>Feature sequence001 2003 99 gene locus_tag LOCUS_00010 2003 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3018 1996 gene locus_tag LOCUS_00020 gene asd 3018 1996 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881220.1 protein_id gnl|my_center|LOCUS_00020 3156 3551 gene locus_tag LOCUS_00030 3156 3551 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_00030 5269 3605 gene locus_tag LOCUS_00040 5269 3605 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456278.1 protein_id gnl|my_center|LOCUS_00040 5773 5354 gene locus_tag LOCUS_00050 5773 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6729 5770 gene locus_tag LOCUS_00060 6729 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7431 6745 gene locus_tag LOCUS_00070 gene pyrF 7431 6745 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942107.1 protein_id gnl|my_center|LOCUS_00070 10612 7439 gene locus_tag LOCUS_00080 10612 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13030 10667 gene locus_tag LOCUS_00090 13030 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15676 13064 gene locus_tag LOCUS_00100 15676 13064 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_00100 16035 15676 gene locus_tag LOCUS_00110 gene rbfA 16035 15676 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694530.1 protein_id gnl|my_center|LOCUS_00110 18812 16035 gene locus_tag LOCUS_00120 18812 16035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 19448 18816 gene locus_tag LOCUS_00130 19448 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20997 19438 gene locus_tag LOCUS_00140 gene nusA 20997 19438 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_00140 21478 20981 gene locus_tag LOCUS_00150 21478 20981 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_00150 21712 22932 gene locus_tag LOCUS_00160 gene coaBC 21712 22932 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392412.1 protein_id gnl|my_center|LOCUS_00160 22919 23383 gene locus_tag LOCUS_00170 22919 23383 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_00170 23390 24040 gene locus_tag LOCUS_00180 23390 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24070 27834 gene locus_tag LOCUS_00190 24070 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27854 28339 gene locus_tag LOCUS_00200 gene coaD 27854 28339 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941899.1 protein_id gnl|my_center|LOCUS_00200 28351 29913 gene locus_tag LOCUS_00210 28351 29913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 31575 29917 gene locus_tag LOCUS_00220 31575 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 34199 31623 gene locus_tag LOCUS_00230 34199 31623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 34321 35589 gene locus_tag LOCUS_00240 34321 35589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 >Feature sequence002 3761 921 gene locus_tag LOCUS_00250 3761 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 5080 3758 gene locus_tag LOCUS_00260 5080 3758 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_00260 5774 5262 gene locus_tag LOCUS_00270 5774 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 6685 5789 gene locus_tag LOCUS_00280 6685 5789 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203185.1 protein_id gnl|my_center|LOCUS_00280 8801 6714 gene locus_tag LOCUS_00290 8801 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 10429 8831 gene locus_tag LOCUS_00300 10429 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 12392 10482 gene locus_tag LOCUS_00310 12392 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 13143 12541 gene locus_tag LOCUS_00320 13143 12541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 13286 13768 gene locus_tag LOCUS_00330 13286 13768 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_00330 14849 13758 gene locus_tag LOCUS_00340 14849 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 16090 14867 gene locus_tag LOCUS_00350 gene pfp 16090 14867 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_00350 17573 16125 gene locus_tag LOCUS_00360 17573 16125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 19592 17595 gene locus_tag LOCUS_00370 19592 17595 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763503.1 protein_id gnl|my_center|LOCUS_00370 21984 19666 gene locus_tag LOCUS_00380 21984 19666 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296458.1 protein_id gnl|my_center|LOCUS_00380 23829 22036 gene locus_tag LOCUS_00390 23829 22036 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462045.1 protein_id gnl|my_center|LOCUS_00390 25281 23887 gene locus_tag LOCUS_00400 25281 23887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 25454 26644 gene locus_tag LOCUS_00410 gene nifS 25454 26644 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_00410 26664 27047 gene locus_tag LOCUS_00420 gene nifU 26664 27047 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_00420 27055 28194 gene locus_tag LOCUS_00430 27055 28194 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943259.1 protein_id gnl|my_center|LOCUS_00430 28243 29718 gene locus_tag LOCUS_00440 28243 29718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 29827 31590 gene locus_tag LOCUS_00450 29827 31590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 31779 32537 gene locus_tag LOCUS_00460 31779 32537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 32572 33228 gene locus_tag LOCUS_00470 32572 33228 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_00470 >Feature sequence003 373 2292 gene locus_tag LOCUS_00480 373 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2411 3781 gene locus_tag LOCUS_00490 2411 3781 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_00490 3814 5334 gene locus_tag LOCUS_00500 3814 5334 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_00500 5453 6910 gene locus_tag LOCUS_00510 5453 6910 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048040655.1 protein_id gnl|my_center|LOCUS_00510 9058 6923 gene locus_tag LOCUS_00520 9058 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 9290 10597 gene locus_tag LOCUS_00530 9290 10597 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_00530 10695 10964 gene locus_tag LOCUS_00540 10695 10964 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005845276.1 protein_id gnl|my_center|LOCUS_00540 10964 11212 gene locus_tag LOCUS_00550 10964 11212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 11209 11673 gene locus_tag LOCUS_00560 11209 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 12007 11932 gene locus_tag LOCUS_t00010 12007 11932 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12624 12046 gene locus_tag LOCUS_00570 gene nadD 12624 12046 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404800.1 protein_id gnl|my_center|LOCUS_00570 13774 12611 gene locus_tag LOCUS_00580 13774 12611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 14564 13761 gene locus_tag LOCUS_00590 gene dapF 14564 13761 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140817.1 protein_id gnl|my_center|LOCUS_00590 15048 14566 gene locus_tag LOCUS_00600 15048 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 15821 15048 gene locus_tag LOCUS_00610 15821 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 17528 15831 gene locus_tag LOCUS_00620 17528 15831 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_00620 17685 19043 gene locus_tag LOCUS_00630 17685 19043 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_00630 21844 19049 gene locus_tag LOCUS_00640 21844 19049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112529604.1 protein_id gnl|my_center|LOCUS_00640 23040 21931 gene locus_tag LOCUS_00650 23040 21931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 23127 24053 gene locus_tag LOCUS_00660 23127 24053 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_00660 24057 24824 gene locus_tag LOCUS_00670 24057 24824 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_00670 24836 25564 gene locus_tag LOCUS_00680 24836 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 25567 26100 gene locus_tag LOCUS_00690 25567 26100 CDS product redoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404062.1 protein_id gnl|my_center|LOCUS_00690 26201 27310 gene locus_tag LOCUS_00700 gene gcvT 26201 27310 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631769.1 protein_id gnl|my_center|LOCUS_00700 27350 27754 gene locus_tag LOCUS_00710 gene gcvH 27350 27754 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723327.1 protein_id gnl|my_center|LOCUS_00710 27824 29182 gene locus_tag LOCUS_00720 gene gcvPA 27824 29182 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460675.1 protein_id gnl|my_center|LOCUS_00720 29179 30645 gene locus_tag LOCUS_00730 gene gcvPB 29179 30645 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_00730 30692 31618 gene locus_tag LOCUS_00740 gene fmt 30692 31618 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_00740 31615 32508 gene locus_tag LOCUS_00750 31615 32508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 >Feature sequence004 414 614 gene locus_tag LOCUS_00760 414 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 1908 664 gene locus_tag LOCUS_00770 1908 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2038 2748 gene locus_tag LOCUS_00780 gene pyrH 2038 2748 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880427.1 protein_id gnl|my_center|LOCUS_00780 2762 3325 gene locus_tag LOCUS_00790 gene frr 2762 3325 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_00790 3338 4924 gene locus_tag LOCUS_00800 3338 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 5319 4921 gene locus_tag LOCUS_00810 5319 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 6176 5379 gene locus_tag LOCUS_00820 6176 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 6298 7641 gene locus_tag LOCUS_00830 gene ffh 6298 7641 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_00830 7664 7912 gene locus_tag LOCUS_00840 gene rpsP 7664 7912 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985074.1 protein_id gnl|my_center|LOCUS_00840 7921 8403 gene locus_tag LOCUS_00850 7921 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 9117 8413 gene locus_tag LOCUS_00860 9117 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 10044 9124 gene locus_tag LOCUS_00870 gene trxB 10044 9124 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_00870 10685 10065 gene locus_tag LOCUS_00880 10685 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 11959 10685 gene locus_tag LOCUS_00890 11959 10685 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_00890 12870 11956 gene locus_tag LOCUS_00900 12870 11956 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_00900 13443 12898 gene locus_tag LOCUS_00910 gene pyrR 13443 12898 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_00910 13809 13453 gene locus_tag LOCUS_00920 13809 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 14003 14995 gene locus_tag LOCUS_00930 14003 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 15005 15388 gene locus_tag LOCUS_00940 gene dksA 15005 15388 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881370.1 protein_id gnl|my_center|LOCUS_00940 15406 16002 gene locus_tag LOCUS_00950 15406 16002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 16005 18020 gene locus_tag LOCUS_00960 gene priA 16005 18020 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680463.1 protein_id gnl|my_center|LOCUS_00960 22686 18124 gene locus_tag LOCUS_00970 22686 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 23931 22690 gene locus_tag LOCUS_00980 gene fabF 23931 22690 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460499.1 protein_id gnl|my_center|LOCUS_00980 24172 23933 gene locus_tag LOCUS_00990 gene acpP 24172 23933 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965054.1 protein_id gnl|my_center|LOCUS_00990 24287 25024 gene locus_tag LOCUS_01000 24287 25024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 25593 25021 gene locus_tag LOCUS_01010 gene pth 25593 25021 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_01010 26204 25644 gene locus_tag LOCUS_01020 26204 25644 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938865.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence005 606 271 gene locus_tag LOCUS_01030 606 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1467 613 gene locus_tag LOCUS_01040 1467 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2664 1618 gene locus_tag LOCUS_01050 2664 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3605 2661 gene locus_tag LOCUS_01060 gene aroB 3605 2661 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831320.1 protein_id gnl|my_center|LOCUS_01060 4141 3638 gene locus_tag LOCUS_01070 4141 3638 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583809.1 protein_id gnl|my_center|LOCUS_01070 5172 4138 gene locus_tag LOCUS_01080 gene aroC 5172 4138 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870358.1 protein_id gnl|my_center|LOCUS_01080 7529 5172 gene locus_tag LOCUS_01090 7529 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 8162 7545 gene locus_tag LOCUS_01100 8162 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 8826 8152 gene locus_tag LOCUS_01110 8826 8152 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942673.1 protein_id gnl|my_center|LOCUS_01110 9442 8837 gene locus_tag LOCUS_01120 9442 8837 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_01120 10494 9439 gene locus_tag LOCUS_01130 gene pilM 10494 9439 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_01130 10718 10509 gene locus_tag LOCUS_01140 10718 10509 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942676.1 protein_id gnl|my_center|LOCUS_01140 10877 10737 gene locus_tag LOCUS_01150 10877 10737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 12156 10870 gene locus_tag LOCUS_01160 gene murA 12156 10870 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669886.1 protein_id gnl|my_center|LOCUS_01160 12897 12253 gene locus_tag LOCUS_01170 gene queE 12897 12253 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_01170 14587 12899 gene locus_tag LOCUS_01180 14587 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 14971 14630 gene locus_tag LOCUS_01190 14971 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 16183 14981 gene locus_tag LOCUS_01200 16183 14981 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_01200 17196 16195 gene locus_tag LOCUS_01210 gene gap 17196 16195 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_01210 18251 17214 gene locus_tag LOCUS_01220 18251 17214 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_01220 19007 18270 gene locus_tag LOCUS_01230 19007 18270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 19218 20048 gene locus_tag LOCUS_01240 gene lgt 19218 20048 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_01240 20035 20574 gene locus_tag LOCUS_01250 20035 20574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 20728 21324 gene locus_tag LOCUS_01260 20728 21324 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393845.1 protein_id gnl|my_center|LOCUS_01260 21339 22388 gene locus_tag LOCUS_01270 21339 22388 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_01270 22397 25534 gene locus_tag LOCUS_01280 22397 25534 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence006 3801 3196 gene locus_tag LOCUS_01290 gene recR 3801 3196 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582670.1 protein_id gnl|my_center|LOCUS_01290 4137 3826 gene locus_tag LOCUS_01300 4137 3826 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002113538.1 protein_id gnl|my_center|LOCUS_01300 4380 6614 gene locus_tag LOCUS_01310 4380 6614 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_01310 6626 9025 gene locus_tag LOCUS_01320 gene pgpH 6626 9025 CDS product cyclic-di-AMP phosphodiesterase PgpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721972.1 protein_id gnl|my_center|LOCUS_01320 9044 9514 gene locus_tag LOCUS_01330 9044 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 9504 11066 gene locus_tag LOCUS_01340 gene lnt 9504 11066 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_01340 11076 12470 gene locus_tag LOCUS_01350 gene gltA 11076 12470 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_01350 12481 13161 gene locus_tag LOCUS_01360 12481 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 13158 14435 gene locus_tag LOCUS_01370 13158 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 15014 15319 gene locus_tag LOCUS_01380 15014 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 15484 16794 gene locus_tag LOCUS_01390 15484 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 16816 22035 gene locus_tag LOCUS_01400 16816 22035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence007 <1 846 gene locus_tag LOCUS_01410 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811492.1:TraB/GumN family protein 1851 862 gene locus_tag LOCUS_01420 gene plsX 1851 862 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869848.1 protein_id gnl|my_center|LOCUS_01420 2067 1885 gene locus_tag LOCUS_01430 gene rpmF 2067 1885 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_01430 2533 2081 gene locus_tag LOCUS_01440 2533 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4074 2689 gene locus_tag LOCUS_01450 4074 2689 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141968.1 protein_id gnl|my_center|LOCUS_01450 7321 4265 gene locus_tag LOCUS_01460 7321 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 10419 7318 gene locus_tag LOCUS_01470 10419 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 10975 10427 gene locus_tag LOCUS_01480 10975 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11523 10972 gene locus_tag LOCUS_01490 11523 10972 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082414.1 protein_id gnl|my_center|LOCUS_01490 12645 11527 gene locus_tag LOCUS_01500 12645 11527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 14159 12642 gene locus_tag LOCUS_01510 gene malQ 14159 12642 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_01510 14675 14169 gene locus_tag LOCUS_01520 14675 14169 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870107.1 protein_id gnl|my_center|LOCUS_01520 15009 14812 gene locus_tag LOCUS_01530 15009 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 15979 15188 gene locus_tag LOCUS_01540 15979 15188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 <21795 16177 gene locus_tag LOCUS_01550 <21795 16177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000842480.1:DUF1566 domain-containing protein >Feature sequence008 666 2429 gene locus_tag LOCUS_01560 666 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 2463 3668 gene locus_tag LOCUS_01570 2463 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3678 