>Feature sequence01 1263 2075 gene locus_tag LOCUS_00010 1263 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2087 2518 gene locus_tag LOCUS_00020 2087 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2606 3535 gene locus_tag LOCUS_00030 2606 3535 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 protein_id gnl|my_center|LOCUS_00030 3541 3981 gene locus_tag LOCUS_00040 3541 3981 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528593.1 protein_id gnl|my_center|LOCUS_00040 3978 4202 gene locus_tag LOCUS_00050 3978 4202 CDS product VF530 family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005396617.1 protein_id gnl|my_center|LOCUS_00050 4767 4204 gene locus_tag LOCUS_00060 4767 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5830 4853 gene locus_tag LOCUS_00070 5830 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6434 5988 gene locus_tag LOCUS_00080 6434 5988 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021829.1 protein_id gnl|my_center|LOCUS_00080 6770 6477 gene locus_tag LOCUS_00090 6770 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8358 6802 gene locus_tag LOCUS_00100 8358 6802 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_00100 10447 8447 gene locus_tag LOCUS_00110 10447 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11215 10502 gene locus_tag LOCUS_00120 11215 10502 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193486466.1 protein_id gnl|my_center|LOCUS_00120 11410 12162 gene locus_tag LOCUS_00130 11410 12162 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_00130 12198 13358 gene locus_tag LOCUS_00140 12198 13358 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962321.1 protein_id gnl|my_center|LOCUS_00140 13564 15975 gene locus_tag LOCUS_00150 13564 15975 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_00150 16683 15982 gene locus_tag LOCUS_00160 16683 15982 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403295.1 protein_id gnl|my_center|LOCUS_00160 16775 17365 gene locus_tag LOCUS_00170 16775 17365 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_00170 17437 17898 gene locus_tag LOCUS_00180 17437 17898 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_00180 17891 18688 gene locus_tag LOCUS_00190 17891 18688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20093 18867 gene locus_tag LOCUS_00200 20093 18867 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_00200 20551 20090 gene locus_tag LOCUS_00210 20551 20090 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383049.1 protein_id gnl|my_center|LOCUS_00210 23215 20723 gene locus_tag LOCUS_00220 23215 20723 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421594.1 protein_id gnl|my_center|LOCUS_00220 23833 23231 gene locus_tag LOCUS_00230 23833 23231 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403961.1 protein_id gnl|my_center|LOCUS_00230 23979 24929 gene locus_tag LOCUS_00240 23979 24929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25579 24926 gene locus_tag LOCUS_00250 gene trmB 25579 24926 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_00250 26225 25581 gene locus_tag LOCUS_00260 gene pdxH 26225 25581 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522643.1 protein_id gnl|my_center|LOCUS_00260 26803 26225 gene locus_tag LOCUS_00270 26803 26225 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_00270 26847 27248 gene locus_tag LOCUS_00280 26847 27248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28481 27399 gene locus_tag LOCUS_00290 28481 27399 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_00290 29240 28563 gene locus_tag LOCUS_00300 29240 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31083 29422 gene locus_tag LOCUS_00310 31083 29422 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_00310 31192 33201 gene locus_tag LOCUS_00320 31192 33201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33623 33177 gene locus_tag LOCUS_00330 33623 33177 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_00330 35280 33625 gene locus_tag LOCUS_00340 35280 33625 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403326.1 protein_id gnl|my_center|LOCUS_00340 36139 35366 gene locus_tag LOCUS_00350 36139 35366 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_00350 36646 36293 gene locus_tag LOCUS_00360 36646 36293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 36714 37457 gene locus_tag LOCUS_00370 gene rlmB 36714 37457 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404211.1 protein_id gnl|my_center|LOCUS_00370 37939 37508 gene locus_tag LOCUS_00380 37939 37508 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_00380 38068 39915 gene locus_tag LOCUS_00390 38068 39915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40007 42049 gene locus_tag LOCUS_00400 40007 42049 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_00400 42113 42727 gene locus_tag LOCUS_00410 42113 42727 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_00410 42724 43518 gene locus_tag LOCUS_00420 42724 43518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43784 46027 gene locus_tag LOCUS_00430 43784 46027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 46869 46111 gene locus_tag LOCUS_00440 46869 46111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48054 46924 gene locus_tag LOCUS_00450 gene mnmA 48054 46924 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_00450 48797 48291 gene locus_tag LOCUS_00460 48797 48291 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_00460 49023 50330 gene locus_tag LOCUS_00470 49023 50330 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403282.1 protein_id gnl|my_center|LOCUS_00470 50337 50744 gene locus_tag LOCUS_00480 50337 50744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 52089 50752 gene locus_tag LOCUS_00490 52089 50752 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838343.1 protein_id gnl|my_center|LOCUS_00490 55196 52089 gene locus_tag LOCUS_00500 55196 52089 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838342.1 protein_id gnl|my_center|LOCUS_00500 56265 55198 gene locus_tag LOCUS_00510 56265 55198 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_00510 57630 56362 gene locus_tag LOCUS_00520 gene serS 57630 56362 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404592.1 protein_id gnl|my_center|LOCUS_00520 57801 58280 gene locus_tag LOCUS_00530 57801 58280 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403162.1 protein_id gnl|my_center|LOCUS_00530 58367 59668 gene locus_tag LOCUS_00540 58367 59668 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_00540 59661 60167 gene locus_tag LOCUS_00550 59661 60167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 60215 60817 gene locus_tag LOCUS_00560 60215 60817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 61459 60830 gene locus_tag LOCUS_00570 61459 60830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967732.1 protein_id gnl|my_center|LOCUS_00570 61737 61522 gene locus_tag LOCUS_00580 gene rpmE 61737 61522 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403916.1 protein_id gnl|my_center|LOCUS_00580 63305 61806 gene locus_tag LOCUS_00590 63305 61806 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_00590 64626 63364 gene locus_tag LOCUS_00600 64626 63364 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_00600 64706 65731 gene locus_tag LOCUS_00610 64706 65731 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405098.1 protein_id gnl|my_center|LOCUS_00610 68394 65734 gene locus_tag LOCUS_00620 68394 65734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 69925 68492 gene locus_tag LOCUS_00630 gene pyk 69925 68492 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_00630 70017 71441 gene locus_tag LOCUS_00640 70017 71441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 71584 74442 gene locus_tag LOCUS_00650 71584 74442 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_00650 74447 75919 gene locus_tag LOCUS_00660 74447 75919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 75967 76452 gene locus_tag LOCUS_00670 75967 76452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 78214 76478 gene locus_tag LOCUS_00680 78214 76478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80089 78341 gene locus_tag LOCUS_00690 80089 78341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 83220 80119 gene locus_tag LOCUS_00700 83220 80119 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_00700 83512 84885 gene locus_tag LOCUS_00710 83512 84885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 85005 87938 gene locus_tag LOCUS_00720 85005 87938 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_00720 87957 89255 gene locus_tag LOCUS_00730 87957 89255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89457 89384 gene locus_tag LOCUS_t00010 89457 89384 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 89575 90837 gene locus_tag LOCUS_00740 gene rocD 89575 90837 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_00740 90929 92278 gene locus_tag LOCUS_00750 gene lat 90929 92278 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_00750 92485 92649 gene locus_tag LOCUS_00760 92485 92649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 95528 93291 gene locus_tag LOCUS_00770 gene purL 95528 93291 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_00770 97331 95685 gene locus_tag LOCUS_00780 97331 95685 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093328686.1 protein_id gnl|my_center|LOCUS_00780 97698 101240 gene locus_tag LOCUS_00790 97698 101240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 101407 101610 gene locus_tag LOCUS_00800 101407 101610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 101607 101801 gene locus_tag LOCUS_00810 101607 101801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 101918 102901 gene locus_tag LOCUS_00820 101918 102901 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921611.1 protein_id gnl|my_center|LOCUS_00820 103592 102915 gene locus_tag LOCUS_00830 103592 102915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 104769 103633 gene locus_tag LOCUS_00840 104769 103633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 105472 104903 gene locus_tag LOCUS_00850 105472 104903 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228316.1 protein_id gnl|my_center|LOCUS_00850 107908 105488 gene locus_tag LOCUS_00860 107908 105488 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_00860 109441 108056 gene locus_tag LOCUS_00870 109441 108056 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196504.1 protein_id gnl|my_center|LOCUS_00870 109743 110321 gene locus_tag LOCUS_00880 109743 110321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 110611 113094 gene locus_tag LOCUS_00890 110611 113094 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 protein_id gnl|my_center|LOCUS_00890 113550 113101 gene locus_tag LOCUS_00900 113550 113101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 113974 113552 gene locus_tag LOCUS_00910 113974 113552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 114446 113967 gene locus_tag LOCUS_00920 114446 113967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 114979 115344 gene locus_tag LOCUS_00930 114979 115344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 115344 115736 gene locus_tag LOCUS_00940 115344 115736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 115822 116616 gene locus_tag LOCUS_00950 115822 116616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 116645 117145 gene locus_tag LOCUS_00960 116645 117145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 117172 117630 gene locus_tag LOCUS_00970 gene merR 117172 117630 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640387.1 protein_id gnl|my_center|LOCUS_00970 117712 118092 gene locus_tag LOCUS_00980 117712 118092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 118089 118703 gene locus_tag LOCUS_00990 118089 118703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 118971 120311 gene locus_tag LOCUS_01000 118971 120311 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163428.1 protein_id gnl|my_center|LOCUS_01000 120865 120428 gene locus_tag LOCUS_01010 120865 120428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 121354 120884 gene locus_tag LOCUS_01020 121354 120884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 121667 121344 gene locus_tag LOCUS_01030 121667 