gene locus_tag LOCUS_01190 112166 112705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 112757 113638 gene locus_tag LOCUS_01200 112757 113638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 113638 114285 gene locus_tag LOCUS_01210 113638 114285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 114363 115349 gene locus_tag LOCUS_01220 114363 115349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 115664 115377 gene locus_tag LOCUS_01230 115664 115377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 115770 116000 gene locus_tag LOCUS_01240 115770 116000 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_01240 116160 118787 gene locus_tag LOCUS_01250 116160 118787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 118836 120086 gene locus_tag LOCUS_01260 118836 120086 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023306.1 protein_id gnl|my_center|LOCUS_01260 120131 120679 gene locus_tag LOCUS_01270 120131 120679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 120705 121331 gene locus_tag LOCUS_01280 120705 121331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_01280 121629 122801 gene locus_tag LOCUS_01290 121629 122801 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436139.1 protein_id gnl|my_center|LOCUS_01290 122802 124376 gene locus_tag LOCUS_01300 122802 124376 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931808.1 protein_id gnl|my_center|LOCUS_01300 124373 124936 gene locus_tag LOCUS_01310 124373 124936 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_01310 126248 124953 gene locus_tag LOCUS_01320 126248 124953 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_01320 127458 126337 gene locus_tag LOCUS_01330 127458 126337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 127640 128209 gene locus_tag LOCUS_01340 gene satP 127640 128209 CDS product acetate uptake transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528527.1 protein_id gnl|my_center|LOCUS_01340 128268 129590 gene locus_tag LOCUS_01350 128268 129590 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_01350 129680 130843 gene locus_tag LOCUS_01360 129680 130843 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_01360 130930 131991 gene locus_tag LOCUS_01370 130930 131991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 132070 134163 gene locus_tag LOCUS_01380 132070 134163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 134168 134557 gene locus_tag LOCUS_01390 134168 134557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 134544 135050 gene locus_tag LOCUS_01400 134544 135050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 135047 135466 gene locus_tag LOCUS_01410 135047 135466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 135467 136339 gene locus_tag LOCUS_01420 135467 136339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 136395 138293 gene locus_tag LOCUS_01430 136395 138293 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_01430 138294 139184 gene locus_tag LOCUS_01440 138294 139184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 139181 140209 gene locus_tag LOCUS_01450 139181 140209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 140285 140734 gene locus_tag LOCUS_01460 140285 140734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 140817 141290 gene locus_tag LOCUS_01470 140817 141290 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_01470 141844 141296 gene locus_tag LOCUS_01480 141844 141296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 142016 143620 gene locus_tag LOCUS_01490 142016 143620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 143957 144284 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgcagagcttgaaatcatggaacaaggaatgcaac >Feature sequence02 828 49 gene locus_tag LOCUS_01500 828 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 1326 847 gene locus_tag LOCUS_01510 1326 847 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867651.1 protein_id gnl|my_center|LOCUS_01510 1561 1331 gene locus_tag LOCUS_01520 1561 1331 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875673.1 protein_id gnl|my_center|LOCUS_01520 2060 1554 gene locus_tag LOCUS_01530 2060 1554 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_01530 2385 2062 gene locus_tag LOCUS_01540 2385 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2844 2386 gene locus_tag LOCUS_01550 2844 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4253 2850 gene locus_tag LOCUS_01560 gene secY 4253 2850 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869979.1 protein_id gnl|my_center|LOCUS_01560 4735 4253 gene locus_tag LOCUS_01570 4735 4253 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_01570 5207 4746 gene locus_tag LOCUS_01580 gene rpmD 5207 4746 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_01580 5899 5204 gene locus_tag LOCUS_01590 gene rpsE 5899 5204 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192961070.1 protein_id gnl|my_center|LOCUS_01590 6475 5900 gene locus_tag LOCUS_01600 6475 5900 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 protein_id gnl|my_center|LOCUS_01600 6924 6481 gene locus_tag LOCUS_01610 6924 6481 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763590.1 protein_id gnl|my_center|LOCUS_01610 7556 6936 gene locus_tag LOCUS_01620 7556 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 8106 7549 gene locus_tag LOCUS_01630 8106 7549 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_01630 8507 8115 gene locus_tag LOCUS_01640 8507 8115 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_01640 8679 8521 gene locus_tag LOCUS_01650 8679 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 9169 8663 gene locus_tag LOCUS_01660 9169 8663 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_01660 9866 9174 gene locus_tag LOCUS_01670 9866 9174 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_01670 10238 9867 gene locus_tag LOCUS_01680 gene rplX 10238 9867 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869967.1 protein_id gnl|my_center|LOCUS_01680 10647 10249 gene locus_tag LOCUS_01690 10647 10249 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_01690 10940 10644 gene locus_tag LOCUS_01700 10940 10644 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_01700 11233 10937 gene locus_tag LOCUS_01710 11233 10937 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_01710 11546 11244 gene locus_tag LOCUS_01720 gene yciH 11546 11244 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_01720 11800 11546 gene locus_tag LOCUS_01730 11800 11546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 12717 11797 gene locus_tag LOCUS_01740 12717 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 13188 12718 gene locus_tag LOCUS_01750 gene rplV 13188 12718 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875649.1 protein_id gnl|my_center|LOCUS_01750 13594 13190 gene locus_tag LOCUS_01760 gene rpsS 13594 13190 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_01760 14318 13599 gene locus_tag LOCUS_01770 14318 13599 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867461.1 protein_id gnl|my_center|LOCUS_01770 14613 14329 gene locus_tag LOCUS_01780 14613 14329 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_01780 15395 14610 gene locus_tag LOCUS_01790 gene rpl4p 15395 14610 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_01790 16404 15403 gene locus_tag LOCUS_01800 gene rpl3p 16404 15403 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_01800 17789 16599 gene locus_tag LOCUS_01810 17789 16599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 18977 17871 gene locus_tag LOCUS_01820 18977 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 19247 20023 gene locus_tag LOCUS_01830 19247 20023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 21494 20046 gene locus_tag LOCUS_01840 21494 20046 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_01840 21916 21497 gene locus_tag LOCUS_01850 21916 21497 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_01850 22372 21926 gene locus_tag LOCUS_01860 gene rpiB 22372 21926 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721284.1 protein_id gnl|my_center|LOCUS_01860 23193 22402 gene locus_tag LOCUS_01870 23193 22402 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963745.1 protein_id gnl|my_center|LOCUS_01870 23911 23216 gene locus_tag LOCUS_01880 23911 23216 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_01880 25597 23912 gene locus_tag LOCUS_01890 25597 23912 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_01890 27650 25623 gene locus_tag LOCUS_01900 27650 25623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 28109 28669 gene locus_tag LOCUS_01910 28109 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 28657 29058 gene locus_tag LOCUS_01920 28657 29058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29136 30971 gene locus_tag LOCUS_01930 29136 30971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 31088 32053 gene locus_tag LOCUS_01940 31088 32053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 32198 34054 gene locus_tag LOCUS_01950 32198 34054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 35086 34049 gene locus_tag LOCUS_01960 35086 34049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 36548 35103 gene locus_tag LOCUS_01970 gene hxsB 36548 35103 CDS product His-Xaa-Ser system radical SAM maturase HxsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479204.1 protein_id gnl|my_center|LOCUS_01970 37466 36627 gene locus_tag LOCUS_01980 37466 36627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 37656 38573 gene locus_tag LOCUS_01990 37656 38573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 38579 39028 gene locus_tag LOCUS_02000 38579 39028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 39883 39035 gene locus_tag LOCUS_02010 39883 39035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 40199 39963 gene locus_tag LOCUS_02020 40199 39963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 40698 40186 gene locus_tag LOCUS_02030 40698 40186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 41234 41031 gene locus_tag LOCUS_02040 41234 41031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 42542 41277 gene locus_tag LOCUS_02050 gene tuf 42542 41277 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_02050 44863 42671 gene locus_tag LOCUS_02060 44863 42671 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_02060 45488 44886 gene locus_tag LOCUS_02070 gene rpsG 45488 44886 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867744.1 protein_id gnl|my_center|LOCUS_02070 45921 45493 gene locus_tag LOCUS_02080 45921 45493 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_02080 46328 45927 gene locus_tag LOCUS_02090 46328 45927 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_02090 46646 46344 gene locus_tag LOCUS_02100 46646 46344 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870557.1 protein_id gnl|my_center|LOCUS_02100 47872 46652 gene locus_tag LOCUS_02110 gene rpoA2 47872 46652 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876678.1 protein_id gnl|my_center|LOCUS_02110 50481 47872 gene locus_tag LOCUS_02120 50481 47872 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_02120 52308 50491 gene locus_tag LOCUS_02130 gene rpoB 52308 50491 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 protein_id gnl|my_center|LOCUS_02130 53782 52316 gene locus_tag LOCUS_02140 53782 52316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02140 54009 53779 gene locus_tag LOCUS_02150 54009 53779 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762458.1 protein_id gnl|my_center|LOCUS_02150 54525 54193 gene locus_tag LOCUS_02160 54525 54193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 54778 55884 gene locus_tag LOCUS_02170 54778 55884 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_02170 56337 55897 gene locus_tag LOCUS_02180 56337 55897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 57140 56397 gene locus_tag LOCUS_02190 57140 56397 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_02190 57331 57152 gene locus_tag LOCUS_02200 57331 57152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 57789 58907 gene locus_tag LOCUS_02210 57789 58907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 60156 58888 gene locus_tag LOCUS_02220 60156 58888 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870788.1 protein_id gnl|my_center|LOCUS_02220 60397 60305 gene locus_tag LOCUS_t00050 60397 60305 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61287 60475 gene locus_tag LOCUS_02230 61287 60475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 61856 61401 gene locus_tag LOCUS_02240 61856 61401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 62442 61861 gene locus_tag LOCUS_02250 62442 61861 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867383.1 protein_id gnl|my_center|LOCUS_02250 63114 62491 gene locus_tag LOCUS_02260 63114 62491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 63228 63156 gene locus_tag LOCUS_t00060 63228 63156 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 63407 63949 gene locus_tag LOCUS_02270 63407 63949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 64415 64020 gene locus_tag LOCUS_02280 64415 64020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 64577 65053 gene locus_tag LOCUS_02290 64577 65053 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454132.1 protein_id gnl|my_center|LOCUS_02290 65367 65729 gene locus_tag LOCUS_02300 65367 65729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 65893 66285 gene locus_tag LOCUS_02310 65893 66285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 66285 66449 gene locus_tag LOCUS_02320 66285 66449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 66436 66837 gene locus_tag LOCUS_02330 66436 66837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 66843 67379 gene locus_tag LOCUS_02340 66843 67379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 67459 67926 gene locus_tag LOCUS_02350 67459 67926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 68012 68296 gene locus_tag LOCUS_02360 68012 68296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 68293 68763 gene locus_tag LOCUS_02370 68293 68763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 68805 69212 gene locus_tag LOCUS_02380 68805 69212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 69209 69826 gene locus_tag LOCUS_02390 69209 69826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 69828 70265 gene locus_tag LOCUS_02400 69828 70265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 70275 71429 gene locus_tag LOCUS_02410 70275 71429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 71440 71568 gene locus_tag LOCUS_02420 71440 71568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 71565 71831 gene locus_tag LOCUS_02430 71565 71831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 72882 72022 gene locus_tag LOCUS_02440 72882 72022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 72947 73147 gene locus_tag LOCUS_02450 72947 73147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 73257 73183 gene locus_tag LOCUS_t00070 73257 73183 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 73571 73497 gene locus_tag LOCUS_t00080 73571 73497 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 74322 73627 gene locus_tag LOCUS_02460 gene rpiA 74322 73627 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722798.1 protein_id gnl|my_center|LOCUS_02460 75760 74501 gene locus_tag LOCUS_02470 gene hisS 75760 74501 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425978.1 protein_id gnl|my_center|LOCUS_02470 75848 75776 gene