>Feature sequence001 272 72 gene locus_tag LOCUS_0010 272 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 1401 379 gene locus_tag LOCUS_0020 1401 379 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004305537.1 protein_id gnl|my_center|LOCUS_0020 1953 1438 gene locus_tag LOCUS_0030 1953 1438 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_0030 2097 3140 gene locus_tag LOCUS_0040 2097 3140 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_0040 4575 3142 gene locus_tag LOCUS_0050 4575 3142 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_0050 5514 4588 gene locus_tag LOCUS_0060 5514 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 6536 5550 gene locus_tag LOCUS_0070 6536 5550 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_0070 7481 6585 gene locus_tag LOCUS_0080 7481 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 8293 7538 gene locus_tag LOCUS_0090 8293 7538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_0090 9030 8290 gene locus_tag LOCUS_0100 9030 8290 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764108.1 protein_id gnl|my_center|LOCUS_0100 9273 10058 gene locus_tag LOCUS_0110 9273 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 10061 11386 gene locus_tag LOCUS_0120 gene ftsA 10061 11386 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_0120 11424 12857 gene locus_tag LOCUS_0130 11424 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 >Feature sequence002 502 1362 gene locus_tag LOCUS_0140 502 1362 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_0140 3115 1367 gene locus_tag LOCUS_0150 3115 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 3227 7471 gene locus_tag LOCUS_0160 3227 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 7584 7659 gene locus_tag LOCUS_t0010 7584 7659 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10461 7960 gene locus_tag LOCUS_0170 10461 7960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 11600 10902 gene locus_tag LOCUS_0180 11600 10902 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_0180 11929 11666 gene locus_tag LOCUS_0190 11929 11666 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_0190 >Feature sequence003 <1 1663 gene locus_tag LOCUS_0200 <1 1663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202248.1:preprotein translocase subunit SecA 3474 1924 gene locus_tag LOCUS_0210 3474 1924 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_0210 4625 3615 gene locus_tag LOCUS_0220 gene pdxA 4625 3615 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_0220 6117 4885 gene locus_tag LOCUS_0230 6117 4885 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_0230 8042 6378 gene locus_tag LOCUS_0240 8042 6378 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_0240 8931 8035 gene locus_tag LOCUS_0250 8931 8035 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_0250 9347 9613 gene locus_tag LOCUS_0260 9347 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 >Feature sequence004 154 729 gene locus_tag LOCUS_0270 154 729 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_0270 747 2177 gene locus_tag LOCUS_0280 747 2177 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_0280 2325 2400 gene locus_tag LOCUS_t0020 2325 2400 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4132 2465 gene locus_tag LOCUS_0290 gene lnt 4132 2465 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_0290 4542 4132 gene locus_tag LOCUS_0300 gene mce 4542 4132 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_0300 6053 4581 gene locus_tag LOCUS_0310 6053 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 6204 7829 gene locus_tag LOCUS_0320 6204 7829 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_0320 7840 8460 gene locus_tag LOCUS_0330 7840 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 >Feature sequence005 2531 1374 gene locus_tag LOCUS_0340 2531 1374 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_0340 3025 2528 gene locus_tag LOCUS_0350 3025 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 3197 5731 gene locus_tag LOCUS_0360 gene gyrA 3197 5731 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_0360 5762 6934 gene locus_tag LOCUS_0370 5762 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 6972 8177 gene locus_tag LOCUS_0380 6972 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 >Feature sequence006 3 581 gene locus_tag LOCUS_0390 3 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 713 1333 gene locus_tag LOCUS_0400 713 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 1367 2386 gene locus_tag LOCUS_0410 1367 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 2398 3441 gene locus_tag LOCUS_0420 2398 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 3522 4445 gene locus_tag LOCUS_0430 3522 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 4561 4486 gene locus_tag LOCUS_t0030 4561 4486 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4772 5689 gene locus_tag LOCUS_0440 4772 5689 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_0440 6959 5673 gene locus_tag LOCUS_0450 6959 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 7635 6976 gene locus_tag LOCUS_0460 7635 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 8081 7632 gene locus_tag LOCUS_0470 8081 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 8310 8235 gene locus_tag LOCUS_t0040 8310 8235 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 464 937 gene locus_tag LOCUS_0480 464 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 1739 1173 gene locus_tag LOCUS_0490 1739 1173 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_0490 2425 1736 gene locus_tag LOCUS_0500 2425 1736 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_0500 2891 2433 gene locus_tag LOCUS_0510 2891 2433 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_0510 4347 2911 gene locus_tag LOCUS_0520 4347 2911 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_0520 6140 4479 gene locus_tag LOCUS_0530 6140 4479 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963474.1 protein_id gnl|my_center|LOCUS_0530 6458 7237 gene locus_tag LOCUS_0540 6458 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 7804 7250 gene locus_tag LOCUS_0550 7804 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 >Feature sequence008 1478 450 gene locus_tag LOCUS_0560 1478 450 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_0560 2854 1568 gene locus_tag LOCUS_0570 gene eno 2854 1568 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_0570 4014 2977 gene locus_tag LOCUS_0580 gene galE 4014 2977 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_0580 5468 4017 gene locus_tag LOCUS_0590 5468 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 6576 5461 gene locus_tag LOCUS_0600 gene recF 6576 5461 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_0600 6775 6581 gene locus_tag LOCUS_0610 6775 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 <7812 6778 gene locus_tag LOCUS_0620 <7812 6778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964009.1:GDSL-type esterase/lipase family protein >Feature sequence009 236 1084 gene locus_tag LOCUS_0630 236 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 2870 1089 gene locus_tag LOCUS_0640 gene uvrC 2870 1089 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_0640 4104 2938 gene locus_tag LOCUS_0650 4104 2938 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_0650 4438 6933 gene locus_tag LOCUS_0660 4438 6933 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_0660 <7610 6962 gene locus_tag LOCUS_0670 <7610 6962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769163.1:pitrilysin family protein >Feature sequence010 3005 93 gene locus_tag LOCUS_0680 gene secDF 3005 93 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_0680 3788 3270 gene locus_tag LOCUS_0690 3788 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 4375 3791 gene locus_tag LOCUS_0700 4375 3791 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929870.1 protein_id gnl|my_center|LOCUS_0700 5103 4387 gene locus_tag LOCUS_0710 gene pssA 5103 4387 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_0710 6652 5129 gene locus_tag LOCUS_0720 6652 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 7210 6713 gene locus_tag LOCUS_0730 7210 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 >Feature sequence011 2821 557 gene locus_tag LOCUS_0740 2821 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 2949 3671 gene locus_tag LOCUS_0750 2949 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 4931 3684 gene locus_tag LOCUS_0760 4931 3684 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769934.1 protein_id gnl|my_center|LOCUS_0760 6514 4961 gene locus_tag LOCUS_0770 6514 4961 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027392.1 protein_id gnl|my_center|LOCUS_0770 6840 6601 gene locus_tag LOCUS_0780 gene yidD 6840 6601 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124565.1 protein_id gnl|my_center|LOCUS_0780 <7446 6869 gene locus_tag LOCUS_0790 <7446 6869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963133.1:16S rRNA (guanine(966)-N(2))-methyltransferase RsmD >Feature sequence012 1125 406 gene locus_tag LOCUS_0800 gene aqpZ 1125 406 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262065.1 protein_id gnl|my_center|LOCUS_0800 1369 3354 gene locus_tag LOCUS_0810 gene rpsA 1369 3354 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_0810 3594 3830 gene locus_tag LOCUS_0820 3594 3830 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_0820 3836 5086 gene locus_tag LOCUS_0830 gene fabF 3836 5086 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_0830 5092 5832 gene locus_tag LOCUS_0840 5092 5832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 5804 7216 gene locus_tag LOCUS_0850 gene rlmD 5804 7216 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_0850 >Feature sequence013 2048 1185 gene locus_tag LOCUS_0860 2048 1185 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108486.1 protein_id gnl|my_center|LOCUS_0860 5669 2079 gene locus_tag LOCUS_0870 5669 2079 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_0870 6956 5709 gene locus_tag LOCUS_0880 gene porV 6956 5709 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_0880 >Feature sequence014 1591 221 gene locus_tag LOCUS_0890 1591 221 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_0890 2446 1670 gene locus_tag LOCUS_0900 2446 1670 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_0900 4749 2560 gene locus_tag LOCUS_0910 4749 2560 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_0910 6077 4845 gene locus_tag LOCUS_0920 gene rocD 6077 4845 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_0920 6303 6887 gene locus_tag LOCUS_0930 6303 6887 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791480.1 protein_id gnl|my_center|LOCUS_0930 6969 7190 gene locus_tag LOCUS_0940 6969 7190 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_0940 >Feature sequence015 500 234 gene locus_tag LOCUS_0950 500 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 1855 497 gene locus_tag LOCUS_0960 1855 497 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798170.1 protein_id gnl|my_center|LOCUS_0960 2886 1852 gene locus_tag LOCUS_0970 2886 1852 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_0970 3392 2991 gene locus_tag LOCUS_0980 3392 2991 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_0980 3865 3392 gene locus_tag LOCUS_0990 gene greA 3865 3392 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_0990 5051 3954 gene locus_tag LOCUS_1000 5051 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 >Feature sequence016 1971 997 gene locus_tag LOCUS_1010 1971 997 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_1010 2227 2682 gene locus_tag LOCUS_1020 gene rplM 2227 2682 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_1020 2688 3074 gene locus_tag LOCUS_1030 gene rpsI 2688 3074 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_1030 3180 4094 gene locus_tag LOCUS_1040 gene rpsB 3180 4094 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_1040 4127 5128 gene locus_tag LOCUS_1050 gene tsf 4127 5128 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_1050 6004 5270 gene locus_tag LOCUS_1060 6004 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 >Feature sequence017 <1 3570 gene locus_tag LOCUS_1070 <1 3570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963727.1:translocation/assembly module TamB domain-containing protein 3698 4930 gene locus_tag LOCUS_1080 3698 4930 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_1080 >Feature sequence018 409 1224 gene locus_tag LOCUS_1090 409 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 1225 1554 gene locus_tag LOCUS_1100 1225 1554 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_1100 1564 2769 gene locus_tag LOCUS_1110 gene coaBC 1564 2769 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_1110 2774 3667 gene locus_tag LOCUS_1120 2774 3667 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 protein_id gnl|my_center|LOCUS_1120 3715 4626 gene locus_tag LOCUS_1130 3715 4626 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261062.1 protein_id gnl|my_center|LOCUS_1130 4938 6422 gene locus_tag LOCUS_1140 4938 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 6872 6564 gene locus_tag LOCUS_1150 6872 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 >Feature sequence019 856 113 gene locus_tag LOCUS_1160 gene fabG 856 113 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_1160 3292 875 gene locus_tag LOCUS_1170 gene lon 3292 875 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963824.1 protein_id gnl|my_center|LOCUS_1170 4696 3302 gene locus_tag LOCUS_1180 gene glmM 4696 3302 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_1180 5637 4888 gene locus_tag LOCUS_1190 5637 4888 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_1190 <6973 6320 gene locus_tag LOCUS_1200 <6973 6320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029269.