121344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 122307 121816 gene locus_tag LOCUS_01040 122307 121816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 124813 122390 gene locus_tag LOCUS_01050 124813 122390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_01050 126381 125029 gene locus_tag LOCUS_01060 126381 125029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 129676 126413 gene locus_tag LOCUS_01070 129676 126413 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176521608.1 protein_id gnl|my_center|LOCUS_01070 130731 129691 gene locus_tag LOCUS_01080 130731 129691 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005681496.1 protein_id gnl|my_center|LOCUS_01080 131470 131225 gene locus_tag LOCUS_01090 131470 131225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01090 133035 131908 gene locus_tag LOCUS_01100 133035 131908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142454231.1 protein_id gnl|my_center|LOCUS_01100 133178 133894 gene locus_tag LOCUS_01110 133178 133894 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_01110 133899 135323 gene locus_tag LOCUS_01120 133899 135323 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_01120 136588 135389 gene locus_tag LOCUS_01130 136588 135389 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227156.1 protein_id gnl|my_center|LOCUS_01130 138077 136611 gene locus_tag LOCUS_01140 138077 136611 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_01140 138473 138087 gene locus_tag LOCUS_01150 138473 138087 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_01150 138700 138482 gene locus_tag LOCUS_01160 138700 138482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 139205 138759 gene locus_tag LOCUS_01170 139205 138759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 139534 139256 gene locus_tag LOCUS_01180 139534 139256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 140094 139753 gene locus_tag LOCUS_01190 140094 139753 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_01190 140965 140147 gene locus_tag LOCUS_01200 140965 140147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 142779 140965 gene locus_tag LOCUS_01210 142779 140965 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_01210 144831 142804 gene locus_tag LOCUS_01220 144831 142804 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_01220 145357 144839 gene locus_tag LOCUS_01230 145357 144839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 147254 145380 gene locus_tag LOCUS_01240 147254 145380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 148749 147265 gene locus_tag LOCUS_01250 148749 147265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 152504 148746 gene locus_tag LOCUS_01260 152504 148746 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_01260 153034 152687 gene locus_tag LOCUS_01270 153034 152687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 153305 153769 gene locus_tag LOCUS_01280 153305 153769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 154032 158342 gene locus_tag LOCUS_01290 154032 158342 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_01290 158366 159577 gene locus_tag LOCUS_01300 158366 159577 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_01300 159648 159980 gene locus_tag LOCUS_01310 159648 159980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 160006 160362 gene locus_tag LOCUS_01320 160006 160362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 160417 161187 gene locus_tag LOCUS_01330 160417 161187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 161448 163883 gene locus_tag LOCUS_01340 161448 163883 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_01340 163940 164680 gene locus_tag LOCUS_01350 163940 164680 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212588.1 protein_id gnl|my_center|LOCUS_01350 164711 165601 gene locus_tag LOCUS_01360 164711 165601 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011235810.1 protein_id gnl|my_center|LOCUS_01360 165598 166164 gene locus_tag LOCUS_01370 165598 166164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 166245 168188 gene locus_tag LOCUS_01380 166245 168188 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_01380 169332 168211 gene locus_tag LOCUS_01390 169332 168211 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_01390 170580 169345 gene locus_tag LOCUS_01400 170580 169345 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403293.1 protein_id gnl|my_center|LOCUS_01400 171732 170668 gene locus_tag LOCUS_01410 171732 170668 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840078.1 protein_id gnl|my_center|LOCUS_01410 172972 171806 gene locus_tag LOCUS_01420 172972 171806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 173061 174035 gene locus_tag LOCUS_01430 173061 174035 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_01430 174040 175575 gene locus_tag LOCUS_01440 174040 175575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 175578 176672 gene locus_tag LOCUS_01450 gene mutY 175578 176672 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_01450 177100 177897 gene locus_tag LOCUS_01460 177100 177897 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_01460 178661 177894 gene locus_tag LOCUS_01470 178661 177894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 178774 178968 gene locus_tag LOCUS_01480 178774 178968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 180339 179005 gene locus_tag LOCUS_01490 gene radA 180339 179005 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405212.1 protein_id gnl|my_center|LOCUS_01490 180565 180341 gene locus_tag LOCUS_01500 180565 180341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01500 181387 180584 gene locus_tag LOCUS_01510 181387 180584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01510 182541 181465 gene locus_tag LOCUS_01520 182541 181465 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_01520 182665 183654 gene locus_tag LOCUS_01530 gene dusB 182665 183654 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771241.1 protein_id gnl|my_center|LOCUS_01530 183806 184012 gene locus_tag LOCUS_01540 183806 184012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 184393 184067 gene locus_tag LOCUS_01550 gene trxA 184393 184067 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932522.1 protein_id gnl|my_center|LOCUS_01550 188704 184499 gene locus_tag LOCUS_01560 gene dnaE 188704 184499 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_01560 189011 189664 gene locus_tag LOCUS_01570 189011 189664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 189700 190632 gene locus_tag LOCUS_01580 189700 190632 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405123.1 protein_id gnl|my_center|LOCUS_01580 190634 191404 gene locus_tag LOCUS_01590 190634 191404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 191715 191401 gene locus_tag LOCUS_01600 191715 191401 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_01600 192185 191727 gene locus_tag LOCUS_01610 192185 191727 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_01610 192513 192166 gene locus_tag LOCUS_01620 192513 192166 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_01620 192675 193100 gene locus_tag LOCUS_01630 192675 193100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 193100 193957 gene locus_tag LOCUS_01640 193100 193957 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839121.1 protein_id gnl|my_center|LOCUS_01640 194970 194209 gene locus_tag LOCUS_01650 gene surE 194970 194209 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_01650 195797 194967 gene locus_tag LOCUS_01660 gene panB 195797 194967 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_01660 196234 195800 gene locus_tag LOCUS_01670 gene fabZ 196234 195800 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_01670 196960 196271 gene locus_tag LOCUS_01680 gene ubiE 196960 196271 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889031.1 protein_id gnl|my_center|LOCUS_01680 197709 197098 gene locus_tag LOCUS_01690 197709 197098 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_01690 198299 197706 gene locus_tag LOCUS_01700 198299 197706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 198943 198296 gene locus_tag LOCUS_01710 198943 198296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 199628 198975 gene locus_tag LOCUS_01720 199628 198975 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_01720 199773 200864 gene locus_tag LOCUS_01730 199773 200864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 200871 202865 gene locus_tag LOCUS_01740 gene ligA 200871 202865 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_01740 202977 204191 gene locus_tag LOCUS_01750 202977 204191 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403664.1 protein_id gnl|my_center|LOCUS_01750 204390 204689 gene locus_tag LOCUS_01760 204390 204689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 204715 205716 gene locus_tag LOCUS_01770 204715 205716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 207752 205854 gene locus_tag LOCUS_01780 gene acs 207752 205854 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_01780 208358 208561 gene locus_tag LOCUS_01790 208358 208561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 209114 208551 gene locus_tag LOCUS_01800 209114 208551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 209453 209638 gene locus_tag LOCUS_01810 209453 209638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 209767 209863 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 209999 213214 gene locus_tag LOCUS_01820 209999 213214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 213984 213241 gene locus_tag LOCUS_01830 213984 213241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 214327 215691 gene locus_tag LOCUS_01840 214327 215691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 215684 216814 gene locus_tag LOCUS_01850 215684 216814 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_01850 216799 217452 gene locus_tag LOCUS_01860 216799 217452 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_01860 220022 217467 gene locus_tag LOCUS_01870 220022 217467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 220096 220650 gene locus_tag LOCUS_01880 220096 220650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 220961 220641 gene locus_tag LOCUS_01890 220961 220641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 221246 221689 gene locus_tag LOCUS_01900 gene umuD 221246 221689 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_01900 221697 223019 gene locus_tag LOCUS_01910 gene umuC 221697 223019 CDS product translesion error-prone DNA polymerase V subunit UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705911.1 protein_id gnl|my_center|LOCUS_01910 225040 223028 gene locus_tag LOCUS_01920 225040 223028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 225122 225781 gene locus_tag LOCUS_01930 gene lexA 225122 225781 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403931.1 protein_id gnl|my_center|LOCUS_01930 226297 225794 gene locus_tag LOCUS_01940 226297 225794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 227212 226406 gene locus_tag LOCUS_01950 227212 226406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 227219 227413 gene locus_tag LOCUS_01960 227219 227413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 227719 227555 gene locus_tag LOCUS_01970 227719 227555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 227856 228359 gene locus_tag LOCUS_01980 227856 228359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 228386 228643 gene locus_tag LOCUS_01990 gene rpmA 228386 228643 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056021.1 protein_id gnl|my_center|LOCUS_01990 229763 228714 gene locus_tag LOCUS_02000 229763 228714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 229837 231450 gene locus_tag LOCUS_02010 229837 231450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 231522 232175 gene locus_tag LOCUS_02020 231522 232175 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_02020 232220 233986 gene locus_tag LOCUS_02030 232220 233986 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_02030 234356 233979 gene locus_tag LOCUS_02040 234356 233979 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_02040 234482 235801 gene locus_tag LOCUS_02050 234482 