4952 gene locus_tag LOCUS_01580 3678 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5334 4966 gene locus_tag LOCUS_01590 5334 4966 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_01590 6633 5344 gene locus_tag LOCUS_01600 6633 5344 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205044.1 protein_id gnl|my_center|LOCUS_01600 7803 6853 gene locus_tag LOCUS_01610 7803 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9165 7891 gene locus_tag LOCUS_01620 gene tyrS 9165 7891 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357324.1 protein_id gnl|my_center|LOCUS_01620 11697 9271 gene locus_tag LOCUS_01630 11697 9271 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_01630 12293 11703 gene locus_tag LOCUS_01640 gene def 12293 11703 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595989.1 protein_id gnl|my_center|LOCUS_01640 13322 12300 gene locus_tag LOCUS_01650 gene ychF 13322 12300 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_01650 14052 13336 gene locus_tag LOCUS_01660 14052 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 14953 14024 gene locus_tag LOCUS_01670 gene lgt 14953 14024 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_01670 16106 14967 gene locus_tag LOCUS_01680 16106 14967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 17238 16093 gene locus_tag LOCUS_01690 gene prfB 17238 16093 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_01690 18072 17239 gene locus_tag LOCUS_01700 18072 17239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 18278 18078 gene locus_tag LOCUS_01710 18278 18078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 <20646 18280 gene locus_tag LOCUS_01720 <20646 18280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016058.1:phenylalanine--tRNA ligase subunit beta >Feature sequence009 76 1452 gene locus_tag LOCUS_01730 76 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 1457 3136 gene locus_tag LOCUS_01740 1457 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4461 3187 gene locus_tag LOCUS_01750 4461 3187 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_01750 5572 4607 gene locus_tag LOCUS_01760 5572 4607 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870250.1 protein_id gnl|my_center|LOCUS_01760 6441 5569 gene locus_tag LOCUS_01770 6441 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7842 6448 gene locus_tag LOCUS_01780 7842 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 10911 7855 gene locus_tag LOCUS_01790 10911 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 11052 12428 gene locus_tag LOCUS_01800 gene purB 11052 12428 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072582.1 protein_id gnl|my_center|LOCUS_01800 12428 14023 gene locus_tag LOCUS_01810 12428 14023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 14032 15162 gene locus_tag LOCUS_01820 14032 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 15162 16079 gene locus_tag LOCUS_01830 15162 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 16180 18126 gene locus_tag LOCUS_01840 16180 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 18199 19503 gene locus_tag LOCUS_01850 18199 19503 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_01850 <20345 19517 gene locus_tag LOCUS_01860 <20345 19517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_203473432.1:type I DNA topoisomerase >Feature sequence010 <1 773 gene locus_tag LOCUS_01870 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791971.1:phosphoenolpyruvate carboxykinase (ATP) 1994 870 gene locus_tag LOCUS_01880 1994 870 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_01880 2099 2974 gene locus_tag LOCUS_01890 gene pdxS 2099 2974 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_01890 2971 3537 gene locus_tag LOCUS_01900 gene pdxT 2971 3537 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_01900 3613 4770 gene locus_tag LOCUS_01910 3613 4770 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_01910 4778 5359 gene locus_tag LOCUS_01920 4778 5359 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_01920 5356 5913 gene locus_tag LOCUS_01930 5356 5913 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_01930 5987 7342 gene locus_tag LOCUS_01940 5987 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 7492 8286 gene locus_tag LOCUS_01950 7492 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 8360 9388 gene locus_tag LOCUS_01960 gene purM 8360 9388 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_01960 9459 9740 gene locus_tag LOCUS_01970 9459 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 9743 10117 gene locus_tag LOCUS_01980 9743 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 10199 10588 gene locus_tag LOCUS_01990 10199 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 10615 12618 gene locus_tag LOCUS_02000 10615 12618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 12683 13999 gene locus_tag LOCUS_02010 gene miaB 12683 13999 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_02010 14520 14002 gene locus_tag LOCUS_02020 14520 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 16319 14517 gene locus_tag LOCUS_02030 16319 14517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 16618 16394 gene locus_tag LOCUS_02040 16618 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 18126 16621 gene locus_tag LOCUS_02050 18126 16621 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_02050 19967 18144 gene locus_tag LOCUS_02060 19967 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 >Feature sequence011 2799 2724 gene locus_tag LOCUS_t00020 2799 2724 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4384 2855 gene locus_tag LOCUS_02070 gene gpmI 4384 2855 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_02070 5934 4402 gene locus_tag LOCUS_02080 5934 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6746 5949 gene locus_tag LOCUS_02090 gene mazG 6746 5949 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869818.1 protein_id gnl|my_center|LOCUS_02090 7185 6739 gene locus_tag LOCUS_02100 7185 6739 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_02100 7564 7187 gene locus_tag LOCUS_02110 gene queD 7564 7187 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_02110 8238 7561 gene locus_tag LOCUS_02120 8238 7561 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_02120 8399 9760 gene locus_tag LOCUS_02130 8399 9760 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448293.1 protein_id gnl|my_center|LOCUS_02130 9770 11140 gene locus_tag LOCUS_02140 9770 11140 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786958.1 protein_id gnl|my_center|LOCUS_02140 13404 11143 gene locus_tag LOCUS_02150 gene ligA 13404 11143 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_02150 14127 13417 gene locus_tag LOCUS_02160 14127 13417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 16441 14147 gene locus_tag LOCUS_02170 16441 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 16876 16460 gene locus_tag LOCUS_02180 gene rlmH 16876 16460 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002981964.1 protein_id gnl|my_center|LOCUS_02180 17232 16873 gene locus_tag LOCUS_02190 17232 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 18172 17216 gene locus_tag LOCUS_02200 18172 17216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 19669 18269 gene locus_tag LOCUS_02210 19669 18269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence012 366 1760 gene locus_tag LOCUS_02220 366 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 1757 2473 gene locus_tag LOCUS_02230 1757 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 2460 3290 gene locus_tag LOCUS_02240 2460 3290 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_02240 3298 3762 gene locus_tag LOCUS_02250 3298 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 3779 4687 gene locus_tag LOCUS_02260 3779 4687 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597692.1 protein_id gnl|my_center|LOCUS_02260 5805 4684 gene locus_tag LOCUS_02270 5805 4684 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_02270 6391 5807 gene locus_tag LOCUS_02280 6391 5807 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_02280 8312 6417 gene locus_tag LOCUS_02290 8312 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 9508 8324 gene locus_tag LOCUS_02300 9508 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9636 10907 gene locus_tag LOCUS_02310 9636 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 11510 11193 gene locus_tag LOCUS_02320 11510 11193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 15030 11779 gene locus_tag LOCUS_02330 15030 11779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 15186 15959 gene locus_tag LOCUS_02340 15186 15959 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_02340 18115 16046 gene locus_tag LOCUS_02350 gene fusA 18115 16046 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_02350 18784 18206 gene locus_tag LOCUS_02360 18784 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 19505 18759 gene locus_tag LOCUS_02370 19505 18759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 <20008 19502 gene locus_tag LOCUS_02380 <20008 19502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851926.1:tRNA-dihydrouridine synthase >Feature sequence013 <1 668 gene locus_tag LOCUS_02390 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948617.1:Fic family protein 1002 1673 gene locus_tag LOCUS_02400 gene gntX 1002 1673 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303702.1 protein_id gnl|my_center|LOCUS_02400 2261 1677 gene locus_tag LOCUS_02410 gene thiE 2261 1677 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880880.1 protein_id gnl|my_center|LOCUS_02410 2981 2271 gene locus_tag LOCUS_02420 2981 2271 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095898.1 protein_id gnl|my_center|LOCUS_02420 4199 2982 gene locus_tag LOCUS_02430 4199 2982 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972198.1 protein_id gnl|my_center|LOCUS_02430 6169 4289 gene locus_tag LOCUS_02440 gene mrdA 6169 4289 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_02440 6660 6166 gene locus_tag LOCUS_02450 6660 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 6789 7373 gene locus_tag LOCUS_02460 6789 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7381 8208 gene locus_tag LOCUS_02470 gene folD 7381 8208 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_02470 8208 8558 gene locus_tag LOCUS_02480 8208 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 8558 9502 gene locus_tag LOCUS_02490 gene meaB 8558 9502 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_02490 9499 11526 gene locus_tag LOCUS_02500 9499 11526 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_02500 11523 12317 gene locus_tag LOCUS_02510 11523 12317 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584092.1 protein_id gnl|my_center|LOCUS_02510 12314 12532 gene locus_tag LOCUS_02520 12314 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 12519 13346 gene locus_tag LOCUS_02530 12519 13346 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_02530 14116 13343 gene locus_tag LOCUS_02540 14116 13343 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962601.1 protein_id gnl|my_center|LOCUS_02540 15286 14132 gene locus_tag LOCUS_02550 gene dxr 15286 14132 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245155.1 protein_id gnl|my_center|LOCUS_02550 16145 15276 gene locus_tag LOCUS_02560 gene cdsA 16145 15276 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212137.1 protein_id gnl|my_center|LOCUS_02560 17828 16164 gene locus_tag LOCUS_02570 gene metG 17828 16164 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791925.1 protein_id gnl|my_center|LOCUS_02570 18773 17865 gene locus_tag LOCUS_02580 18773 17865 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence014 71 766 gene locus_tag LOCUS_02590 71 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 779 852 gene locus_tag LOCUS_t00030 779 852 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1558 2826 gene locus_tag LOCUS_02600 1558 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3914 2913 gene locus_tag LOCUS_02610 3914 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4679 3939 gene locus_tag LOCUS_02620 4679 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4955 8284 gene locus_tag LOCUS_02630 4955 8284 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005821947.1 protein_id gnl|my_center|LOCUS_02630 8287 9432 gene locus_tag LOCUS_02640 8287 9432 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000886120.1 protein_id gnl|my_center|LOCUS_02640 9449 10042 gene locus_tag LOCUS_02650 9449 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 10039 11322 gene locus_tag LOCUS_02660 10039 11322 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_02660 12056 11334 gene locus_tag LOCUS_02670 12056 11334 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398521.1 protein_id gnl|my_center|LOCUS_02670 13223 12069 gene locus_tag LOCUS_02680 gene dnaJ 13223 12069 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_02680 15164 13251 gene locus_tag LOCUS_02690 gene dnaK 15164 13251 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_02690 15995 15198 gene locus_tag LOCUS_02700 15995 15198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 16222 17949 gene locus_tag LOCUS_02710 16222 17949 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_02710 17942 18553 gene locus_tag LOCUS_02720 17942 18553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 18554 19432 gene locus_tag LOCUS_02730 gene rpoH 18554 19432 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388776.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence015 80 892 gene locus_tag LOCUS_02740 80 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 902 1648 gene locus_tag LOCUS_02750 902 1648 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667090.1 protein_id gnl|my_center|LOCUS_02750 1751 2785 gene locus_tag LOCUS_02760 1751 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 2789 4141 gene locus_tag LOCUS_02770 gene mnmE 2789 4141 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_02770 4278 6143 gene locus_tag LOCUS_02780 gene mnmG 4278 6143 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_02780 6136 6771 gene locus_tag LOCUS_02790 gene rsmG 6136 6771 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546513.1 protein_id gnl|my_center|LOCUS_02790 9283 6773 gene locus_tag LOCUS_02800 9283 6773 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937681.1 protein_id gnl|my_center|LOCUS_02800 9426 11384 gene locus_tag LOCUS_02810 9426 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 13733 11544 gene locus_tag LOCUS_02820 13733 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 16424 13851 gene locus_tag LOCUS_02830 gene mutS 16424 13851 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_02830 17204 16461 gene locus_tag LOCUS_02840 17204 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 18599 17220 gene locus_tag LOCUS_02850 18599 17220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence016 <1 612 gene locus_tag LOCUS_02860 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005167740.1:GDP-mannose 4,6-dehydratase 634 4422 gene locus_tag LOCUS_02870 gene dnaE 634 4422 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_02870 4433 5950 gene locus_tag LOCUS_02880 4433 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 5943 7457 gene locus_tag LOCUS_02890 5943 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8394 7498 gene locus_tag LOCUS_02900 8394 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 8599 9483 gene locus_tag LOCUS_02910 8599 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 9489 10769 gene locus_tag LOCUS_02920 9489 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10773 12671 gene locus_tag LOCUS_02930 gene mutL 10773 12671 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_02930 12668 13600 gene locus_tag LOCUS_02940 gene miaA 12668 13600 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_02940 13584 16859 gene locus_tag LOCUS_02950 gene mfd 13584 16859 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254101.1 protein_id gnl|my_center|LOCUS_02950 16919 17938 gene locus_tag LOCUS_02960 gene galE 16919 17938 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389959.