locus_tag LOCUS_t00090 75848 75776 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 76028 76165 gene locus_tag LOCUS_02480 76028 76165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 76811 76158 gene locus_tag LOCUS_02490 76811 76158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 78360 76885 gene locus_tag LOCUS_02500 78360 76885 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867494.1 protein_id gnl|my_center|LOCUS_02500 79725 79459 gene locus_tag LOCUS_02510 79725 79459 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_02510 79944 79726 gene locus_tag LOCUS_02520 79944 79726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 80192 80108 gene locus_tag LOCUS_t00100 80192 80108 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 80675 80220 gene locus_tag LOCUS_02530 80675 80220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 81864 80908 gene locus_tag LOCUS_02540 81864 80908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 82774 81869 gene locus_tag LOCUS_02550 gene map 82774 81869 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_02550 85172 82791 gene locus_tag LOCUS_02560 85172 82791 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_02560 85340 85834 gene locus_tag LOCUS_02570 85340 85834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 87346 85838 gene locus_tag LOCUS_02580 87346 85838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 87488 88159 gene locus_tag LOCUS_02590 87488 88159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 88507 88166 gene locus_tag LOCUS_02600 88507 88166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 88825 88517 gene locus_tag LOCUS_02610 88825 88517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 89097 88834 gene locus_tag LOCUS_02620 89097 88834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 89468 89142 gene locus_tag LOCUS_02630 89468 89142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 89901 89473 gene locus_tag LOCUS_02640 89901 89473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 96920 89958 gene locus_tag LOCUS_02650 96920 89958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 104452 96950 gene locus_tag LOCUS_02660 104452 96950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 111699 104524 gene locus_tag LOCUS_02670 111699 104524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 113656 111905 gene locus_tag LOCUS_02680 113656 111905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 122092 113678 gene locus_tag LOCUS_02690 122092 113678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 122732 122187 gene locus_tag LOCUS_02700 122732 122187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 122936 125206 gene locus_tag LOCUS_02710 122936 125206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 125212 127731 gene locus_tag LOCUS_02720 125212 127731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 127731 128180 gene locus_tag LOCUS_02730 127731 128180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 128326 128658 gene locus_tag LOCUS_02740 128326 128658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 128610 128843 gene locus_tag LOCUS_02750 128610 128843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 129039 129212 gene locus_tag LOCUS_02760 129039 129212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 129224 129784 gene locus_tag LOCUS_02770 129224 129784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 129781 130410 gene locus_tag LOCUS_02780 129781 130410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 130413 130910 gene locus_tag LOCUS_02790 130413 130910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 130901 131662 gene locus_tag LOCUS_02800 130901 131662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 132380 131700 gene locus_tag LOCUS_02810 132380 131700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 132481 132993 gene locus_tag LOCUS_02820 132481 132993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence03 5826 1792 gene locus_tag LOCUS_02830 5826 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 8167 6008 gene locus_tag LOCUS_02840 8167 6008 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_02840 8870 8238 gene locus_tag LOCUS_02850 8870 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 8975 9325 gene locus_tag LOCUS_02860 8975 9325 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_02860 10679 9327 gene locus_tag LOCUS_02870 10679 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10898 11626 gene locus_tag LOCUS_02880 10898 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 11726 12373 gene locus_tag LOCUS_02890 gene psmB 11726 12373 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250380.1 protein_id gnl|my_center|LOCUS_02890 12435 14327 gene locus_tag LOCUS_02900 12435 14327 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_02900 14589 14732 gene locus_tag LOCUS_02910 14589 14732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 14833 15327 gene locus_tag LOCUS_02920 14833 15327 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249293.1 protein_id gnl|my_center|LOCUS_02920 15324 16562 gene locus_tag LOCUS_02930 15324 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 16667 17800 gene locus_tag LOCUS_02940 16667 17800 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_02940 18984 18628 gene locus_tag LOCUS_02950 18984 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 19172 19657 gene locus_tag LOCUS_02960 19172 19657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 20655 19654 gene locus_tag LOCUS_02970 20655 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 20704 21549 gene locus_tag LOCUS_02980 20704 21549 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867130.1 protein_id gnl|my_center|LOCUS_02980 22566 21574 gene locus_tag LOCUS_02990 gene fni 22566 21574 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250421.1 protein_id gnl|my_center|LOCUS_02990 23343 22588 gene locus_tag LOCUS_03000 23343 22588 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_03000 24140 23343 gene locus_tag LOCUS_03010 24140 23343 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_03010 24523 24137 gene locus_tag LOCUS_03020 24523 24137 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_03020 25692 24520 gene locus_tag LOCUS_03030 25692 24520 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_03030 26332 25697 gene locus_tag LOCUS_03040 26332 25697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 27630 26329 gene locus_tag LOCUS_03050 27630 26329 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_03050 28181 27627 gene locus_tag LOCUS_03060 28181 27627 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_03060 29117 28185 gene locus_tag LOCUS_03070 29117 28185 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_03070 29594 29193 gene locus_tag LOCUS_03080 29594 29193 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_03080 30763 29591 gene locus_tag LOCUS_03090 30763 29591 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_03090 31819 30773 gene locus_tag LOCUS_03100 31819 30773 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_03100 33054 31816 gene locus_tag LOCUS_03110 33054 31816 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_03110 33222 33938 gene locus_tag LOCUS_03120 33222 33938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 34024 35490 gene locus_tag LOCUS_03130 34024 35490 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_03130 35564 36340 gene locus_tag LOCUS_03140 35564 36340 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_03140 36571 39231 gene locus_tag LOCUS_03150 gene ppdK 36571 39231 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392144.1 protein_id gnl|my_center|LOCUS_03150 39239 40255 gene locus_tag LOCUS_03160 39239 40255 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_03160 41318 40260 gene locus_tag LOCUS_03170 41318 40260 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920597.1 protein_id gnl|my_center|LOCUS_03170 41417 42733 gene locus_tag LOCUS_03180 41417 42733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 43026 43598 gene locus_tag LOCUS_03190 gene coaE 43026 43598 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_03190 43591 44091 gene locus_tag LOCUS_03200 gene coaD 43591 44091 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200601.1 protein_id gnl|my_center|LOCUS_03200 44458 44066 gene locus_tag LOCUS_03210 44458 44066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 44579 45574 gene locus_tag LOCUS_03220 44579 45574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 45631 46359 gene locus_tag LOCUS_03230 45631 46359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 46370 46801 gene locus_tag LOCUS_03240 46370 46801 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_03240 46850 47812 gene locus_tag LOCUS_03250 gene galT 46850 47812 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_03250 47818 49188 gene locus_tag LOCUS_03260 47818 49188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 49290 50282 gene locus_tag LOCUS_03270 gene gap 49290 50282 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_03270 50288 51499 gene locus_tag LOCUS_03280 gene pgk 50288 51499 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_03280 51596 52759 gene locus_tag LOCUS_03290 51596 52759 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_03290 52752 53957 gene locus_tag LOCUS_03300 52752 53957 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_03300 55753 53918 gene locus_tag LOCUS_03310 55753 53918 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_03310 55985 57733 gene locus_tag LOCUS_03320 55985 57733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 57780 58979 gene locus_tag LOCUS_03330 57780 58979 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250039.1 protein_id gnl|my_center|LOCUS_03330 59019 60152 gene locus_tag LOCUS_03340 59019 60152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 60402 60178 gene locus_tag LOCUS_03350 60402 60178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 60554 60808 gene locus_tag LOCUS_03360 60554 60808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 61411 60815 gene locus_tag LOCUS_03370 61411 60815 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_03370 61456 61920 gene locus_tag LOCUS_03380 61456 61920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 61954 65367 gene locus_tag LOCUS_03390 61954 65367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 66775 65588 gene locus_tag LOCUS_03400 66775 65588 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_03400 67126 66860 gene locus_tag LOCUS_03410 67126 66860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 67255 68094 gene locus_tag LOCUS_03420 gene xerA 67255 68094 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_03420 68252 68506 gene locus_tag LOCUS_03430 68252 68506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 68806 69264 gene locus_tag LOCUS_03440 68806 69264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 69705 69265 gene locus_tag LOCUS_03450 69705 69265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 70144 70069 gene locus_tag LOCUS_t00110 70144 70069 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 70876 70343 gene locus_tag LOCUS_03460 gene tfe 70876 70343 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 protein_id gnl|my_center|LOCUS_03460 71438 70923 gene locus_tag LOCUS_03470 71438 70923 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_03470 71513 72769 gene locus_tag LOCUS_03480 gene serS 71513 72769 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_03480 72843 72917 gene locus_tag LOCUS_t00120 72843 72917 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 72985 73058 gene locus_tag LOCUS_t00130 72985 73058 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 73804 73064 gene locus_tag LOCUS_03490 73804 73064 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_03490 75714 73852 gene locus_tag LOCUS_03500 75714 73852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 75807 76484 gene locus_tag LOCUS_03510 gene tpiA 75807 76484 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_03510 76486 76830 gene locus_tag LOCUS_03520 76486 76830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 77363 77127 gene locus_tag LOCUS_03530 77363 77127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 79044 77860 gene locus_tag LOCUS_03540 79044 77860 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680038.1 protein_id gnl|my_center|LOCUS_03540 79151 80140 gene locus_tag LOCUS_03550 gene tdh 79151 80140 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_03550 81101 80157 gene locus_tag LOCUS_03560 gene radA 81101 80157 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_03560 82518 81166 gene locus_tag LOCUS_03570 82518 81166 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_03570 82562 83221 gene locus_tag LOCUS_03580 82562 83221 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_03580 83240 84031 gene locus_tag LOCUS_03590 83240 84031 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_03590 84933 84028 gene locus_tag LOCUS_03600 84933 84028 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_03600 86016 84955 gene locus_tag LOCUS_03610 gene ribD 86016 84955 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071741110.1 protein_id gnl|my_center|LOCUS_03610 86151 87095 gene locus_tag LOCUS_03620 86151 87095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 87266 87006 gene locus_tag LOCUS_03630 87266 87006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 87290 89338 gene locus_tag LOCUS_03640 87290 89338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 89460 90014 gene locus_tag LOCUS_03650 89460 90014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 90024 90344 gene locus_tag LOCUS_03660 90024 90344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 90350 90550 gene locus_tag LOCUS_03670 90350 90550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 90556 90972 gene locus_tag LOCUS_03680 90556 90972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 90981 91637 gene locus_tag LOCUS_03690 90981 91637 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868639.1 protein_id gnl|my_center|LOCUS_03690 91660 91839 gene locus_tag LOCUS_03700 gene rpl18a 91660 91839 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879556.1 protein_id gnl|my_center|LOCUS_03700 91868 92317 gene locus_tag LOCUS_03710 91868 92317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 92327 93511 gene locus_tag LOCUS_03720 gene ftsY 92327 93511 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_03720 94175 93567 gene locus_tag LOCUS_03730 94175 93567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 95867 94269 gene locus_tag LOCUS_03740 95867 94269 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_03740 96007 97362 gene locus_tag LOCUS_03750 96007 97362 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_03750 97367 98200 gene locus_tag LOCUS_03760 97367 98200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 98486 98130 gene locus_tag LOCUS_03770 98486 98130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 98581 98510 gene locus_tag LOCUS_t00140 98581 98510 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 98661 99284 gene locus_tag LOCUS_03780 gene tmk 98661 99284 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_03780 99336 100295 gene locus_tag LOCUS_03790 99336 100295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 100367 100297 gene locus_tag LOCUS_t00150 100367 100297 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 100634 101047 gene locus_tag LOCUS_03800 100634 