235801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 235830 237011 gene locus_tag LOCUS_02060 235830 237011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 237011 238147 gene locus_tag LOCUS_02070 237011 238147 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839746.1 protein_id gnl|my_center|LOCUS_02070 238229 239407 gene locus_tag LOCUS_02080 238229 239407 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_02080 239725 243588 gene locus_tag LOCUS_02090 gene porU 239725 243588 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_02090 243643 244779 gene locus_tag LOCUS_02100 gene porV 243643 244779 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_02100 244902 247949 gene locus_tag LOCUS_02110 244902 247949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 247949 251290 gene locus_tag LOCUS_02120 247949 251290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 251287 252234 gene locus_tag LOCUS_02130 251287 252234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 252363 253094 gene locus_tag LOCUS_02140 252363 253094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 253094 253765 gene locus_tag LOCUS_02150 gene rpe 253094 253765 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_02150 253856 254803 gene locus_tag LOCUS_02160 253856 254803 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932928.1 protein_id gnl|my_center|LOCUS_02160 254848 255660 gene locus_tag LOCUS_02170 254848 255660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 255647 256441 gene locus_tag LOCUS_02180 255647 256441 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_02180 256442 257014 gene locus_tag LOCUS_02190 256442 257014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 257448 257918 gene locus_tag LOCUS_02200 gene mraZ 257448 257918 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 protein_id gnl|my_center|LOCUS_02200 257905 258846 gene locus_tag LOCUS_02210 gene rsmH 257905 258846 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_02210 258843 259262 gene locus_tag LOCUS_02220 258843 259262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 259259 261427 gene locus_tag LOCUS_02230 259259 261427 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403331.1 protein_id gnl|my_center|LOCUS_02230 261424 262884 gene locus_tag LOCUS_02240 261424 262884 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838231.1 protein_id gnl|my_center|LOCUS_02240 262884 264020 gene locus_tag LOCUS_02250 gene mraY 262884 264020 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_02250 263933 265372 gene locus_tag LOCUS_02260 gene murD 263933 265372 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_02260 265587 266678 gene locus_tag LOCUS_02270 265587 266678 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061084.1 protein_id gnl|my_center|LOCUS_02270 266671 267771 gene locus_tag LOCUS_02280 gene murG 266671 267771 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_02280 267771 269201 gene locus_tag LOCUS_02290 gene murC 267771 269201 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403337.1 protein_id gnl|my_center|LOCUS_02290 269205 269951 gene locus_tag LOCUS_02300 269205 269951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 270169 271428 gene locus_tag LOCUS_02310 gene ftsA 270169 271428 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015601.1 protein_id gnl|my_center|LOCUS_02310 271489 272832 gene locus_tag LOCUS_02320 gene ftsZ 271489 272832 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403340.1 protein_id gnl|my_center|LOCUS_02320 273408 273692 gene locus_tag LOCUS_02330 273408 273692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 274003 274452 gene locus_tag LOCUS_02340 274003 274452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 276643 274733 gene locus_tag LOCUS_02350 276643 274733 CDS product M61 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_02350 277369 277911 gene locus_tag LOCUS_02360 277369 277911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 279176 278019 gene locus_tag LOCUS_02370 279176 278019 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499920.1 protein_id gnl|my_center|LOCUS_02370 280485 279349 gene locus_tag LOCUS_02380 gene hppD 280485 279349 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_02380 280857 281801 gene locus_tag LOCUS_02390 gene paaA 280857 281801 CDS product 1,2-phenylacetyl-CoA epoxidase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_02390 281919 282218 gene locus_tag LOCUS_02400 gene paaB 281919 282218 CDS product 1,2-phenylacetyl-CoA epoxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_02400 282279 283061 gene locus_tag LOCUS_02410 gene paaC 282279 283061 CDS product phenylacetate-CoA oxygenase subunit PaaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965788.1 protein_id gnl|my_center|LOCUS_02410 283147 283656 gene locus_tag LOCUS_02420 gene paaJ 283147 283656 CDS product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177939.1 protein_id gnl|my_center|LOCUS_02420 283647 284009 gene locus_tag LOCUS_02430 283647 284009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 284006 284797 gene locus_tag LOCUS_02440 gene paaG 284006 284797 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_02440 285236 284817 gene locus_tag LOCUS_02450 285236 284817 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096578551.1 protein_id gnl|my_center|LOCUS_02450 285469 285233 gene locus_tag LOCUS_02460 285469 285233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 285592 286758 gene locus_tag LOCUS_02470 285592 286758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 286852 287259 gene locus_tag LOCUS_02480 gene paaI 286852 287259 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391943.1 protein_id gnl|my_center|LOCUS_02480 287311 287661 gene locus_tag LOCUS_02490 287311 287661 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 protein_id gnl|my_center|LOCUS_02490 287703 288920 gene locus_tag LOCUS_02500 gene paaJ 287703 288920 CDS product bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206197.1 protein_id gnl|my_center|LOCUS_02500 288933 289376 gene locus_tag LOCUS_02510 288933 289376 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_02510 289408 290007 gene locus_tag LOCUS_02520 gene paaY 289408 290007 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 protein_id gnl|my_center|LOCUS_02520 290099 290542 gene locus_tag LOCUS_02530 290099 290542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 290579 290785 gene locus_tag LOCUS_02540 290579 290785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 290791 292866 gene locus_tag LOCUS_02550 gene paaZ 290791 292866 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889007.1 protein_id gnl|my_center|LOCUS_02550 292972 293328 gene locus_tag LOCUS_02560 292972 293328 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_02560 293374 294138 gene locus_tag LOCUS_02570 293374 294138 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_02570 297128 294135 gene locus_tag LOCUS_02580 297128 294135 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_02580 297294 300566 gene locus_tag LOCUS_02590 297294 300566 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence02 <1 559 gene locus_tag LOCUS_02600 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837919.1:CPBP family glutamic-type intramembrane protease 714 1277 gene locus_tag LOCUS_02610 714 1277 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_02610 2602 1262 gene locus_tag LOCUS_02620 2602 1262 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_02620 3943 2690 gene locus_tag LOCUS_02630 gene clpX 3943 2690 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472289.1 protein_id gnl|my_center|LOCUS_02630 4620 3970 gene locus_tag LOCUS_02640 gene clpP 4620 3970 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 protein_id gnl|my_center|LOCUS_02640 5928 4639 gene locus_tag LOCUS_02650 gene tig 5928 4639 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023405.1 protein_id gnl|my_center|LOCUS_02650 6075 5991 gene locus_tag LOCUS_t00020 6075 5991 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6224 6556 gene locus_tag LOCUS_02660 6224 6556 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_02660 6556 7308 gene locus_tag LOCUS_02670 6556 7308 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174552577.1 protein_id gnl|my_center|LOCUS_02670 7318 7977 gene locus_tag LOCUS_02680 7318 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8927 7986 gene locus_tag LOCUS_02690 8927 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 10123 8924 gene locus_tag LOCUS_02700 10123 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 11098 10127 gene locus_tag LOCUS_02710 11098 10127 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_02710 11192 11821 gene locus_tag LOCUS_02720 11192 11821 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986838.1 protein_id gnl|my_center|LOCUS_02720 12559 13851 gene locus_tag LOCUS_02730 12559 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13844 14035 gene locus_tag LOCUS_02740 13844 14035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14509 14039 gene locus_tag LOCUS_02750 gene smpB 14509 14039 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829588.1 protein_id gnl|my_center|LOCUS_02750 15046 14621 gene locus_tag LOCUS_02760 15046 14621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 16278 15052 gene locus_tag LOCUS_02770 16278 15052 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_02770 17519 16290 gene locus_tag LOCUS_02780 17519 16290 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_02780 18799 17597 gene locus_tag LOCUS_02790 18799 17597 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_02790 19062 19913 gene locus_tag LOCUS_02800 19062 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 20025 21359 gene locus_tag LOCUS_02810 20025 21359 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205134.1 protein_id gnl|my_center|LOCUS_02810 21437 22468 gene locus_tag LOCUS_02820 21437 22468 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388877.1 protein_id gnl|my_center|LOCUS_02820 24024 22576 gene locus_tag LOCUS_02830 24024 22576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 24784 24173 gene locus_tag LOCUS_02840 24784 24173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 27080 24870 gene locus_tag LOCUS_02850 27080 24870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 27303 28385 gene locus_tag LOCUS_02860 27303 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 28382 29104 gene locus_tag LOCUS_02870 28382 29104 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_02870 33811 30248 gene locus_tag LOCUS_02880 33811 30248 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_02880 34903 33830 gene locus_tag LOCUS_02890 34903 33830 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_02890 36412 34934 gene locus_tag LOCUS_02900 36412 34934 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_02900 37161 36436 gene locus_tag LOCUS_02910 37161 36436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 37308 38915 gene locus_tag LOCUS_02920 37308 38915 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933376.1 protein_id gnl|my_center|LOCUS_02920 40359 38986 gene locus_tag LOCUS_02930 40359 38986 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_02930 40835 40365 gene locus_tag LOCUS_02940 40835 40365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 42206 40896 gene locus_tag LOCUS_02950 42206 40896 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_02950 42952 42203 gene locus_tag LOCUS_02960 42952 42203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 44649 42958 gene locus_tag LOCUS_02970 44649 42958 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_02970 47598 44707 gene locus_tag LOCUS_02980 47598 44707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 47807 49573 gene locus_tag LOCUS_02990 47807 49573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 49682 50029 gene locus_tag LOCUS_03000 49682 50029 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_03000 50112 50714 gene locus_tag LOCUS_03010 gene recR 50112 50714 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932487.1 protein_id gnl|my_center|LOCUS_03010 50895 52769 gene locus_tag LOCUS_03020 50895 52769 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_03020 52808 53995 gene locus_tag LOCUS_03030 52808 