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence017 1949 351 gene locus_tag LOCUS_02970 1949 351 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_02970 5040 2053 gene locus_tag LOCUS_02980 5040 2053 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_02980 5517 5068 gene locus_tag LOCUS_02990 gene ptsN 5517 5068 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529589.1 protein_id gnl|my_center|LOCUS_02990 7087 5510 gene locus_tag LOCUS_03000 gene rpoN 7087 5510 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034853748.1 protein_id gnl|my_center|LOCUS_03000 7240 8802 gene locus_tag LOCUS_03010 7240 8802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 8812 9057 gene locus_tag LOCUS_03020 8812 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 9067 9360 gene locus_tag LOCUS_03030 9067 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 9404 10105 gene locus_tag LOCUS_03040 gene suhB 9404 10105 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314166.1 protein_id gnl|my_center|LOCUS_03040 10200 11804 gene locus_tag LOCUS_03050 10200 11804 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_03050 11816 12400 gene locus_tag LOCUS_03060 11816 12400 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_03060 12490 13302 gene locus_tag LOCUS_03070 12490 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 13286 13954 gene locus_tag LOCUS_03080 gene tsaA 13286 13954 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03080 15108 13951 gene locus_tag LOCUS_03090 gene metK 15108 13951 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_03090 15564 15178 gene locus_tag LOCUS_03100 gene rpsI 15564 15178 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939789.1 protein_id gnl|my_center|LOCUS_03100 16020 15589 gene locus_tag LOCUS_03110 gene rplM 16020 15589 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_03110 16301 17269 gene locus_tag LOCUS_03120 16301 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 <18321 17293 gene locus_tag LOCUS_03130 <18321 17293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680484.1:ATP-binding protein >Feature sequence018 <1 1002 gene locus_tag LOCUS_03140 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002667047.1:ribose-phosphate pyrophosphokinase 1024 2031 gene locus_tag LOCUS_03150 1024 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2112 2960 gene locus_tag LOCUS_03160 gene nfo 2112 2960 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873880.1 protein_id gnl|my_center|LOCUS_03160 2970 4565 gene locus_tag LOCUS_03170 2970 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4635 4994 gene locus_tag LOCUS_03180 gene yajC 4635 4994 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975343.1 protein_id gnl|my_center|LOCUS_03180 5013 6749 gene locus_tag LOCUS_03190 gene secD 5013 6749 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_03190 6763 7890 gene locus_tag LOCUS_03200 6763 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7890 9617 gene locus_tag LOCUS_03210 gene recJ 7890 9617 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_03210 9684 11651 gene locus_tag LOCUS_03220 9684 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 11654 12637 gene locus_tag LOCUS_03230 11654 12637 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_03230 12763 14157 gene locus_tag LOCUS_03240 12763 14157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 14170 15567 gene locus_tag LOCUS_03250 14170 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 15580 16500 gene locus_tag LOCUS_03260 15580 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 16636 17214 gene locus_tag LOCUS_03270 16636 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence019 1901 1062 gene locus_tag LOCUS_03280 1901 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 3334 1904 gene locus_tag LOCUS_03290 3334 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3594 3331 gene locus_tag LOCUS_03300 3594 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4318 3692 gene locus_tag LOCUS_03310 4318 3692 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_03310 4454 5539 gene locus_tag LOCUS_03320 gene mnmA 4454 5539 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_03320 5529 6533 gene locus_tag LOCUS_03330 gene hydE 5529 6533 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964939.1 protein_id gnl|my_center|LOCUS_03330 6579 6833 gene locus_tag LOCUS_03340 6579 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7554 6925 gene locus_tag LOCUS_03350 7554 6925 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288107.1 protein_id gnl|my_center|LOCUS_03350 9124 7565 gene locus_tag LOCUS_03360 gene purH 9124 7565 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456445.1 protein_id gnl|my_center|LOCUS_03360 9704 9141 gene locus_tag LOCUS_03370 9704 9141 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_03370 10374 11090 gene locus_tag LOCUS_03380 10374 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13735 11786 gene locus_tag LOCUS_03390 gene htpG 13735 11786 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_03390 14052 16055 gene locus_tag LOCUS_03400 14052 16055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16100 17713 gene locus_tag LOCUS_03410 16100 17713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence020 1330 722 gene locus_tag LOCUS_03420 1330 722 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011215625.1 protein_id gnl|my_center|LOCUS_03420 2721 1330 gene locus_tag LOCUS_03430 gene asnS 2721 1330 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_03430 3597 2752 gene locus_tag LOCUS_03440 gene speD 3597 2752 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_03440 4584 3763 gene locus_tag LOCUS_03450 4584 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4751 5737 gene locus_tag LOCUS_03460 4751 5737 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_03460 5747 6847 gene locus_tag LOCUS_03470 gene rodA 5747 6847 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_03470 6857 8032 gene locus_tag LOCUS_03480 6857 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 8131 11313 gene locus_tag LOCUS_03490 8131 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 11364 13175 gene locus_tag LOCUS_03500 11364 13175 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266869.1 protein_id gnl|my_center|LOCUS_03500 14542 13205 gene locus_tag LOCUS_03510 14542 13205 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_03510 16370 14715 gene locus_tag LOCUS_03520 16370 14715 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_03520 >Feature sequence021 1550 2119 gene locus_tag LOCUS_03530 1550 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3179 2238 gene locus_tag LOCUS_03540 3179 2238 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258828.1 protein_id gnl|my_center|LOCUS_03540 3305 4951 gene locus_tag LOCUS_03550 gene pgi 3305 4951 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916643.1 protein_id gnl|my_center|LOCUS_03550 5526 4954 gene locus_tag LOCUS_03560 5526 4954 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785533.1 protein_id gnl|my_center|LOCUS_03560 6807 5548 gene locus_tag LOCUS_03570 6807 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7928 6921 gene locus_tag LOCUS_03580 7928 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 9008 7938 gene locus_tag LOCUS_03590 9008 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 9237 9022 gene locus_tag LOCUS_03600 9237 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 10156 9266 gene locus_tag LOCUS_03610 10156 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 10272 10880 gene locus_tag LOCUS_03620 10272 10880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 11880 10885 gene locus_tag LOCUS_03630 11880 10885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12161 13354 gene locus_tag LOCUS_03640 12161 13354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 13374 13856 gene locus_tag LOCUS_03650 gene ybaK 13374 13856 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_03650 14020 14982 gene locus_tag LOCUS_03660 14020 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15042 15857 gene locus_tag LOCUS_03670 15042 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 15841 16680 gene locus_tag LOCUS_03680 15841 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence022 301 2052 gene locus_tag LOCUS_03690 301 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2506 2018 gene locus_tag LOCUS_03700 2506 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3616 2531 gene locus_tag LOCUS_03710 gene rlmD 3616 2531 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_03710 4160 3606 gene locus_tag LOCUS_03720 gene nudF 4160 3606 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398600.1 protein_id gnl|my_center|LOCUS_03720 4926 4165 gene locus_tag LOCUS_03730 4926 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 7357 4916 gene locus_tag LOCUS_03740 7357 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 8049 7384 gene locus_tag LOCUS_03750 8049 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 9982 8060 gene locus_tag LOCUS_03760 9982 8060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11187 9979 gene locus_tag LOCUS_03770 11187 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 12094 11195 gene locus_tag LOCUS_03780 12094 11195 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948018.1 protein_id gnl|my_center|LOCUS_03780 12275 14359 gene locus_tag LOCUS_03790 12275 14359 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_03790 14365 15399 gene locus_tag LOCUS_03800 14365 15399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 15381 16379 gene locus_tag LOCUS_03810 15381 16379 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383750.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence023 910 320 gene locus_tag LOCUS_03820 910 320 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_03820 1079 2395 gene locus_tag LOCUS_03830 1079 2395 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_03830 4270 2447 gene locus_tag LOCUS_03840 4270 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4420 6030 gene locus_tag LOCUS_03850 4420 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 6080 7042 gene locus_tag LOCUS_03860 6080 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 7030 8319 gene locus_tag LOCUS_03870 7030 8319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 9694 8345 gene locus_tag LOCUS_03880 9694 8345 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_03880 9851 10738 gene locus_tag LOCUS_03890 9851 10738 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_03890 12534 10741 gene locus_tag LOCUS_03900 12534 10741 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679753.1 protein_id gnl|my_center|LOCUS_03900 12733 13794 gene locus_tag LOCUS_03910 12733 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 13800 14723 gene locus_tag LOCUS_03920 13800 14723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 14726 15781 gene locus_tag LOCUS_03930 gene mtnA 14726 15781 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence024 <1 601 gene locus_tag LOCUS_03940 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229613.1:ATP-dependent protease ATP-binding subunit ClpX 614 3052 gene locus_tag LOCUS_03950 gene lon 614 3052 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225200.1 protein_id gnl|my_center|LOCUS_03950 3572 3024 gene locus_tag LOCUS_03960 3572 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 3752 4036 gene locus_tag LOCUS_03970 gene rpsT 3752 4036 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_03970 4050 5291 gene locus_tag LOCUS_03980 gene hutI 4050 5291 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016618.1 protein_id gnl|my_center|LOCUS_03980 6515 5304 gene locus_tag LOCUS_03990 6515 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 7528 6512 gene locus_tag LOCUS_04000 gene ruvB 7528 6512 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862355.1 protein_id gnl|my_center|LOCUS_04000 8139 7537 gene locus_tag LOCUS_04010 gene ruvA 8139 7537 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223336.1 protein_id gnl|my_center|LOCUS_04010 8622 8143 gene locus_tag LOCUS_04020 gene ruvC 8622 8143 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_04020 9377 8631 gene locus_tag LOCUS_04030 9377 8631 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_04030 10333 9470 gene locus_tag LOCUS_04040 10333 9470 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_04040 11032 10391 gene locus_tag LOCUS_04050 11032 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 11858 11019 gene locus_tag LOCUS_04060 11858 11019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 <15970 11875 gene locus_tag LOCUS_04070 <15970 11875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010874666.1:terminal organelle tip protein HMW2 >Feature sequence025 751 461 gene locus_tag LOCUS_04080 751 461 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_04080 2092 866 gene locus_tag LOCUS_04090 gene mtaB 2092 866 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_04090 3852 2152 gene locus_tag LOCUS_04100 3852 2152 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_04100 4011 7163 gene locus_tag LOCUS_04110 4011 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7237 8496 gene locus_tag LOCUS_04120 7237 8496 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393972.1 protein_id gnl|my_center|LOCUS_04120 8503 9417 gene locus_tag LOCUS_04130 8503 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9515 10852 gene locus_tag LOCUS_04140 gene rsxC 9515 10852 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_04140 10881 11855 gene locus_tag LOCUS_04150 10881 11855 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_04150 11845 12420 gene locus_tag LOCUS_04160 11845 12420 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_04160 12430 13032 gene locus_tag LOCUS_04170 12430 13032 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_04170 13042 13626 gene locus_tag LOCUS_04180 gene rsxA 13042 13626 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_04180 13783 15063 gene locus_tag LOCUS_04190 13783 15063 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_04190 15442 15167 gene locus_tag LOCUS_04200 15442 15167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 >Feature sequence026 2337 463 gene locus_tag LOCUS_04210 2337 463 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_04210 4314 2386 gene locus_tag LOCUS_04220 4314 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 5696 4410 gene locus_tag LOCUS_04230 5696 4410 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_04230 6024 5934 gene locus_tag LOCUS_t00040 6024 5934 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6140 6049 gene locus_tag LOCUS_t00050 6140 6049 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6638 6144 gene locus_tag LOCUS_04240 gene tadA 6638 6144 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674836.1 protein_id gnl|my_center|LOCUS_04240 6726 6650 gene locus_tag LOCUS_t00060 6726 6650 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6827 6735 gene locus_tag LOCUS_t00070 6827 6735 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6927 6840 gene locus_tag LOCUS_t00080 6927 6840 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7126 8307 gene locus_tag LOCUS_04250 gene thiI 7126 8307 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_04250 10202 8304 gene locus_tag LOCUS_04260 gene dnaK 10202 8304 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595925.1 protein_id gnl|my_center|LOCUS_04260 10387 10950 gene locus_tag LOCUS_04270 gene efp 10387 10950 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_04270 10967 12943 gene locus_tag LOCUS_04280 10967 12943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 12956 13654 gene locus_tag LOCUS_04290 12956 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence027 298 450 gene locus_tag LOCUS_04300 298 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 847 452 gene locus_tag LOCUS_04310 847 452 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_04310 1323 868 gene locus_tag LOCUS_04320 1323 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4211 1332 gene locus_tag LOCUS_04330 4211 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4672 4211 gene locus_tag LOCUS_04340 gene trmL 4672 4211 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_04340 5414 4731 gene locus_tag LOCUS_04350 5414 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6048 5401 gene locus_tag LOCUS_04360 6048 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10164 6052 gene locus_tag LOCUS_04370 10164 6052 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924811.1 protein_id gnl|my_center|LOCUS_04370 14248 10277 gene locus_tag LOCUS_04380 14248 10277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 >Feature sequence028 649 1464 gene locus_tag LOCUS_04390 649 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1486 2226 gene locus_tag LOCUS_04400 1486 2226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971768.1 protein_id gnl|my_center|LOCUS_04400 2262 2993 gene locus_tag LOCUS_04410 2262 2993 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_04410 5167 3002 gene locus_tag LOCUS_04420 gene pnp 5167 3002 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_04420 5395 7044 gene locus_tag LOCUS_04430 5395 7044 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_04430 7050 8402 gene locus_tag LOCUS_04440 7050 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8470 9738 gene locus_tag LOCUS_04450 8470 9738 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_04450 9848 10384 gene locus_tag LOCUS_04460 9848 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 10381 10839 gene locus_tag LOCUS_04470 10381 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 10867 11901 gene locus_tag LOCUS_04480 10867 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 11904 12455 gene locus_tag LOCUS_04490 11904 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 12469 13557 gene locus_tag LOCUS_04500 12469 13557 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence029 2 2614 gene locus_tag LOCUS_04510 2 2614 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_04510 2679 4457 gene locus_tag LOCUS_04520 2679 4457 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897930.1 protein_id gnl|my_center|LOCUS_04520 5692 6378 gene locus_tag LOCUS_04530 5692 6378 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_04530 6400 7689 gene locus_tag LOCUS_04540 6400 7689 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_04540 7815 10304 gene locus_tag LOCUS_04550 7815 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 10324 11961 gene locus_tag LOCUS_04560 10324 11961 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_04560 11970 12425 gene locus_tag LOCUS_04570 11970 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 12440 13432 gene locus_tag LOCUS_04580 12440 13432 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904502.1 protein_id gnl|my_center|LOCUS_04580 13511 13436 gene locus_tag LOCUS_t00090 13511 13436 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 2545 437 gene locus_tag LOCUS_04590 2545 437 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937467.1 protein_id gnl|my_center|LOCUS_04590 2664 4649 gene locus_tag LOCUS_04600 2664 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4646 5746 gene locus_tag LOCUS_04610 gene mraY 4646 5746 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313553.1 protein_id gnl|my_center|LOCUS_04610 7063 5765 gene locus_tag LOCUS_04620 7063 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7950 7066 gene locus_tag LOCUS_04630 7950 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8861 7947 gene locus_tag LOCUS_04640 8861 7947 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864655.1 protein_id gnl|my_center|LOCUS_04640 9781 8888 gene locus_tag LOCUS_04650 9781 8888 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_04650 11284 9809 gene locus_tag LOCUS_04660 gene gltX 11284 9809 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_04660 11429 12160 gene locus_tag LOCUS_04670 gene fkpA 11429 12160 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071319.