101047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 102285 101044 gene locus_tag LOCUS_03810 gene dnaG 102285 101044 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_03810 102636 102340 gene locus_tag LOCUS_03820 102636 102340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 102791 103204 gene locus_tag LOCUS_03830 gene hjc 102791 103204 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_03830 103814 103194 gene locus_tag LOCUS_03840 103814 103194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 104460 103816 gene locus_tag LOCUS_03850 104460 103816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 104852 104499 gene locus_tag LOCUS_03860 gene pth2 104852 104499 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_03860 104951 106708 gene locus_tag LOCUS_03870 104951 106708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 106785 108332 gene locus_tag LOCUS_03880 106785 108332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 108938 108336 gene locus_tag LOCUS_03890 108938 108336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 109109 108951 gene locus_tag LOCUS_03900 109109 108951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 109292 109573 gene locus_tag LOCUS_03910 109292 109573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence04 102 2765 gene locus_tag LOCUS_03920 102 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2817 3812 gene locus_tag LOCUS_03930 gene dph2 2817 3812 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_03930 4621 3818 gene locus_tag LOCUS_03940 gene pyrH 4621 3818 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 protein_id gnl|my_center|LOCUS_03940 4732 5955 gene locus_tag LOCUS_03950 gene prf1 4732 5955 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146580.1 protein_id gnl|my_center|LOCUS_03950 5966 7204 gene locus_tag LOCUS_03960 gene truD 5966 7204 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_03960 7259 8224 gene locus_tag LOCUS_03970 7259 8224 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_03970 8761 8916 gene locus_tag LOCUS_03980 8761 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 9813 9187 gene locus_tag LOCUS_03990 9813 9187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12868 9893 gene locus_tag LOCUS_04000 12868 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13743 13102 gene locus_tag LOCUS_04010 13743 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 13890 14219 gene locus_tag LOCUS_04020 13890 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 15154 14222 gene locus_tag LOCUS_04030 gene amrS 15154 14222 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_04030 15341 16612 gene locus_tag LOCUS_04040 15341 16612 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867749.1 protein_id gnl|my_center|LOCUS_04040 17390 16614 gene locus_tag LOCUS_04050 17390 16614 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_04050 18179 17400 gene locus_tag LOCUS_04060 18179 17400 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496399.1 protein_id gnl|my_center|LOCUS_04060 18385 18191 gene locus_tag LOCUS_04070 18385 18191 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_04070 18991 18452 gene locus_tag LOCUS_04080 18991 18452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249491.1 protein_id gnl|my_center|LOCUS_04080 20255 18981 gene locus_tag LOCUS_04090 gene priS 20255 18981 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_04090 21273 20245 gene locus_tag LOCUS_04100 gene priL 21273 20245 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_04100 22065 21343 gene locus_tag LOCUS_04110 22065 21343 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868494.1 protein_id gnl|my_center|LOCUS_04110 22959 22165 gene locus_tag LOCUS_04120 22959 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 23038 23982 gene locus_tag LOCUS_04130 gene ilvA 23038 23982 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_04130 23986 24861 gene locus_tag LOCUS_04140 23986 24861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 25691 24945 gene locus_tag LOCUS_04150 gene pcn 25691 24945 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 protein_id gnl|my_center|LOCUS_04150 26073 25723 gene locus_tag LOCUS_04160 26073 25723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 26985 26083 gene locus_tag LOCUS_04170 26985 26083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 27535 26963 gene locus_tag LOCUS_04180 27535 26963 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_04180 27822 27547 gene locus_tag LOCUS_04190 27822 27547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 28396 27836 gene locus_tag LOCUS_04200 28396 27836 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_04200 28534 29517 gene locus_tag LOCUS_04210 28534 29517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 30484 29525 gene locus_tag LOCUS_04220 30484 29525 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 protein_id gnl|my_center|LOCUS_04220 30622 31860 gene locus_tag LOCUS_04230 30622 31860 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_04230 33828 31861 gene locus_tag LOCUS_04240 gene lonB 33828 31861 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250215.1 protein_id gnl|my_center|LOCUS_04240 33898 34812 gene locus_tag LOCUS_04250 gene rnz 33898 34812 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_04250 34817 35515 gene locus_tag LOCUS_04260 34817 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 36327 35641 gene locus_tag LOCUS_04270 36327 35641 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 protein_id gnl|my_center|LOCUS_04270 36477 37274 gene locus_tag LOCUS_04280 36477 37274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 37799 37290 gene locus_tag LOCUS_04290 37799 37290 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_04290 37881 39323 gene locus_tag LOCUS_04300 37881 39323 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249872.1 protein_id gnl|my_center|LOCUS_04300 39327 40961 gene locus_tag LOCUS_04310 gene pheT 39327 40961 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249876.1 protein_id gnl|my_center|LOCUS_04310 42415 40958 gene locus_tag LOCUS_04320 42415 40958 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_04320 43567 42581 gene locus_tag LOCUS_04330 43567 42581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 43850 45037 gene locus_tag LOCUS_04340 43850 45037 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_04340 46170 45055 gene locus_tag LOCUS_04350 46170 45055 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877755.1 protein_id gnl|my_center|LOCUS_04350 46298 46492 gene locus_tag LOCUS_04360 46298 46492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 47415 46555 gene locus_tag LOCUS_04370 47415 46555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 47473 48042 gene locus_tag LOCUS_04380 47473 48042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 48039 48383 gene locus_tag LOCUS_04390 48039 48383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 48361 48828 gene locus_tag LOCUS_04400 48361 48828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 48829 49179 gene locus_tag LOCUS_04410 48829 49179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 49593 49162 gene locus_tag LOCUS_04420 49593 49162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 49784 49590 gene locus_tag LOCUS_04430 49784 49590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 49878 50474 gene locus_tag LOCUS_04440 49878 50474 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870115.1 protein_id gnl|my_center|LOCUS_04440 52660 50486 gene locus_tag LOCUS_04450 52660 50486 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_04450 53523 52720 gene locus_tag LOCUS_04460 53523 52720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 54059 53523 gene locus_tag LOCUS_04470 54059 53523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 55170 54313 gene locus_tag LOCUS_04480 55170 54313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 57218 55176 gene locus_tag LOCUS_04490 57218 55176 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_04490 57293 58513 gene locus_tag LOCUS_04500 57293 58513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 58983 58510 gene locus_tag LOCUS_04510 58983 58510 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_04510 59847 59056 gene locus_tag LOCUS_04520 59847 59056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 61285 60014 gene locus_tag LOCUS_04530 61285 60014 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876459.1 protein_id gnl|my_center|LOCUS_04530 61427 61756 gene locus_tag LOCUS_04540 61427 61756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 62210 61842 gene locus_tag LOCUS_04550 62210 61842 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250876.1 protein_id gnl|my_center|LOCUS_04550 62814 62251 gene locus_tag LOCUS_04560 gene pdxT 62814 62251 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081494.1 protein_id gnl|my_center|LOCUS_04560 63740 62829 gene locus_tag LOCUS_04570 gene pdxS 63740 62829 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583836.1 protein_id gnl|my_center|LOCUS_04570 63873 64832 gene locus_tag LOCUS_04580 63873 64832 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_04580 64867 65571 gene locus_tag LOCUS_04590 64867 65571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 66575 65568 gene locus_tag LOCUS_04600 66575 65568 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_04600 66944 68680 gene locus_tag LOCUS_04610 gene thrS 66944 68680 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393260.1 protein_id gnl|my_center|LOCUS_04610 68745 70697 gene locus_tag LOCUS_04620 68745 70697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 70700 71878 gene locus_tag LOCUS_04630 70700 71878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 71889 72809 gene locus_tag LOCUS_04640 71889 72809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 72813 72968 gene locus_tag LOCUS_04650 72813 72968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 72985 73269 gene locus_tag LOCUS_04660 72985 73269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 73315 73497 gene locus_tag LOCUS_04670 73315 73497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 73485 73688 gene locus_tag LOCUS_04680 73485 73688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 73705 74832 gene locus_tag LOCUS_04690 73705 74832 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876060.1 protein_id gnl|my_center|LOCUS_04690 74814 75335 gene locus_tag LOCUS_04700 74814 75335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 75319 75699 gene locus_tag LOCUS_04710 75319 75699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 77805 75700 gene locus_tag LOCUS_04720 77805 75700 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_04720 78056 78637 gene locus_tag LOCUS_04730 78056 78637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 78846 80327 gene locus_tag LOCUS_04740 gene metG 78846 80327 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_04740 80382 80954 gene locus_tag LOCUS_04750 80382 80954 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_04750 80986 81870 gene locus_tag LOCUS_04760 gene htpX 80986 81870 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_04760 83397 82291 gene locus_tag LOCUS_04770 83397 82291 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869891.1 protein_id gnl|my_center|LOCUS_04770 84139 83471 gene locus_tag LOCUS_04780 84139 83471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 84956 84273 gene locus_tag LOCUS_04790 84956 84273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 85370 85062 gene locus_tag LOCUS_04800 85370 85062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 85708 85418 gene locus_tag LOCUS_04810 85708 85418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 86116 85721 gene locus_tag LOCUS_04820 gene eif5A 86116 85721 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_04820 86236 86733 gene locus_tag LOCUS_04830 86236 86733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 86810 87625 gene locus_tag LOCUS_04840 86810 87625 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_04840 87622 87840 gene locus_tag LOCUS_04850 87622 87840 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_04850 88008 87934 gene locus_tag LOCUS_t00160 88008 87934 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 88375 90882 gene locus_tag LOCUS_04860 88375 90882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 90995 90922 gene locus_tag LOCUS_t00170 90995 90922 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 92056 91043 gene locus_tag LOCUS_04870 92056 91043 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_04870 92168 92749 gene locus_tag LOCUS_04880 92168 92749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 92788 93828 gene locus_tag LOCUS_04890 gene mtnA 92788 93828 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_04890 93828 94424 gene locus_tag LOCUS_04900 93828 94424 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545581.1 protein_id gnl|my_center|LOCUS_04900 94414 94932 gene locus_tag LOCUS_04910 94414 94932 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_04910 94933 95499 gene locus_tag LOCUS_04920 94933 95499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 95551 95883 gene locus_tag LOCUS_04930 95551 95883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 95874 97061 gene locus_tag LOCUS_04940 95874 97061 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250738.1 protein_id gnl|my_center|LOCUS_04940 97123 97503 gene locus_tag LOCUS_04950 97123 97503 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250213.1 protein_id gnl|my_center|LOCUS_04950 97485 98729 gene locus_tag LOCUS_04960 97485 98729 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871137.1 protein_id gnl|my_center|LOCUS_04960 98756 99175 gene locus_tag LOCUS_04970 98756 99175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 99180 99689 gene locus_tag LOCUS_04980 99180 99689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 99686 99976 gene locus_tag LOCUS_04990 99686 99976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 99976 100446 gene locus_tag LOCUS_05000 99976 100446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 <100957 100443 gene locus_tag LOCUS_05010 <100957 100443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060813.