53995 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_03030 57296 54051 gene locus_tag LOCUS_03040 57296 54051 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_03040 57989 57399 gene locus_tag LOCUS_03050 57989 57399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 60785 58245 gene locus_tag LOCUS_03060 gene topA 60785 58245 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_03060 61272 60799 gene locus_tag LOCUS_03070 61272 60799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 61953 61426 gene locus_tag LOCUS_03080 61953 61426 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971326.1 protein_id gnl|my_center|LOCUS_03080 61953 62573 gene locus_tag LOCUS_03090 61953 62573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 63193 62624 gene locus_tag LOCUS_03100 63193 62624 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808789.1 protein_id gnl|my_center|LOCUS_03100 63192 64373 gene locus_tag LOCUS_03110 63192 64373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 64504 65220 gene locus_tag LOCUS_03120 gene radC 64504 65220 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_03120 65305 65622 gene locus_tag LOCUS_03130 65305 65622 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_03130 65715 67355 gene locus_tag LOCUS_03140 gene argS 65715 67355 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_03140 68207 67401 gene locus_tag LOCUS_03150 68207 67401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 69057 68269 gene locus_tag LOCUS_03160 69057 68269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 70172 69057 gene locus_tag LOCUS_03170 gene dnaN 70172 69057 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402793.1 protein_id gnl|my_center|LOCUS_03170 70361 71431 gene locus_tag LOCUS_03180 70361 71431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838453.1 protein_id gnl|my_center|LOCUS_03180 71771 72688 gene locus_tag LOCUS_03190 gene miaA 71771 72688 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404248.1 protein_id gnl|my_center|LOCUS_03190 72729 72974 gene locus_tag LOCUS_03200 gene purS 72729 72974 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_03200 72974 73294 gene locus_tag LOCUS_03210 72974 73294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 73296 73994 gene locus_tag LOCUS_03220 gene purQ 73296 73994 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_03220 74017 74778 gene locus_tag LOCUS_03230 gene lptB 74017 74778 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_03230 74791 75111 gene locus_tag LOCUS_03240 74791 75111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 76362 75139 gene locus_tag LOCUS_03250 gene rho 76362 75139 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405059.1 protein_id gnl|my_center|LOCUS_03250 77860 76520 gene locus_tag LOCUS_03260 77860 76520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838376.1 protein_id gnl|my_center|LOCUS_03260 79227 77926 gene locus_tag LOCUS_03270 79227 77926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 80420 79227 gene locus_tag LOCUS_03280 80420 79227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 81241 80444 gene locus_tag LOCUS_03290 81241 80444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 82069 81251 gene locus_tag LOCUS_03300 82069 81251 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_03300 83629 82139 gene locus_tag LOCUS_03310 gene malQ 83629 82139 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941842.1 protein_id gnl|my_center|LOCUS_03310 85836 83626 gene locus_tag LOCUS_03320 gene glgB 85836 83626 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_03320 85930 87162 gene locus_tag LOCUS_03330 85930 87162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_03330 88639 87173 gene locus_tag LOCUS_03340 88639 87173 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405061.1 protein_id gnl|my_center|LOCUS_03340 88963 89967 gene locus_tag LOCUS_03350 88963 89967 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838289.1 protein_id gnl|my_center|LOCUS_03350 90349 89975 gene locus_tag LOCUS_03360 90349 89975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 90876 90445 gene locus_tag LOCUS_03370 90876 90445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 91276 90887 gene locus_tag LOCUS_03380 91276 90887 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932025.1 protein_id gnl|my_center|LOCUS_03380 91494 91273 gene locus_tag LOCUS_03390 91494 91273 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142728.1 protein_id gnl|my_center|LOCUS_03390 91955 91554 gene locus_tag LOCUS_03400 91955 91554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 92041 93465 gene locus_tag LOCUS_03410 92041 93465 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_03410 93470 94348 gene locus_tag LOCUS_03420 gene ispE 93470 94348 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_03420 94386 96866 gene locus_tag LOCUS_03430 94386 96866 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_03430 96977 97567 gene locus_tag LOCUS_03440 96977 97567 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 protein_id gnl|my_center|LOCUS_03440 97619 97948 gene locus_tag LOCUS_03450 97619 97948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 97952 98449 gene locus_tag LOCUS_03460 97952 98449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 98471 99451 gene locus_tag LOCUS_03470 98471 99451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 99577 100068 gene locus_tag LOCUS_03480 99577 100068 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921747.1 protein_id gnl|my_center|LOCUS_03480 103370 100227 gene locus_tag LOCUS_03490 103370 100227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03490 104918 103548 gene locus_tag LOCUS_03500 104918 103548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 105598 104930 gene locus_tag LOCUS_03510 105598 104930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 106111 105695 gene locus_tag LOCUS_03520 106111 105695 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_03520 106821 106114 gene locus_tag LOCUS_03530 106821 106114 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_03530 108607 106835 gene locus_tag LOCUS_03540 108607 106835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 108807 108610 gene locus_tag LOCUS_03550 108807 108610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 110475 108811 gene locus_tag LOCUS_03560 110475 108811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 111641 110607 gene locus_tag LOCUS_03570 111641 110607 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_03570 112222 111644 gene locus_tag LOCUS_03580 112222 111644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 114782 112239 gene locus_tag LOCUS_03590 114782 112239 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_03590 115512 114775 gene locus_tag LOCUS_03600 115512 114775 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062096.1 protein_id gnl|my_center|LOCUS_03600 116637 115537 gene locus_tag LOCUS_03610 gene gcvT 116637 115537 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_03610 117142 118266 gene locus_tag LOCUS_03620 117142 118266 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403585.1 protein_id gnl|my_center|LOCUS_03620 118467 119072 gene locus_tag LOCUS_03630 118467 119072 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_03630 119575 119069 gene locus_tag LOCUS_03640 119575 119069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 119988 119689 gene locus_tag LOCUS_03650 119988 119689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 120099 120575 gene locus_tag LOCUS_03660 120099 120575 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_03660 122056 120605 gene locus_tag LOCUS_03670 122056 120605 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867156.1 protein_id gnl|my_center|LOCUS_03670 123523 122117 gene locus_tag LOCUS_03680 123523 122117 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_03680 124353 123601 gene locus_tag LOCUS_03690 124353 123601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 124773 124381 gene locus_tag LOCUS_03700 124773 124381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 125095 124826 gene locus_tag LOCUS_03710 125095 124826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 125206 126507 gene locus_tag LOCUS_03720 gene pvdM 125206 126507 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246323.1 protein_id gnl|my_center|LOCUS_03720 126684 127796 gene locus_tag LOCUS_03730 gene dinB 126684 127796 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 protein_id gnl|my_center|LOCUS_03730 128212 127811 gene locus_tag LOCUS_03740 128212 127811 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_03740 128361 128945 gene locus_tag LOCUS_03750 128361 128945 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329277.1 protein_id gnl|my_center|LOCUS_03750 128938 129615 gene locus_tag LOCUS_03760 128938 129615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 129605 130801 gene locus_tag LOCUS_03770 129605 130801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 131467 130883 gene locus_tag LOCUS_03780 gene aat 131467 130883 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338055.1 protein_id gnl|my_center|LOCUS_03780 133963 131549 gene locus_tag LOCUS_03790 133963 131549 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839793.1 protein_id gnl|my_center|LOCUS_03790 134736 134239 gene locus_tag LOCUS_03800 134736 134239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 136239 134905 gene locus_tag LOCUS_03810 136239 134905 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_03810 136455 137174 gene locus_tag LOCUS_03820 136455 137174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 137180 138070 gene locus_tag LOCUS_03830 137180 138070 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_03830 138497 138054 gene locus_tag LOCUS_03840 138497 138054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 139171 138497 gene locus_tag LOCUS_03850 139171 138497 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190428.1 protein_id gnl|my_center|LOCUS_03850 139288 139764 gene locus_tag LOCUS_03860 139288 139764 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_03860 139773 140126 gene locus_tag LOCUS_03870 139773 140126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 140971 140291 gene locus_tag LOCUS_03880 140971 140291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 142005 141163 gene locus_tag LOCUS_03890 142005 141163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 142858 142100 gene locus_tag LOCUS_03900 142858 142100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115766.1 protein_id gnl|my_center|LOCUS_03900 143725 142859 gene locus_tag LOCUS_03910 gene lgt 143725 142859 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461890.1 protein_id gnl|my_center|LOCUS_03910 145213 143753 gene locus_tag LOCUS_03920 145213 143753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 145969 145346 gene locus_tag LOCUS_03930 145969 145346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 146731 146141 gene locus_tag LOCUS_03940 146731 146141 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402867.1 protein_id gnl|my_center|LOCUS_03940 146884 148074 gene locus_tag LOCUS_03950 146884 148074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 150912 148105 gene locus_tag LOCUS_03960 gene uvrA 150912 148105 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_03960 151078 152385 gene locus_tag LOCUS_03970 151078 152385 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_03970 153402 152452 gene locus_tag LOCUS_03980 153402 152452 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_03980 153647 153928 gene locus_tag LOCUS_03990 153647 153928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 154334 156070 gene locus_tag LOCUS_04000 154334 156070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 156172 156840 gene locus_tag LOCUS_04010 156172 156840 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_04010 156969 158405 gene locus_tag LOCUS_04020 156969 158405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 158626 159069 gene locus_tag LOCUS_04030 158626 159069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 159097 160161 gene locus_tag LOCUS_04040 159097 160161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 160741 163620 gene locus_tag LOCUS_04050 