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence031 70 393 gene locus_tag LOCUS_04680 70 393 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811035.1 protein_id gnl|my_center|LOCUS_04680 1814 468 gene locus_tag LOCUS_04690 1814 468 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_04690 3258 1882 gene locus_tag LOCUS_04700 gene trkA 3258 1882 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_04700 4256 3255 gene locus_tag LOCUS_04710 4256 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 5341 4259 gene locus_tag LOCUS_04720 5341 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6274 5381 gene locus_tag LOCUS_04730 6274 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 11623 6374 gene locus_tag LOCUS_04740 11623 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 12246 11635 gene locus_tag LOCUS_04750 12246 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence032 1212 742 gene locus_tag LOCUS_04760 gene nusB 1212 742 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_04760 1683 1222 gene locus_tag LOCUS_04770 gene ribE 1683 1222 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_04770 2961 1702 gene locus_tag LOCUS_04780 2961 1702 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_04780 3734 3030 gene locus_tag LOCUS_04790 3734 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4650 3724 gene locus_tag LOCUS_04800 gene xerD 4650 3724 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 protein_id gnl|my_center|LOCUS_04800 5890 4652 gene locus_tag LOCUS_04810 5890 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6810 6109 gene locus_tag LOCUS_04820 6810 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7745 6939 gene locus_tag LOCUS_04830 7745 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8449 7742 gene locus_tag LOCUS_04840 8449 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10191 8446 gene locus_tag LOCUS_04850 10191 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 11070 10228 gene locus_tag LOCUS_04860 11070 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 12044 11070 gene locus_tag LOCUS_04870 12044 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 13027 12041 gene locus_tag LOCUS_04880 13027 12041 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence033 527 452 gene locus_tag LOCUS_t00100 527 452 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 678 2264 gene locus_tag LOCUS_04890 678 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2313 4643 gene locus_tag LOCUS_04900 2313 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5069 4839 gene locus_tag LOCUS_04910 5069 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5243 6493 gene locus_tag LOCUS_04920 gene glgC 5243 6493 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_04920 6500 8674 gene locus_tag LOCUS_04930 6500 8674 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_04930 8689 9855 gene locus_tag LOCUS_04940 8689 9855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 11215 9878 gene locus_tag LOCUS_04950 11215 9878 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_04950 12699 11233 gene locus_tag LOCUS_04960 gene guaB 12699 11233 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence034 1464 1147 gene locus_tag LOCUS_04970 gene groES 1464 1147 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939263.1 protein_id gnl|my_center|LOCUS_04970 1644 2504 gene locus_tag LOCUS_04980 gene panC 1644 2504 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208399.1 protein_id gnl|my_center|LOCUS_04980 2506 3063 gene locus_tag LOCUS_04990 gene folK 2506 3063 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 protein_id gnl|my_center|LOCUS_04990 3056 4423 gene locus_tag LOCUS_05000 gene der 3056 4423 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_05000 4424 5452 gene locus_tag LOCUS_05010 gene mltG 4424 5452 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_05010 5464 6225 gene locus_tag LOCUS_05020 5464 6225 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_05020 6315 8027 gene locus_tag LOCUS_05030 6315 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 8070 9254 gene locus_tag LOCUS_05040 8070 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 9953 9261 gene locus_tag LOCUS_05050 9953 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10338 9961 gene locus_tag LOCUS_05060 10338 9961 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_05060 10456 10532 gene locus_tag LOCUS_t00110 10456 10532 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11394 10567 gene locus_tag LOCUS_05070 11394 10567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 12440 11400 gene locus_tag LOCUS_05080 12440 11400 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence035 1120 332 gene locus_tag LOCUS_05090 gene truA 1120 332 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_05090 3021 1123 gene locus_tag LOCUS_05100 3021 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4882 3014 gene locus_tag LOCUS_05110 4882 3014 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_05110 5040 4891 gene locus_tag LOCUS_05120 5040 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5457 5053 gene locus_tag LOCUS_05130 5457 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 5598 7703 gene locus_tag LOCUS_05140 5598 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7688 8104 gene locus_tag LOCUS_05150 7688 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 9043 8147 gene locus_tag LOCUS_05160 9043 8147 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_05160 10262 9078 gene locus_tag LOCUS_05170 10262 9078 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257135.1 protein_id gnl|my_center|LOCUS_05170 11659 10262 gene locus_tag LOCUS_05180 11659 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 12813 11659 gene locus_tag LOCUS_05190 12813 11659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence036 33 106 gene locus_tag LOCUS_t00120 33 106 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 113 187 gene locus_tag LOCUS_t00130 113 187 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 222 1997 gene locus_tag LOCUS_05200 gene uvrC 222 1997 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_05200 3067 1994 gene locus_tag LOCUS_05210 gene ispG 3067 1994 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880999.1 protein_id gnl|my_center|LOCUS_05210 4248 3064 gene locus_tag LOCUS_05220 4248 3064 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005947503.1 protein_id gnl|my_center|LOCUS_05220 6060 4297 gene locus_tag LOCUS_05230 6060 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 7850 6078 gene locus_tag LOCUS_05240 7850 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10889 7965 gene locus_tag LOCUS_05250 10889 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 11557 10898 gene locus_tag LOCUS_05260 11557 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 12463 11558 gene locus_tag LOCUS_05270 12463 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 >Feature sequence037 474 1604 gene locus_tag LOCUS_05280 474 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 1715 4672 gene locus_tag LOCUS_05290 1715 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 6296 4794 gene locus_tag LOCUS_05300 6296 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6447 7334 gene locus_tag LOCUS_05310 6447 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 7479 9302 gene locus_tag LOCUS_05320 7479 9302 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_05320 9312 10385 gene locus_tag LOCUS_05330 9312 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10382 11098 gene locus_tag LOCUS_05340 10382 11098 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909097.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence038 4658 366 gene locus_tag LOCUS_05350 gene rpoC 4658 366 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_05350 8798 4668 gene locus_tag LOCUS_05360 gene rpoB 8798 4668 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_05360 9305 8934 gene locus_tag LOCUS_05370 gene rplL 9305 8934 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_05370 9816 9337 gene locus_tag LOCUS_05380 gene rplJ 9816 9337 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_05380 10678 9971 gene locus_tag LOCUS_05390 gene rplA 10678 9971 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_05390 11112 10690 gene locus_tag LOCUS_05400 gene rplK 11112 10690 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_05400 11698 11135 gene locus_tag LOCUS_05410 gene nusG 11698 11135 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_05410 12101 11715 gene locus_tag LOCUS_05420 12101 11715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12197 12122 gene locus_tag LOCUS_t00140 12197 12122 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 12386 12210 gene locus_tag LOCUS_05430 gene rpmG 12386 12210 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence039 928 305 gene locus_tag LOCUS_05440 928 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1935 1075 gene locus_tag LOCUS_05450 1935 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2122 3549 gene locus_tag LOCUS_05460 gene purF 2122 3549 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880738.1 protein_id gnl|my_center|LOCUS_05460 3588 4940 gene locus_tag LOCUS_05470 3588 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 6938 5004 gene locus_tag LOCUS_05480 6938 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7543 6941 gene locus_tag LOCUS_05490 gene coaE 7543 6941 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_05490 7823 7533 gene locus_tag LOCUS_05500 7823 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 9644 7836 gene locus_tag LOCUS_05510 9644 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10570 9662 gene locus_tag LOCUS_05520 10570 9662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence040 854 570 gene locus_tag LOCUS_05530 854 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05530 951 877 gene locus_tag LOCUS_t00150 951 877 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1575 1045 gene locus_tag LOCUS_05540 1575 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2450 1590 gene locus_tag LOCUS_05550 2450 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3023 2553 gene locus_tag LOCUS_05560 3023 2553 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215245.1 protein_id gnl|my_center|LOCUS_05560 3126 3611 gene locus_tag LOCUS_05570 3126 3611 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_05570 6022 3614 gene locus_tag LOCUS_05580 6022 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_05580 7600 6029 gene locus_tag LOCUS_05590 gene murJ 7600 6029 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681318.1 protein_id gnl|my_center|LOCUS_05590 8615 7620 gene locus_tag LOCUS_05600 gene pta 8615 7620 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_05600 8784 10106 gene locus_tag LOCUS_05610 gene purD 8784 10106 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_05610 10093 10662 gene locus_tag LOCUS_05620 gene yihA 10093 10662 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_05620 10667 11179 gene locus_tag LOCUS_05630 10667 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11190 11957 gene locus_tag LOCUS_05640 11190 11957 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_05640 12344 12030 gene locus_tag LOCUS_05650 12344 12030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence041 382 1428 gene locus_tag LOCUS_05660 382 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1432 4308 gene locus_tag LOCUS_05670 1432 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4320 5681 gene locus_tag LOCUS_05680 4320 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5678 6958 gene locus_tag LOCUS_05690 5678 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 6968 8761 gene locus_tag LOCUS_05700 6968 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8783 9625 gene locus_tag LOCUS_05710 gene folE2 8783 9625 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_05710 9635 11518 gene locus_tag LOCUS_05720 9635 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence042 1196 222 gene locus_tag LOCUS_05730 1196 222 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_05730 2811 1240 gene locus_tag LOCUS_05740 2811 1240 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082429.1 protein_id gnl|my_center|LOCUS_05740 3395 2808 gene locus_tag LOCUS_05750 3395 2808 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881079.1 protein_id gnl|my_center|LOCUS_05750 3780 3385 gene locus_tag LOCUS_05760 3780 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 6705 3790 gene locus_tag LOCUS_05770 6705 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 8926 6734 gene locus_tag LOCUS_05780 8926 6734 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_05780 10512 9013 gene locus_tag LOCUS_05790 10512 9013 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_05790 <11831 10524 gene locus_tag LOCUS_05800 <11831 10524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924828.1:sensor histidine kinase >Feature sequence043 942 1943 gene locus_tag LOCUS_05810 942 1943 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798895.1 protein_id gnl|my_center|LOCUS_05810 2611 1964 gene locus_tag LOCUS_05820 gene pgsA 2611 1964 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_05820 3201 2605 gene locus_tag LOCUS_05830 3201 2605 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886480.1 protein_id gnl|my_center|LOCUS_05830 4988 3201 gene locus_tag LOCUS_05840 gene ftsH 4988 3201 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_05840 6587 5067 gene locus_tag LOCUS_05850 6587 5067 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869193.1 protein_id gnl|my_center|LOCUS_05850 6774 8984 gene locus_tag LOCUS_05860 6774 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 10183 9071 gene locus_tag LOCUS_05870 10183 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 10463 11575 gene locus_tag LOCUS_05880 10463 11575 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence044 <1 4297 gene locus_tag LOCUS_05890 <1 4297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000601484.1:DUF1566 domain-containing protein 4307 5623 gene locus_tag LOCUS_05900 4307 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5703 7772 gene locus_tag LOCUS_05910 5703 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7772 8920 gene locus_tag LOCUS_05920 7772 8920 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633142.1 protein_id gnl|my_center|LOCUS_05920 9096 10751 gene locus_tag LOCUS_05930 9096 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10763 11173 gene locus_tag LOCUS_05940 10763 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence045 4211 816 gene locus_tag LOCUS_05950 4211 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4386 5846 gene locus_tag LOCUS_05960 4386 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5950 7140 gene locus_tag LOCUS_05970 5950 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 7151 8050 gene locus_tag LOCUS_05980 7151 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10264 8072 gene locus_tag LOCUS_05990 10264 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 10764 10261 gene locus_tag LOCUS_06000 10764 10261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence046 1786 1094 gene locus_tag LOCUS_06010 1786 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5043 1921 gene locus_tag LOCUS_06020 5043 1921 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762065.1 protein_id gnl|my_center|LOCUS_06020 6198 5056 gene locus_tag LOCUS_06030 gene czcB 6198 5056 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_06030 6891 6211 gene locus_tag LOCUS_06040 6891 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 8218 6893 gene locus_tag LOCUS_06050 8218 6893 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_06050 9079 8342 gene locus_tag LOCUS_06060 9079 8342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 10464 9079 gene locus_tag LOCUS_06070 10464 9079 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_06070 11012 10479 gene locus_tag LOCUS_06080 gene rplI 11012 10479 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence047 466 930 gene locus_tag LOCUS_06090 gene mscL 466 930 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_06090 973 2058 gene locus_tag LOCUS_06100 973 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3527 2061 gene locus_tag LOCUS_06110 3527 2061 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022613.1 protein_id gnl|my_center|LOCUS_06110 4595 3597 gene locus_tag LOCUS_06120 4595 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5249 4620 gene locus_tag LOCUS_06130 5249 4620 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965939.1 protein_id gnl|my_center|LOCUS_06130 6263 5370 gene locus_tag LOCUS_06140 gene dapA 6263 5370 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_06140 8611 6266 gene locus_tag LOCUS_06150 8611 6266 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546134.1 protein_id gnl|my_center|LOCUS_06150 9239 8604 gene locus_tag LOCUS_06160 9239 8604 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080010664.1 protein_id gnl|my_center|LOCUS_06160 9544 9293 gene locus_tag LOCUS_06170 9544 9293 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324899.1 protein_id gnl|my_center|LOCUS_06170 <11042 9625 gene locus_tag LOCUS_06180 <11042 9625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942908.1:outer membrane protein assembly factor BamA >Feature sequence048 1269 529 gene locus_tag LOCUS_06190 gene dapB 1269 529 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400159.1 protein_id gnl|my_center|LOCUS_06190 2291 1266 gene locus_tag LOCUS_06200 2291 1266 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_06200 3104 2415 gene locus_tag LOCUS_06210 3104 2415 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_06210 3227 5842 gene locus_tag LOCUS_06220 3227 5842 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_06220 5893 6195 gene locus_tag LOCUS_06230 5893 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6250 8979 gene locus_tag LOCUS_06240 gene secA 6250 8979 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942693.1 protein_id gnl|my_center|LOCUS_06240 8988 10703 gene locus_tag LOCUS_06250 gene argS 8988 10703 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence049 2946 595 gene locus_tag LOCUS_06260 2946 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 4412 3009 gene locus_tag LOCUS_06270 4412 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 5222 4449 gene locus_tag LOCUS_06280 5222 4449 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880039.1 protein_id gnl|my_center|LOCUS_06280 5983 5303 gene locus_tag LOCUS_06290 5983 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8450 5988 gene locus_tag LOCUS_06300 gene clpA 8450 5988 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679937.1 protein_id gnl|my_center|LOCUS_06300 9348 8467 gene locus_tag LOCUS_06310 9348 8467 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460731.1 protein_id gnl|my_center|LOCUS_06310 9994 9356 gene locus_tag LOCUS_06320 9994 9356 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_06320 10555 10010 gene locus_tag LOCUS_06330 10555 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence050 324 1904 gene locus_tag LOCUS_06340 324 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2592 1906 gene locus_tag LOCUS_06350 2592 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 2949 2599 gene locus_tag LOCUS_06360 2949 2599 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_06360 4062 2959 gene locus_tag