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence020 <1 1515 gene locus_tag LOCUS_1210 <1 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964377.1:aromatic amino acid ammonia-lyase 2340 1519 gene locus_tag LOCUS_1220 2340 1519 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992443.1 protein_id gnl|my_center|LOCUS_1220 2935 2342 gene locus_tag LOCUS_1230 2935 2342 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788037.1 protein_id gnl|my_center|LOCUS_1230 3698 2997 gene locus_tag LOCUS_1240 3698 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_1240 5882 3807 gene locus_tag LOCUS_1250 5882 3807 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108532.1 protein_id gnl|my_center|LOCUS_1250 <6948 5933 gene locus_tag LOCUS_1260 <6948 5933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926964.1:sodium-translocating pyrophosphatase >Feature sequence021 1294 3783 gene locus_tag LOCUS_1270 1294 3783 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_1270 3834 5756 gene locus_tag LOCUS_1280 gene yidC 3834 5756 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_1280 >Feature sequence022 870 109 gene locus_tag LOCUS_1290 870 109 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_1290 1064 1660 gene locus_tag LOCUS_1300 1064 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 1702 3417 gene locus_tag LOCUS_1310 1702 3417 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_1310 3433 4749 gene locus_tag LOCUS_1320 gene miaB 3433 4749 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_1320 4752 5249 gene locus_tag LOCUS_1330 4752 5249 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_1330 >Feature sequence023 3 695 gene locus_tag LOCUS_1340 gene lmtA 3 695 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_1340 762 1898 gene locus_tag LOCUS_1350 762 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 2606 1944 gene locus_tag LOCUS_1360 gene upp 2606 1944 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_1360 4439 2685 gene locus_tag LOCUS_1370 4439 2685 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_1370 4658 5680 gene locus_tag LOCUS_1380 4658 5680 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_1380 >Feature sequence024 1015 284 gene locus_tag LOCUS_1390 1015 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 2182 1058 gene locus_tag LOCUS_1400 gene lpxB 2182 1058 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_1400 3332 2199 gene locus_tag LOCUS_1410 3332 2199 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966194.1 protein_id gnl|my_center|LOCUS_1410 4555 3332 gene locus_tag LOCUS_1420 4555 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 4674 4748 gene locus_tag LOCUS_t0050 4674 4748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4816 5709 gene locus_tag LOCUS_1430 gene fabD 4816 5709 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_1430 5740 6273 gene locus_tag LOCUS_1440 5740 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 >Feature sequence025 2164 299 gene locus_tag LOCUS_1450 gene mutL 2164 299 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_1450 2447 2175 gene locus_tag LOCUS_1460 2447 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 3230 2559 gene locus_tag LOCUS_1470 3230 2559 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_1470 4101 3349 gene locus_tag LOCUS_1480 4101 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 4213 4974 gene locus_tag LOCUS_1490 4213 4974 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_1490 5843 4977 gene locus_tag LOCUS_1500 5843 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 6373 6005 gene locus_tag LOCUS_1510 6373 6005 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_1510 >Feature sequence026 289 1512 gene locus_tag LOCUS_1520 289 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 1555 2442 gene locus_tag LOCUS_1530 1555 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 2522 3739 gene locus_tag LOCUS_1540 2522 3739 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_1540 3786 4508 gene locus_tag LOCUS_1550 3786 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 4513 4935 gene locus_tag LOCUS_1560 4513 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 4938 5657 gene locus_tag LOCUS_1570 4938 5657 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_1570 5727 5801 gene locus_tag LOCUS_t0060 5727 5801 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <6691 5913 gene locus_tag LOCUS_1580 <6691 5913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766203.1:metallophosphoesterase >Feature sequence027 <1 903 gene locus_tag LOCUS_1590 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107393.1:carboxynorspermidine decarboxylase 1008 1349 gene locus_tag LOCUS_1600 1008 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 1359 2075 gene locus_tag LOCUS_1610 1359 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 2062 2841 gene locus_tag LOCUS_1620 2062 2841 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_1620 2828 3247 gene locus_tag LOCUS_1630 2828 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 3270 5060 gene locus_tag LOCUS_1640 3270 5060 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202069.1 protein_id gnl|my_center|LOCUS_1640 6371 5097 gene locus_tag LOCUS_1650 6371 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 >Feature sequence028 <1 697 gene locus_tag LOCUS_1660 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107756.1:acyl-CoA dehydratase activase 719 1336 gene locus_tag LOCUS_1670 719 1336 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_1670 1449 1892 gene locus_tag LOCUS_1680 gene rpiB 1449 1892 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766127.1 protein_id gnl|my_center|LOCUS_1680 1899 2957 gene locus_tag LOCUS_1690 1899 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 2958 4226 gene locus_tag LOCUS_1700 2958 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 4797 4180 gene locus_tag LOCUS_1710 4797 4180 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108280.1 protein_id gnl|my_center|LOCUS_1710 <6535 4790 gene locus_tag LOCUS_1720 <6535 4790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203179.1:cytochrome c biogenesis protein CcdA >Feature sequence029 1401 1171 gene locus_tag LOCUS_1730 1401 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 1886 1398 gene locus_tag LOCUS_1740 1886 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 2204 4237 gene locus_tag LOCUS_1750 2204 4237 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_1750 >Feature sequence030 2577 736 gene locus_tag LOCUS_1760 2577 736 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_1760 5084 2616 gene locus_tag LOCUS_1770 gene pheT 5084 2616 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_1770 6129 5128 gene locus_tag LOCUS_1780 6129 5128 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455105.1 protein_id gnl|my_center|LOCUS_1780 >Feature sequence031 183 1313 gene locus_tag LOCUS_1790 183 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 2429 1491 gene locus_tag LOCUS_1800 2429 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 3293 2454 gene locus_tag LOCUS_1810 3293 2454 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809790.1 protein_id gnl|my_center|LOCUS_1810 3829 3293 gene locus_tag LOCUS_1820 3829 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 5144 3840 gene locus_tag LOCUS_1830 gene murA 5144 3840 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_1830 6010 5150 gene locus_tag LOCUS_1840 6010 5150 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_1840 >Feature sequence032 173 1090 gene locus_tag LOCUS_1850 173 1090 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_1850 1197 2795 gene locus_tag LOCUS_1860 1197 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 2798 3754 gene locus_tag LOCUS_1870 2798 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 3785 4471 gene locus_tag LOCUS_1880 gene rpe 3785 4471 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_1880 4473 4946 gene locus_tag LOCUS_1890 gene rlmH 4473 4946 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_1890 <6378 4954 gene locus_tag LOCUS_1900 <6378 4954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202481.1:TonB-dependent receptor >Feature sequence033 193 2223 gene locus_tag LOCUS_1910 193 2223 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_1910 2227 2835 gene locus_tag LOCUS_1920 2227 2835 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_1920 2871 4376 gene locus_tag LOCUS_1930 gene hutH 2871 4376 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_1930 5536 4670 gene locus_tag LOCUS_1940 5536 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 6150 5542 gene locus_tag LOCUS_1950 6150 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 >Feature sequence034 516 1148 gene locus_tag LOCUS_1960 516 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 1145 1624 gene locus_tag LOCUS_1970 1145 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 1692 2720 gene locus_tag LOCUS_1980 1692 2720 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_1980 2723 5827 gene locus_tag LOCUS_1990 2723 5827 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262950.1 protein_id gnl|my_center|LOCUS_1990 >Feature sequence035 1195 530 gene locus_tag LOCUS_2000 gene trmB 1195 530 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_2000 3451 1208 gene locus_tag LOCUS_2010 3451 1208 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_2010 4538 3471 gene locus_tag LOCUS_2020 4538 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 4913 5902 gene locus_tag LOCUS_2030 4913 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 >Feature sequence036 34 2421 gene locus_tag LOCUS_2040 34 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 2604 3710 gene locus_tag LOCUS_2050 2604 3710 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_2050 3833 4894 gene locus_tag LOCUS_2060 3833 4894 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948736.1 protein_id gnl|my_center|LOCUS_2060 5694 5341 gene locus_tag LOCUS_2070 gene rplS 5694 5341 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_2070 >Feature sequence037 2799 1345 gene locus_tag LOCUS_2080 2799 1345 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_2080 4154 2835 gene locus_tag LOCUS_2090 4154 2835 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_2090 5151 4159 gene locus_tag LOCUS_2100 5151 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 <6110 5201 gene locus_tag LOCUS_2110 <6110 5201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932840.