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence05 3345 58 gene locus_tag LOCUS_05020 3345 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3878 3351 gene locus_tag LOCUS_05030 3878 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4597 4001 gene locus_tag LOCUS_05040 4597 4001 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_05040 4745 5905 gene locus_tag LOCUS_05050 gene metK 4745 5905 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_05050 5983 6405 gene locus_tag LOCUS_05060 5983 6405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6459 7124 gene locus_tag LOCUS_05070 6459 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7129 8280 gene locus_tag LOCUS_05080 7129 8280 CDS product TraB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656981.1 protein_id gnl|my_center|LOCUS_05080 8959 8288 gene locus_tag LOCUS_05090 8959 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 9327 9001 gene locus_tag LOCUS_05100 9327 9001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 10006 9353 gene locus_tag LOCUS_05110 10006 9353 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257309.1 protein_id gnl|my_center|LOCUS_05110 11708 10011 gene locus_tag LOCUS_05120 gene pyrG 11708 10011 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867477.1 protein_id gnl|my_center|LOCUS_05120 11857 12153 gene locus_tag LOCUS_05130 11857 12153 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147167.1 protein_id gnl|my_center|LOCUS_05130 12173 12763 gene locus_tag LOCUS_05140 12173 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 12763 12939 gene locus_tag LOCUS_05150 12763 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 13236 13799 gene locus_tag LOCUS_05160 13236 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 13799 15160 gene locus_tag LOCUS_05170 13799 15160 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_05170 15210 16415 gene locus_tag LOCUS_05180 15210 16415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 16878 16510 gene locus_tag LOCUS_05190 16878 16510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 17090 16878 gene locus_tag LOCUS_05200 17090 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 17863 17129 gene locus_tag LOCUS_05210 17863 17129 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_05210 17962 19002 gene locus_tag LOCUS_05220 17962 19002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 19237 19530 gene locus_tag LOCUS_05230 19237 19530 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_05230 19558 19800 gene locus_tag LOCUS_05240 19558 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 20336 20127 gene locus_tag LOCUS_05250 20336 20127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 20365 20988 gene locus_tag LOCUS_05260 20365 20988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 21071 21610 gene locus_tag LOCUS_05270 21071 21610 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021975.1 protein_id gnl|my_center|LOCUS_05270 24123 21607 gene locus_tag LOCUS_05280 24123 21607 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_05280 24572 24342 gene locus_tag LOCUS_05290 24572 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 24651 25076 gene locus_tag LOCUS_05300 24651 25076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 25979 25077 gene locus_tag LOCUS_05310 25979 25077 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814952.1 protein_id gnl|my_center|LOCUS_05310 26089 27363 gene locus_tag LOCUS_05320 gene eno 26089 27363 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147178.1 protein_id gnl|my_center|LOCUS_05320 27959 27573 gene locus_tag LOCUS_05330 27959 27573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 28610 27969 gene locus_tag LOCUS_05340 28610 27969 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778522.1 protein_id gnl|my_center|LOCUS_05340 29575 28607 gene locus_tag LOCUS_05350 gene thiL 29575 28607 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405143.1 protein_id gnl|my_center|LOCUS_05350 30834 29584 gene locus_tag LOCUS_05360 gene thiC 30834 29584 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184001.1 protein_id gnl|my_center|LOCUS_05360 31463 30831 gene locus_tag LOCUS_05370 gene thiE 31463 30831 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022682.1 protein_id gnl|my_center|LOCUS_05370 32269 31463 gene locus_tag LOCUS_05380 gene thiM 32269 31463 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022683.1 protein_id gnl|my_center|LOCUS_05380 33042 32293 gene locus_tag LOCUS_05390 gene nucS 33042 32293 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_05390 33165 33317 gene locus_tag LOCUS_05400 33165 33317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 33298 33711 gene locus_tag LOCUS_05410 33298 33711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 33708 33842 gene locus_tag LOCUS_05420 33708 33842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 35027 33960 gene locus_tag LOCUS_05430 35027 33960 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583399.1 protein_id gnl|my_center|LOCUS_05430 36808 35024 gene locus_tag LOCUS_05440 36808 35024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 37000 36836 gene locus_tag LOCUS_05450 37000 36836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 37191 38231 gene locus_tag LOCUS_05460 37191 38231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 38237 38800 gene locus_tag LOCUS_05470 gene dcd 38237 38800 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582476.1 protein_id gnl|my_center|LOCUS_05470 39333 38797 gene locus_tag LOCUS_05480 39333 38797 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_05480 39620 39324 gene locus_tag LOCUS_05490 39620 39324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 40594 39707 gene locus_tag LOCUS_05500 40594 39707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 41121 40696 gene locus_tag LOCUS_05510 gene nikR 41121 40696 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_05510 41240 41521 gene locus_tag LOCUS_05520 41240 41521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 41535 41858 gene locus_tag LOCUS_05530 41535 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 42781 41885 gene locus_tag LOCUS_05540 gene porB 42781 41885 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_05540 43920 42778 gene locus_tag LOCUS_05550 gene porA 43920 42778 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_05550 44231 43917 gene locus_tag LOCUS_05560 44231 43917 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388230.1 protein_id gnl|my_center|LOCUS_05560 44500 44228 gene locus_tag LOCUS_05570 gene porD 44500 44228 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_05570 45056 44502 gene locus_tag LOCUS_05580 45056 44502 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_05580 45119 45394 gene locus_tag LOCUS_05590 45119 45394 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_05590 45864 45397 gene locus_tag LOCUS_05600 45864 45397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 46204 45914 gene locus_tag LOCUS_05610 46204 45914 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_05610 46951 46205 gene locus_tag LOCUS_05620 gene dph5 46951 46205 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_05620 47823 46954 gene locus_tag LOCUS_05630 47823 46954 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249739.1 protein_id gnl|my_center|LOCUS_05630 47865 48716 gene locus_tag LOCUS_05640 47865 48716 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_05640 48847 49506 gene locus_tag LOCUS_05650 48847 49506 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_05650 49503 50018 gene locus_tag LOCUS_05660 49503 50018 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903443.1 protein_id gnl|my_center|LOCUS_05660 50011 50997 gene locus_tag LOCUS_05670 50011 50997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 51110 52357 gene locus_tag LOCUS_05680 gene ahcY 51110 52357 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870905.1 protein_id gnl|my_center|LOCUS_05680 52585 53223 gene locus_tag LOCUS_05690 52585 53223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 53942 53229 gene locus_tag LOCUS_05700 53942 53229 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_05700 54083 54850 gene locus_tag LOCUS_05710 54083 54850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 55809 54847 gene locus_tag LOCUS_05720 55809 54847 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_05720 56623 55814 gene locus_tag LOCUS_05730 56623 55814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 57417 56635 gene locus_tag LOCUS_05740 57417 56635 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_05740 57503 57769 gene locus_tag LOCUS_05750 57503 57769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 57956 58792 gene locus_tag LOCUS_05760 57956 58792 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868801.1 protein_id gnl|my_center|LOCUS_05760 60019 58787 gene locus_tag LOCUS_05770 60019 58787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 60133 61074 gene locus_tag LOCUS_05780 60133 61074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 61168 61677 gene locus_tag LOCUS_05790 61168 61677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 62472 61666 gene locus_tag LOCUS_05800 gene orc1 62472 61666 CDS product DNA replication protein Orc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904037.1 protein_id gnl|my_center|LOCUS_05800 63096 62476 gene locus_tag LOCUS_05810 63096 62476 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_05810 65368 63182 gene locus_tag LOCUS_05820 65368 63182 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082809.1 protein_id gnl|my_center|LOCUS_05820 66562 65456 gene locus_tag LOCUS_05830 66562 65456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 66672 67961 gene locus_tag LOCUS_05840 66672 67961 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147190.1 protein_id gnl|my_center|LOCUS_05840 68233 67955 gene locus_tag LOCUS_05850 68233 67955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 70070 68274 gene locus_tag LOCUS_05860 gene guaA 70070 68274 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234667.1 protein_id gnl|my_center|LOCUS_05860 71449 70253 gene locus_tag LOCUS_05870 71449 70253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 71841 71482 gene locus_tag LOCUS_05880 71841 71482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 72272 72357 gene locus_tag LOCUS_t00180 72272 72357 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 73058 72774 gene locus_tag LOCUS_05890 73058 72774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 73923 73390 gene locus_tag LOCUS_05900 73923 73390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 74059 74535 gene locus_tag LOCUS_05910 74059 74535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 74935 75021 gene locus_tag LOCUS_t00190 74935 75021 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 75799 75275 gene locus_tag LOCUS_05920 75799 75275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 75906 76280 gene locus_tag LOCUS_05930 75906 76280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 76288 76713 gene locus_tag LOCUS_05940 76288 76713 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_05940 76753 76836 gene locus_tag LOCUS_t00200 76753 76836 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 77711 76836 gene locus_tag LOCUS_05950 77711 76836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 77929 77729 gene locus_tag LOCUS_05960 77929 77729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 77992 78873 gene locus_tag LOCUS_05970 77992 78873 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545634.1 protein_id gnl|my_center|LOCUS_05970 79021 79425 gene locus_tag LOCUS_05980 79021 79425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 80389 79433 gene locus_tag LOCUS_05990 80389 79433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 80503 80949 gene locus_tag LOCUS_06000 80503 80949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 81233 80973 gene locus_tag LOCUS_06010 81233 80973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 83062 81233 gene locus_tag LOCUS_06020 83062 81233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 83225 83298 gene locus_tag LOCUS_t00210 83225 83298 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 83656 83465 gene locus_tag LOCUS_06030 83656 83465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence06 1497 790 gene locus_tag LOCUS_06040 1497 790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_06040 2629 1499 gene locus_tag LOCUS_06050 2629 1499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_06050 3863 2643 gene locus_tag LOCUS_06060 3863 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 6094 3965 gene locus_tag LOCUS_06070 6094 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6548 6096 gene locus_tag LOCUS_06080 6548 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 7152 6613 gene locus_tag LOCUS_06090 7152 6613 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879640.1 protein_id gnl|my_center|LOCUS_06090 8205 7165 gene locus_tag LOCUS_06100 8205 7165 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658369.1 protein_id gnl|my_center|LOCUS_06100 8590 8673 gene locus_tag LOCUS_t00220 8590 8673 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8736 9419 gene locus_tag LOCUS_06110 8736 9419 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_06110 9713 9570 gene locus_tag LOCUS_06120 9713 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 9889 10452 gene locus_tag LOCUS_06130 9889 10452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 10467 10928 gene locus_tag LOCUS_06140 10467 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359809.1 protein_id gnl|my_center|LOCUS_06140 10915 11835 gene locus_tag LOCUS_06150 10915 11835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 13248 11938 gene locus_tag LOCUS_06160 13248 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 13387 14526 gene locus_tag LOCUS_06170 13387 14526 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868783.1 protein_id gnl|my_center|LOCUS_06170 14555 14968 gene locus_tag LOCUS_06180 14555 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 14965 15624 gene locus_tag LOCUS_06190 14965 15624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 15762 16274 gene locus_tag LOCUS_06200 15762 16274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 16497 16240 gene locus_tag LOCUS_06210 16497 16240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 17971 16601 gene locus_tag LOCUS_06220 gene betB 17971 16601 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243430.1 protein_id gnl|my_center|LOCUS_06220 18026 18214 gene locus_tag LOCUS_06230 18026 18214 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584058.1 protein_id gnl|my_center|LOCUS_06230 19304 18216 gene locus_tag LOCUS_06240 19304 18216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 20450 19365 gene locus_tag LOCUS_06250 20450 19365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 20738 20523 gene locus_tag LOCUS_06260 20738 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 20877 20950 gene locus_tag LOCUS_t00230 20877 20950 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22240 21032 gene locus_tag LOCUS_06270 22240 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 22599 24896 gene locus_tag LOCUS_06280 22599 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 24921 25616 gene locus_tag LOCUS_06290 24921 25616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 26908 25619 gene locus_tag LOCUS_06300 26908 25619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_06300 26981 27442 gene locus_tag LOCUS_06310 26981 27442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 28125 27634 gene locus_tag LOCUS_06320 28125 27634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 28286 29749 gene locus_tag LOCUS_06330 28286 29749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 30073 29801 gene locus_tag LOCUS_06340 gene albA 30073 29801 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061063.1 protein_id gnl|my_center|LOCUS_06340 30943 30119 gene locus_tag LOCUS_06350 30943 30119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 31190 32326 gene locus_tag LOCUS_06360 31190 32326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 33310 32345 gene locus_tag LOCUS_06370 33310 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 33385 33552 gene locus_tag LOCUS_06380 33385 33552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 36431 33561 gene locus_tag LOCUS_06390 gene ileS 36431 33561 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_06390 36581 36826 gene locus_tag LOCUS_06400 36581 36826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 36881 37162 gene locus_tag LOCUS_06410 36881 37162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 