LOCUS_06370 gene xseA 4062 2959 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_06370 4618 4145 gene locus_tag LOCUS_06380 4618 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6064 4634 gene locus_tag LOCUS_06390 6064 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 6213 7274 gene locus_tag LOCUS_06400 6213 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7265 8023 gene locus_tag LOCUS_06410 7265 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 8069 8145 gene locus_tag LOCUS_t00160 8069 8145 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8188 10344 gene locus_tag LOCUS_06420 8188 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence051 92 379 gene locus_tag LOCUS_06430 92 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 360 2405 gene locus_tag LOCUS_06440 360 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2483 3694 gene locus_tag LOCUS_06450 2483 3694 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978580.1 protein_id gnl|my_center|LOCUS_06450 3696 5114 gene locus_tag LOCUS_06460 3696 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5101 6060 gene locus_tag LOCUS_06470 5101 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6077 6583 gene locus_tag LOCUS_06480 6077 6583 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_06480 7371 6637 gene locus_tag LOCUS_06490 7371 6637 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_06490 7821 7447 gene locus_tag LOCUS_06500 7821 7447 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_06500 8499 7837 gene locus_tag LOCUS_06510 8499 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 9356 8598 gene locus_tag LOCUS_06520 9356 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence052 661 978 gene locus_tag LOCUS_06530 661 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1040 1540 gene locus_tag LOCUS_06540 gene rsmD 1040 1540 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_06540 1544 3046 gene locus_tag LOCUS_06550 1544 3046 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_06550 4152 3043 gene locus_tag LOCUS_06560 4152 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4340 5440 gene locus_tag LOCUS_06570 4340 5440 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_06570 5447 6376 gene locus_tag LOCUS_06580 5447 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6568 6945 gene locus_tag LOCUS_06590 6568 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9091 6971 gene locus_tag LOCUS_06600 9091 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 9428 9096 gene locus_tag LOCUS_06610 9428 9096 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_06610 9600 10172 gene locus_tag LOCUS_06620 9600 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence053 1917 1099 gene locus_tag LOCUS_06630 1917 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3795 1918 gene locus_tag LOCUS_06640 3795 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5656 3809 gene locus_tag LOCUS_06650 5656 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5818 6336 gene locus_tag LOCUS_06660 5818 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6326 7060 gene locus_tag LOCUS_06670 6326 7060 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922324.1 protein_id gnl|my_center|LOCUS_06670 7158 7352 gene locus_tag LOCUS_06680 gene rpmB 7158 7352 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_06680 7477 9000 gene locus_tag LOCUS_06690 7477 9000 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_06690 9881 9015 gene locus_tag LOCUS_06700 gene galU 9881 9015 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_06700 <10607 9871 gene locus_tag LOCUS_06710 <10607 9871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943868.1:galactose-1-phosphate uridylyltransferase >Feature sequence054 1306 422 gene locus_tag LOCUS_06720 1306 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1705 1433 gene locus_tag LOCUS_06730 1705 1433 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028883.1 protein_id gnl|my_center|LOCUS_06730 5000 1878 gene locus_tag LOCUS_06740 5000 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 5165 6097 gene locus_tag LOCUS_06750 5165 6097 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_06750 6094 6807 gene locus_tag LOCUS_06760 6094 6807 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_06760 8284 6794 gene locus_tag LOCUS_06770 8284 6794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 10344 8281 gene locus_tag LOCUS_06780 10344 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence055 101 1261 gene locus_tag LOCUS_06790 101 1261 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222346.1 protein_id gnl|my_center|LOCUS_06790 1332 2189 gene locus_tag LOCUS_06800 1332 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2182 3141 gene locus_tag LOCUS_06810 2182 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3142 4539 gene locus_tag LOCUS_06820 3142 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4541 5464 gene locus_tag LOCUS_06830 4541 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 5473 6453 gene locus_tag LOCUS_06840 gene trpS 5473 6453 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_06840 6672 7523 gene locus_tag LOCUS_06850 6672 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 7524 8141 gene locus_tag LOCUS_06860 gene purN 7524 8141 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_06860 8138 9319 gene locus_tag LOCUS_06870 8138 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 9328 9777 gene locus_tag LOCUS_06880 9328 9777 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_06880 10128 9844 gene locus_tag LOCUS_06890 10128 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 10536 10195 gene locus_tag LOCUS_06900 10536 10195 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068360.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence056 2 1912 gene locus_tag LOCUS_06910 gene uvrB 2 1912 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_06910 2152 3402 gene locus_tag LOCUS_06920 gene rho 2152 3402 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_06920 4889 3510 gene locus_tag LOCUS_06930 4889 3510 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_06930 5314 4901 gene locus_tag LOCUS_06940 5314 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 5675 5331 gene locus_tag LOCUS_06950 5675 5331 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583279.1 protein_id gnl|my_center|LOCUS_06950 5897 7567 gene locus_tag LOCUS_06960 5897 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 7612 7698 gene locus_tag LOCUS_t00170 7612 7698 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7771 8595 gene locus_tag LOCUS_06970 7771 8595 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_06970 9344 8592 gene locus_tag LOCUS_06980 9344 8592 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_06980 9524 9856 gene locus_tag LOCUS_06990 9524 9856 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081549.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence057 1349 2599 gene locus_tag LOCUS_07000 gene pepT 1349 2599 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244314.1 protein_id gnl|my_center|LOCUS_07000 2693 3676 gene locus_tag LOCUS_07010 2693 3676 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_07010 3679 4725 gene locus_tag LOCUS_07020 3679 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4726 5181 gene locus_tag LOCUS_07030 gene ruvX 4726 5181 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403824.1 protein_id gnl|my_center|LOCUS_07030 5178 5471 gene locus_tag LOCUS_07040 5178 5471 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256312.1 protein_id gnl|my_center|LOCUS_07040 5488 8424 gene locus_tag LOCUS_07050 5488 8424 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence058 415 1794 gene locus_tag LOCUS_07060 415 1794 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767538.1 protein_id gnl|my_center|LOCUS_07060 2566 1973 gene locus_tag LOCUS_07070 2566 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 4246 2819 gene locus_tag LOCUS_07080 4246 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4410 4742 gene locus_tag LOCUS_07090 4410 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4848 5936 gene locus_tag LOCUS_07100 4848 5936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_07100 5953 7134 gene locus_tag LOCUS_07110 5953 7134 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870391.1 protein_id gnl|my_center|LOCUS_07110 7124 7696 gene locus_tag LOCUS_07120 7124 7696 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_07120 8434 7682 gene locus_tag LOCUS_07130 8434 7682 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence059 712 71 gene locus_tag LOCUS_07140 712 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1957 734 gene locus_tag LOCUS_07150 gene ftsZ 1957 734 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121912.1 protein_id gnl|my_center|LOCUS_07150 3194 1968 gene locus_tag LOCUS_07160 gene ftsA 3194 1968 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_07160 4066 3194 gene locus_tag LOCUS_07170 4066 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4973 4068 gene locus_tag LOCUS_07180 4973 4068 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_07180 5830 4991 gene locus_tag LOCUS_07190 gene murB 5830 4991 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925148.1 protein_id gnl|my_center|LOCUS_07190 7185 5827 gene locus_tag LOCUS_07200 gene murC 7185 5827 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144080384.1 protein_id gnl|my_center|LOCUS_07200 8294 7185 gene locus_tag LOCUS_07210 gene murG 8294 7185 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_07210 9398 8310 gene locus_tag LOCUS_07220 gene ftsW 9398 8310 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence060 2322 1186 gene locus_tag LOCUS_07230 2322 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3977 2319 gene locus_tag LOCUS_07240 3977 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4900 3974 gene locus_tag LOCUS_07250 4900 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 8030 5001 gene locus_tag LOCUS_07260 8030 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 8175 9092 gene locus_tag LOCUS_07270 8175 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence061 <1 895 gene locus_tag LOCUS_07280 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545243.1:threonine--tRNA ligase 892 1443 gene locus_tag LOCUS_07290 gene infC 892 1443 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_07290 1455 1652 gene locus_tag LOCUS_07300 gene rpmI 1455 1652 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_07300 1669 2016 gene locus_tag LOCUS_07310 gene rplT 1669 2016 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_07310 2034 2330 gene locus_tag LOCUS_07320 2034 2330 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931006.1 protein_id gnl|my_center|LOCUS_07320 2346 2423 gene locus_tag LOCUS_t00180 2346 2423 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2435 3226 gene locus_tag LOCUS_07330 gene surE 2435 3226 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_07330 3216 4196 gene locus_tag LOCUS_07340 3216 4196 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_07340 4474 4884 gene locus_tag LOCUS_07350 4474 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4881 5897 gene locus_tag LOCUS_07360 gene aroF 4881 5897 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583420.1 protein_id gnl|my_center|LOCUS_07360 5922 6779 gene locus_tag LOCUS_07370 5922 6779 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870248.1 protein_id gnl|my_center|LOCUS_07370 6834 7712 gene locus_tag LOCUS_07380 6834 7712 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_07380 7712 8764 gene locus_tag LOCUS_07390 7712 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence062 <1 4726 gene locus_tag LOCUS_07400 <1 4726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014966167.1:alpha-2-macroglobulin 5009 8335 gene locus_tag LOCUS_07410 5009 8335 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_07410 8360 8767 gene locus_tag LOCUS_07420 8360 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence063 144 740 gene locus_tag LOCUS_07430 144 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2243 726 gene locus_tag LOCUS_07440 2243 726 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_07440 2384 3697 gene locus_tag LOCUS_07450 gene rsmB 2384 3697 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440956.1 protein_id gnl|my_center|LOCUS_07450 3694 4353 gene locus_tag LOCUS_07460 gene rpe 3694 4353 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_07460 4364 5209 gene locus_tag LOCUS_07470 gene nadC 4364 5209 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_07470 5871 5206 gene locus_tag LOCUS_07480 5871 5206 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_07480 8058 5908 gene locus_tag LOCUS_07490 8058 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence064 <1 814 gene locus_tag LOCUS_07500 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940997.1:type II secretion system secretin GspD 817 2511 gene locus_tag LOCUS_07510 gene gspE 817 2511 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_07510 2511 3740 gene locus_tag LOCUS_07520 gene gspF 2511 3740 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262831.1 protein_id gnl|my_center|LOCUS_07520 3768 4196 gene locus_tag LOCUS_07530 gene gspG 3768 4196 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_07530 4203 5033 gene locus_tag LOCUS_07540 4203 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5017 5682 gene locus_tag LOCUS_07550 5017 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5682 6335 gene locus_tag LOCUS_07560 5682 6335 CDS product type II secretion system protein GspJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940991.1 protein_id gnl|my_center|LOCUS_07560 6336 7562 gene locus_tag LOCUS_07570 6336 7562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence065 3067 437 gene locus_tag LOCUS_07580 3067 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3428 3099 gene locus_tag LOCUS_07590 gene trxA 3428 3099 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_07590 4033 3440 gene locus_tag LOCUS_07600 4033 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4154 4582 gene locus_tag LOCUS_07610 4154 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5060 4584 gene locus_tag LOCUS_07620 5060 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5937 5026 gene locus_tag LOCUS_07630 gene thiL 5937 5026 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_07630 6046 6642 gene locus_tag LOCUS_07640 6046 6642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6730 7575 gene locus_tag LOCUS_07650 6730 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 7659 8558 gene locus_tag LOCUS_07660 gene ptb 7659 8558 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966357.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence066 <1 1226 gene locus_tag LOCUS_07670 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A 2396 1323 gene locus_tag LOCUS_07680 gene buk 2396 1323 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_07680 4677 2521 gene locus_tag LOCUS_07690 4677 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 5200 4931 gene locus_tag LOCUS_07700 5200 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6117 5200 gene locus_tag LOCUS_07710 6117 5200 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 protein_id gnl|my_center|LOCUS_07710 6273 7028 gene locus_tag LOCUS_07720 gene map 6273 7028 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724059.1 protein_id gnl|my_center|LOCUS_07720 7073 8821 gene locus_tag LOCUS_07730 gene aspS 7073 8821 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence067 89 2494 gene locus_tag LOCUS_07740 89 2494 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_07740 2641 5106 gene locus_tag LOCUS_07750 2641 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5109 5549 gene locus_tag LOCUS_07760 5109 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 5588 6457 gene locus_tag LOCUS_07770 5588 6457 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_07770 6471 8147 gene locus_tag LOCUS_07780 6471 8147 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963991.