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence038 630 2042 gene locus_tag LOCUS_2120 630 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 2162 3085 gene locus_tag LOCUS_2130 2162 3085 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108326.1 protein_id gnl|my_center|LOCUS_2130 3109 3666 gene locus_tag LOCUS_2140 3109 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 4377 3865 gene locus_tag LOCUS_2150 4377 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 5560 4379 gene locus_tag LOCUS_2160 5560 4379 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861662.1 protein_id gnl|my_center|LOCUS_2160 >Feature sequence039 2908 80 gene locus_tag LOCUS_2170 gene uvrA 2908 80 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_2170 3505 2936 gene locus_tag LOCUS_2180 3505 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 >Feature sequence040 239 2017 gene locus_tag LOCUS_2190 gene recJ 239 2017 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_2190 2426 2025 gene locus_tag LOCUS_2200 2426 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_2200 2912 2448 gene locus_tag LOCUS_2210 2912 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_2210 5492 2976 gene locus_tag LOCUS_2220 5492 2976 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_2220 >Feature sequence041 505 2013 gene locus_tag LOCUS_2230 505 2013 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555722.1 protein_id gnl|my_center|LOCUS_2230 2029 2544 gene locus_tag LOCUS_2240 2029 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_2240 2666 4129 gene locus_tag LOCUS_2250 2666 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 4126 5106 gene locus_tag LOCUS_2260 4126 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 >Feature sequence042 84 1748 gene locus_tag LOCUS_2270 84 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 1787 3112 gene locus_tag LOCUS_2280 1787 3112 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 protein_id gnl|my_center|LOCUS_2280 3117 4241 gene locus_tag LOCUS_2290 3117 4241 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530516.1 protein_id gnl|my_center|LOCUS_2290 4327 4938 gene locus_tag LOCUS_2300 4327 4938 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_2300 >Feature sequence043 753 373 gene locus_tag LOCUS_2310 gene gcvH 753 373 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_2310 1345 785 gene locus_tag LOCUS_2320 gene frr 1345 785 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_2320 2069 1359 gene locus_tag LOCUS_2330 gene pyrH 2069 1359 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_2330 2218 3201 gene locus_tag LOCUS_2340 2218 3201 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_2340 3231 4592 gene locus_tag LOCUS_2350 3231 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 4596 4952 gene locus_tag LOCUS_2360 gene folB 4596 4952 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_2360 >Feature sequence044 297 929 gene locus_tag LOCUS_2370 297 929 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_2370 919 1467 gene locus_tag LOCUS_2380 919 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 1479 1985 gene locus_tag LOCUS_2390 1479 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 1992 3008 gene locus_tag LOCUS_2400 1992 3008 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_2400 3016 3804 gene locus_tag LOCUS_2410 3016 3804 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_2410 >Feature sequence045 <1 1424 gene locus_tag LOCUS_2420 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760864.1:chloride channel protein 1528 2277 gene locus_tag LOCUS_2430 gene prmC 1528 2277 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_2430 2323 2396 gene locus_tag LOCUS_t0070 2323 2396 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2403 2477 gene locus_tag LOCUS_t0080 2403 2477 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2752 4740 gene locus_tag LOCUS_2440 2752 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 4876 5721 gene locus_tag LOCUS_2450 4876 5721 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_2450 >Feature sequence046 <1 1330 gene locus_tag LOCUS_2460 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962764.1:ATP-dependent zinc metalloprotease FtsH 1330 1980 gene locus_tag LOCUS_2470 1330 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 1999 2790 gene locus_tag LOCUS_2480 1999 2790 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_2480 2787 4025 gene locus_tag LOCUS_2490 2787 4025 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_2490 4128 4847 gene locus_tag LOCUS_2500 4128 4847 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_2500 4860 5297 gene locus_tag LOCUS_2510 4860 5297 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_2510 >Feature sequence047 119 1408 gene locus_tag LOCUS_2520 119 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 1484 1556 gene locus_tag LOCUS_t0090 1484 1556 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3426 1690 gene locus_tag LOCUS_2530 3426 1690 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_2530 4302 3460 gene locus_tag LOCUS_2540 4302 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 5091 4399 gene locus_tag LOCUS_2550 gene trmD 5091 4399 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_2550 5635 5096 gene locus_tag LOCUS_2560 5635 5096 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_2560 >Feature sequence048 3787 1310 gene locus_tag LOCUS_2570 3787 1310 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_2570 4168 5028 gene locus_tag LOCUS_2580 4168 5028 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_2580 >Feature sequence049 511 2742 gene locus_tag LOCUS_2590 511 2742 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838619.1 protein_id gnl|my_center|LOCUS_2590 3638 2739 gene locus_tag LOCUS_2600 3638 2739 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_2600 4833 3652 gene locus_tag LOCUS_2610 4833 3652 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_2610 <5406 4845 gene locus_tag LOCUS_2620 <5406 4845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761351.1:NAD(P)H-dependent oxidoreductase >Feature sequence050 <1 769 gene locus_tag LOCUS_2630 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162903181.1:PKD domain-containing protein 878 1408 gene locus_tag LOCUS_2640 878 1408 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_2640 1980 1468 gene locus_tag LOCUS_2650 gene rplQ 1980 1468 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_2650 2942 1986 gene locus_tag LOCUS_2660 2942 1986 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963445.1 protein_id gnl|my_center|LOCUS_2660 3635 3030 gene locus_tag LOCUS_2670 gene rpsD 3635 3030 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963446.1 protein_id gnl|my_center|LOCUS_2670 4086 3697 gene locus_tag LOCUS_2680 gene rpsK 4086 3697 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_2680 4505 4131 gene locus_tag LOCUS_2690 gene rpsM 4505 4131 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_2690 4901 4683 gene locus_tag LOCUS_2700 gene infA 4901 4683 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_2700 >Feature sequence051 646 1254 gene locus_tag LOCUS_2710 646 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 2533 1313 gene locus_tag LOCUS_2720 2533 1313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_2720 3289 2546 gene locus_tag LOCUS_2730 3289 2546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786909.1 protein_id gnl|my_center|LOCUS_2730 4528 3308 gene locus_tag LOCUS_2740 4528 3308 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107657.1 protein_id gnl|my_center|LOCUS_2740 <5336 4551 gene locus_tag LOCUS_2750 <5336 4551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964214.1:TolC family protein >Feature sequence052 1007 321 gene locus_tag LOCUS_2760 1007 321 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_2760 1180 2580 gene locus_tag LOCUS_2770 gene lpdA 1180 2580 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_2770 2863 3327 gene locus_tag LOCUS_2780 gene infC 2863 3327 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_2780 3374 3571 gene locus_tag LOCUS_2790 gene rpmI 3374 3571 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_2790 3703 3999 gene locus_tag LOCUS_2800 gene rplT 3703 3999 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_2800 >Feature sequence053 <1 641 gene locus_tag LOCUS_2810 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769170.1:DUF2851 family protein 1541 672 gene locus_tag LOCUS_2820 1541 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 2461 1724 gene locus_tag LOCUS_2830 gene panB 2461 1724 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_2830 3097 2576 gene locus_tag LOCUS_2840 gene rpsE 3097 2576 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_2840 3475 3116 gene locus_tag LOCUS_2850 gene rplR 3475 3116 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_2850 4054 3494 gene locus_tag LOCUS_2860 gene rplF 4054 3494 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_2860 4468 4070 gene locus_tag LOCUS_2870 gene rpsH 4468 4070 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963456.1 protein_id gnl|my_center|LOCUS_2870 4789 4490 gene locus_tag LOCUS_2880 gene rpsN 4789 4490 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791558.1 protein_id gnl|my_center|LOCUS_2880 >Feature sequence054 2823 1540 gene locus_tag LOCUS_2890 2823 1540 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_2890 3694 2858 gene locus_tag LOCUS_2900 gene nfo 3694 2858 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_2900 4920 3691 gene locus_tag LOCUS_2910 4920 3691 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_2910 >Feature sequence055 1483 548 gene locus_tag LOCUS_2920 1483 548 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_2920 3250 1535 gene locus_tag LOCUS_2930 3250 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 3850 3317 gene locus_tag LOCUS_2940 3850 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 4799 4218 gene locus_tag LOCUS_2950 4799 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 5076 4789 gene locus_tag LOCUS_2960 5076 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 >Feature sequence056 2125 1343 gene locus_tag LOCUS_2970 gene kdsA 2125 1343 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_2970 4764 2167 gene locus_tag LOCUS_2980 4764 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 >Feature sequence057 2039 402 gene locus_tag LOCUS_2990 gene groL 2039 402 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_2990 2362 2084 gene locus_tag LOCUS_3000 2362 2084 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_3000 3667 2486 gene locus_tag LOCUS_3010 3667 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 3976 3767 gene locus_tag LOCUS_3020 3976 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 <5019 3985 gene locus_tag LOCUS_3030 <5019 3985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966338.1:glycosyltransferase family 4 protein >Feature sequence058 1723 89 gene locus_tag LOCUS_3040 1723 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 2836 1856 gene locus_tag LOCUS_3050 2836 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3050 4447 2921 gene locus_tag LOCUS_3060 4447 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 >Feature sequence059 500 54 gene locus_tag LOCUS_3070 gene bcp 500 54 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_3070 1536 466 gene locus_tag LOCUS_3080 1536 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 2174 3916 gene locus_tag LOCUS_3090 2174 3916 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_3090 3947 4813 gene locus_tag LOCUS_3100 gene folD 3947 4813 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_3100 >Feature sequence060 1537 3618 gene locus_tag LOCUS_3110 1537 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 >Feature sequence061 617 18 gene locus_tag LOCUS_3120 617 18 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883143.1 protein_id gnl|my_center|LOCUS_3120 2257 659 gene locus_tag LOCUS_3130 2257 659 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202272.1 protein_id gnl|my_center|LOCUS_3130 3005 2262 gene locus_tag LOCUS_3140 gene rlmB 3005 2262 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_3140 3904 3008 gene locus_tag LOCUS_3150 3904 3008 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_3150 >Feature