37253 37179 gene locus_tag LOCUS_t00240 37253 37179 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 37692 37345 gene locus_tag LOCUS_06420 37692 37345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 38541 37834 gene locus_tag LOCUS_06430 38541 37834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 39127 38600 gene locus_tag LOCUS_06440 39127 38600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 40850 39201 gene locus_tag LOCUS_06450 gene thsB 40850 39201 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_06450 40987 41616 gene locus_tag LOCUS_06460 40987 41616 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867963.1 protein_id gnl|my_center|LOCUS_06460 42021 41626 gene locus_tag LOCUS_06470 42021 41626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061151.1 protein_id gnl|my_center|LOCUS_06470 42140 42790 gene locus_tag LOCUS_06480 42140 42790 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_06480 44428 42776 gene locus_tag LOCUS_06490 44428 42776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 44409 44669 gene locus_tag LOCUS_06500 44409 44669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 46603 45281 gene locus_tag LOCUS_06510 46603 45281 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146581.1 protein_id gnl|my_center|LOCUS_06510 46749 46675 gene locus_tag LOCUS_t00250 46749 46675 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 47023 47715 gene locus_tag LOCUS_06520 47023 47715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 47946 47737 gene locus_tag LOCUS_06530 47946 47737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 48328 49518 gene locus_tag LOCUS_06540 48328 49518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 50158 49538 gene locus_tag LOCUS_06550 50158 49538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 50631 50311 gene locus_tag LOCUS_06560 50631 50311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 51651 50692 gene locus_tag LOCUS_06570 51651 50692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 51790 53541 gene locus_tag LOCUS_06580 gene glmS 51790 53541 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_06580 53548 54900 gene locus_tag LOCUS_06590 gene glmM 53548 54900 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_06590 54897 55529 gene locus_tag LOCUS_06600 54897 55529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 58422 55519 gene locus_tag LOCUS_06610 58422 55519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 58635 59114 gene locus_tag LOCUS_06620 58635 59114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 59166 59239 gene locus_tag LOCUS_t00260 59166 59239 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 59295 60074 gene locus_tag LOCUS_06630 59295 60074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 60090 60509 gene locus_tag LOCUS_06640 60090 60509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 60692 61819 gene locus_tag LOCUS_06650 60692 61819 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_06650 62253 61849 gene locus_tag LOCUS_06660 62253 61849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 63398 62304 gene locus_tag LOCUS_06670 63398 62304 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 protein_id gnl|my_center|LOCUS_06670 63462 63968 gene locus_tag LOCUS_06680 gene endA 63462 63968 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_06680 64179 64006 gene locus_tag LOCUS_06690 64179 64006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 64672 64337 gene locus_tag LOCUS_06700 64672 64337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 64748 65107 gene locus_tag LOCUS_06710 gene hypA 64748 65107 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_06710 65121 65783 gene locus_tag LOCUS_06720 gene hypB 65121 65783 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_06720 65780 66217 gene locus_tag LOCUS_06730 gene hycI 65780 66217 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867982.1 protein_id gnl|my_center|LOCUS_06730 66663 66220 gene locus_tag LOCUS_06740 66663 66220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 67663 66668 gene locus_tag LOCUS_06750 67663 66668 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_06750 68883 67660 gene locus_tag LOCUS_06760 68883 67660 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867842.1 protein_id gnl|my_center|LOCUS_06760 69401 68880 gene locus_tag LOCUS_06770 69401 68880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 69862 69398 gene locus_tag LOCUS_06780 69862 69398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 70206 69853 gene locus_tag LOCUS_06790 70206 69853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 71762 70206 gene locus_tag LOCUS_06800 71762 70206 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_06800 72133 71759 gene locus_tag LOCUS_06810 72133 71759 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_06810 72594 72130 gene locus_tag LOCUS_06820 72594 72130 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867848.1 protein_id gnl|my_center|LOCUS_06820 72857 72591 gene locus_tag LOCUS_06830 72857 72591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 73087 72854 gene locus_tag LOCUS_06840 73087 72854 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146635.1 protein_id gnl|my_center|LOCUS_06840 73422 73084 gene locus_tag LOCUS_06850 gene mnhG 73422 73084 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_06850 73673 73419 gene locus_tag LOCUS_06860 73673 73419 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 protein_id gnl|my_center|LOCUS_06860 74173 73670 gene locus_tag LOCUS_06870 74173 73670 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251030.1 protein_id gnl|my_center|LOCUS_06870 74299 75936 gene locus_tag LOCUS_06880 74299 75936 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_06880 77093 77548 gene locus_tag LOCUS_06890 77093 77548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 78240 77584 gene locus_tag LOCUS_06900 78240 77584 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817114.1 protein_id gnl|my_center|LOCUS_06900 78326 78502 gene locus_tag LOCUS_06910 78326 78502 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_06910 78527 79441 gene locus_tag LOCUS_06920 78527 79441 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496573.1 protein_id gnl|my_center|LOCUS_06920 79434 80228 gene locus_tag LOCUS_06930 79434 80228 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_06930 80324 81205 gene locus_tag LOCUS_06940 80324 81205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 82496 81240 gene locus_tag LOCUS_06950 82496 81240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence07 40 1317 gene locus_tag LOCUS_06960 40 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2322 1705 gene locus_tag LOCUS_06970 2322 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3343 2384 gene locus_tag LOCUS_06980 3343 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 3413 4627 gene locus_tag LOCUS_06990 3413 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 4686 6806 gene locus_tag LOCUS_07000 gene hypF 4686 6806 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496588.1 protein_id gnl|my_center|LOCUS_07000 7733 6768 gene locus_tag LOCUS_07010 gene hypE 7733 6768 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986399.1 protein_id gnl|my_center|LOCUS_07010 8734 7730 gene locus_tag LOCUS_07020 gene hypD 8734 7730 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870507.1 protein_id gnl|my_center|LOCUS_07020 8952 8731 gene locus_tag LOCUS_07030 8952 8731 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_07030 9373 9029 gene locus_tag LOCUS_07040 9373 9029 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870594.1 protein_id gnl|my_center|LOCUS_07040 9767 9375 gene locus_tag LOCUS_07050 9767 9375 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812273.1 protein_id gnl|my_center|LOCUS_07050 10080 9769 gene locus_tag LOCUS_07060 10080 9769 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319571.1 protein_id gnl|my_center|LOCUS_07060 10351 10085 gene locus_tag LOCUS_07070 10351 10085 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_07070 10779 10348 gene locus_tag LOCUS_07080 10779 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10958 12151 gene locus_tag LOCUS_07090 10958 12151 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_07090 12238 12660 gene locus_tag LOCUS_07100 12238 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 12657 12890 gene locus_tag LOCUS_07110 12657 12890 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583917.1 protein_id gnl|my_center|LOCUS_07110 12891 14912 gene locus_tag LOCUS_07120 gene feoB 12891 14912 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582918.1 protein_id gnl|my_center|LOCUS_07120 14899 15132 gene locus_tag LOCUS_07130 14899 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 16490 15063 gene locus_tag LOCUS_07140 16490 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 16627 17112 gene locus_tag LOCUS_07150 16627 17112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 18012 17131 gene locus_tag LOCUS_07160 18012 17131 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876797.1 protein_id gnl|my_center|LOCUS_07160 18839 18009 gene locus_tag LOCUS_07170 18839 18009 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876798.1 protein_id gnl|my_center|LOCUS_07170 19684 18836 gene locus_tag LOCUS_07180 19684 18836 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877350.1 protein_id gnl|my_center|LOCUS_07180 20472 19705 gene locus_tag LOCUS_07190 20472 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 20864 20469 gene locus_tag LOCUS_07200 20864 20469 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_07200 21709 20861 gene locus_tag LOCUS_07210 21709 20861 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_07210 22055 21723 gene locus_tag LOCUS_07220 22055 21723 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047760.1 protein_id gnl|my_center|LOCUS_07220 22477 22052 gene locus_tag LOCUS_07230 22477 22052 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 protein_id gnl|my_center|LOCUS_07230 22743 22474 gene locus_tag LOCUS_07240 22743 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 23185 22736 gene locus_tag LOCUS_07250 gene tsaA 23185 22736 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_07250 23680 23195 gene locus_tag LOCUS_07260 23680 23195 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020215.1 protein_id gnl|my_center|LOCUS_07260 25095 23740 gene locus_tag LOCUS_07270 25095 23740 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868782.1 protein_id gnl|my_center|LOCUS_07270 25470 25162 gene locus_tag LOCUS_07280 25470 25162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 25552 26463 gene locus_tag LOCUS_07290 gene twy1 25552 26463 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061270.1 protein_id gnl|my_center|LOCUS_07290 28236 26434 gene locus_tag LOCUS_07300 28236 26434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 28244 28588 gene locus_tag LOCUS_07310 28244 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 29165 28554 gene locus_tag LOCUS_07320 29165 28554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 30149 29220 gene locus_tag LOCUS_07330 gene argF 30149 29220 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870395.1 protein_id gnl|my_center|LOCUS_07330 30752 30231 gene locus_tag LOCUS_07340 30752 30231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 31473 30766 gene locus_tag LOCUS_07350 gene alaXM 31473 30766 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_07350 31641 32225 gene locus_tag LOCUS_07360 gene grpE 31641 32225 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_07360 32250 34106 gene locus_tag LOCUS_07370 gene dnaK 32250 34106 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_07370 34122 35279 gene locus_tag LOCUS_07380 gene dnaJ 34122 35279 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_07380 35284 35898 gene locus_tag LOCUS_07390 35284 35898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 36506 35895 gene locus_tag LOCUS_07400 gene nth 36506 35895 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_07400 37065 36511 gene locus_tag LOCUS_07410 37065 36511 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_07410 37884 37108 gene locus_tag LOCUS_07420 37884 37108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 37983 38216 gene locus_tag LOCUS_07430 37983 38216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 38719 38291 gene locus_tag LOCUS_07440 38719 38291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 40075 38765 gene locus_tag LOCUS_07450 gene mgtE 40075 38765 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_07450 41470 40160 gene locus_tag LOCUS_07460 41470 40160 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_07460 42035 41532 gene locus_tag LOCUS_07470 42035 41532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 42135 42596 gene locus_tag LOCUS_07480 42135 42596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 42867 42601 gene locus_tag LOCUS_07490 42867 42601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 42996 44585 gene locus_tag LOCUS_07500 42996 44585 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_07500 46430 44613 gene locus_tag LOCUS_07510 46430 44613 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582757.1 protein_id gnl|my_center|LOCUS_07510 48172 46475 gene locus_tag LOCUS_07520 48172 46475 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_07520 49284 48163 gene locus_tag LOCUS_07530 49284 48163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 49694 49281 gene locus_tag LOCUS_07540 49694 49281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 50476 49886 gene locus_tag LOCUS_07550 50476 49886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 50760 50476 gene locus_tag LOCUS_07560 gene cas2 50760 50476 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879369.1 protein_id gnl|my_center|LOCUS_07560 51751 50762 gene locus_tag LOCUS_07570 gene cas1 51751 50762 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_07570 51856 >52349 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgttccatgatttcaagctctgcaat >Feature sequence08 157 1806 gene locus_tag LOCUS_07580 157 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 1803 2780 gene locus_tag LOCUS_07590 1803 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2777 3988 gene locus_tag LOCUS_07600 2777 3988 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_07600 6188 4446 gene locus_tag LOCUS_07610 6188 4446 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_07610 6388 6197 gene locus_tag LOCUS_07620 6388 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7733 6672 gene locus_tag LOCUS_07630 7733 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 8082 7810 gene locus_tag LOCUS_07640 8082 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8315 8067 gene locus_tag LOCUS_07650 8315 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9573 8338 gene locus_tag LOCUS_07660 9573 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9845 9570 gene locus_tag LOCUS_07670 9845 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 10114 9830 gene locus_tag LOCUS_07680 10114 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 10793 10119 gene locus_tag LOCUS_07690 10793 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 11611 10832 gene locus_tag LOCUS_07700 11611 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 12767 11604 gene locus_tag LOCUS_07710 12767 11604 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024330.1 