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence068 2149 1838 gene locus_tag LOCUS_07790 2149 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3091 2165 gene locus_tag LOCUS_07800 3091 2165 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947921.1 protein_id gnl|my_center|LOCUS_07800 4141 3107 gene locus_tag LOCUS_07810 4141 3107 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257479.1 protein_id gnl|my_center|LOCUS_07810 4982 4176 gene locus_tag LOCUS_07820 gene rsmI 4982 4176 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948680.1 protein_id gnl|my_center|LOCUS_07820 5362 4979 gene locus_tag LOCUS_07830 5362 4979 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_07830 5814 5359 gene locus_tag LOCUS_07840 gene smpB 5814 5359 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880138.1 protein_id gnl|my_center|LOCUS_07840 6911 5814 gene locus_tag LOCUS_07850 gene thiH 6911 5814 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210678.1 protein_id gnl|my_center|LOCUS_07850 7579 6962 gene locus_tag LOCUS_07860 7579 6962 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 protein_id gnl|my_center|LOCUS_07860 8405 7572 gene locus_tag LOCUS_07870 gene lgt 8405 7572 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence069 265 1128 gene locus_tag LOCUS_07880 gene ispE 265 1128 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_07880 2233 1112 gene locus_tag LOCUS_07890 gene hisC 2233 1112 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_07890 2487 2753 gene locus_tag LOCUS_07900 gene rpsO 2487 2753 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_07900 2848 5043 gene locus_tag LOCUS_07910 gene pnp 2848 5043 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_07910 5018 5476 gene locus_tag LOCUS_07920 gene dut 5018 5476 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_07920 5473 6759 gene locus_tag LOCUS_07930 5473 6759 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence070 439 750 gene locus_tag LOCUS_07940 gene rplU 439 750 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119318.1 protein_id gnl|my_center|LOCUS_07940 770 1039 gene locus_tag LOCUS_07950 gene rpmA 770 1039 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_07950 1102 2133 gene locus_tag LOCUS_07960 gene obgE 1102 2133 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_07960 2218 3741 gene locus_tag LOCUS_07970 2218 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3746 4549 gene locus_tag LOCUS_07980 3746 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4615 6132 gene locus_tag LOCUS_07990 4615 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6160 7341 gene locus_tag LOCUS_08000 6160 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 <8472 7447 gene locus_tag LOCUS_08010 <8472 7447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546871.1:leucine--tRNA ligase >Feature sequence071 335 829 gene locus_tag LOCUS_08020 335 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 830 1609 gene locus_tag LOCUS_08030 830 1609 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262928.1 protein_id gnl|my_center|LOCUS_08030 1609 2307 gene locus_tag LOCUS_08040 1609 2307 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682279.1 protein_id gnl|my_center|LOCUS_08040 2371 3486 gene locus_tag LOCUS_08050 2371 3486 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459608.1 protein_id gnl|my_center|LOCUS_08050 3523 4239 gene locus_tag LOCUS_08060 3523 4239 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669614.1 protein_id gnl|my_center|LOCUS_08060 4243 5859 gene locus_tag LOCUS_08070 4243 5859 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460052.1 protein_id gnl|my_center|LOCUS_08070 5957 5871 gene locus_tag LOCUS_t00190 5957 5871 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7071 5995 gene locus_tag LOCUS_08080 7071 5995 CDS product glycerate 2-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980109.1 protein_id gnl|my_center|LOCUS_08080 7167 7760 gene locus_tag LOCUS_08090 7167 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence072 1129 692 gene locus_tag LOCUS_08100 gene tsaE 1129 692 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_08100 2588 1119 gene locus_tag LOCUS_08110 2588 1119 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_08110 2687 3604 gene locus_tag LOCUS_08120 gene nagZ 2687 3604 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957992.1 protein_id gnl|my_center|LOCUS_08120 3693 5354 gene locus_tag LOCUS_08130 3693 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5413 7332 gene locus_tag LOCUS_08140 5413 7332 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678989.1 protein_id gnl|my_center|LOCUS_08140 8222 7329 gene locus_tag LOCUS_08150 8222 7329 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence073 <1 969 gene locus_tag LOCUS_08160 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459608.1:aminopeptidase 2960 975 gene locus_tag LOCUS_08170 2960 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3555 2977 gene locus_tag LOCUS_08180 3555 2977 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_08180 4652 3588 gene locus_tag LOCUS_08190 4652 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6040 4634 gene locus_tag LOCUS_08200 gene aroA 6040 4634 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_08200 6207 6749 gene locus_tag LOCUS_08210 gene pfpI 6207 6749 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250235.1 protein_id gnl|my_center|LOCUS_08210 6760 7110 gene locus_tag LOCUS_08220 6760 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence074 2070 385 gene locus_tag LOCUS_08230 2070 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5464 2054 gene locus_tag LOCUS_08240 5464 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 7715 5448 gene locus_tag LOCUS_08250 7715 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence075 1213 116 gene locus_tag LOCUS_08260 1213 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2367 1222 gene locus_tag LOCUS_08270 2367 1222 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039644929.1 protein_id gnl|my_center|LOCUS_08270 4495 2435 gene locus_tag LOCUS_08280 4495 2435 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_08280 6321 4504 gene locus_tag LOCUS_08290 gene sppA 6321 4504 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898564.1 protein_id gnl|my_center|LOCUS_08290 7587 6340 gene locus_tag LOCUS_08300 gene hisS 7587 6340 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_08300 7812 7887 gene locus_tag LOCUS_t00200 7812 7887 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7892 7977 gene locus_tag LOCUS_t00210 7892 7977 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 7984 8060 gene locus_tag LOCUS_t00220 7984 8060 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence076 3683 903 gene locus_tag LOCUS_08310 3683 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4976 3813 gene locus_tag LOCUS_08320 4976 3813 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004465704.1 protein_id gnl|my_center|LOCUS_08320 6487 4976 gene locus_tag LOCUS_08330 6487 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence077 2455 89 gene locus_tag LOCUS_08340 2455 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 3440 2565 gene locus_tag LOCUS_08350 3440 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4553 3453 gene locus_tag LOCUS_08360 4553 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6447 4540 gene locus_tag LOCUS_08370 6447 4540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7770 6625 gene locus_tag LOCUS_08380 7770 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence078 302 532 gene locus_tag LOCUS_08390 302 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 535 1320 gene locus_tag LOCUS_08400 gene uppP 535 1320 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_08400 1337 2062 gene locus_tag LOCUS_08410 1337 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2062 2805 gene locus_tag LOCUS_08420 2062 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2835 5324 gene locus_tag LOCUS_08430 2835 5324 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_08430 6705 5326 gene locus_tag LOCUS_08440 gene hslU 6705 5326 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_08440 7250 6702 gene locus_tag LOCUS_08450 gene hslV 7250 6702 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556895.1 protein_id gnl|my_center|LOCUS_08450 7757 7263 gene locus_tag LOCUS_08460 7757 7263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence079 606 2729 gene locus_tag LOCUS_08470 606 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3474 2767 gene locus_tag LOCUS_08480 3474 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4400 3471 gene locus_tag LOCUS_08490 4400 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4535 4684 gene locus_tag LOCUS_08500 gene rpmH 4535 4684 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944078.1 protein_id gnl|my_center|LOCUS_08500 4698 5057 gene locus_tag LOCUS_08510 gene rnpA 4698 5057 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081756.1 protein_id gnl|my_center|LOCUS_08510 5020 5232 gene locus_tag LOCUS_08520 gene yidD 5020 5232 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_08520 5242 6843 gene locus_tag LOCUS_08530 gene yidC 5242 6843 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_08530 7304 7125 gene locus_tag LOCUS_08540 7304 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7794 7297 gene locus_tag LOCUS_08550 7794 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence080 685 837 gene locus_tag LOCUS_08560 685 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 894 4022 gene locus_tag LOCUS_08570 894 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 4716 4048 gene locus_tag LOCUS_08580 gene radC 4716 4048 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546157.1 protein_id gnl|my_center|LOCUS_08580 5901 4813 gene locus_tag LOCUS_08590 5901 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence081 509 1450 gene locus_tag LOCUS_08600 509 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1447 2055 gene locus_tag LOCUS_08610 1447 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 2077 3645 gene locus_tag LOCUS_08620 2077 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3652 6138 gene locus_tag LOCUS_08630 3652 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 6208 6284 gene locus_tag LOCUS_t00230 6208 6284 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7255 6302 gene locus_tag LOCUS_08640 7255 6302 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062858.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence082 444 2195 gene locus_tag LOCUS_08650 444 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 2211 6008 gene locus_tag LOCUS_08660 2211 6008 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001066611.1 protein_id gnl|my_center|LOCUS_08660 7094 6015 gene locus_tag LOCUS_08670 gene ribD 7094 6015 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942331.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence083 1968 3740 gene locus_tag LOCUS_08680 1968 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3760 4989 gene locus_tag LOCUS_08690 3760 4989 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103754.1 protein_id gnl|my_center|LOCUS_08690 4986 6086 gene locus_tag LOCUS_08700 gene tgt 4986 6086 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_08700 7387 6104 gene locus_tag LOCUS_08710 7387 6104 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261139.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence084 5 1396 gene locus_tag LOCUS_08720 5 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1471 3072 gene locus_tag LOCUS_08730 gene nadB 1471 3072 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_08730 3083 4849 gene locus_tag LOCUS_08740 3083 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 4876 6798 gene locus_tag LOCUS_08750 4876 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence085 <1 517 gene locus_tag LOCUS_08760 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000601484.1:DUF1566 domain-containing protein 1620 928 gene locus_tag LOCUS_08770 1620 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 2057 3961 gene locus_tag LOCUS_08780 2057 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4007 4789 gene locus_tag LOCUS_08790 4007 4789 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545987.1 protein_id gnl|my_center|LOCUS_08790 4789 5550 gene locus_tag LOCUS_08800 4789 5550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_08800 5550 7058 gene locus_tag LOCUS_08810 5550 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence086 188 2299 gene locus_tag LOCUS_08820 188 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 2280 2996 gene locus_tag LOCUS_08830 gene trmD 2280 2996 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_08830 2993 3541 gene locus_tag LOCUS_08840 2993 3541 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_08840 3575 3934 gene locus_tag LOCUS_08850 gene rplS 3575 3934 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938136.1 protein_id gnl|my_center|LOCUS_08850 3934 4941 gene locus_tag LOCUS_08860 3934 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 4963 5835 gene locus_tag LOCUS_08870 4963 5835 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_08870 5855 7048 gene locus_tag LOCUS_08880 5855 7048 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_08880 7179 7104 gene locus_tag LOCUS_t00240 7179 7104 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 698 120 gene locus_tag LOCUS_08890 698 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 903 691 gene locus_tag LOCUS_08900 903 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2102 903 gene locus_tag LOCUS_08910 2102 903 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460317.1 protein_id gnl|my_center|LOCUS_08910 3526 2111 gene locus_tag LOCUS_08920 gene radA 3526 2111 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075213698.1 protein_id gnl|my_center|LOCUS_08920 4384 3551 gene locus_tag LOCUS_08930 4384 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4548 5918 gene locus_tag LOCUS_08940 gene lpdA 4548 5918 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_08940 6915 5989 gene locus_tag LOCUS_08950 6915 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence088 <1 1147 gene locus_tag LOCUS_08960 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001081798.1:DUF1566 domain-containing protein 1582 1280 gene locus_tag LOCUS_08970 1582 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3985 1583 gene locus_tag LOCUS_08980 3985 1583 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_08980 4937 4158 gene locus_tag LOCUS_08990 4937 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 5361 4927 gene locus_tag LOCUS_09000 5361 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6451 5339 gene locus_tag LOCUS_09010 6451 5339 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence089 119 45 gene locus_tag LOCUS_t00250 119 45 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 212 137 gene locus_tag LOCUS_t00260 212 137 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 379 1233 gene locus_tag LOCUS_09020 379 1233 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976585.1 protein_id gnl|my_center|LOCUS_09020 1300 1764 gene locus_tag LOCUS_09030 1300 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1761 2249 gene locus_tag LOCUS_09040 gene purE 1761 2249 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817242.1 protein_id gnl|my_center|LOCUS_09040 2251 2883 gene locus_tag LOCUS_09050 2251 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2890 3645 gene locus_tag LOCUS_09060 2890 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3647 4675 gene locus_tag LOCUS_09070 3647 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 6255 4705 gene locus_tag LOCUS_09080 6255 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 6780 6316 gene locus_tag LOCUS_09090 6780 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 <7297 6783 gene locus_tag LOCUS_09100 <7297 6783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527768.1:TlpA disulfide reductase family protein >Feature sequence090 512 1591 gene locus_tag LOCUS_09110 512 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2039 1605 gene locus_tag LOCUS_09120 gene rpiB 2039 1605 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_09120 2450 2052 gene locus_tag LOCUS_09130 2450 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 3619 2501 gene locus_tag LOCUS_09140 3619 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4003 4728 gene locus_tag LOCUS_09150 4003 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 4843 5183 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatacaggcgctgataccgg 5616 6902 gene locus_tag LOCUS_09160 5616 6902 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence091 1345 173 gene locus_tag LOCUS_09170 gene gltA 1345 173 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583430.1 protein_id gnl|my_center|LOCUS_09170 2503 1382 gene locus_tag LOCUS_09180 2503 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3700 2588 gene locus_tag LOCUS_09190 gene prfA 3700 2588 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000804726.1 protein_id gnl|my_center|LOCUS_09190 4002 3781 gene locus_tag LOCUS_09200 gene rpmE 4002 3781 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010356285.1 protein_id gnl|my_center|LOCUS_09200 4228 5934 gene locus_tag LOCUS_09210 4228 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence092 145 2115 gene locus_tag LOCUS_09220 gene recG 145 2115 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_09220 2127 3761 gene locus_tag LOCUS_09230 gene recN 2127 3761 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_09230 5106 3751 gene locus_tag LOCUS_09240 5106 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 6024 5209 gene locus_tag LOCUS_09250 6024 5209 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_09250 6772 6026 gene locus_tag LOCUS_09260 6772 6026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence093 2554 1055 gene locus_tag LOCUS_09270 2554 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 3743 2565 gene locus_tag LOCUS_09280 3743 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4016 5140 gene locus_tag LOCUS_09290 4016 5140 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858082.1 protein_id gnl|my_center|LOCUS_09290 6504 5197 gene locus_tag LOCUS_09300 6504 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence094 3048 604 gene locus_tag LOCUS_09310 3048 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 5964 3205 gene locus_tag LOCUS_09320 gene ileS 5964 3205 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_09320 6644 6042 gene locus_tag LOCUS_09330 6644 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence095 1467 271 gene locus_tag LOCUS_09340 1467 271 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_09340 2574 1471 gene locus_tag LOCUS_09350 2574 1471 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_09350 4343 2589 gene locus_tag LOCUS_09360 gene pilB 4343 2589 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence096 690 151 gene locus_tag LOCUS_09370 690 151 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496537.1 protein_id gnl|my_center|LOCUS_09370 1514 687 gene locus_tag LOCUS_09380 1514 687 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_09380 2662 1526 gene locus_tag LOCUS_09390 2662 1526 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_09390 2913 2680 gene locus_tag LOCUS_09400 2913 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3416 2925 gene locus_tag LOCUS_09410 3416 2925 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_09410 4241 3423 gene locus_tag LOCUS_09420 4241 3423 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_09420 4387 5343 gene locus_tag LOCUS_09430 gene lepB 4387 5343 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065098.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence097 84 1220 gene locus_tag LOCUS_09440 84 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2957 1230 gene locus_tag LOCUS_09450 2957 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3208 3044 gene locus_tag LOCUS_09460 3208 3044 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_09460 4289 3303 gene locus_tag LOCUS_09470 4289 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 6058 4292 gene locus_tag LOCUS_09480 6058 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence098 <1 623 gene locus_tag LOCUS_09490 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003420702.1:butyrate kinase 1638 625 gene locus_tag LOCUS_09500 gene tsaD 1638 625 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925415.1 protein_id gnl|my_center|LOCUS_09500 3227 1623 gene locus_tag LOCUS_09510 3227 1623 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_09510 3887 3312 gene locus_tag LOCUS_09520 3887 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 4057 4854 gene locus_tag LOCUS_09530 4057 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4862 6190 gene locus_tag LOCUS_09540 4862 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence099 74 502 gene locus_tag LOCUS_09550 74 502 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_09550 499 765 gene locus_tag LOCUS_09560 499 765 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_09560 766 2523 gene locus_tag LOCUS_09570 gene ptsP 766 2523 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_09570 2505 4088 gene locus_tag LOCUS_09580 2505 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence100 3869 702 gene locus_tag LOCUS_09590 3869 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4802 3888 gene locus_tag LOCUS_09600 4802 3888 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966513.