sequence062 701 99 gene locus_tag LOCUS_3160 gene fkpA 701 99 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704938.1 protein_id gnl|my_center|LOCUS_3160 1720 809 gene locus_tag LOCUS_3170 1720 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3170 2095 1742 gene locus_tag LOCUS_3180 2095 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3180 2596 2162 gene locus_tag LOCUS_3190 2596 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3190 2815 3237 gene locus_tag LOCUS_3200 2815 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 3242 3670 gene locus_tag LOCUS_3210 3242 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 3678 4625 gene locus_tag LOCUS_3220 3678 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 >Feature sequence063 493 2262 gene locus_tag LOCUS_3230 493 2262 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_3230 2298 2720 gene locus_tag LOCUS_3240 2298 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 2727 3425 gene locus_tag LOCUS_3250 2727 3425 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_3250 >Feature sequence064 284 372 gene locus_tag LOCUS_t0100 284 372 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 432 1244 gene locus_tag LOCUS_3260 432 1244 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_3260 1376 2245 gene locus_tag LOCUS_3270 1376 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 2252 2833 gene locus_tag LOCUS_3280 2252 2833 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_3280 2865 3359 gene locus_tag LOCUS_3290 2865 3359 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_3290 >Feature sequence065 2610 979 gene locus_tag LOCUS_3300 2610 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 3866 2760 gene locus_tag LOCUS_3310 3866 2760 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_3310 >Feature sequence066 272 1453 gene locus_tag LOCUS_3320 272 1453 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_3320 >Feature sequence067 <1 1737 gene locus_tag LOCUS_3330 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:OmpA family protein 2966 1734 gene locus_tag LOCUS_3340 2966 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802082.1 protein_id gnl|my_center|LOCUS_3340 4004 2973 gene locus_tag LOCUS_3350 4004 2973 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_3350 <4712 4078 gene locus_tag LOCUS_3360 <4712 4078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964399.1:T9SS C-terminal target domain-containing protein >Feature sequence068 460 1539 gene locus_tag LOCUS_3370 gene rfbG 460 1539 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_3370 1539 2084 gene locus_tag LOCUS_3380 gene rfbC 1539 2084 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_3380 2103 2996 gene locus_tag LOCUS_3390 2103 2996 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107727.1 protein_id gnl|my_center|LOCUS_3390 3083 4396 gene locus_tag LOCUS_3400 3083 4396 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_3400 >Feature sequence069 2452 431 gene locus_tag LOCUS_3410 gene uvrB 2452 431 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_3410 4680 2455 gene locus_tag LOCUS_3420 4680 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 >Feature sequence070 1275 1349 gene locus_tag LOCUS_t0110 1275 1349 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1501 2247 gene locus_tag LOCUS_3430 gene truB 1501 2247 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964446.1 protein_id gnl|my_center|LOCUS_3430 3077 2250 gene locus_tag LOCUS_3440 3077 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 3779 3099 gene locus_tag LOCUS_3450 3779 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 >Feature sequence071 2770 644 gene locus_tag LOCUS_3460 2770 644 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_3460 3390 2899 gene locus_tag LOCUS_3470 3390 2899 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_3470 <4604 3394 gene locus_tag LOCUS_3480 <4604 3394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence072 <1 1975 gene locus_tag LOCUS_3490 <1 1975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203526.1:RecQ family ATP-dependent DNA helicase 2058 2540 gene locus_tag LOCUS_3500 2058 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3500 2712 3254 gene locus_tag LOCUS_3510 2712 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3510 3363 4367 gene locus_tag LOCUS_3520 gene recA 3363 4367 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_3520 >Feature sequence073 260 2230 gene locus_tag LOCUS_3530 260 2230 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109193.1 protein_id gnl|my_center|LOCUS_3530 2243 2818 gene locus_tag LOCUS_3540 gene gmk 2243 2818 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_3540 2818 3396 gene locus_tag LOCUS_3550 gene nadD 2818 3396 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116975564.1 protein_id gnl|my_center|LOCUS_3550 3393 3992 gene locus_tag LOCUS_3560 3393 3992 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_3560 4182 4501 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttagtggaatatgctctttgag >Feature sequence074 1743 367 gene locus_tag LOCUS_3570 1743 367 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_3570 2311 1775 gene locus_tag LOCUS_3580 2311 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 3345 2503 gene locus_tag LOCUS_3590 gene speB 3345 2503 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_3590 >Feature sequence075 1095 190 gene locus_tag LOCUS_3600 gene miaA 1095 190 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_3600 1687 1076 gene locus_tag LOCUS_3610 1687 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 2476 1760 gene locus_tag LOCUS_3620 2476 1760 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768977.1 protein_id gnl|my_center|LOCUS_3620 3916 2555 gene locus_tag LOCUS_3630 3916 2555 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_3630 <4499 3941 gene locus_tag LOCUS_3640 <4499 3941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760849.1:triose-phosphate isomerase >Feature sequence076 377 1375 gene locus_tag LOCUS_3650 gene pta 377 1375 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_3650 1440 3143 gene locus_tag LOCUS_3660 1440 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 3163 3558 gene locus_tag LOCUS_3670 3163 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964368.1 protein_id gnl|my_center|LOCUS_3670 3889 4422 gene locus_tag LOCUS_3680 3889 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 >Feature sequence077 315 13 gene locus_tag LOCUS_3690 315 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 874 356 gene locus_tag LOCUS_3700 874 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 1446 907 gene locus_tag LOCUS_3710 1446 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 1650 3209 gene locus_tag LOCUS_3720 1650 3209 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_3720 3231 4199 gene locus_tag LOCUS_3730 3231 4199 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789537.1 protein_id gnl|my_center|LOCUS_3730 4250 4323 gene locus_tag LOCUS_t0120 4250 4323 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 3436 1691 gene locus_tag LOCUS_3740 gene aspS 3436 1691 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_3740 4363 3449 gene locus_tag LOCUS_3750 4363 3449 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_3750 >Feature sequence079 567 2129 gene locus_tag LOCUS_3760 gene rny 567 2129 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_3760 3132 2164 gene locus_tag LOCUS_3770 gene dusB 3132 2164 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_3770 3738 3145 gene locus_tag LOCUS_3780 3738 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 >Feature sequence080 21 1226 gene locus_tag LOCUS_3790 21 1226 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_3790 1223 2287 gene locus_tag LOCUS_3800 1223 2287 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_3800 2324 3637 gene locus_tag LOCUS_3810 2324 3637 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964343.1 protein_id gnl|my_center|LOCUS_3810 >Feature sequence081 <1 1061 gene locus_tag LOCUS_3820 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785097.1:bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase 1201 3036 gene locus_tag LOCUS_3830 1201 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 3041 3562 gene locus_tag LOCUS_3840 3041 3562 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_3840 >Feature sequence082 789 705 gene locus_tag LOCUS_t0130 789 705 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1276 2481 gene locus_tag LOCUS_3850 1276 2481 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_3850 >Feature sequence083 <1 706 gene locus_tag LOCUS_3860 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203604.1:glycosyltransferase N-terminal domain-containing protein 758 3193 gene locus_tag LOCUS_3870 758 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 >Feature sequence084 <1 645 gene locus_tag LOCUS_3880 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962384.1:radical SAM family heme chaperone HemW 1010 2398 gene locus_tag LOCUS_3890 gene fumC 1010 2398 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_3890 2411 4051 gene locus_tag LOCUS_3900 2411 4051 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_3900 >Feature sequence085 449 901 gene locus_tag LOCUS_3910 449 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 929 2200 gene locus_tag LOCUS_3920 gene wzx 929 2200 CDS product O-antigen flipase Wzx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119725.1 protein_id gnl|my_center|LOCUS_3920 2617 3480 gene locus_tag LOCUS_3930 2617 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 >Feature sequence086 1560 2399 gene locus_tag LOCUS_3940 1560 2399 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_3940 3096 2485 gene locus_tag LOCUS_3950 3096 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 >Feature sequence087 525 451 gene locus_tag LOCUS_t0140 525 451 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 648 2630 gene locus_tag LOCUS_3960 gene gyrB 648 2630 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_3960 2709 3887 gene locus_tag LOCUS_3970 2709 3887 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_3970 3984 4271 gene locus_tag LOCUS_3980 3984 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 >Feature sequence088 1034 375 gene locus_tag LOCUS_3990 1034 375 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_3990 2176 1040 gene locus_tag LOCUS_4000 2176 1040 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860104.1 protein_id gnl|my_center|LOCUS_4000 3604 2261 gene locus_tag LOCUS_4010 3604 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_4010 <4267 3706 gene locus_tag LOCUS_4020 <4267 3706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962842.1:transketolase >Feature sequence089 1353 952 gene locus_tag LOCUS_4030 1353 952 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203080.1 protein_id gnl|my_center|LOCUS_4030 2335 1406 gene locus_tag LOCUS_4040 2335 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 2560 4074 gene locus_tag LOCUS_4050 gene gltX 2560 4074 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_4050 >Feature sequence090 986 372 gene locus_tag LOCUS_4060 986 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 2145 1300 gene locus_tag LOCUS_4070 2145 1300 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_4070 2670 2263 gene locus_tag LOCUS_4080 2670 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 3295 2738 gene locus_tag LOCUS_4090 3295 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 >Feature sequence091 515 258 gene locus_tag LOCUS_4100 515 258 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_4100 1151 525 gene locus_tag LOCUS_4110 1151 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_4110 2322 1144 gene locus_tag LOCUS_4120 2322 1144 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964359.1 protein_id gnl|my_center|LOCUS_4120 3435 2347 gene locus_tag LOCUS_4130 3435 2347 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_4130 <4208 3578 gene locus_tag LOCUS_4140 <4208 3578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948945.1:iron ABC transporter permease >Feature sequence092 <1 812 gene locus_tag LOCUS_4150 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763724.1:GNAT