160741 163620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 163712 164077 gene locus_tag LOCUS_04060 163712 164077 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762411.1 protein_id gnl|my_center|LOCUS_04060 164915 164475 gene locus_tag LOCUS_04070 164915 164475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 166129 167154 gene locus_tag LOCUS_04080 166129 167154 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_04080 167222 167641 gene locus_tag LOCUS_04090 167222 167641 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138156903.1 protein_id gnl|my_center|LOCUS_04090 167634 168935 gene locus_tag LOCUS_04100 gene dcm 167634 168935 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_04100 168936 170039 gene locus_tag LOCUS_04110 168936 170039 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964363.1 protein_id gnl|my_center|LOCUS_04110 170136 170933 gene locus_tag LOCUS_04120 170136 170933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 171689 170970 gene locus_tag LOCUS_04130 171689 170970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 172541 171696 gene locus_tag LOCUS_04140 172541 171696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 174522 172528 gene locus_tag LOCUS_04150 174522 172528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 175824 174733 gene locus_tag LOCUS_04160 175824 174733 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_04160 177200 176064 gene locus_tag LOCUS_04170 177200 176064 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_04170 178389 177223 gene locus_tag LOCUS_04180 178389 177223 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_04180 178781 179317 gene locus_tag LOCUS_04190 178781 179317 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_04190 179381 179632 gene locus_tag LOCUS_04200 179381 179632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 180145 179612 gene locus_tag LOCUS_04210 180145 179612 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_04210 180724 180152 gene locus_tag LOCUS_04220 180724 180152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 181863 180730 gene locus_tag LOCUS_04230 gene tyrA 181863 180730 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477896.1 protein_id gnl|my_center|LOCUS_04230 182753 184807 gene locus_tag LOCUS_04240 gene uvrB 182753 184807 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_04240 185388 184939 gene locus_tag LOCUS_04250 185388 184939 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141820.1 protein_id gnl|my_center|LOCUS_04250 185520 186656 gene locus_tag LOCUS_04260 185520 186656 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_04260 187431 186664 gene locus_tag LOCUS_04270 187431 186664 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_04270 188646 187432 gene locus_tag LOCUS_04280 gene tyrS 188646 187432 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404369.1 protein_id gnl|my_center|LOCUS_04280 189209 188649 gene locus_tag LOCUS_04290 189209 188649 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207199.1 protein_id gnl|my_center|LOCUS_04290 189667 189209 gene locus_tag LOCUS_04300 189667 189209 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_04300 189924 189754 gene locus_tag LOCUS_04310 189924 189754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 190097 189933 gene locus_tag LOCUS_04320 gene rpmG 190097 189933 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402813.1 protein_id gnl|my_center|LOCUS_04320 190347 190102 gene locus_tag LOCUS_04330 gene rpmB 190347 190102 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963554.1 protein_id gnl|my_center|LOCUS_04330 190629 192566 gene locus_tag LOCUS_04340 gene gyrB 190629 192566 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_04340 192604 195057 gene locus_tag LOCUS_04350 gene gyrA 192604 195057 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962907.1 protein_id gnl|my_center|LOCUS_04350 196068 195130 gene locus_tag LOCUS_04360 196068 195130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 196708 196061 gene locus_tag LOCUS_04370 gene rsmG 196708 196061 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_04370 198602 196716 gene locus_tag LOCUS_04380 gene mnmG 198602 196716 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_04380 198752 198678 gene locus_tag LOCUS_t00030 198752 198678 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 199368 198823 gene locus_tag LOCUS_04390 199368 198823 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_04390 199428 200144 gene locus_tag LOCUS_04400 199428 200144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 200141 200440 gene locus_tag LOCUS_04410 200141 200440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 200440 201201 gene locus_tag LOCUS_04420 200440 201201 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_04420 202196 201198 gene locus_tag LOCUS_04430 202196 201198 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_04430 203408 202338 gene locus_tag LOCUS_04440 203408 202338 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061460.1 protein_id gnl|my_center|LOCUS_04440 204082 203405 gene locus_tag LOCUS_04450 204082 203405 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405016.1 protein_id gnl|my_center|LOCUS_04450 204881 204294 gene locus_tag LOCUS_04460 gene ruvA 204881 204294 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728708.1 protein_id gnl|my_center|LOCUS_04460 205453 204878 gene locus_tag LOCUS_04470 gene ruvC 205453 204878 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405380.1 protein_id gnl|my_center|LOCUS_04470 206413 205580 gene locus_tag LOCUS_04480 206413 205580 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403308.1 protein_id gnl|my_center|LOCUS_04480 207785 206583 gene locus_tag LOCUS_04490 207785 206583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 208930 207785 gene locus_tag LOCUS_04500 208930 207785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 209313 210653 gene locus_tag LOCUS_04510 gene ffh 209313 210653 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404376.1 protein_id gnl|my_center|LOCUS_04510 210687 211556 gene locus_tag LOCUS_04520 210687 211556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 211572 212114 gene locus_tag LOCUS_04530 gene rimM 211572 212114 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404374.1 protein_id gnl|my_center|LOCUS_04530 212117 212809 gene locus_tag LOCUS_04540 gene trmD 212117 212809 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_04540 212840 213199 gene locus_tag LOCUS_04550 gene rplS 212840 213199 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404372.1 protein_id gnl|my_center|LOCUS_04550 213279 213833 gene locus_tag LOCUS_04560 213279 213833 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000789400.1 protein_id gnl|my_center|LOCUS_04560 214929 214015 gene locus_tag LOCUS_04570 214929 214015 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184594.1 protein_id gnl|my_center|LOCUS_04570 216491 214929 gene locus_tag LOCUS_04580 216491 214929 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_04580 218119 216629 gene locus_tag LOCUS_04590 gene glpK 218119 216629 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556718.1 protein_id gnl|my_center|LOCUS_04590 218533 218135 gene locus_tag LOCUS_04600 218533 218135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 219488 218592 gene locus_tag LOCUS_04610 219488 218592 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_04610 220979 219513 gene locus_tag LOCUS_04620 220979 219513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 221227 220976 gene locus_tag LOCUS_04630 221227 220976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 221757 221224 gene locus_tag LOCUS_04640 221757 221224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 222414 221905 gene locus_tag LOCUS_04650 222414 221905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 223304 222411 gene locus_tag LOCUS_04660 223304 222411 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404721.1 protein_id gnl|my_center|LOCUS_04660 223746 223306 gene locus_tag LOCUS_04670 gene dtd 223746 223306 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_04670 224185 224694 gene locus_tag LOCUS_04680 gene bstA 224185 224694 CDS product bacillithiol transferase BstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000999077.1 protein_id gnl|my_center|LOCUS_04680 224782 225792 gene locus_tag LOCUS_04690 gene purM 224782 225792 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404229.1 protein_id gnl|my_center|LOCUS_04690 225810 226169 gene locus_tag LOCUS_04700 225810 226169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 226661 227146 gene locus_tag LOCUS_04710 226661 227146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 228748 227195 gene locus_tag LOCUS_04720 228748 227195 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804353.1 protein_id gnl|my_center|LOCUS_04720 229934 229011 gene locus_tag LOCUS_04730 229934 229011 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922143.1 protein_id gnl|my_center|LOCUS_04730 230540 231157 gene locus_tag LOCUS_04740 230540 231157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 231372 231154 gene locus_tag LOCUS_04750 231372 231154 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_04750 231820 231374 gene locus_tag LOCUS_04760 231820 231374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 231948 232835 gene locus_tag LOCUS_04770 231948 232835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 232944 232795 gene locus_tag LOCUS_04780 232944 232795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 233568 233242 gene locus_tag LOCUS_04790 233568 233242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 234259 234885 gene locus_tag LOCUS_04800 234259 234885 CDS product 2OG-Fe(II) oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962260.1 protein_id gnl|my_center|LOCUS_04800 235086 234892 gene locus_tag LOCUS_04810 235086 234892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 235179 235523 gene locus_tag LOCUS_04820 235179 235523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 235594 235935 gene locus_tag LOCUS_04830 235594 235935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 236838 235951 gene locus_tag LOCUS_04840 236838 235951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 237438 236881 gene locus_tag LOCUS_04850 237438 236881 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_04850 240377 237438 gene locus_tag LOCUS_04860 240377 237438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 241045 240377 gene locus_tag LOCUS_04870 241045 240377 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_04870 242319 241060 gene locus_tag LOCUS_04880 242319 241060 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_04880 242486 244273 gene locus_tag LOCUS_04890 242486 244273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 244270 244980 gene locus_tag LOCUS_04900 244270 244980 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_04900 245262 247847 gene locus_tag LOCUS_04910 245262 247847 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838916.1 protein_id gnl|my_center|LOCUS_04910 247848 248396 gene locus_tag LOCUS_04920 247848 248396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 248858 248403 gene locus_tag LOCUS_04930 248858 248403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 248986 249651 gene locus_tag LOCUS_04940 248986 249651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 251049 249655 gene locus_tag LOCUS_04950 251049 249655 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_04950 251896 251153 gene locus_tag LOCUS_04960 251896 251153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 252596 252021 gene locus_tag LOCUS_04970 252596 252021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975568.1 protein_id gnl|my_center|LOCUS_04970 253151 252852 gene locus_tag LOCUS_04980 253151 252852 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_04980 253750 253148 gene locus_tag LOCUS_04990 253750 253148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 254397 253813 gene locus_tag LOCUS_05000 254397 253813 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065739343.1 protein_id gnl|my_center|LOCUS_05000 254994 254668 gene locus_tag LOCUS_05010 254994 254668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 255481 