protein_id gnl|my_center|LOCUS_07710 13879 12764 gene locus_tag LOCUS_07720 13879 12764 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037589.1 protein_id gnl|my_center|LOCUS_07720 14850 13876 gene locus_tag LOCUS_07730 14850 13876 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_07730 16311 14860 gene locus_tag LOCUS_07740 gene hpnJ 16311 14860 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_07740 16407 17264 gene locus_tag LOCUS_07750 16407 17264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 17352 17540 gene locus_tag LOCUS_07760 17352 17540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 17703 17924 gene locus_tag LOCUS_07770 17703 17924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 18774 17899 gene locus_tag LOCUS_07780 18774 17899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 19501 18767 gene locus_tag LOCUS_07790 19501 18767 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_07790 20373 19498 gene locus_tag LOCUS_07800 gene rfbD 20373 19498 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943001.1 protein_id gnl|my_center|LOCUS_07800 21328 20366 gene locus_tag LOCUS_07810 gene rfbB 21328 20366 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_07810 21796 21329 gene locus_tag LOCUS_07820 21796 21329 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045300.1 protein_id gnl|my_center|LOCUS_07820 21869 23023 gene locus_tag LOCUS_07830 21869 23023 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_07830 23483 22995 gene locus_tag LOCUS_07840 23483 22995 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_07840 23929 23483 gene locus_tag LOCUS_07850 gene pssD 23929 23483 CDS product PssD/Cps14F family polysaccharide biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065325.1 protein_id gnl|my_center|LOCUS_07850 24971 23940 gene locus_tag LOCUS_07860 24971 23940 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060851.1 protein_id gnl|my_center|LOCUS_07860 27191 24975 gene locus_tag LOCUS_07870 27191 24975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 27704 27267 gene locus_tag LOCUS_07880 27704 27267 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_07880 27930 27694 gene locus_tag LOCUS_07890 27930 27694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 28532 28011 gene locus_tag LOCUS_07900 28532 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 29694 28543 gene locus_tag LOCUS_07910 gene nifS 29694 28543 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066396.1 protein_id gnl|my_center|LOCUS_07910 30008 29691 gene locus_tag LOCUS_07920 30008 29691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 30124 31080 gene locus_tag LOCUS_07930 30124 31080 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053827.1 protein_id gnl|my_center|LOCUS_07930 32288 31095 gene locus_tag LOCUS_07940 32288 31095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 32463 32377 gene locus_tag LOCUS_r00010 32463 32377 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 73 percent of the 5S ribosomal RNA 33149 32538 gene locus_tag LOCUS_07950 33149 32538 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 protein_id gnl|my_center|LOCUS_07950 33354 33656 gene locus_tag LOCUS_07960 33354 33656 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_07960 33653 33997 gene locus_tag LOCUS_07970 33653 33997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 34031 34627 gene locus_tag LOCUS_07980 34031 34627 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_07980 34642 35463 gene locus_tag LOCUS_07990 gene rsmA 34642 35463 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870542.1 protein_id gnl|my_center|LOCUS_07990 36994 35456 gene locus_tag LOCUS_08000 36994 35456 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878838.1 protein_id gnl|my_center|LOCUS_08000 37064 38236 gene locus_tag LOCUS_08010 37064 38236 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_08010 38764 38237 gene locus_tag LOCUS_08020 38764 38237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 39624 38761 gene locus_tag LOCUS_08030 gene pyrF 39624 38761 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957153.1 protein_id gnl|my_center|LOCUS_08030 40276 39635 gene locus_tag LOCUS_08040 gene pyrE 40276 39635 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957485.1 protein_id gnl|my_center|LOCUS_08040 41615 40290 gene locus_tag LOCUS_08050 41615 40290 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_08050 42087 41620 gene locus_tag LOCUS_08060 gene pyrI 42087 41620 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_08060 43055 42081 gene locus_tag LOCUS_08070 gene pyrB 43055 42081 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_08070 43991 43176 gene locus_tag LOCUS_08080 43991 43176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 44151 45041 gene locus_tag LOCUS_08090 44151 45041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 45111 45674 gene locus_tag LOCUS_08100 45111 45674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 45850 46092 gene locus_tag LOCUS_08110 45850 46092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146880.1 protein_id gnl|my_center|LOCUS_08110 46076 46486 gene locus_tag LOCUS_08120 46076 46486 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048201672.1 protein_id gnl|my_center|LOCUS_08120 48034 46721 gene locus_tag LOCUS_08130 gene gatD 48034 46721 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_08130 48096 48854 gene locus_tag LOCUS_08140 48096 48854 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence09 1333 236 gene locus_tag LOCUS_08150 1333 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1765 1691 gene locus_tag LOCUS_t00270 1765 1691 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2328 3401 gene locus_tag LOCUS_08160 gene ftsZ 2328 3401 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_08160 4407 3451 gene locus_tag LOCUS_08170 4407 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4388 4600 gene locus_tag LOCUS_08180 4388 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 5416 5009 gene locus_tag LOCUS_08190 5416 5009 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_08190 5827 6852 gene locus_tag LOCUS_08200 gene fen 5827 6852 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_08200 6857 8443 gene locus_tag LOCUS_08210 gene lysS 6857 8443 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583287.1 protein_id gnl|my_center|LOCUS_08210 9076 8435 gene locus_tag LOCUS_08220 9076 8435 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_08220 9896 9087 gene locus_tag LOCUS_08230 9896 9087 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_08230 10083 9922 gene locus_tag LOCUS_08240 10083 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 10249 10324 gene locus_tag LOCUS_t00280 10249 10324 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10377 11021 gene locus_tag LOCUS_08250 10377 11021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 11018 11746 gene locus_tag LOCUS_08260 11018 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 13152 11884 gene locus_tag LOCUS_08270 13152 11884 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_08270 13521 14171 gene locus_tag LOCUS_08280 gene snatA 13521 14171 CDS product neutral amino acid NAAT transporter SnatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250610.1 protein_id gnl|my_center|LOCUS_08280 14211 15098 gene locus_tag LOCUS_08290 14211 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 15174 15509 gene locus_tag LOCUS_08300 15174 15509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 15600 15758 gene locus_tag LOCUS_08310 15600 15758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 16862 15939 gene locus_tag LOCUS_08320 16862 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 17291 18739 gene locus_tag LOCUS_r00020 17291 18739 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 18860 18932 gene locus_tag LOCUS_t00290 18860 18932 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19162 22114 gene locus_tag LOCUS_r00030 19162 22114 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 22240 22560 gene locus_tag LOCUS_08330 22240 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 22566 22793 gene locus_tag LOCUS_08340 22566 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 22768 22920 gene locus_tag LOCUS_08350 22768 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 23824 23165 gene locus_tag LOCUS_08360 23824 23165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 24276 23926 gene locus_tag LOCUS_08370 24276 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 24460 24257 gene locus_tag LOCUS_08380 24460 24257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 25020 27698 gene locus_tag LOCUS_08390 gene alaS 25020 27698 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868790.1 protein_id gnl|my_center|LOCUS_08390 27773 29716 gene locus_tag LOCUS_08400 27773 29716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 29807 30361 gene locus_tag LOCUS_08410 29807 30361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 30414 33287 gene locus_tag LOCUS_08420 gene leuS 30414 33287 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496564.1 protein_id gnl|my_center|LOCUS_08420 35222 33288 gene locus_tag LOCUS_08430 35222 33288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 36947 35229 gene locus_tag LOCUS_08440 gene argS 36947 35229 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_08440 37104 37412 gene locus_tag LOCUS_08450 37104 37412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 37405 39357 gene locus_tag LOCUS_08460 37405 39357 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869718.1 protein_id gnl|my_center|LOCUS_08460 39358 39618 gene locus_tag LOCUS_08470 39358 39618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 39658 40236 gene locus_tag LOCUS_08480 39658 40236 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868883.1 protein_id gnl|my_center|LOCUS_08480 40241 41377 gene locus_tag LOCUS_08490 40241 41377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 41379 41681 gene locus_tag LOCUS_08500 41379 41681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 41704 43473 gene locus_tag LOCUS_08510 41704 43473 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_08510 43470 44945 gene locus_tag LOCUS_08520 43470 44945 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869712.1 protein_id gnl|my_center|LOCUS_08520 44942 45604 gene locus_tag LOCUS_08530 44942 45604 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250555.1 protein_id gnl|my_center|LOCUS_08530 45642 46424 gene locus_tag LOCUS_08540 45642 46424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 46574 46813 gene locus_tag LOCUS_08550 46574 46813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence10 66 461 gene locus_tag LOCUS_08560 66 461 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_08560 467 1210 gene locus_tag LOCUS_08570 467 1210 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_08570 1348 1713 gene locus_tag LOCUS_08580 1348 1713 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_08580 1724 2143 gene locus_tag LOCUS_08590 gene rplM 1724 2143 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_08590 2148 2564 gene locus_tag LOCUS_08600 2148 2564 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_08600 2570 2764 gene locus_tag LOCUS_08610 2570 2764 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_08610 2773 3453 gene locus_tag LOCUS_08620 gene rpsB 2773 3453 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_08620 3488 4288 gene locus_tag LOCUS_08630 3488 4288 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_08630 4420 5163 gene locus_tag LOCUS_08640 4420 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5221 6879 gene locus_tag LOCUS_08650 5221 6879 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_08650 7036 7593 gene locus_tag LOCUS_08660 7036 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 7609 7815 gene locus_tag LOCUS_08670 7609 7815 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_08670 7829 8011 gene locus_tag LOCUS_08680 7829 8011 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_08680 8011 8478 gene locus_tag LOCUS_08690 gene ndk 8011 8478 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146967.1 protein_id gnl|my_center|LOCUS_08690 8483 8914 gene locus_tag LOCUS_08700 gene dut 8483 8914 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_08700 8921 10675 gene locus_tag LOCUS_08710 gene infB 8921 10675 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_08710 10672 11238 gene locus_tag LOCUS_08720 10672 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 11235 12452 gene locus_tag LOCUS_08730 11235 12452 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_08730 12436 12819 gene locus_tag LOCUS_08740 12436 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 12829 13452 gene locus_tag LOCUS_08750 gene rpoE 12829 13452 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_08750 13449 13643 gene locus_tag LOCUS_08760 13449 13643 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 protein_id gnl|my_center|LOCUS_08760 13655 14110 gene locus_tag LOCUS_08770 13655 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 14116 14334 gene locus_tag LOCUS_08780 14116 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 14336 14881 gene locus_tag LOCUS_08790 14336 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 14917 15507 gene locus_tag LOCUS_08800 14917 15507 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869554.1 protein_id gnl|my_center|LOCUS_08800 15509 16486 gene locus_tag LOCUS_08810 15509 16486 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_08810 17216 16578 gene locus_tag LOCUS_08820 17216 16578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 18427 18561 gene locus_tag LOCUS_08830 18427 18561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 18620 19762 gene locus_tag LOCUS_08840 18620 19762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 19778 20101 gene locus_tag LOCUS_08850 19778 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 20594 20172 gene locus_tag LOCUS_08860 20594 20172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 20676 21275 gene locus_tag LOCUS_08870 20676 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 21367 21891 gene locus_tag LOCUS_08880 21367 21891 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_08880 21892 22017 gene locus_tag LOCUS_08890 21892 22017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 22017 22595 gene locus_tag LOCUS_08900 22017 22595 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_08900 22592 23269 gene locus_tag LOCUS_08910 22592 23269 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320022.1 protein_id gnl|my_center|LOCUS_08910 24187 23270 gene locus_tag LOCUS_08920 gene sppA 24187 23270 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881360.1 protein_id gnl|my_center|LOCUS_08920 24360 24779 gene locus_tag LOCUS_08930 24360 24779 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_08930 24776 25300 gene locus_tag LOCUS_08940 24776 25300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 26954 25317 gene locus_tag LOCUS_08950 26954 25317 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250545.1 protein_id gnl|my_center|LOCUS_08950 27843 26959 gene locus_tag LOCUS_08960 27843 26959 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870766.1 protein_id gnl|my_center|LOCUS_08960 27966 28955 gene locus_tag LOCUS_08970 27966 28955 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_08970 29029 29295 gene locus_tag LOCUS_08980 29029 29295 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012980461.1 