family N-acetyltransferase 900 1550 gene locus_tag LOCUS_4160 900 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 1563 2390 gene locus_tag LOCUS_4170 1563 2390 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_4170 2399 3547 gene locus_tag LOCUS_4180 2399 3547 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_4180 >Feature sequence093 863 378 gene locus_tag LOCUS_4190 gene ispF 863 378 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791741.1 protein_id gnl|my_center|LOCUS_4190 2108 876 gene locus_tag LOCUS_4200 2108 876 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976696.1 protein_id gnl|my_center|LOCUS_4200 3587 2133 gene locus_tag LOCUS_4210 3587 2133 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_4210 >Feature sequence094 836 2287 gene locus_tag LOCUS_4220 gene gldK 836 2287 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_4220 2371 3078 gene locus_tag LOCUS_4230 gene gldL 2371 3078 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_4230 >Feature sequence095 2 1039 gene locus_tag LOCUS_4240 2 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 2164 1049 gene locus_tag LOCUS_4250 2164 1049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107327.1 protein_id gnl|my_center|LOCUS_4250 3271 2168 gene locus_tag LOCUS_4260 3271 2168 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_4260 >Feature sequence096 384 1922 gene locus_tag LOCUS_4270 gene dnaB 384 1922 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_4270 1932 2819 gene locus_tag LOCUS_4280 gene era 1932 2819 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_4280 3167 2940 gene locus_tag LOCUS_4290 3167 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 3268 3468 gene locus_tag LOCUS_4300 3268 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 >Feature sequence097 1841 354 gene locus_tag LOCUS_4310 1841 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 3555 1900 gene locus_tag LOCUS_4320 3555 1900 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_4320 3983 3552 gene locus_tag LOCUS_4330 gene rnpA 3983 3552 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964465.1 protein_id gnl|my_center|LOCUS_4330 >Feature sequence098 2078 288 gene locus_tag LOCUS_4340 2078 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 <4128 2071 gene locus_tag LOCUS_4350 <4128 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797422.1:tetratricopeptide repeat protein >Feature sequence099 2857 365 gene locus_tag LOCUS_4360 2857 365 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_4360 3225 2989 gene locus_tag LOCUS_4370 gene rpmB 3225 2989 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_4370 4097 3561 gene locus_tag LOCUS_4380 4097 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 >Feature sequence100 1430 2833 gene locus_tag LOCUS_4390 1430 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 2891 3469 gene locus_tag LOCUS_4400 2891 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 >Feature sequence101 157 1059 gene locus_tag LOCUS_4410 157 1059 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099264473.1 protein_id gnl|my_center|LOCUS_4410 1167 2369 gene locus_tag LOCUS_4420 1167 2369 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_4420 2372 2839 gene locus_tag LOCUS_4430 2372 2839 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_4430 2847 3785 gene locus_tag LOCUS_4440 2847 3785 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_4440 >Feature sequence102 3211 578 gene locus_tag LOCUS_4450 3211 578 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_4450 3796 3482 gene locus_tag LOCUS_4460 3796 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 >Feature sequence103 271 1161 gene locus_tag LOCUS_4470 271 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 1161 2123 gene locus_tag LOCUS_4480 1161 2123 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_4480 2838 2913 gene locus_tag LOCUS_t0150 2838 2913 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4053 2992 gene locus_tag LOCUS_4490 4053 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 >Feature sequence104 2019 3359 gene locus_tag LOCUS_4500 2019 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 3645 3496 gene locus_tag LOCUS_4510 3645 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 >Feature sequence105 <1 1344 gene locus_tag LOCUS_4520 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962290.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 1373 2401 gene locus_tag LOCUS_4530 gene tsaD 1373 2401 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_4530 2411 3139 gene locus_tag LOCUS_4540 gene fabG 2411 3139 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_4540 3350 3811 gene locus_tag LOCUS_4550 3350 3811 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507213.1 protein_id gnl|my_center|LOCUS_4550 >Feature sequence106 <1 840 gene locus_tag LOCUS_4560 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767918.1:signal recognition particle protein 844 2301 gene locus_tag LOCUS_4570 844 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 >Feature sequence107 38 111 gene locus_tag LOCUS_t0160 38 111 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1219 260 gene locus_tag LOCUS_4580 1219 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 3670 1250 gene locus_tag LOCUS_4590 3670 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 >Feature sequence108 2306 270 gene locus_tag LOCUS_4600 2306 270 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_4600 3984 2374 gene locus_tag LOCUS_4610 3984 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 >Feature sequence109 506 1336 gene locus_tag LOCUS_4620 506 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 1373 2656 gene locus_tag LOCUS_4630 1373 2656 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_4630 2735 3640 gene locus_tag LOCUS_4640 gene ptb 2735 3640 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_4640 >Feature sequence110 244 783 gene locus_tag LOCUS_4650 244 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 904 1755 gene locus_tag LOCUS_4660 904 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 1777 2211 gene locus_tag LOCUS_4670 1777 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 2261 3865 gene locus_tag LOCUS_4680 2261 3865 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_4680 >Feature sequence111 768 1577 gene locus_tag LOCUS_4690 768 1577 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_4690 1730 2119 gene locus_tag LOCUS_4700 gene rpsL 1730 2119 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_4700 2206 2673 gene locus_tag LOCUS_4710 gene rpsG 2206 2673 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_4710 >Feature sequence112 <1 659 gene locus_tag LOCUS_4720 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964345.1:NAD(P)/FAD-dependent oxidoreductase 1129 677 gene locus_tag LOCUS_4730 1129 677 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_4730 2983 1184 gene locus_tag LOCUS_4740 2983 1184 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_4740 3587 3054 gene locus_tag LOCUS_4750 3587 3054 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_4750 >Feature sequence113 >Feature sequence114 318 1505 gene locus_tag LOCUS_4760 318 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 >Feature sequence115 91 372 gene locus_tag LOCUS_4770 91 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4770 394 1218 gene locus_tag LOCUS_4780 394 1218 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_4780 2116 1226 gene locus_tag LOCUS_4790 2116 1226 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_4790 2962 2123 gene locus_tag LOCUS_4800 2962 2123 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_4800 >Feature sequence116 2271 175 gene locus_tag LOCUS_4810 2271 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_4810 2575 3819 gene locus_tag LOCUS_4820 2575 3819 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 protein_id gnl|my_center|LOCUS_4820 >Feature sequence117 2842 365 gene locus_tag LOCUS_4830 2842 365 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_4830 <3942 3028 gene locus_tag LOCUS_4840 <3942 3028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763756.1:AAA family ATPase >Feature sequence118 2054 2800 gene locus_tag LOCUS_4850 gene recO 2054 2800 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_4850 3925 2840 gene locus_tag LOCUS_4860 3925 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 >Feature sequence119 1945 611 gene locus_tag LOCUS_4870 gene rsxC 1945 611 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_4870 2842 1991 gene locus_tag LOCUS_4880 2842 1991 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_4880 3057 3695 gene locus_tag LOCUS_4890 3057 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 >Feature sequence120 2487 1321 gene locus_tag LOCUS_4900 2487 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 3190 2570 gene locus_tag LOCUS_4910 3190 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 3668 3144 gene locus_tag LOCUS_4920 3668 3144 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787274.1 protein_id gnl|my_center|LOCUS_4920 >Feature sequence121 1553 1089 gene locus_tag LOCUS_4930 gene rplO 1553 1089 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_4930 1769 1590 gene locus_tag LOCUS_4940 gene rpmD 1769 1590 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_4940 <3876 2022 gene locus_tag LOCUS_4950 <3876 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103821.1:LTA synthase family protein >Feature sequence122 2958 1993 gene locus_tag LOCUS_4960 gene rfaD 2958 1993 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_4960 3773 3039 gene locus_tag LOCUS_4970 3773 3039 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202003.1 protein_id gnl|my_center|LOCUS_4970 >Feature sequence123 3780 271 gene locus_tag LOCUS_4980 3780 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 >Feature sequence124 1452 475 gene locus_tag LOCUS_4990 gene ribD 1452 475 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_4990 1820 1452 gene locus_tag LOCUS_5000 1820 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 3210 1813 gene locus_tag LOCUS_5010 3210 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 <3839 3226 gene locus_tag LOCUS_5020 <3839 3226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963730.1:DUF4159 domain-containing protein >Feature sequence125 1386 883 gene locus_tag LOCUS_5030 1386 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 1714 1409 gene locus_tag LOCUS_5040 1714 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 1851 2249 gene locus_tag LOCUS_5050 1851 2249 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_5050 2255 3049 gene locus_tag LOCUS_5060 2255 3049 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_5060 >Feature sequence126 <1 549 gene locus_tag LOCUS_5070 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765874.1:Na(+)-translocating NADH-quinone reductase subunit A 553 1692 gene locus_tag LOCUS_5080 553 1692 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_5080 >Feature sequence127 1188 823 gene locus_tag LOCUS_5090 1188 823 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_5090 1740 1279 gene locus_tag LOCUS_5100 1740 1279 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_5100 2852 1830 gene locus_tag LOCUS_5110 2852 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 <3805 2903 gene locus_tag LOCUS_5120 <3805 2903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796577.1:sodium-dependent transporter >Feature sequence128 740 42 gene locus_tag LOCUS_5130 740 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 935 2104 gene locus_tag LOCUS_5140 935 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 2151 2687 gene locus_tag LOCUS_5150 2151 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 2723 3646 gene locus_tag LOCUS_5160 2723 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 >Feature sequence129 528 1271 gene locus_tag LOCUS_5170 528 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 1278 3152 gene locus_tag LOCUS_5180 1278 3152 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963039.1 protein_id gnl|my_center|LOCUS_5180 3165 3479 gene locus_tag LOCUS_5190 gene trxA 3165 3479 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_5190 >Feature sequence130 <1 1101 gene locus_tag LOCUS_5200 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964031.1:anhydro-N-acetylmuramic acid kinase 1220 3553 gene locus_tag LOCUS_5210 1220 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 >Feature sequence131 187 1245 gene locus_tag LOCUS_5220 gene queA 187 1245 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_5220 1249 2277 gene locus_tag LOCUS_5230 1249 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 2281 3681 gene locus_tag LOCUS_5240 gene xseA 2281 3681 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546335.1 protein_id gnl|my_center|LOCUS_5240 >Feature sequence132 89 841 gene locus_tag LOCUS_5250 89 841 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_5250 843 1496 gene locus_tag LOCUS_5260 843 1496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_5260 2505 1531 gene locus_tag LOCUS_5270 2505 1531 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_5270 >Feature sequence133 2510 384 gene locus_tag LOCUS_5280 2510 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 <3741 2534 gene locus_tag LOCUS_5290 <3741 2534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964346.1:MMPL family transporter >Feature sequence134 <1 1299 gene locus_tag LOCUS_5300 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962252.1:tetratricopeptide repeat protein 1302 2042 gene locus_tag LOCUS_5310 1302 2042 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_5310 2029 3306 gene locus_tag LOCUS_5320 2029 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 >Feature sequence135 1067 156 gene locus_tag LOCUS_5330 1067 156 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_5330 <3729 1085 gene locus_tag LOCUS_5340 <3729 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789604.1:excinuclease ABC subunit UvrA >Feature sequence136 <1 980 gene locus_tag LOCUS_5350 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939053.1:[FeFe] hydrogenase H-cluster radical SAM maturase HydG 1092 1430 gene locus_tag LOCUS_5360 1092 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 1549 2136 gene locus_tag LOCUS_5370 1549 2136 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_5370 2170 3633 gene locus_tag LOCUS_5380 2170 3633 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707191.1 protein_id gnl|my_center|LOCUS_5380 >Feature sequence137 1194 715 gene locus_tag LOCUS_5390 1194 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 1304 2302 gene locus_tag LOCUS_5400 1304 2302 CDS product protein tlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963548.1 protein_id gnl|my_center|LOCUS_5400 2369 3571 gene locus_tag LOCUS_5410 2369 3571 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962581.1 protein_id gnl|my_center|LOCUS_5410 >Feature sequence138 2511 1222 gene locus_tag LOCUS_5420 2511 1222 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129252674.1 protein_id gnl|my_center|LOCUS_5420 3539 2523 gene locus_tag LOCUS_5430 gene pheS 3539 2523 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_5430 >Feature sequence139 84 1112 gene locus_tag LOCUS_5440 84 1112 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_5440 1140 1847 gene locus_tag LOCUS_5450 1140 1847 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760815.1 protein_id gnl|my_center|LOCUS_5450 1962 2324 gene locus_tag LOCUS_5460 gene rpsF 1962 2324 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_5460 2328 2603 gene locus_tag LOCUS_5470 gene rpsR 2328 2603 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_5470 2619 3083 gene locus_tag LOCUS_5480 gene rplI 2619 3083 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_5480 3087 3257 gene locus_tag LOCUS_5490 3087 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 >Feature sequence140 <1 1461 gene locus_tag LOCUS_5500 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786228.1:C69 family dipeptidase 1633 1704 gene locus_tag LOCUS_t0170 1633 1704 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1783 3054 gene locus_tag LOCUS_5510 gene nusA 1783 3054 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_5510 >Feature sequence141 1500 160 gene locus_tag LOCUS_5520 1500 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 2921 1851 gene locus_tag LOCUS_5530 2921 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 >Feature sequence142 1734 2762 gene locus_tag LOCUS_5540 1734 2762 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_5540 2819 3274 gene locus_tag LOCUS_5550 gene mscL 2819 3274 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147388001.1 protein_id gnl|my_center|LOCUS_5550 >Feature sequence143 2173 1640 gene locus_tag LOCUS_5560 2173 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 >Feature sequence144 <1 2834 gene locus_tag LOCUS_5570 <1 2834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804147.1:efflux RND transporter permease subunit 2898 3233 gene locus_tag LOCUS_5580 2898 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 >Feature sequence145 211 2 gene locus_tag LOCUS_5590 211 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 311 2920 gene locus_tag LOCUS_5600 gene alaS 311 2920 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_5600 >Feature sequence146 205 1287 gene locus_tag LOCUS_5610 gene mnmA 205 1287 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948825.1 protein_id gnl|my_center|LOCUS_5610 2412 1342 gene locus_tag LOCUS_5620 gene hydE 2412 1342 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_5620 <3558 2438 gene locus_tag LOCUS_5630 <3558 2438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108648.1:leucine--tRNA ligase >Feature sequence147 268 636 gene locus_tag LOCUS_5640 268 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 779 1123 gene locus_tag LOCUS_5650 779 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 1220 1294 gene locus_tag LOCUS_t0180 1220 1294 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1319 2692 gene locus_tag LOCUS_5660 gene mnmE 1319 2692 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962791.1 protein_id gnl|my_center|LOCUS_5660 <3553 2654 gene locus_tag LOCUS_5670 <3553 2654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766203.1:metallophosphoesterase >Feature sequence148 <1 987 gene locus_tag LOCUS_5680 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851428.1:ATP-binding protein 1007 2296 gene locus_tag LOCUS_5690 1007 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 >Feature sequence149 2589 955 gene locus_tag LOCUS_5700 2589 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 <3534 2970 gene locus_tag LOCUS_5710 <3534 2970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202520.1:endolytic transglycosylase MltG >Feature sequence150 356 829 gene locus_tag LOCUS_5720 356 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 976 1782 gene locus_tag LOCUS_5730 976 1782 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_5730 1807 2799 gene locus_tag LOCUS_5740 1807 2799 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_5740 >Feature sequence151 <1 533 gene locus_tag LOCUS_5750 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 572 1666 gene locus_tag LOCUS_5760 572 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 1696 2274 gene locus_tag LOCUS_5770 1696 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 2348 2968 gene locus_tag LOCUS_5780 2348 2968 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_5780 3075 3162 gene locus_tag LOCUS_t0190 3075 3162 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 866 369 gene locus_tag LOCUS_5790 866 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 3509 1290 gene locus_tag LOCUS_5800 gene ccsA 3509 1290 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764579.1 protein_id gnl|my_center|LOCUS_5800 >Feature sequence153 3 794 gene locus_tag LOCUS_5810 gene map 3 794 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108453.1 protein_id gnl|my_center|LOCUS_5810 1447 800 gene locus_tag LOCUS_5820 1447 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 2108 1431 gene locus_tag LOCUS_5830 2108 1431 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054641.1 protein_id gnl|my_center|LOCUS_5830 2960 2214 gene locus_tag LOCUS_5840 2960 2214 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761172.1 protein_id gnl|my_center|LOCUS_5840 >Feature sequence154 1543 2427 gene locus_tag LOCUS_5850 1543 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 2418 2906 gene locus_tag LOCUS_5860 2418 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 >Feature sequence155 1085 132 gene locus_tag LOCUS_5870 1085 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 2539 1070 gene locus_tag LOCUS_5880 gene cysS 2539 1070 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_5880 2671 3435 gene locus_tag LOCUS_5890 gene rsmA 2671 3435 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962249.1 protein_id gnl|my_center|LOCUS_5890 >Feature sequence156 196 885 gene locus_tag LOCUS_5900 196 885 CDS product conjugal transfer protein TrbF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970261.1 protein_id gnl|my_center|LOCUS_5900 905 1990 gene locus_tag LOCUS_5910 905 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 1987 3201 gene locus_tag LOCUS_5920 1987 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 >Feature sequence157 2278 464 gene locus_tag LOCUS_5930 gene mrdA 2278 464 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_5930 3241 2279 gene locus_tag LOCUS_5940 3241 2279 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_5940 >Feature sequence158 <1 1348 gene locus_tag LOCUS_5950 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025814212.1:BatD family protein 1409 2446 gene locus_tag LOCUS_5960 gene lpxD 1409 2446 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_5960 2457 3365 gene locus_tag LOCUS_5970 2457 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence159 1333 179 gene locus_tag LOCUS_5980 1333 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 2608 1346 gene locus_tag LOCUS_5990 2608 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_5990 2966 2829 gene locus_tag LOCUS_6000 2966 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 2983 3303 gene locus_tag LOCUS_6010 2983 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 >Feature sequence160 1404 301 gene locus_tag LOCUS_6020 1404 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 >Feature sequence161 106 276 gene locus_tag LOCUS_6030 106 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 273 1517 gene locus_tag LOCUS_6040 273 1517 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_6040 3091 1550 gene locus_tag LOCUS_6050 3091 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 >Feature sequence162 219 1217 gene locus_tag LOCUS_6060 gene aroB 219 1217 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_6060 2513 1233 gene locus_tag LOCUS_6070 2513 1233 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_6070 >Feature sequence163 699 2492 gene locus_tag LOCUS_6080 699 2492 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_6080 >Feature sequence164 <1 741 gene locus_tag LOCUS_6090 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764762.1:saccharopine dehydrogenase family protein 738 1622 gene locus_tag LOCUS_6100 738 1622 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_6100 >Feature sequence165 405 1577 gene locus_tag LOCUS_6110 405 1577 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 protein_id gnl|my_center|LOCUS_6110 >Feature sequence166 66 710 gene locus_tag LOCUS_6120 66 710 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_6120 714 1622 gene locus_tag LOCUS_6130 714 1622 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_6130 1619 2950 gene locus_tag LOCUS_6140 1619 2950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_6140 >Feature sequence167 1 798 gene locus_tag LOCUS_6150 1 798 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_6150 812 2629 gene locus_tag LOCUS_6160 812 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 >Feature sequence168 <3393 2001 gene locus_tag LOCUS_6170 <3393 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839622.1:carboxypeptidase regulatory-like domain-containing protein >Feature sequence169 >Feature sequence170 <1 1720 gene locus_tag LOCUS_6180 <1 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor 1982 1895 gene locus_tag LOCUS_t0200 1982 1895 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2108 3223 gene locus_tag LOCUS_6190 2108 3223 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962812.1 protein_id gnl|my_center|LOCUS_6190 >Feature sequence171 2 1093 gene locus_tag LOCUS_6200 2 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 1090 1812 gene locus_tag LOCUS_6210 1090 1812 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_6210 2879 1830 gene locus_tag LOCUS_6220 2879 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 >Feature sequence172 230 961 gene locus_tag LOCUS_6230 gene gldF 230 961 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_6230 981 2753 gene locus_tag LOCUS_6240 gene gldG 981 2753 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_6240 >Feature sequence173 225 1268 gene locus_tag LOCUS_6250 gene rlmN 225 1268 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_6250 1361 2437 gene locus_tag LOCUS_6260 gene buk 1361 2437 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964967.1 protein_id gnl|my_center|LOCUS_6260 <3346 2510 gene locus_tag LOCUS_6270 <3346 2510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765025.1:TonB-dependent receptor >Feature sequence174 941 693 gene locus_tag LOCUS_6280 941 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 1838 1062 gene locus_tag LOCUS_6290 1838 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 >Feature sequence175 <1 1107 gene locus_tag LOCUS_6300 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303123.1:insulinase family protein 2181 1249 gene locus_tag LOCUS_6310 2181 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 2404 3129 gene locus_tag LOCUS_6320 2404 3129 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_6320 >Feature sequence176 <3327 664 gene locus_tag LOCUS_6330 <3327 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962369.1:transcription-repair coupling factor >Feature sequence177 966 2396 gene locus_tag LOCUS_6340 966 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 >Feature sequence178 164 748 gene locus_tag LOCUS_6350 164 748 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_6350 989 1618 gene locus_tag LOCUS_6360 989 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_6360 1623 1913 gene locus_tag LOCUS_6370 1623 1913 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_6370 3161 1977 gene locus_tag LOCUS_6380 3161 1977 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_6380 >Feature sequence179 825 2258 gene locus_tag LOCUS_6390 825 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 2460 3020 gene locus_tag LOCUS_6400 2460 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 >Feature sequence180 449 2287 gene locus_tag LOCUS_6410 449 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 >Feature sequence181 286 214 gene locus_tag LOCUS_t0210 286 214 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 711 2483 gene locus_tag LOCUS_6420 711 2483 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_6420 >Feature sequence182 <1 1365 gene locus_tag LOCUS_6430 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108646.1:DNA mismatch repair protein MutS note possible pseudo, internal stop codon 1477 2586 gene locus_tag LOCUS_6440 1477 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6440 >Feature sequence183 2493 1753 gene locus_tag LOCUS_6450 2493 1753 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776430.1 protein_id gnl|my_center|LOCUS_6450 2655 2897 gene locus_tag LOCUS_6460 2655 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 >Feature sequence184 <1 648 gene locus_tag LOCUS_6470 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108742.1:polysaccharide biosynthesis C-terminal domain-containing protein 784 1086 gene locus_tag LOCUS_6480 784 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6480 1099 2784 gene locus_tag LOCUS_6490 1099 2784 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6490 >Feature sequence185 <1 533 gene locus_tag LOCUS_6500 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763485.1:DUF1015 domain-containing protein 657 2369 gene locus_tag LOCUS_6510 657 2369 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_6510 >Feature sequence186 2 262 gene locus_tag LOCUS_6520 2 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 263 1645 gene locus_tag LOCUS_6530 263 1645 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_6530 1669 2004 gene locus_tag LOCUS_6540 1669 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_6540 2015 2755 gene locus_tag LOCUS_6550 2015 2755 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_6550 >Feature sequence187 1011 418 gene locus_tag LOCUS_6560 1011 418 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_6560 1175 1879 gene locus_tag LOCUS_6570 1175 1879 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840104.1 protein_id gnl|my_center|LOCUS_6570 1866 2375 gene locus_tag LOCUS_6580 gene ribH 1866 2375 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_6580 >Feature sequence188 597 920 gene locus_tag LOCUS_6590 597 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 925 1698 gene locus_tag LOCUS_6600 925 1698 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_6600 1713 2606 gene locus_tag LOCUS_6610 1713 2606 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_6610 >Feature sequence189 <1 2190 gene locus_tag LOCUS_6620 <1 2190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249075.1:4Fe-4S binding protein 2721 2227 gene locus_tag LOCUS_6630 2721 2227 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_6630 >Feature sequence190 793 200 gene locus_tag LOCUS_6640 793 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 1132 1779 gene locus_tag LOCUS_6650 1132 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 1748 2407 gene locus_tag LOCUS_6660 1748 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 <3172 2494 gene locus_tag LOCUS_6670 <3172 2494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I >Feature sequence191 787 1377 gene locus_tag LOCUS_6680 787 1377 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_6680 1492 2574 gene locus_tag LOCUS_6690 1492 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 >Feature sequence192 <1 2275 gene locus_tag LOCUS_6700 <1 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813448.1:TonB-dependent receptor <3149 2272 gene locus_tag LOCUS_6710 <3149 2272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337008.1:NAD(+) synthase >Feature sequence193 1134 16 gene locus_tag LOCUS_6720 1134 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 2193 1219 gene locus_tag LOCUS_6730 2193 1219 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_6730 2538 2221 gene locus_tag LOCUS_6740 2538 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 >Feature sequence194 962 525 gene locus_tag LOCUS_6750 962 525 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794207.1 protein_id gnl|my_center|LOCUS_6750 1105 2265 gene locus_tag LOCUS_6760 1105 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 >Feature sequence195 205 486 gene locus_tag LOCUS_6770 205 486 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762277.1 protein_id gnl|my_center|LOCUS_6770 708 2276 gene locus_tag LOCUS_6780 708 2276 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_6780 >Feature sequence196 489 1121 gene locus_tag LOCUS_6790 gene pnuC 489 1121 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108279.1 protein_id gnl|my_center|LOCUS_6790 1164 1919 gene locus_tag LOCUS_6800 gene dapB 1164 1919 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_6800 >Feature sequence197 <1 1346 gene locus_tag LOCUS_6810 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787605.1:alpha amylase C-terminal domain-containing protein >Feature sequence198 711 238 gene locus_tag LOCUS_6820 711 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 852 1991 gene locus_tag LOCUS_6830 852 1991 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964380.1 protein_id gnl|my_center|LOCUS_6830 1995 2573 gene locus_tag LOCUS_6840 1995 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 >Feature sequence199 840 307 gene locus_tag LOCUS_6850 840 307 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_6850 1851 871 gene locus_tag LOCUS_6860 1851 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 2956 1862 gene locus_tag LOCUS_6870 2956 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 >Feature sequence200 1902 907 gene locus_tag LOCUS_6880 1902 907 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_6880 2853 1912 gene locus_tag LOCUS_6890 gene arcC 2853 1912 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_6890 >Feature sequence201 610 1221 gene locus_tag LOCUS_6900 gene elbB 610 1221 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210143.1 protein_id gnl|my_center|LOCUS_6900 1235 1366 gene locus_tag LOCUS_6910 1235 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6910 1388 2839 gene locus_tag LOCUS_6920 gene pyrG 1388 2839 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_6920 >Feature sequence202 1118 1192 gene locus_tag LOCUS_t0220 1118 1192 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2579 1233 gene locus_tag LOCUS_6930 2579 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 2746 2573 gene locus_tag LOCUS_6940 2746 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 >Feature sequence203 2 490 gene locus_tag LOCUS_6950 2 490 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_6950 496 2178 gene locus_tag LOCUS_6960 496 2178 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_6960 2813 2962 gene locus_tag LOCUS_6970 2813 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 >Feature sequence204 104 1249 gene locus_tag LOCUS_6980 104 1249 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460692.1 protein_id gnl|my_center|LOCUS_6980 >Feature sequence205 652 272 gene locus_tag LOCUS_6990 gene yajC 652 272 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_6990 1131 697 gene locus_tag LOCUS_7000 1131 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 2005 1262 gene locus_tag LOCUS_7010 gene gpmA 2005 1262 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107928.1 protein_id gnl|my_center|LOCUS_7010 2369 2022 gene locus_tag LOCUS_7020 2369 2022 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_7020 2990 2382 gene locus_tag LOCUS_7030 2990 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 >Feature sequence206 448 1212 gene locus_tag LOCUS_7040 gene sufC 448 1212 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763669.1 protein_id gnl|my_center|LOCUS_7040 1216 2604 gene locus_tag LOCUS_7050 gene sufD 1216 2604 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_7050 >Feature sequence207 375 1112 gene locus_tag LOCUS_7060 375 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 1102 2238 gene locus_tag LOCUS_7070 1102 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 >Feature sequence208 470 1081 gene locus_tag LOCUS_7080 470 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 1438 1968 gene locus_tag LOCUS_7090 1438 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 >Feature sequence209 727 155 gene locus_tag LOCUS_7100 727 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 1331 729 gene locus_tag LOCUS_7110 1331 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 2133 1492 gene locus_tag LOCUS_7120 2133 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 2618 2136 gene locus_tag LOCUS_7130 gene folK 2618 2136 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_7130 >Feature sequence210 735 2321 gene locus_tag LOCUS_7140 735 2321 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387166.1 protein_id gnl|my_center|LOCUS_7140 >Feature sequence211 1327 296 gene locus_tag LOCUS_7150 gene ruvB 1327 296 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762892.1 protein_id gnl|my_center|LOCUS_7150 2020 1445 gene locus_tag LOCUS_7160 gene rsxA 2020 1445 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_7160 2632 2045 gene locus_tag LOCUS_7170 2632 2045 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_7170 >Feature sequence212 <1 1164 gene locus_tag LOCUS_7180 <1 1164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583609.