255020 gene locus_tag LOCUS_05020 255481 255020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 256122 255625 gene locus_tag LOCUS_05030 256122 255625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 256587 256213 gene locus_tag LOCUS_05040 256587 256213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 258168 256831 gene locus_tag LOCUS_05050 258168 256831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 258703 258302 gene locus_tag LOCUS_05060 258703 258302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence03 2342 1146 gene locus_tag LOCUS_05070 gene lhgO 2342 1146 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107022.1 protein_id gnl|my_center|LOCUS_05070 3312 2335 gene locus_tag LOCUS_05080 3312 2335 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403393.1 protein_id gnl|my_center|LOCUS_05080 3844 3302 gene locus_tag LOCUS_05090 3844 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4625 3912 gene locus_tag LOCUS_05100 4625 3912 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_05100 4748 7081 gene locus_tag LOCUS_05110 4748 7081 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706678.1 protein_id gnl|my_center|LOCUS_05110 8451 7174 gene locus_tag LOCUS_05120 8451 7174 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_05120 9427 8522 gene locus_tag LOCUS_05130 gene cysD 9427 8522 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_05130 10000 9473 gene locus_tag LOCUS_05140 gene cysC 10000 9473 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_05140 10763 10017 gene locus_tag LOCUS_05150 gene cysQ 10763 10017 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_05150 12543 10774 gene locus_tag LOCUS_05160 12543 10774 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_05160 14666 12606 gene locus_tag LOCUS_05170 14666 12606 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838897.1 protein_id gnl|my_center|LOCUS_05170 15425 14667 gene locus_tag LOCUS_05180 15425 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 15538 16437 gene locus_tag LOCUS_05190 15538 16437 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015543.1 protein_id gnl|my_center|LOCUS_05190 16542 17288 gene locus_tag LOCUS_05200 16542 17288 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_05200 17377 18351 gene locus_tag LOCUS_05210 gene etfA 17377 18351 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101963.1 protein_id gnl|my_center|LOCUS_05210 18405 19730 gene locus_tag LOCUS_05220 18405 19730 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461382.1 protein_id gnl|my_center|LOCUS_05220 19759 20106 gene locus_tag LOCUS_05230 19759 20106 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_05230 20165 20467 gene locus_tag LOCUS_05240 20165 20467 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979864.1 protein_id gnl|my_center|LOCUS_05240 20663 21835 gene locus_tag LOCUS_05250 20663 21835 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_05250 21919 23127 gene locus_tag LOCUS_05260 21919 23127 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084682.1 protein_id gnl|my_center|LOCUS_05260 23382 23612 gene locus_tag LOCUS_05270 23382 23612 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096668979.1 protein_id gnl|my_center|LOCUS_05270 23609 23968 gene locus_tag LOCUS_05280 23609 23968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 23965 24282 gene locus_tag LOCUS_05290 23965 24282 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405420.1 protein_id gnl|my_center|LOCUS_05290 24401 25000 gene locus_tag LOCUS_05300 24401 25000 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_05300 25075 26226 gene locus_tag LOCUS_05310 25075 26226 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816129.1 protein_id gnl|my_center|LOCUS_05310 26304 26837 gene locus_tag LOCUS_05320 26304 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 26908 27852 gene locus_tag LOCUS_05330 26908 27852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 27985 28503 gene locus_tag LOCUS_05340 27985 28503 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256496.1 protein_id gnl|my_center|LOCUS_05340 28532 29431 gene locus_tag LOCUS_05350 28532 29431 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_05350 29442 30368 gene locus_tag LOCUS_05360 29442 30368 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_05360 30730 30365 gene locus_tag LOCUS_05370 gene crcB 30730 30365 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_05370 31375 30758 gene locus_tag LOCUS_05380 31375 30758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05380 31823 31323 gene locus_tag LOCUS_05390 31823 31323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05390 34683 31888 gene locus_tag LOCUS_05400 gene ppc 34683 31888 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402879.1 protein_id gnl|my_center|LOCUS_05400 34770 35333 gene locus_tag LOCUS_05410 34770 35333 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_05410 36820 35411 gene locus_tag LOCUS_05420 36820 35411 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838082.1 protein_id gnl|my_center|LOCUS_05420 37043 38497 gene locus_tag LOCUS_05430 37043 38497 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840109.1 protein_id gnl|my_center|LOCUS_05430 38521 40596 gene locus_tag LOCUS_05440 38521 40596 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840110.1 protein_id gnl|my_center|LOCUS_05440 40700 41230 gene locus_tag LOCUS_05450 40700 41230 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_05450 42237 41233 gene locus_tag LOCUS_05460 42237 41233 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699793.1 protein_id gnl|my_center|LOCUS_05460 43049 42234 gene locus_tag LOCUS_05470 43049 42234 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 protein_id gnl|my_center|LOCUS_05470 44054 44509 gene locus_tag LOCUS_05480 44054 44509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 45060 44515 gene locus_tag LOCUS_05490 45060 44515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925589.1 protein_id gnl|my_center|LOCUS_05490 45139 45756 gene locus_tag LOCUS_05500 45139 45756 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_05500 46544 45975 gene locus_tag LOCUS_05510 46544 45975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 48127 47108 gene locus_tag LOCUS_05520 48127 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 48467 48255 gene locus_tag LOCUS_05530 48467 48255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 49876 48575 gene locus_tag LOCUS_05540 49876 48575 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103171.1 protein_id gnl|my_center|LOCUS_05540 52829 49932 gene locus_tag LOCUS_05550 gene gcvP 52829 49932 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_05550 53045 55036 gene locus_tag LOCUS_05560 53045 55036 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_05560 55051 57063 gene locus_tag LOCUS_05570 55051 57063 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_05570 57192 58382 gene locus_tag LOCUS_05580 57192 58382 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839763.1 protein_id gnl|my_center|LOCUS_05580 59171 58452 gene locus_tag LOCUS_05590 59171 58452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 59287 60150 gene locus_tag LOCUS_05600 59287 60150 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_05600 60585 60142 gene locus_tag LOCUS_05610 60585 60142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 62023 60569 gene locus_tag LOCUS_05620 62023 60569 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278133.1 protein_id gnl|my_center|LOCUS_05620 62501 62016 gene locus_tag LOCUS_05630 62501 62016 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 protein_id gnl|my_center|LOCUS_05630 63793 62501 gene locus_tag LOCUS_05640 63793 62501 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_05640 63975 65456 gene locus_tag LOCUS_05650 gene putP 63975 65456 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477390.1 protein_id gnl|my_center|LOCUS_05650 68932 65540 gene locus_tag LOCUS_05660 68932 65540 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_05660 69554 69021 gene locus_tag LOCUS_05670 69554 69021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 70000 70731 gene locus_tag LOCUS_05680 70000 70731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 72375 70732 gene locus_tag LOCUS_05690 gene ettA 72375 70732 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_05690 73218 72775 gene locus_tag LOCUS_05700 73218 72775 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037987.1 protein_id gnl|my_center|LOCUS_05700 77328 73297 gene locus_tag LOCUS_05710 77328 73297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 77565 79448 gene locus_tag LOCUS_05720 77565 79448 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_05720 79544 80746 gene locus_tag LOCUS_05730 79544 80746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 80736 81218 gene locus_tag LOCUS_05740 80736 81218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 84559 81272 gene locus_tag LOCUS_05750 84559 81272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_05750 86024 85302 gene locus_tag LOCUS_05760 86024 85302 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_05760 86710 86192 gene locus_tag LOCUS_05770 86710 86192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 87204 86755 gene locus_tag LOCUS_05780 87204 86755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 87940 87494 gene locus_tag LOCUS_05790 87940 87494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 88413 88081 gene locus_tag LOCUS_05800 88413 88081 CDS product low molecular weight protein tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528628.1 protein_id gnl|my_center|LOCUS_05800 88773 88525 gene locus_tag LOCUS_05810 88773 88525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 89388 88915 gene locus_tag LOCUS_05820 89388 88915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 89996 89505 gene locus_tag LOCUS_05830 89996 89505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 91740 90190 gene locus_tag LOCUS_05840 91740 90190 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_05840 93415 91751 gene locus_tag LOCUS_05850 93415 91751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 93524 94141 gene locus_tag LOCUS_05860 gene ccmA 93524 94141 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_05860 94264 95367 gene locus_tag LOCUS_05870 94264 95367 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_05870 95448 95897 gene locus_tag LOCUS_05880 95448 95897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 96260 96811 gene locus_tag LOCUS_05890 96260 96811 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 protein_id gnl|my_center|LOCUS_05890 96824 97279 gene locus_tag LOCUS_05900 96824 97279 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_05900 97284 97751 gene locus_tag LOCUS_05910 97284 97751 CDS product DUF6265 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920316.1 protein_id gnl|my_center|LOCUS_05910 97751 98119 gene locus_tag LOCUS_05920 97751 98119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 98280 98708 gene locus_tag LOCUS_05930 98280 98708 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_05930 100359 98743 gene locus_tag LOCUS_05940 100359 98743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 100793 101083 gene locus_tag LOCUS_05950 100793 101083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 104374 101111 gene locus_tag LOCUS_05960 104374 101111 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070433.1 protein_id gnl|my_center|LOCUS_05960 104810 104577 gene locus_tag LOCUS_05970 104810 104577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 105095 104910 gene locus_tag LOCUS_05980 105095 104910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 106403 105126 gene locus_tag LOCUS_05990 106403 105126 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_05990 106830 106486 gene locus_tag LOCUS_06000 106830 106486 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_06000 107760 106852 gene locus_tag LOCUS_06010 gene secF 107760 106852 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404566.1 protein_id gnl|my_center|LOCUS_06010 109615 107798 gene locus_tag LOCUS_06020 gene secD 109615 107798 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_06020 110320 109775 gene locus_tag LOCUS_06030 110320 