protein_id gnl|my_center|LOCUS_08980 29295 30803 gene locus_tag LOCUS_08990 29295 30803 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870207.1 protein_id gnl|my_center|LOCUS_08990 30803 34207 gene locus_tag LOCUS_09000 gene polC 30803 34207 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_09000 34992 34210 gene locus_tag LOCUS_09010 34992 34210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 35389 35030 gene locus_tag LOCUS_09020 35389 35030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 35533 36759 gene locus_tag LOCUS_09030 35533 36759 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_09030 39075 36745 gene locus_tag LOCUS_09040 39075 36745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 40593 39109 gene locus_tag LOCUS_09050 40593 39109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 41579 40539 gene locus_tag LOCUS_09060 41579 40539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence11 206 3382 gene locus_tag LOCUS_09070 206 3382 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_09070 3382 6825 gene locus_tag LOCUS_09080 3382 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6838 9732 gene locus_tag LOCUS_09090 6838 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10328 12451 gene locus_tag LOCUS_09100 10328 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 12592 12834 gene locus_tag LOCUS_09110 12592 12834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 12831 13103 gene locus_tag LOCUS_09120 12831 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 14146 13256 gene locus_tag LOCUS_09130 14146 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 14528 14358 gene locus_tag LOCUS_09140 14528 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065096.1 protein_id gnl|my_center|LOCUS_09140 14738 15931 gene locus_tag LOCUS_09150 14738 15931 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250045.1 protein_id gnl|my_center|LOCUS_09150 15984 16934 gene locus_tag LOCUS_09160 gene ftcD 15984 16934 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836511.1 protein_id gnl|my_center|LOCUS_09160 17672 16938 gene locus_tag LOCUS_09170 gene upp 17672 16938 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867910.1 protein_id gnl|my_center|LOCUS_09170 17733 18578 gene locus_tag LOCUS_09180 gene speB 17733 18578 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393578.1 protein_id gnl|my_center|LOCUS_09180 18641 21040 gene locus_tag LOCUS_09190 gene valS 18641 21040 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_09190 21040 21735 gene locus_tag LOCUS_09200 21040 21735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 22305 21739 gene locus_tag LOCUS_09210 22305 21739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 23090 22335 gene locus_tag LOCUS_09220 23090 22335 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771252.1 protein_id gnl|my_center|LOCUS_09220 23243 24190 gene locus_tag LOCUS_09230 23243 24190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 24190 24777 gene locus_tag LOCUS_09240 24190 24777 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_09240 24812 25960 gene locus_tag LOCUS_09250 24812 25960 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250237.1 protein_id gnl|my_center|LOCUS_09250 26847 25951 gene locus_tag LOCUS_09260 26847 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 28160 26844 gene locus_tag LOCUS_09270 28160 26844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 28223 28915 gene locus_tag LOCUS_09280 28223 28915 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496840.1 protein_id gnl|my_center|LOCUS_09280 28985 30631 gene locus_tag LOCUS_09290 28985 30631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 31006 31179 gene locus_tag LOCUS_09300 31006 31179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 31252 32172 gene locus_tag LOCUS_09310 31252 32172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 32274 32837 gene locus_tag LOCUS_09320 32274 32837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 32834 33511 gene locus_tag LOCUS_09330 32834 33511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 33508 33969 gene locus_tag LOCUS_09340 33508 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 36705 33964 gene locus_tag LOCUS_09350 36705 33964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence12 797 78 gene locus_tag LOCUS_09360 797 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1544 900 gene locus_tag LOCUS_09370 1544 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1675 1603 gene locus_tag LOCUS_t00300 1675 1603 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1902 2642 gene locus_tag LOCUS_09380 1902 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2668 3957 gene locus_tag LOCUS_09390 2668 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 4088 6037 gene locus_tag LOCUS_09400 gene acs 4088 6037 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_09400 6351 6067 gene locus_tag LOCUS_09410 6351 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7746 6568 gene locus_tag LOCUS_09420 7746 6568 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249749.1 protein_id gnl|my_center|LOCUS_09420 9393 7747 gene locus_tag LOCUS_09430 gene top6B 9393 7747 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_09430 9930 9403 gene locus_tag LOCUS_09440 9930 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10773 10030 gene locus_tag LOCUS_09450 gene rio1 10773 10030 CDS product RIO-type serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879299.1 protein_id gnl|my_center|LOCUS_09450 11138 10812 gene locus_tag LOCUS_09460 gene eif1A 11138 10812 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_09460 11433 11140 gene locus_tag LOCUS_09470 11433 11140 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020725.1 protein_id gnl|my_center|LOCUS_09470 11840 11439 gene locus_tag LOCUS_09480 11840 11439 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_09480 12307 11837 gene locus_tag LOCUS_09490 12307 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12399 13010 gene locus_tag LOCUS_09500 12399 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 13876 13028 gene locus_tag LOCUS_09510 13876 13028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 13908 14282 gene locus_tag LOCUS_09520 13908 14282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 14336 15061 gene locus_tag LOCUS_09530 gene psmA 14336 15061 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_09530 15100 15807 gene locus_tag LOCUS_09540 15100 15807 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496552.1 protein_id gnl|my_center|LOCUS_09540 15829 16485 gene locus_tag LOCUS_09550 gene rrp4 15829 16485 CDS product exosome complex protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877999.1 protein_id gnl|my_center|LOCUS_09550 16486 17424 gene locus_tag LOCUS_09560 16486 17424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 17421 18209 gene locus_tag LOCUS_09570 gene rrp42 17421 18209 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_09570 18223 18609 gene locus_tag LOCUS_09580 18223 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 18611 18742 gene locus_tag LOCUS_09590 18611 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 19026 19385 gene locus_tag LOCUS_09600 19026 19385 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_09600 19397 20404 gene locus_tag LOCUS_09610 19397 20404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 21106 20414 gene locus_tag LOCUS_09620 21106 20414 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_09620 21646 21329 gene locus_tag LOCUS_09630 21646 21329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 22064 21657 gene locus_tag LOCUS_09640 22064 21657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 23515 22061 gene locus_tag LOCUS_09650 23515 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 23675 25150 gene locus_tag LOCUS_09660 23675 25150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 25208 26479 gene locus_tag LOCUS_09670 25208 26479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869538.1 protein_id gnl|my_center|LOCUS_09670 26482 27273 gene locus_tag LOCUS_09680 26482 27273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 27270 27971 gene locus_tag LOCUS_09690 27270 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 28685 27975 gene locus_tag LOCUS_09700 28685 27975 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_09700 29136 28750 gene locus_tag LOCUS_09710 29136 28750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence13 1533 967 gene locus_tag LOCUS_09720 1533 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2096 1575 gene locus_tag LOCUS_09730 2096 1575 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_09730 3486 2101 gene locus_tag LOCUS_09740 gene pyk 3486 2101 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732565.1 protein_id gnl|my_center|LOCUS_09740 6172 3491 gene locus_tag LOCUS_09750 6172 3491 CDS product calcium-transporting P-type ATPase, PMR1-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272458.1 protein_id gnl|my_center|LOCUS_09750 6549 6187 gene locus_tag LOCUS_09760 6549 6187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6634 7200 gene locus_tag LOCUS_09770 6634 7200 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_09770 7435 8589 gene locus_tag LOCUS_09780 7435 8589 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870834.1 protein_id gnl|my_center|LOCUS_09780 8638 8892 gene locus_tag LOCUS_09790 8638 8892 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_09790 8962 9213 gene locus_tag LOCUS_09800 8962 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 9275 9826 gene locus_tag LOCUS_09810 9275 9826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9859 10656 gene locus_tag LOCUS_09820 9859 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 11461 10658 gene locus_tag LOCUS_09830 11461 10658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 11763 13040 gene locus_tag LOCUS_09840 11763 13040 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931831.1 protein_id gnl|my_center|LOCUS_09840 13055 14155 gene locus_tag LOCUS_09850 13055 14155 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_09850 14156 15064 gene locus_tag LOCUS_09860 14156 15064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 15518 15066 gene locus_tag LOCUS_09870 15518 15066 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_09870 15650 16132 gene locus_tag LOCUS_09880 15650 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 16237 16383 gene locus_tag LOCUS_09890 16237 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 16376 16576 gene locus_tag LOCUS_09900 16376 16576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 16590 16718 gene locus_tag LOCUS_09910 16590 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 16708 16866 gene locus_tag LOCUS_09920 16708 16866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 16866 17576 gene locus_tag LOCUS_09930 16866 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 17995 17609 gene locus_tag LOCUS_09940 gene lrpA 17995 17609 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_09940 18180 18704 gene locus_tag LOCUS_09950 18180 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 18701 19081 gene locus_tag LOCUS_09960 18701 19081 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_09960 19087 19713 gene locus_tag LOCUS_09970 19087 19713 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_09970 19945 19706 gene locus_tag LOCUS_09980 19945 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 20204 20440 gene locus_tag LOCUS_09990 20204 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 20445 20570 gene locus_tag LOCUS_10000 20445 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 20574 20843 gene locus_tag LOCUS_10010 20574 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 20894 21169 gene locus_tag LOCUS_10020 20894 21169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 21162 21503 gene locus_tag LOCUS_10030 21162 21503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 21768 22691 gene locus_tag LOCUS_10040 21768 22691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 23599 22829 gene locus_tag LOCUS_10050 23599 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_10050 24327 23596 gene locus_tag LOCUS_10060 24327 23596 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023092.1 protein_id gnl|my_center|LOCUS_10060 26317 24896 gene locus_tag LOCUS_10070 26317 24896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence14 936 22 gene locus_tag LOCUS_10080 gene arcC 936 22 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_10080 1937 1041 gene locus_tag LOCUS_10090 1937 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2101 3381 gene locus_tag LOCUS_10100 gene purD 2101 3381 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_10100 3381 4958 gene locus_tag LOCUS_10110 gene purF 3381 4958 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583771.1 protein_id gnl|my_center|LOCUS_10110 4964 7936 gene locus_tag LOCUS_10120 4964 7936 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_10120 7941 8762 gene locus_tag LOCUS_10130 7941 8762 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_10130 8783 9811 gene locus_tag LOCUS_10140 gene purM 8783 9811 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_10140 10617 9805 gene locus_tag LOCUS_10150 10617 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 10739 12007 gene locus_tag LOCUS_10160 10739 12007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 12049 13074 gene locus_tag LOCUS_10170 12049 13074 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289411.1 protein_id gnl|my_center|LOCUS_10170 13079 13585 gene locus_tag LOCUS_10180 gene purE 13079 13585 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582680.1 protein_id gnl|my_center|LOCUS_10180 13585 14448 gene locus_tag LOCUS_10190 gene folD 13585 14448 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_10190 14445 15980 gene locus_tag LOCUS_10200 gene purH 14445 15980 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244516.1 protein_id gnl|my_center|LOCUS_10200 15989 16198 gene locus_tag LOCUS_10210 15989 16198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 17041 16199 gene locus_tag LOCUS_10220 17041 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17170 18078 gene locus_tag LOCUS_10230 17170 18078 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_10230 19373 18069 gene locus_tag LOCUS_10240 19373 18069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 20572 19370 gene locus_tag LOCUS_10250 20572 19370 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546494.1 protein_id gnl|my_center|LOCUS_10250 22525 20639 gene locus_tag LOCUS_10260 gene gatE 22525 20639 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_10260 22821 22597 gene locus_tag LOCUS_10270 22821 22597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 23316 22984 gene locus_tag LOCUS_10280 23316 22984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 23207 24826 gene locus_tag LOCUS_10290 23207 24826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence15 2150 474 gene locus_tag LOCUS_10300 2150 474 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_10300 2313 3347 gene locus_tag LOCUS_10310 2313 3347 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_10310 3720 3340 gene locus_tag LOCUS_10320 3720 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4109 3762 gene locus_tag LOCUS_10330 4109 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 4496 4167 gene locus_tag LOCUS_10340 4496 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 