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 1164 2144 gene locus_tag LOCUS_7190 1164 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 >Feature sequence213 <1 704 gene locus_tag LOCUS_7200 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784846.1:DUF5683 domain-containing protein 737 1402 gene locus_tag LOCUS_7210 gene ung 737 1402 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence214 <1 1043 gene locus_tag LOCUS_7220 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962553.1:S46 family peptidase 1053 1484 gene locus_tag LOCUS_7230 gene dut 1053 1484 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_7230 >Feature sequence215 1637 945 gene locus_tag LOCUS_7240 gene tsaA 1637 945 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_7240 <2900 1644 gene locus_tag LOCUS_7250 <2900 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037869.1:UDP-N-acetyl-alpha-D-muramoyl-L-alanyl-L-glutamate epimerase >Feature sequence216 2608 1259 gene locus_tag LOCUS_7260 2608 1259 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_7260 >Feature sequence217 436 1527 gene locus_tag LOCUS_7270 436 1527 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129003072.1 protein_id gnl|my_center|LOCUS_7270 1518 2120 gene locus_tag LOCUS_7280 gene sigW 1518 2120 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_7280 <2863 2126 gene locus_tag LOCUS_7290 <2863 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784666.1:16S rRNA (cytidine(1402)-2'-O)-methyltransferase >Feature sequence218 <1 2447 gene locus_tag LOCUS_7300 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767925.1:ferrous iron transport protein B >Feature sequence219 470 1348 gene locus_tag LOCUS_7310 470 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 1854 1345 gene locus_tag LOCUS_7320 1854 1345 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763722.1 protein_id gnl|my_center|LOCUS_7320 >Feature sequence220 313 1392 gene locus_tag LOCUS_7330 gene prfA 313 1392 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759884.1 protein_id gnl|my_center|LOCUS_7330 1394 2383 gene locus_tag LOCUS_7340 1394 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 2383 2802 gene locus_tag LOCUS_7350 2383 2802 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_7350 >Feature sequence221 <1 909 gene locus_tag LOCUS_7360 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762838.1:tyrosine--tRNA ligase 909 1514 gene locus_tag LOCUS_7370 909 1514 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_7370 1511 2101 gene locus_tag LOCUS_7380 1511 2101 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_7380 2113 2721 gene locus_tag LOCUS_7390 gene nqrE 2113 2721 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence222 460 2757 gene locus_tag LOCUS_7400 460 2757 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_7400 >Feature sequence223 515 1255 gene locus_tag LOCUS_7410 515 1255 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_7410 2224 1280 gene locus_tag LOCUS_7420 gene xerD 2224 1280 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_7420 2569 2643 gene locus_tag LOCUS_t0230 2569 2643 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence224 1537 608 gene locus_tag LOCUS_7430 1537 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 1723 2307 gene locus_tag LOCUS_7440 1723 2307 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_7440 >Feature sequence225 1034 258 gene locus_tag LOCUS_7450 1034 258 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_7450 1958 1071 gene locus_tag LOCUS_7460 1958 1071 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_7460 >Feature sequence226 2307 28 gene locus_tag LOCUS_7470 2307 28 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_7470 >Feature sequence227 1856 903 gene locus_tag LOCUS_7480 1856 903 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788767.1 protein_id gnl|my_center|LOCUS_7480 2491 1886 gene locus_tag LOCUS_7490 gene folE 2491 1886 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_7490 >Feature sequence228 206 778 gene locus_tag LOCUS_7500 gene coaE 206 778 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_7500 778 1497 gene locus_tag LOCUS_7510 778 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 <2789 1498 gene locus_tag LOCUS_7520 <2789 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963479.1:replication-associated recombination protein A >Feature sequence229 225 536 gene locus_tag LOCUS_7530 225 536 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_7530 630 1172 gene locus_tag LOCUS_7540 630 1172 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964857.1 protein_id gnl|my_center|LOCUS_7540 >Feature sequence230 <1 973 gene locus_tag LOCUS_7550 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768269.1:ABC transporter permease 2169 988 gene locus_tag LOCUS_7560 2169 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 >Feature sequence231 >Feature sequence232 195 539 gene locus_tag LOCUS_7570 195 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 2108 636 gene locus_tag LOCUS_7580 2108 636 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_7580 >Feature sequence233 >Feature sequence234 330 881 gene locus_tag LOCUS_7590 gene rfbC 330 881 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_7590 908 2008 gene locus_tag LOCUS_7600 908 2008 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_7600 >Feature sequence235 582 1202 gene locus_tag LOCUS_7610 582 1202 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_7610 1237 2727 gene locus_tag LOCUS_7620 1237 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 >Feature sequence236 642 570 gene locus_tag LOCUS_t0240 642 570 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1265 648 gene locus_tag LOCUS_7630 gene pth 1265 648 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_7630 1321 2043 gene locus_tag LOCUS_7640 1321 2043 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_7640 <2739 2047 gene locus_tag LOCUS_7650 <2739 2047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964438.1:HAMP domain-containing sensor histidine kinase >Feature sequence237 <2737 1397 gene locus_tag LOCUS_7660 <2737 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870108.1:3-isopropylmalate dehydratase large subunit >Feature sequence238 123 368 gene locus_tag LOCUS_7670 123 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7670 361 771 gene locus_tag LOCUS_7680 361 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 781 912 gene locus_tag LOCUS_7690 781 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 923 1552 gene locus_tag LOCUS_7700 923 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 >Feature sequence239 1548 439 gene locus_tag LOCUS_7710 1548 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 >Feature sequence240 <1 1146 gene locus_tag LOCUS_7720 <1 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765467.1:tetraacyldisaccharide 4'-kinase 1110 1922 gene locus_tag LOCUS_7730 1110 1922 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_7730 >Feature sequence241 1991 1089 gene locus_tag LOCUS_7740 1991 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 2579 2046 gene locus_tag LOCUS_7750 2579 2046 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_7750 >Feature sequence242 249 1142 gene locus_tag LOCUS_7760 249 1142 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_7760 1148 1468 gene locus_tag LOCUS_7770 1148 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7770 1475 2269 gene locus_tag LOCUS_7780 1475 2269 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_7780 >Feature sequence243 191 928 gene locus_tag LOCUS_7790 191 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7790 1029 2312 gene locus_tag LOCUS_7800 1029 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 >Feature sequence244 >Feature sequence245 151 1251 gene locus_tag LOCUS_7810 151 1251 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_7810 1367 2020 gene locus_tag LOCUS_7820 1367 2020 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_7820 >Feature sequence246 627 1670 gene locus_tag LOCUS_7830 627 1670 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_7830 1712 2023 gene locus_tag LOCUS_7840 1712 2023 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_7840 2016 2354 gene locus_tag LOCUS_7850 2016 2354 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_7850 >Feature sequence247 1936 782 gene locus_tag LOCUS_7860 gene mtaB 1936 782 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_7860 2083 2202 gene locus_tag LOCUS_7870 2083 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 2227 2526 gene locus_tag LOCUS_7880 2227 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 >Feature sequence248 1457 768 gene locus_tag LOCUS_7890 1457 768 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_7890 2639 1461 gene locus_tag LOCUS_7900 2639 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7900 >Feature sequence249 722 27 gene locus_tag LOCUS_7910 gene ubiE 722 27 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_7910 2027 735 gene locus_tag LOCUS_7920 2027 735 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_7920 <2624 2046 gene locus_tag LOCUS_7930 <2624 2046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761550.1:C4-type zinc ribbon domain-containing protein >Feature sequence250 <1 660 gene locus_tag LOCUS_7940 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963005.1:excinuclease ABC subunit UvrA 1655 669 gene locus_tag LOCUS_7950 1655 669 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_7950 1813 2439 gene locus_tag LOCUS_7960 gene rsmG 1813 2439 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_7960 >Feature sequence251 218 302 gene locus_tag LOCUS_t0250 218 302 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 387 1259 gene locus_tag LOCUS_7970 387 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 1570 1487 gene locus_tag LOCUS_t0260 1570 1487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence252 184 2079 gene locus_tag LOCUS_7980 gene dxs 184 2079 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_7980 >Feature sequence253 1826 1161 gene locus_tag LOCUS_7990 1826 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 <2589 1841 gene locus_tag LOCUS_8000 <2589 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802230.1:lysine--tRNA ligase >Feature sequence254 932 1621 gene locus_tag LOCUS_8010 932 1621 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215631.1 protein_id gnl|my_center|LOCUS_8010 2339 1911 gene locus_tag LOCUS_8020 2339 1911 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476617.1 protein_id gnl|my_center|LOCUS_8020 2551 2336 gene locus_tag LOCUS_8030 2551 2336 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704279.1 protein_id gnl|my_center|LOCUS_8030 >Feature sequence255 2399 1059 gene locus_tag LOCUS_8040 2399 1059 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_8040 >Feature sequence256 1433 2269 gene locus_tag LOCUS_8050 gene prmA 1433 2269 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_8050 >Feature sequence257 <1 573 gene locus_tag LOCUS_8060 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963888.1:imidazolonepropionase 595 1440 gene locus_tag LOCUS_8070 595 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 2233 1829 gene locus_tag LOCUS_8080 2233 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8080 >Feature sequence258 1790 846 gene locus_tag LOCUS_8090 gene rfbB 1790 846 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_8090 2462 1803 gene locus_tag LOCUS_8100 2462 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8100 >Feature sequence259 565 8 gene locus_tag LOCUS_8110 gene atpH 565 8 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_8110 1062 568 gene locus_tag LOCUS_8120 1062 568 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_8120 1436 1179 gene locus_tag LOCUS_8130 gene atpE 1436 1179 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_8130 <2524 1482 gene locus_tag LOCUS_8140 <2524 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787483.1:F0F1 ATP synthase subunit A >Feature sequence260 46 1059 gene locus_tag LOCUS_8150 46 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 1782 1078 gene locus_tag LOCUS_8160 1782 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8160 <2523 1804 gene locus_tag LOCUS_8170 <2523 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203339.1:cation:proton antiporter