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence101 537 752 gene locus_tag LOCUS_09610 537 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 945 2444 gene locus_tag LOCUS_09620 945 2444 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_09620 2441 3739 gene locus_tag LOCUS_09630 2441 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3736 4497 gene locus_tag LOCUS_09640 3736 4497 CDS product GPMC system MBL fold metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943103.1 protein_id gnl|my_center|LOCUS_09640 5344 4499 gene locus_tag LOCUS_09650 gene htpX 5344 4499 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_09650 5869 5492 gene locus_tag LOCUS_09660 5869 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 <6426 5870 gene locus_tag LOCUS_09670 <6426 5870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase >Feature sequence102 1507 1100 gene locus_tag LOCUS_09680 gene mce 1507 1100 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_09680 1661 3607 gene locus_tag LOCUS_09690 1661 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3667 5370 gene locus_tag LOCUS_09700 gene dnaX 3667 5370 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476228.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence103 2676 160 gene locus_tag LOCUS_09710 2676 160 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941031.1 protein_id gnl|my_center|LOCUS_09710 2769 4127 gene locus_tag LOCUS_09720 2769 4127 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993309.1 protein_id gnl|my_center|LOCUS_09720 4173 4967 gene locus_tag LOCUS_09730 4173 4967 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938913.1 protein_id gnl|my_center|LOCUS_09730 4964 5095 gene locus_tag LOCUS_09740 4964 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence104 1201 170 gene locus_tag LOCUS_09750 1201 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2169 1207 gene locus_tag LOCUS_09760 2169 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2652 2191 gene locus_tag LOCUS_09770 gene nrdR 2652 2191 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_09770 3960 2668 gene locus_tag LOCUS_09780 3960 2668 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_09780 4149 5402 gene locus_tag LOCUS_09790 4149 5402 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767234.1 protein_id gnl|my_center|LOCUS_09790 <6214 5408 gene locus_tag LOCUS_09800 <6214 5408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942344.1:NADP-dependent malic enzyme >Feature sequence105 2303 1353 gene locus_tag LOCUS_09810 2303 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3201 2287 gene locus_tag LOCUS_09820 gene ispH 3201 2287 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_09820 3859 3194 gene locus_tag LOCUS_09830 gene cmk 3859 3194 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_09830 4943 4017 gene locus_tag LOCUS_09840 4943 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5270 5034 gene locus_tag LOCUS_09850 5270 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence106 2215 944 gene locus_tag LOCUS_09860 2215 944 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963518.1 protein_id gnl|my_center|LOCUS_09860 3672 2215 gene locus_tag LOCUS_09870 3672 2215 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881134.1 protein_id gnl|my_center|LOCUS_09870 5806 3659 gene locus_tag LOCUS_09880 5806 3659 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence107 <1 744 gene locus_tag LOCUS_09890 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193360270.1:GTPase Era 1287 745 gene locus_tag LOCUS_09900 1287 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2425 1280 gene locus_tag LOCUS_09910 2425 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3475 2438 gene locus_tag LOCUS_09920 3475 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3843 3487 gene locus_tag LOCUS_09930 3843 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 5371 3899 gene locus_tag LOCUS_09940 5371 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence108 1123 497 gene locus_tag LOCUS_09950 gene mtnX 1123 497 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_09950 1258 2061 gene locus_tag LOCUS_09960 gene pssA 1258 2061 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391331.1 protein_id gnl|my_center|LOCUS_09960 2061 3230 gene locus_tag LOCUS_09970 2061 3230 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_09970 3227 4639 gene locus_tag LOCUS_09980 3227 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence109 238 1404 gene locus_tag LOCUS_09990 238 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2963 1419 gene locus_tag LOCUS_10000 2963 1419 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620446.1 protein_id gnl|my_center|LOCUS_10000 4256 2973 gene locus_tag LOCUS_10010 gene tig 4256 2973 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367952.1 protein_id gnl|my_center|LOCUS_10010 4384 4302 gene locus_tag LOCUS_t00270 4384 4302 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4521 4446 gene locus_tag LOCUS_t00280 4521 4446 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4608 4534 gene locus_tag LOCUS_t00290 4608 4534 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4708 4632 gene locus_tag LOCUS_t00300 4708 4632 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4805 4728 gene locus_tag LOCUS_t00310 4805 4728 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence110 <1 3093 gene locus_tag LOCUS_10020 <1 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001101409.1:DUF1566 domain-containing protein 3436 4014 gene locus_tag LOCUS_10030 3436 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5768 4314 gene locus_tag LOCUS_10040 5768 4314 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence111 470 1807 gene locus_tag LOCUS_10050 gene degP 470 1807 CDS product serine endoprotease DegP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753945.1 protein_id gnl|my_center|LOCUS_10050 1830 3626 gene locus_tag LOCUS_10060 gene pepF 1830 3626 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_10060 3706 5715 gene locus_tag LOCUS_10070 3706 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence112 596 1459 gene locus_tag LOCUS_10080 596 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1970 1461 gene locus_tag LOCUS_10090 1970 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2701 2045 gene locus_tag LOCUS_10100 2701 2045 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256674.1 protein_id gnl|my_center|LOCUS_10100 3336 2698 gene locus_tag LOCUS_10110 gene udk 3336 2698 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_10110 5028 3445 gene locus_tag LOCUS_10120 5028 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence113 2531 2767 gene locus_tag LOCUS_10130 2531 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2771 4372 gene locus_tag LOCUS_10140 2771 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 <5784 4373 gene locus_tag LOCUS_10150 <5784 4373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880620.1:AMP-binding protein >Feature sequence114 <1 510 gene locus_tag LOCUS_10160 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003894930.1:sigma-70 family RNA polymerase sigma factor 503 1330 gene locus_tag LOCUS_10170 503 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1780 1331 gene locus_tag LOCUS_10180 1780 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2206 1802 gene locus_tag LOCUS_10190 2206 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2462 2968 gene locus_tag LOCUS_10200 2462 2968 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 protein_id gnl|my_center|LOCUS_10200 2987 4528 gene locus_tag LOCUS_10210 gene rny 2987 4528 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_10210 4532 5317 gene locus_tag LOCUS_10220 4532 5317 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence115 132 1178 gene locus_tag LOCUS_10230 132 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1184 2548 gene locus_tag LOCUS_10240 gene dacB 1184 2548 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_10240 2549 3088 gene locus_tag LOCUS_10250 2549 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3153 4913 gene locus_tag LOCUS_10260 3153 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 <5770 5106 gene locus_tag LOCUS_10270 <5770 5106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545192.1:chaperonin GroEL >Feature sequence116 102 1154 gene locus_tag LOCUS_10280 102 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1218 2699 gene locus_tag LOCUS_10290 1218 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2701 3621 gene locus_tag LOCUS_10300 2701 3621 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_10300 4162 3623 gene locus_tag LOCUS_10310 4162 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 <5750 4950 gene locus_tag LOCUS_10320 <5750 4950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002080367.1:DUF1566 domain-containing protein >Feature sequence117 <1 598 gene locus_tag LOCUS_10330 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880515.1:30S ribosomal protein S12 methylthiotransferase RimO 615 4697 gene locus_tag LOCUS_10340 615 4697 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence118 171 485 gene locus_tag LOCUS_10350 171 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 482 763 gene locus_tag LOCUS_10360 482 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 760 1929 gene locus_tag LOCUS_10370 760 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 1954 3105 gene locus_tag LOCUS_10380 1954 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3102 3989 gene locus_tag LOCUS_10390 3102 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 3986 4723 gene locus_tag LOCUS_10400 3986 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4804 5673 gene locus_tag LOCUS_10410 4804 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence119 281 2827 gene locus_tag LOCUS_10420 281 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2920 3939 gene locus_tag LOCUS_10430 2920 3939 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_10430 4696 4376 gene locus_tag LOCUS_10440 4696 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5416 4940 gene locus_tag LOCUS_10450 5416 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence120 1136 2182 gene locus_tag LOCUS_10460 1136 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2650 2216 gene locus_tag LOCUS_10470 2650 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5562 2674 gene locus_tag LOCUS_10480 5562 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence121 1167 376 gene locus_tag LOCUS_10490 1167 376 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938748.1 protein_id gnl|my_center|LOCUS_10490 1369 1294 gene locus_tag LOCUS_t00320 1369 1294 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1608 1417 gene locus_tag LOCUS_10500 1608 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2971 1787 gene locus_tag LOCUS_10510 2971 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3757 2987 gene locus_tag LOCUS_10520 3757 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5503 3830 gene locus_tag LOCUS_10530 5503 3830 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence122 193 1164 gene locus_tag LOCUS_10540 193 1164 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_10540 1188 4139 gene locus_tag LOCUS_10550 1188 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4706 4149 gene locus_tag LOCUS_10560 gene sigM 4706 4149 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029295.1 protein_id gnl|my_center|LOCUS_10560 <5482 4706 gene locus_tag LOCUS_10570 <5482 4706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838307.1:adenosine deaminase >Feature sequence123 781 2037 gene locus_tag LOCUS_10580 781 2037 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_10580 2110 3372 gene locus_tag LOCUS_10590 2110 3372 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_10590 4377 3394 gene locus_tag LOCUS_10600 4377 3394 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_10600 4933 4439 gene locus_tag LOCUS_10610 4933 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5451 4939 gene locus_tag LOCUS_10620 5451 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence124 <1 1070 gene locus_tag LOCUS_10630 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966917.1:heavy metal translocating P-type ATPase 1226 2593 gene locus_tag LOCUS_10640 gene glmM 1226 2593 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938578.1 protein_id gnl|my_center|LOCUS_10640 2590 3309 gene locus_tag LOCUS_10650 2590 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3345 5096 gene locus_tag LOCUS_10660 3345 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence125 2012 1062 gene locus_tag LOCUS_10670 2012 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2700 2149 gene locus_tag LOCUS_10680 2700 2149 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246691.1 protein_id gnl|my_center|LOCUS_10680 3871 2750 gene locus_tag LOCUS_10690 3871 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4596 3919 gene locus_tag LOCUS_10700 gene queC 4596 3919 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence126 1257 322 gene locus_tag LOCUS_10710 gene fabD 1257 322 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861134.1 protein_id gnl|my_center|LOCUS_10710 2335 1259 gene locus_tag LOCUS_10720 2335 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3381 2332 gene locus_tag LOCUS_10730 3381 2332 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073438.1 protein_id gnl|my_center|LOCUS_10730 3986 3378 gene locus_tag LOCUS_10740 3986 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence127 2881 4677 gene locus_tag LOCUS_10750 2881 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 <5302 4681 gene locus_tag LOCUS_10760 <5302 4681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890811.1:TetR/AcrR family transcriptional regulator >Feature sequence128 1527 70 gene locus_tag LOCUS_10770 1527 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3837 1705 gene locus_tag LOCUS_10780 gene clpB 3837 1705 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948176.1 protein_id gnl|my_center|LOCUS_10780 4072 4680 gene locus_tag LOCUS_10790 4072 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 4775 5158 gene locus_tag LOCUS_10800 4775 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence129 6 551 gene locus_tag LOCUS_10810 6 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1487 558 gene locus_tag LOCUS_10820 1487 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1630 3006 gene locus_tag LOCUS_10830 1630 3006 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_10830 3219 3482 gene locus_tag LOCUS_10840 3219 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 <5176 3564 gene locus_tag LOCUS_10850 <5176 3564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291001.1:CHASE2 domain-containing protein >Feature sequence130 266 1804 gene locus_tag LOCUS_10860 266 1804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_10860 1808 3001 gene locus_tag LOCUS_10870 gene folP 1808 3001 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582989.1 protein_id gnl|my_center|LOCUS_10870 2995 3804 gene locus_tag LOCUS_10880 gene cdaA 2995 3804 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115697.1 protein_id gnl|my_center|LOCUS_10880 3814 4380 gene locus_tag LOCUS_10890 3814 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4377 4907 gene locus_tag LOCUS_10900 4377 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence131 64 834 gene locus_tag LOCUS_10910 64 834 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_10910 843 2384 gene locus_tag LOCUS_10920 gene rng 843 2384 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_10920 2384 2785 gene locus_tag LOCUS_10930 2384 2785 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264782.1 protein_id gnl|my_center|LOCUS_10930 2866 4452 gene locus_tag LOCUS_10940 2866 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence132 <1 1233 gene locus_tag LOCUS_10950 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000061358.1:two-component system response regulator 2463 1255 gene locus_tag LOCUS_10960 gene cca 2463 1255 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708517.1 protein_id gnl|my_center|LOCUS_10960 3772 2471 gene locus_tag LOCUS_10970 3772 2471 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_10970 <4927 3780 gene locus_tag LOCUS_10980 <4927 3780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583247.1:DNA polymerase I >Feature sequence133 293 108 gene locus_tag LOCUS_10990 293 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2138 333 gene locus_tag LOCUS_11000 gene lepA 2138 333 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941921.1 protein_id gnl|my_center|LOCUS_11000 2849 2151 gene locus_tag LOCUS_11010 gene rnc 2849 2151 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583311.1 protein_id gnl|my_center|LOCUS_11010 3582 2851 gene locus_tag LOCUS_11020 gene rlmB 3582 2851 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_11020 3707 4714 gene locus_tag LOCUS_11030 gene ansA 3707 4714 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948559.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence134 2138 930 gene locus_tag LOCUS_11040 2138 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3531 2140 gene locus_tag LOCUS_11050 3531 2140 CDS product MBOAT family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035887521.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence135 <1 1522 gene locus_tag LOCUS_11060 <1 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545409.1:molecular chaperone DnaK 1519 2415 gene locus_tag LOCUS_11070 1519 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2419 3189 gene locus_tag LOCUS_11080 2419 3189 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_11080 3206 4732 gene locus_tag LOCUS_11090 gene hutH 3206 4732 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017128.