109775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 110491 110895 gene locus_tag LOCUS_06040 110491 110895 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404877.1 protein_id gnl|my_center|LOCUS_06040 113756 110907 gene locus_tag LOCUS_06050 gene uvrA 113756 110907 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_06050 115135 113837 gene locus_tag LOCUS_06060 115135 113837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 115244 116620 gene locus_tag LOCUS_06070 115244 116620 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_06070 118697 116778 gene locus_tag LOCUS_06080 118697 116778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 119657 118764 gene locus_tag LOCUS_06090 119657 118764 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015552.1 protein_id gnl|my_center|LOCUS_06090 120250 119789 gene locus_tag LOCUS_06100 120250 119789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 120580 120323 gene locus_tag LOCUS_06110 120580 120323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 123327 120658 gene locus_tag LOCUS_06120 gene mutS 123327 120658 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_06120 123775 124569 gene locus_tag LOCUS_06130 123775 124569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 124569 125177 gene locus_tag LOCUS_06140 124569 125177 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636477.1 protein_id gnl|my_center|LOCUS_06140 125313 125900 gene locus_tag LOCUS_06150 125313 125900 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_06150 125986 126534 gene locus_tag LOCUS_06160 125986 126534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_06160 126603 127286 gene locus_tag LOCUS_06170 126603 127286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 127295 128275 gene locus_tag LOCUS_06180 127295 128275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 128275 129507 gene locus_tag LOCUS_06190 128275 129507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 129504 130223 gene locus_tag LOCUS_06200 129504 130223 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890736.1 protein_id gnl|my_center|LOCUS_06200 130284 131432 gene locus_tag LOCUS_06210 130284 131432 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_06210 131521 132522 gene locus_tag LOCUS_06220 131521 132522 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_06220 132904 132578 gene locus_tag LOCUS_06230 132904 132578 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932868.1 protein_id gnl|my_center|LOCUS_06230 132970 133422 gene locus_tag LOCUS_06240 132970 133422 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_06240 133765 133412 gene locus_tag LOCUS_06250 133765 133412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 135843 134011 gene locus_tag LOCUS_06260 gene glmS 135843 134011 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_06260 135930 137120 gene locus_tag LOCUS_06270 135930 137120 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_06270 138733 137135 gene locus_tag LOCUS_06280 138733 137135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 139214 138774 gene locus_tag LOCUS_06290 139214 138774 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_06290 142163 139299 gene locus_tag LOCUS_06300 142163 139299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 142735 142160 gene locus_tag LOCUS_06310 gene mepS 142735 142160 CDS product bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241012.1 protein_id gnl|my_center|LOCUS_06310 142827 143546 gene locus_tag LOCUS_06320 142827 143546 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932023.1 protein_id gnl|my_center|LOCUS_06320 143671 144558 gene locus_tag LOCUS_06330 gene era 143671 144558 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404809.1 protein_id gnl|my_center|LOCUS_06330 146968 145553 gene locus_tag LOCUS_06340 146968 145553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 148081 146972 gene locus_tag LOCUS_06350 148081 146972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 148800 148096 gene locus_tag LOCUS_06360 148800 148096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 149492 150808 gene locus_tag LOCUS_06370 149492 150808 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403257.1 protein_id gnl|my_center|LOCUS_06370 150831 151886 gene locus_tag LOCUS_06380 gene metX 150831 151886 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_06380 151870 152961 gene locus_tag LOCUS_06390 151870 152961 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403260.1 protein_id gnl|my_center|LOCUS_06390 153082 154668 gene locus_tag LOCUS_06400 153082 154668 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933561.1 protein_id gnl|my_center|LOCUS_06400 154886 155980 gene locus_tag LOCUS_06410 154886 155980 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_06410 156577 156083 gene locus_tag LOCUS_06420 156577 156083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 156664 157227 gene locus_tag LOCUS_06430 156664 157227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 157346 158683 gene locus_tag LOCUS_06440 157346 158683 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_06440 158670 159458 gene locus_tag LOCUS_06450 158670 159458 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_06450 160254 159559 gene locus_tag LOCUS_06460 160254 159559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 160526 160452 gene locus_tag LOCUS_t00040 160526 160452 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 161063 161818 gene locus_tag LOCUS_06470 161063 161818 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_06470 162832 161834 gene locus_tag LOCUS_06480 162832 161834 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838714.1 protein_id gnl|my_center|LOCUS_06480 164022 162904 gene locus_tag LOCUS_06490 164022 162904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 164675 164022 gene locus_tag LOCUS_06500 164675 164022 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404680.1 protein_id gnl|my_center|LOCUS_06500 164812 165561 gene locus_tag LOCUS_06510 164812 165561 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228854.1 protein_id gnl|my_center|LOCUS_06510 165668 166927 gene locus_tag LOCUS_06520 165668 166927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 167839 166931 gene locus_tag LOCUS_06530 167839 166931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 168024 168569 gene locus_tag LOCUS_06540 168024 168569 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071590.1 protein_id gnl|my_center|LOCUS_06540 168663 169772 gene locus_tag LOCUS_06550 gene rlmN 168663 169772 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404854.1 protein_id gnl|my_center|LOCUS_06550 170904 169765 gene locus_tag LOCUS_06560 170904 169765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 171723 170914 gene locus_tag LOCUS_06570 171723 170914 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229890.1 protein_id gnl|my_center|LOCUS_06570 172502 171723 gene locus_tag LOCUS_06580 172502 171723 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114424.1 protein_id gnl|my_center|LOCUS_06580 172566 174974 gene locus_tag LOCUS_06590 172566 174974 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_06590 175361 175008 gene locus_tag LOCUS_06600 175361 175008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 177623 176331 gene locus_tag LOCUS_06610 gene hemL 177623 176331 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963336.1 protein_id gnl|my_center|LOCUS_06610 178663 177683 gene locus_tag LOCUS_06620 gene hemB 178663 177683 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056277.1 protein_id gnl|my_center|LOCUS_06620 179734 178805 gene locus_tag LOCUS_06630 gene hemF 179734 178805 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962218.1 protein_id gnl|my_center|LOCUS_06630 180765 179734 gene locus_tag LOCUS_06640 gene hemE 180765 179734 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962222.1 protein_id gnl|my_center|LOCUS_06640 181438 180752 gene locus_tag LOCUS_06650 181438 180752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 182343 181450 gene locus_tag LOCUS_06660 gene hemC 182343 181450 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962224.1 protein_id gnl|my_center|LOCUS_06660 183511 182333 gene locus_tag LOCUS_06670 gene hemA 183511 182333 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962225.1 protein_id gnl|my_center|LOCUS_06670 184908 183571 gene locus_tag LOCUS_06680 gene hemG 184908 183571 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_06680 185967 184909 gene locus_tag LOCUS_06690 gene hemH 185967 184909 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962227.1 protein_id gnl|my_center|LOCUS_06690 186030 186857 gene locus_tag LOCUS_06700 186030 186857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404737.1 protein_id gnl|my_center|LOCUS_06700 187512 187138 gene locus_tag LOCUS_06710 187512 187138 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082088.1 protein_id gnl|my_center|LOCUS_06710 187758 189257 gene locus_tag LOCUS_06720 187758 189257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 189316 189894 gene locus_tag LOCUS_06730 189316 189894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 190022 191239 gene locus_tag LOCUS_06740 190022 191239 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_06740 191292 192404 gene locus_tag LOCUS_06750 191292 192404 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_06750 192495 193778 gene locus_tag LOCUS_06760 192495 193778 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_06760 193759 196236 gene locus_tag LOCUS_06770 193759 196236 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_06770 196704 196297 gene locus_tag LOCUS_06780 196704 196297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 196866 197924 gene locus_tag LOCUS_06790 196866 197924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 198076 198555 gene locus_tag LOCUS_06800 gene resA 198076 198555 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742192.1 protein_id gnl|my_center|LOCUS_06800 198552 200072 gene locus_tag LOCUS_06810 198552 200072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 200167 200610 gene locus_tag LOCUS_06820 200167 200610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 200620 201420 gene locus_tag LOCUS_06830 200620 201420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 202087 201428 gene locus_tag LOCUS_06840 202087 201428 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404773.1 protein_id gnl|my_center|LOCUS_06840 202617 202090 gene locus_tag LOCUS_06850 202617 202090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 205258 202634 gene locus_tag LOCUS_06860 205258 202634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 205345 206118 gene locus_tag LOCUS_06870 205345 206118 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_06870 206184 207641 gene locus_tag LOCUS_06880 206184 207641 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_06880 207682 208128 gene locus_tag LOCUS_06890 207682 208128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 209739 208360 gene locus_tag LOCUS_06900 209739 208360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 209932 211581 gene locus_tag LOCUS_06910 209932 211581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 211589 213328 gene locus_tag LOCUS_06920 211589 213328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence04 354 1310 gene locus_tag LOCUS_06930 354 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1918 1307 gene locus_tag LOCUS_06940 1918 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 2933 1920 gene locus_tag LOCUS_06950 2933 1920 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840140.1 protein_id gnl|my_center|LOCUS_06950 3038 3541 gene locus_tag LOCUS_06960 3038 3541 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_06960 4777 3545 gene locus_tag LOCUS_06970 4777 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6572 4779 gene locus_tag LOCUS_06980 6572 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 7270 6572 gene locus_tag LOCUS_06990 7270 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7499 8677 gene locus_tag LOCUS_07000 7499 8677 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994167.1 protein_id gnl|my_center|LOCUS_07000 9963 8866 gene locus_tag LOCUS_07010 9963 8866 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_07010 