6102 4531 gene locus_tag LOCUS_10350 6102 4531 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_10350 6893 6099 gene locus_tag LOCUS_10360 6893 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 6965 7606 gene locus_tag LOCUS_10370 6965 7606 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_10370 7603 8202 gene locus_tag LOCUS_10380 7603 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762063.1 protein_id gnl|my_center|LOCUS_10380 8199 8738 gene locus_tag LOCUS_10390 gene thpR 8199 8738 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871092.1 protein_id gnl|my_center|LOCUS_10390 10302 8725 gene locus_tag LOCUS_10400 10302 8725 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_10400 10397 11761 gene locus_tag LOCUS_10410 gene cca 10397 11761 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_10410 11956 12111 gene locus_tag LOCUS_10420 11956 12111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 12127 12387 gene locus_tag LOCUS_10430 12127 12387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 12436 12885 gene locus_tag LOCUS_10440 12436 12885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 12943 15339 gene locus_tag LOCUS_10450 12943 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 15532 15308 gene locus_tag LOCUS_10460 15532 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 15748 15533 gene locus_tag LOCUS_10470 15748 15533 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846508.1 protein_id gnl|my_center|LOCUS_10470 17207 15879 gene locus_tag LOCUS_10480 17207 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 18776 17244 gene locus_tag LOCUS_10490 18776 17244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_10490 19936 18863 gene locus_tag LOCUS_10500 19936 18863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 <21805 19996 gene locus_tag LOCUS_10510 <21805 19996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921441.1:cadherin domain-containing protein >Feature sequence16 543 331 gene locus_tag LOCUS_10520 543 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 982 581 gene locus_tag LOCUS_10530 982 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1485 1012 gene locus_tag LOCUS_10540 1485 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1735 1580 gene locus_tag LOCUS_10550 1735 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3190 1751 gene locus_tag LOCUS_10560 3190 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3567 3226 gene locus_tag LOCUS_10570 3567 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3697 3840 gene locus_tag LOCUS_10580 3697 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4016 4825 gene locus_tag LOCUS_10590 4016 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4847 7816 gene locus_tag LOCUS_10600 4847 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 10255 7823 gene locus_tag LOCUS_10610 10255 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 10333 10815 gene locus_tag LOCUS_10620 10333 10815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 10812 12005 gene locus_tag LOCUS_10630 10812 12005 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_10630 12337 12035 gene locus_tag LOCUS_10640 gene rpl12p 12337 12035 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_10640 13200 12379 gene locus_tag LOCUS_10650 13200 12379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 13858 13202 gene locus_tag LOCUS_10660 13858 13202 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_10660 14488 13931 gene locus_tag LOCUS_10670 14488 13931 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_10670 14948 14511 gene locus_tag LOCUS_10680 14948 14511 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869871.1 protein_id gnl|my_center|LOCUS_10680 15214 15020 gene locus_tag LOCUS_10690 15214 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 16375 15251 gene locus_tag LOCUS_10700 gene ftsZ 16375 15251 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_10700 16689 17081 gene locus_tag LOCUS_10710 16689 17081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 >Feature sequence17 84 12 gene locus_tag LOCUS_t00310 84 12 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 213 524 gene locus_tag LOCUS_10720 213 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 556 1113 gene locus_tag LOCUS_10730 556 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1690 1118 gene locus_tag LOCUS_10740 1690 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2560 1790 gene locus_tag LOCUS_10750 2560 1790 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289227.1 protein_id gnl|my_center|LOCUS_10750 2656 2925 gene locus_tag LOCUS_10760 2656 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2946 3584 gene locus_tag LOCUS_10770 2946 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3639 3712 gene locus_tag LOCUS_t00320 3639 3712 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3752 4459 gene locus_tag LOCUS_10780 3752 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4989 4456 gene locus_tag LOCUS_10790 4989 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5367 4999 gene locus_tag LOCUS_10800 5367 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5948 5553 gene locus_tag LOCUS_10810 5948 5553 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_10810 7246 5954 gene locus_tag LOCUS_10820 gene asnS 7246 5954 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_10820 7413 7577 gene locus_tag LOCUS_10830 7413 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8345 7566 gene locus_tag LOCUS_10840 8345 7566 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_10840 9094 8342 gene locus_tag LOCUS_10850 9094 8342 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_10850 10414 9104 gene locus_tag LOCUS_10860 gene aspS 10414 9104 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_10860 11133 10435 gene locus_tag LOCUS_10870 11133 10435 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880057.1 protein_id gnl|my_center|LOCUS_10870 12167 11178 gene locus_tag LOCUS_10880 12167 11178 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_10880 12296 13399 gene locus_tag LOCUS_10890 12296 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 13810 13403 gene locus_tag LOCUS_10900 13810 13403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 13897 14694 gene locus_tag LOCUS_10910 13897 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 14726 15709 gene locus_tag LOCUS_10920 14726 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence18 1087 419 gene locus_tag LOCUS_10930 gene rpe 1087 419 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_10930 2075 1107 gene locus_tag LOCUS_10940 2075 1107 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_10940 2895 2068 gene locus_tag LOCUS_10950 2895 2068 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_10950 3561 2908 gene locus_tag LOCUS_10960 gene fsa 3561 2908 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_10960 4400 3723 gene locus_tag LOCUS_10970 4400 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5346 4420 gene locus_tag LOCUS_10980 gene trxB 5346 4420 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080734.1 protein_id gnl|my_center|LOCUS_10980 5461 6045 gene locus_tag LOCUS_10990 5461 6045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6042 8207 gene locus_tag LOCUS_11000 6042 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 8241 8822 gene locus_tag LOCUS_11010 8241 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8819 10033 gene locus_tag LOCUS_11020 8819 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 10030 10899 gene locus_tag LOCUS_11030 10030 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 11043 14054 gene locus_tag LOCUS_11040 11043 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence19 394 158 gene locus_tag LOCUS_11050 394 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 676 1113 gene locus_tag LOCUS_11060 676 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1106 1972 gene locus_tag LOCUS_11070 1106 1972 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919036.1 protein_id gnl|my_center|LOCUS_11070 1984 3270 gene locus_tag LOCUS_11080 gene glpT 1984 3270 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246460.1 protein_id gnl|my_center|LOCUS_11080 3285 4427 gene locus_tag LOCUS_11090 3285 4427 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_11090 5923 4469 gene locus_tag LOCUS_11100 5923 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 6345 5887 gene locus_tag LOCUS_11110 6345 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 7640 6342 gene locus_tag LOCUS_11120 7640 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 7809 8810 gene locus_tag LOCUS_11130 7809 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 8811 9647 gene locus_tag LOCUS_11140 8811 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9644 10600 gene locus_tag LOCUS_11150 9644 10600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10601 11515 gene locus_tag LOCUS_11160 10601 11515 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence20 74 3 gene locus_tag LOCUS_t00330 74 3 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1603 110 gene locus_tag LOCUS_11170 1603 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 1809 2612 gene locus_tag LOCUS_11180 1809 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 3185 2613 gene locus_tag LOCUS_11190 3185 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 4110 3331 gene locus_tag LOCUS_11200 4110 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5194 4136 gene locus_tag LOCUS_11210 5194 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 5500 5252 gene locus_tag LOCUS_11220 5500 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 5706 5855 gene locus_tag LOCUS_11230 5706 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 5897 6559 gene locus_tag LOCUS_11240 5897 6559 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_11240 6574 7155 gene locus_tag LOCUS_11250 6574 7155 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022004.1 protein_id gnl|my_center|LOCUS_11250 7246 9234 gene locus_tag LOCUS_11260 7246 9234 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_11260 9227 9379 gene locus_tag LOCUS_11270 9227 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11270 9427 10119 gene locus_tag LOCUS_11280 9427 10119 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_11280 10181 10255 gene locus_tag LOCUS_t00340 10181 10255 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence21 <1 1238 gene locus_tag LOCUS_11290 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861666.1:thioether cross-link-forming SCIFF peptide maturase 1580 1365 gene locus_tag LOCUS_11300 1580 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1579 2238 gene locus_tag LOCUS_11310 1579 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2455 2252 gene locus_tag LOCUS_11320 2455 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2771 3685 gene locus_tag LOCUS_11330 2771 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 3695 4159 gene locus_tag LOCUS_11340 3695 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4363 4785 gene locus_tag LOCUS_11350 4363 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4990 5865 gene locus_tag LOCUS_11360 4990 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 6826 5876 gene locus_tag LOCUS_11370 6826 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8778 6823 gene locus_tag LOCUS_11380 8778 6823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8777 8986 gene locus_tag LOCUS_11390 8777 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 9581 9228 gene locus_tag LOCUS_11400 9581 9228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 10030 9659 gene locus_tag LOCUS_11410 10030 9659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence22 1926 94 gene locus_tag LOCUS_11420 1926 94 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583146.1 protein_id gnl|my_center|LOCUS_11420 2130 2205 gene locus_tag LOCUS_t00350 2130 2205 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2264 2337 gene locus_tag LOCUS_t00360 2264 2337 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2504 6367 gene locus_tag LOCUS_11430 2504 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 6422 6498 gene locus_tag LOCUS_t00370 6422 6498 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6604 8058 gene locus_tag LOCUS_11440 gene proS 6604 8058 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040960.1 protein_id gnl|my_center|LOCUS_11440 9455 8085 gene locus_tag LOCUS_11450 9455 8085 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147306.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence23 3766 2705 gene locus_tag LOCUS_11460 3766 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4003 3812 gene locus_tag LOCUS_11470 4003 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4174 4566 gene locus_tag LOCUS_11480 4174 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4563 5039 gene locus_tag LOCUS_11490 gene ribC 4563 5039 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_11490 5058 5465 gene locus_tag LOCUS_11500 gene ribH 5058 5465 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_11500 6234 5479 gene locus_tag LOCUS_11510 6234 5479 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867248.1 protein_id gnl|my_center|LOCUS_11510 7023 6307 gene locus_tag LOCUS_11520 7023 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7777 7013 gene locus_tag LOCUS_11530 7777 7013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence24 641 501 gene locus_tag LOCUS_11540 641 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1376 681 gene locus_tag LOCUS_11550 1376 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2330 1449 gene locus_tag LOCUS_11560 2330 1449 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071840.1 protein_id gnl|my_center|LOCUS_11560 2439 3125 gene locus_tag LOCUS_11570 2439 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3906 3166 gene locus_tag LOCUS_11580 3906 3166 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_11580 4433 3918 gene locus_tag LOCUS_11590 4433 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence25 320 478 gene locus_tag LOCUS_11600 320 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 392 396 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 513 659 gene locus_tag LOCUS_11610 513 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 702 866 gene locus_tag LOCUS_11620 702 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 863 2374 gene locus_tag LOCUS_11630 863 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2352 2636 gene locus_tag LOCUS_11640 2352 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2629 2793 gene locus_tag LOCUS_11650 2629 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2799 3239 gene locus_tag LOCUS_11660 2799 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3239 3481 gene locus_tag LOCUS_11670 3239 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 3482 3775 gene locus_tag LOCUS_11680 3482 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3772 4161 gene locus_tag LOCUS_11690 3772 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence26 1723 656 gene locus_tag LOCUS_11700 1723 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2231 1725 gene locus_tag LOCUS_11710 2231 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2473 2691 gene locus_tag LOCUS_11720 2473 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence27 <2479 1 gene locus_tag LOCUS_11730 <2479 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878683.1:AN1-type zinc finger domain-containing protein