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence136 <1 3626 gene locus_tag LOCUS_11100 <1 3626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107756.1:acyl-CoA dehydratase activase 4533 3667 gene locus_tag LOCUS_11110 4533 3667 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence137 2101 992 gene locus_tag LOCUS_11120 2101 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3295 2138 gene locus_tag LOCUS_11130 3295 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence138 1442 114 gene locus_tag LOCUS_11140 1442 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1593 4130 gene locus_tag LOCUS_11150 1593 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence139 52 1047 gene locus_tag LOCUS_11160 52 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1199 2056 gene locus_tag LOCUS_11170 1199 2056 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_11170 2058 3095 gene locus_tag LOCUS_11180 gene rlmN 2058 3095 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_11180 3088 3936 gene locus_tag LOCUS_11190 gene lipA 3088 3936 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence140 <1 507 gene locus_tag LOCUS_11200 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108289.1:pyridoxal phosphate-dependent aminotransferase 559 1143 gene locus_tag LOCUS_11210 559 1143 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705703.1 protein_id gnl|my_center|LOCUS_11210 1279 2364 gene locus_tag LOCUS_11220 gene ugpC 1279 2364 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_11220 2370 3635 gene locus_tag LOCUS_11230 2370 3635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 3666 4430 gene locus_tag LOCUS_11240 3666 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence141 2142 751 gene locus_tag LOCUS_11250 2142 751 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_11250 3724 2132 gene locus_tag LOCUS_11260 3724 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence142 1481 408 gene locus_tag LOCUS_11270 1481 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 1625 2821 gene locus_tag LOCUS_11280 1625 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2849 4177 gene locus_tag LOCUS_11290 2849 4177 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence143 1555 3117 gene locus_tag LOCUS_11300 gene citF 1555 3117 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368306.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence144 25 2262 gene locus_tag LOCUS_11310 25 2262 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948722.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence145 1580 903 gene locus_tag LOCUS_11320 gene lolD 1580 903 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_11320 2874 1573 gene locus_tag LOCUS_11330 2874 1573 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_11330 3785 2904 gene locus_tag LOCUS_11340 3785 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4258 3851 gene locus_tag LOCUS_11350 4258 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence146 2079 814 gene locus_tag LOCUS_11360 2079 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3691 2312 gene locus_tag LOCUS_11370 3691 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4373 3678 gene locus_tag LOCUS_11380 4373 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence147 <1 1319 gene locus_tag LOCUS_11390 <1 1319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682366.1:MATE family efflux transporter 1453 3897 gene locus_tag LOCUS_11400 1453 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence148 <1 1902 gene locus_tag LOCUS_11410 <1 1902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902257.1:S9 family peptidase 1908 2783 gene locus_tag LOCUS_11420 gene xerC 1908 2783 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_11420 2863 3891 gene locus_tag LOCUS_11430 2863 3891 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321517.1 protein_id gnl|my_center|LOCUS_11430 4046 4270 gene locus_tag LOCUS_11440 4046 4270 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence149 104 1264 gene locus_tag LOCUS_11450 104 1264 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_11450 1294 2733 gene locus_tag LOCUS_11460 gene cysS 1294 2733 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_11460 2850 3563 gene locus_tag LOCUS_11470 2850 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 4303 3611 gene locus_tag LOCUS_11480 4303 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence150 <1 1245 gene locus_tag LOCUS_11490 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1258 3516 gene locus_tag LOCUS_11500 1258 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3957 4187 gene locus_tag LOCUS_11510 3957 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence151 699 1181 gene locus_tag LOCUS_11520 gene nrdG 699 1181 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_11520 1192 2844 gene locus_tag LOCUS_11530 1192 2844 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940078.1 protein_id gnl|my_center|LOCUS_11530 2969 3352 gene locus_tag LOCUS_11540 2969 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence152 <1 957 gene locus_tag LOCUS_11550 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545411.1:B12-binding domain-containing radical SAM protein 954 1670 gene locus_tag LOCUS_11560 954 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1924 3933 gene locus_tag LOCUS_11570 gene pcrA 1924 3933 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836754.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence153 1442 168 gene locus_tag LOCUS_11580 gene serS 1442 168 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_11580 3857 1524 gene locus_tag LOCUS_11590 gene lon 3857 1524 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence154 <1 786 gene locus_tag LOCUS_11600 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048249.1:sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein 789 1403 gene locus_tag LOCUS_11610 789 1403 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_11610 1512 2588 gene locus_tag LOCUS_11620 gene recA 1512 2588 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_11620 2585 3775 gene locus_tag LOCUS_11630 2585 3775 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence155 467 892 gene locus_tag LOCUS_11640 467 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 908 1363 gene locus_tag LOCUS_11650 908 1363 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_11650 1373 3268 gene locus_tag LOCUS_11660 1373 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3973 3488 gene locus_tag LOCUS_11670 3973 3488 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941558.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence156 151 573 gene locus_tag LOCUS_11680 gene fabZ 151 573 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_11680 966 595 gene locus_tag LOCUS_11690 966 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3166 1046 gene locus_tag LOCUS_11700 3166 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 <3978 3205 gene locus_tag LOCUS_11710 <3978 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762240.1:inositol-3-phosphate synthase >Feature sequence157 1849 3300 gene locus_tag LOCUS_11720 1849 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence158 1221 616 gene locus_tag LOCUS_11730 gene clpP 1221 616 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_11730 2126 1281 gene locus_tag LOCUS_11740 gene prmC 2126 1281 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_11740 2821 2126 gene locus_tag LOCUS_11750 2821 2126 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962571.1 protein_id gnl|my_center|LOCUS_11750 3676 2834 gene locus_tag LOCUS_11760 3676 2834 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence159 2462 252 gene locus_tag LOCUS_11770 2462 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3838 2477 gene locus_tag LOCUS_11780 3838 2477 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122716.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence160 1047 2096 gene locus_tag LOCUS_11790 1047 2096 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_11790 <3857 2145 gene locus_tag LOCUS_11800 <3857 2145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001049207.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence161 709 170 gene locus_tag LOCUS_11810 709 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 872 1465 gene locus_tag LOCUS_11820 872 1465 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_11820 1532 3154 gene locus_tag LOCUS_11830 1532 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence162 677 1315 gene locus_tag LOCUS_11840 677 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 2210 1305 gene locus_tag LOCUS_11850 2210 1305 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence163 195 2492 gene locus_tag LOCUS_11860 195 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2497 3465 gene locus_tag LOCUS_11870 2497 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence164 1934 2929 gene locus_tag LOCUS_11880 1934 2929 CDS product IS5-like element IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310555.1 protein_id gnl|my_center|LOCUS_11880 3788 3075 gene locus_tag LOCUS_11890 3788 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence165 2209 1238 gene locus_tag LOCUS_11900 2209 1238 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_11900 2891 2298 gene locus_tag LOCUS_11910 2891 2298 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766706.1 protein_id gnl|my_center|LOCUS_11910 <3725 2913 gene locus_tag LOCUS_11920 <3725 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003722870.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence166 773 447 gene locus_tag LOCUS_11930 gene acpS 773 447 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635040.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence167 <1 2480 gene locus_tag LOCUS_11940 <1 2480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765523.1:pyruvate, phosphate dikinase >Feature sequence168 7 2886 gene locus_tag LOCUS_11950 7 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 2914 3342 gene locus_tag LOCUS_11960 2914 3342 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094983.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence169 790 212 gene locus_tag LOCUS_11970 790 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1663 800 gene locus_tag LOCUS_11980 1663 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1896 1690 gene locus_tag LOCUS_11990 1896 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <3592 2011 gene locus_tag LOCUS_12000 <3592 2011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948291.1:carbon starvation protein A >Feature sequence170 1621 1211 gene locus_tag LOCUS_12010 gene cdd 1621 1211 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_12010 2471 1614 gene locus_tag LOCUS_12020 2471 1614 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence171 2678 225 gene locus_tag LOCUS_12030 2678 225 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence172 161 1126 gene locus_tag LOCUS_12040 161 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1140 1976 gene locus_tag LOCUS_12050 gene speE 1140 1976 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence173 1173 652 gene locus_tag LOCUS_12060 1173 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2736 1186 gene locus_tag LOCUS_12070 2736 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3271 2729 gene locus_tag LOCUS_12080 3271 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 >Feature sequence174 2213 330 gene locus_tag LOCUS_12090 2213 330 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000459865.1 protein_id gnl|my_center|LOCUS_12090 2855 2271 gene locus_tag LOCUS_12100 2855 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence175 41 289 gene locus_tag LOCUS_12110 41 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 418 624 gene locus_tag LOCUS_12120 418 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 614 904 gene locus_tag LOCUS_12130 614 904 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916169.1 protein_id gnl|my_center|LOCUS_12130 975 2492 gene locus_tag LOCUS_12140 975 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence176 953 1915 gene locus_tag LOCUS_12150 953 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence177 913 38 gene locus_tag LOCUS_12160 913 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1095 2024 gene locus_tag LOCUS_12170 1095 2024 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_12170 2055 2750 gene locus_tag LOCUS_12180 2055 2750 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707733.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence178 1502 462 gene locus_tag LOCUS_12190 gene queA 1502 462 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957235.1 protein_id gnl|my_center|LOCUS_12190 2816 1527 gene locus_tag LOCUS_12200 2816 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence179 1647 613 gene locus_tag LOCUS_12210 1647 613 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_12210 2687 1950 gene locus_tag LOCUS_12220 2687 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101009.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence180 1057 338 gene locus_tag LOCUS_12230 1057 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2376 1072 gene locus_tag LOCUS_12240 gene tolB 2376 1072 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence181 1121 366 gene locus_tag LOCUS_12250 1121 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 <3148 1166 gene locus_tag LOCUS_12260 <3148 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836754.1:DNA helicase PcrA >Feature sequence182 >Feature sequence183 1980 613 gene locus_tag LOCUS_12270 gene trkA 1980 613 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_12270 <3031 2322 gene locus_tag LOCUS_12280 <3031 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001030302.1:nucleotidyl transferase AbiEii/AbiGii toxin family protein >Feature sequence184 <1 629 gene locus_tag LOCUS_12290 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476196.1:excinuclease ABC subunit UvrA 1071 700 gene locus_tag LOCUS_12300 1071 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1649 1218 gene locus_tag LOCUS_12310 gene aroQ 1649 1218 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_12310 1852 1646 gene locus_tag LOCUS_12320 1852 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 <3004 1831 gene locus_tag LOCUS_12330 <3004 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546707.1:[FeFe] hydrogenase H-cluster maturation GTPase HydF >Feature sequence185 <1 1045 gene locus_tag LOCUS_12340 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261336.1:exodeoxyribonuclease V subunit alpha >Feature sequence186 43 1974 gene locus_tag LOCUS_12350 43 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence187 2911 2054 gene locus_tag LOCUS_12360 2911 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence188 2270 69 gene locus_tag LOCUS_12370 2270 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 <2896 2289 gene locus_tag LOCUS_12380 <2896 2289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941152.1:GTP cyclohydrolase FolE2 >Feature sequence189 <1 699 gene locus_tag LOCUS_12390 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202616.1:sugar-binding protein 734 1477 gene locus_tag LOCUS_12400 734 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1480 2523 gene locus_tag LOCUS_12410 gene rsgA 1480 2523 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001073056.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence190 841 53 gene locus_tag LOCUS_12420 841 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1281 1925 gene locus_tag LOCUS_12430 1281 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1934 2536 gene locus_tag LOCUS_12440 gene tmk 1934 2536 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence191 643 173 gene locus_tag LOCUS_12450 gene greA 643 173 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383382.1 protein_id gnl|my_center|LOCUS_12450 818 2026 gene locus_tag LOCUS_12460 818 2026 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_12460 2096 2770 gene locus_tag LOCUS_12470 gene pyrE 2096 2770 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence192 1711 2676 gene locus_tag LOCUS_12480 1711 2676 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence193 1902 886 gene locus_tag LOCUS_12490 gene pheS 1902 886 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053743.1 protein_id gnl|my_center|LOCUS_12490 <2773 1967 gene locus_tag LOCUS_12500 <2773 1967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207610.1:bifunctional tetrahydrofolate synthase/dihydrofolate synthase >Feature sequence194 29 991 gene locus_tag LOCUS_12510 29 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1866 997 gene locus_tag LOCUS_12520 1866 997 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence195 <1 616 gene locus_tag LOCUS_12530 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107232.1:NAD-dependent epimerase/dehydratase family protein 609 1784 gene locus_tag LOCUS_12540 609 1784 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence196 281 880 gene locus_tag LOCUS_12550 281 880 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266644.1 protein_id gnl|my_center|LOCUS_12550 948 2360 gene locus_tag LOCUS_12560 948 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence197 456 22 gene locus_tag LOCUS_12570 gene tolR 456 22 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089889.1 protein_id gnl|my_center|LOCUS_12570 1181 456 gene locus_tag LOCUS_12580 gene tolQ 1181 456 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_12580 <2688 1209 gene locus_tag LOCUS_12590 <2688 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_123640612.1:RIP metalloprotease RseP >Feature sequence198 203 1816 gene locus_tag LOCUS_12600 203 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 <2631 1831 gene locus_tag LOCUS_12610 <2631 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430205.1:Na/Pi cotransporter family protein >Feature sequence199 >Feature sequence200 <1 534 gene locus_tag LOCUS_12620 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762065.1:efflux RND transporter permease subunit 531 851 gene locus_tag LOCUS_12630 531 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 853 2229 gene locus_tag LOCUS_12640 853 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence201 1045 1986 gene locus_tag LOCUS_12650 1045 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence202 1371 673 gene locus_tag LOCUS_12660 gene dapD 1371 673 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081875.1 protein_id gnl|my_center|LOCUS_12660 2098 1373 gene locus_tag LOCUS_12670 2098 1373 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_12670 2217 2141 gene locus_tag LOCUS_t00330 2217 2141 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2312 2237 gene locus_tag LOCUS_t00340 2312 2237 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38