10708 10112 gene locus_tag LOCUS_07020 10708 10112 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328968.1 protein_id gnl|my_center|LOCUS_07020 11699 10701 gene locus_tag LOCUS_07030 11699 10701 CDS product BtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117868.1 protein_id gnl|my_center|LOCUS_07030 11924 12184 gene locus_tag LOCUS_07040 11924 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 12222 13313 gene locus_tag LOCUS_07050 gene prfB 12222 13313 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404522.1 protein_id gnl|my_center|LOCUS_07050 13316 13909 gene locus_tag LOCUS_07060 gene coaE 13316 13909 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405495.1 protein_id gnl|my_center|LOCUS_07060 13976 15016 gene locus_tag LOCUS_07070 gene fbp 13976 15016 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_07070 15542 15069 gene locus_tag LOCUS_07080 15542 15069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 18333 15532 gene locus_tag LOCUS_07090 18333 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 18474 19244 gene locus_tag LOCUS_07100 18474 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 19456 19707 gene locus_tag LOCUS_07110 19456 19707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 20175 20636 gene locus_tag LOCUS_07120 gene rimP 20175 20636 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942230.1 protein_id gnl|my_center|LOCUS_07120 20657 21913 gene locus_tag LOCUS_07130 gene nusA 20657 21913 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839192.1 protein_id gnl|my_center|LOCUS_07130 21973 24780 gene locus_tag LOCUS_07140 21973 24780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 24798 25172 gene locus_tag LOCUS_07150 gene rbfA 24798 25172 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931934.1 protein_id gnl|my_center|LOCUS_07150 25175 25912 gene locus_tag LOCUS_07160 gene truB 25175 25912 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_07160 25899 26831 gene locus_tag LOCUS_07170 25899 26831 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404517.1 protein_id gnl|my_center|LOCUS_07170 27289 26846 gene locus_tag LOCUS_07180 27289 26846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 27459 27728 gene locus_tag LOCUS_07190 gene rpsO 27459 27728 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_07190 27851 29962 gene locus_tag LOCUS_07200 gene pnp 27851 29962 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701697.1 protein_id gnl|my_center|LOCUS_07200 30877 32124 gene locus_tag LOCUS_07210 30877 32124 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942239.1 protein_id gnl|my_center|LOCUS_07210 32230 33726 gene locus_tag LOCUS_07220 32230 33726 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387048.1 protein_id gnl|my_center|LOCUS_07220 34097 33906 gene locus_tag LOCUS_07230 34097 33906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 35497 34106 gene locus_tag LOCUS_07240 35497 34106 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_07240 35815 35501 gene locus_tag LOCUS_07250 35815 35501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 36416 35760 gene locus_tag LOCUS_07260 36416 35760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 36530 37588 gene locus_tag LOCUS_07270 gene holA 36530 37588 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_07270 37639 38250 gene locus_tag LOCUS_07280 37639 38250 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_07280 38296 38541 gene locus_tag LOCUS_07290 38296 38541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 38762 41419 gene locus_tag LOCUS_07300 38762 41419 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071716.1 protein_id gnl|my_center|LOCUS_07300 41857 41507 gene locus_tag LOCUS_07310 41857 41507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 43183 42059 gene locus_tag LOCUS_07320 43183 42059 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225411.1 protein_id gnl|my_center|LOCUS_07320 44417 43320 gene locus_tag LOCUS_07330 44417 43320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 44770 44450 gene locus_tag LOCUS_07340 44770 44450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 45378 44773 gene locus_tag LOCUS_07350 45378 44773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 46176 45550 gene locus_tag LOCUS_07360 46176 45550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 47472 46468 gene locus_tag LOCUS_07370 47472 46468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 49464 47482 gene locus_tag LOCUS_07380 49464 47482 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839420.1 protein_id gnl|my_center|LOCUS_07380 49605 50012 gene locus_tag LOCUS_07390 gene speD 49605 50012 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992621.1 protein_id gnl|my_center|LOCUS_07390 50019 50513 gene locus_tag LOCUS_07400 50019 50513 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867679.1 protein_id gnl|my_center|LOCUS_07400 50571 51449 gene locus_tag LOCUS_07410 gene speE 50571 51449 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424691.1 protein_id gnl|my_center|LOCUS_07410 51468 53111 gene locus_tag LOCUS_07420 51468 53111 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404845.1 protein_id gnl|my_center|LOCUS_07420 54654 53116 gene locus_tag LOCUS_07430 54654 53116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 55077 54709 gene locus_tag LOCUS_07440 55077 54709 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_07440 55666 55151 gene locus_tag LOCUS_07450 55666 55151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 56914 55889 gene locus_tag LOCUS_07460 gene nuoH 56914 55889 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_07460 58650 56914 gene locus_tag LOCUS_07470 58650 56914 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_07470 59067 58714 gene locus_tag LOCUS_07480 59067 58714 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_07480 60389 59106 gene locus_tag LOCUS_07490 gene nuoF 60389 59106 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838122.1 protein_id gnl|my_center|LOCUS_07490 60932 60393 gene locus_tag LOCUS_07500 60932 60393 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838121.1 protein_id gnl|my_center|LOCUS_07500 62224 60932 gene locus_tag LOCUS_07510 gene nuoD 62224 60932 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403174.1 protein_id gnl|my_center|LOCUS_07510 62742 62230 gene locus_tag LOCUS_07520 62742 62230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 63228 62746 gene locus_tag LOCUS_07530 63228 62746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 63611 63237 gene locus_tag LOCUS_07540 63611 63237 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_07540 63654 63788 gene locus_tag LOCUS_07550 63654 63788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 63844 64410 gene locus_tag LOCUS_07560 63844 64410 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_07560 64410 66017 gene locus_tag LOCUS_07570 gene bshC 64410 66017 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_07570 66014 66607 gene locus_tag LOCUS_07580 66014 66607 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583583.1 protein_id gnl|my_center|LOCUS_07580 66629 67345 gene locus_tag LOCUS_07590 66629 67345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 67461 68057 gene locus_tag LOCUS_07600 gene tmk 67461 68057 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_07600 70570 68270 gene locus_tag LOCUS_07610 70570 68270 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_07610 70716 71375 gene locus_tag LOCUS_07620 70716 71375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 71417 71968 gene locus_tag LOCUS_07630 71417 71968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 72042 73346 gene locus_tag LOCUS_07640 72042 73346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 73461 73928 gene locus_tag LOCUS_07650 73461 73928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 73992 75236 gene locus_tag LOCUS_07660 73992 75236 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_07660 75248 75559 gene locus_tag LOCUS_07670 75248 75559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 75595 77232 gene locus_tag LOCUS_07680 75595 77232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 77250 80336 gene locus_tag LOCUS_07690 77250 80336 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_07690 81702 80341 gene locus_tag LOCUS_07700 81702 80341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 81868 82341 gene locus_tag LOCUS_07710 81868 82341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 82516 83280 gene locus_tag LOCUS_07720 82516 83280 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405001.1 protein_id gnl|my_center|LOCUS_07720 83261 84016 gene locus_tag LOCUS_07730 gene pgeF 83261 84016 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_07730 84013 84912 gene locus_tag LOCUS_07740 84013 84912 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_07740 84989 85906 gene locus_tag LOCUS_07750 84989 85906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 85983 87131 gene locus_tag LOCUS_07760 85983 87131 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_07760 87133 88464 gene locus_tag LOCUS_07770 gene rseP 87133 88464 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_07770 88468 89121 gene locus_tag LOCUS_07780 88468 89121 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838510.1 protein_id gnl|my_center|LOCUS_07780 89232 89945 gene locus_tag LOCUS_07790 gene pssA 89232 89945 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831663.1 protein_id gnl|my_center|LOCUS_07790 91073 89973 gene locus_tag LOCUS_07800 gene wecB 91073 89973 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187374459.1 protein_id gnl|my_center|LOCUS_07800 91516 91070 gene locus_tag LOCUS_07810 91516 91070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07810 92106 91489 gene locus_tag LOCUS_07820 92106 91489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 91524 91533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 93662 92103 gene locus_tag LOCUS_07830 93662 92103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 95038 93635 gene locus_tag LOCUS_07840 95038 93635 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834089.1 protein_id gnl|my_center|LOCUS_07840 95471 95031 gene locus_tag LOCUS_07850 95471 95031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 96917 96051 gene locus_tag LOCUS_07860 96917 96051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 98017 96992 gene locus_tag LOCUS_07870 98017 96992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 99620 98019 gene locus_tag LOCUS_07880 99620 98019 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_07880 100429 99620 gene locus_tag LOCUS_07890 100429 99620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 100810 102270 gene locus_tag LOCUS_07900 gene trpE 100810 102270 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826697.1 protein_id gnl|my_center|LOCUS_07900 102267 103250 gene locus_tag LOCUS_07910 gene trpS 102267 103250 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404409.1 protein_id gnl|my_center|LOCUS_07910 103347 103910 gene locus_tag LOCUS_07920 103347 103910 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404410.1 protein_id gnl|my_center|LOCUS_07920 103907 104947 gene locus_tag LOCUS_07930 gene trpD 103907 104947 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404411.1 protein_id gnl|my_center|LOCUS_07930 104947 105765 gene locus_tag LOCUS_07940 gene trpC 104947 105765 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404412.1 protein_id gnl|my_center|LOCUS_07940 105758 106399 gene locus_tag LOCUS_07950 105758 106399 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404413.1 protein_id gnl|my_center|LOCUS_07950 106572 107771 gene locus_tag LOCUS_07960 gene trpB 106572 107771 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404414.1 protein_id gnl|my_center|LOCUS_07960 108067 108864 gene locus_tag LOCUS_07970 gene trpA 108067 108864 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404415.1 protein_id gnl|my_center|LOCUS_07970 108875 109963 gene locus_tag LOCUS_07980 108875 109963 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_07980 109964 111139 gene locus_tag LOCUS_07990 gene bioF 109964 111139 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033449714.1 protein_id gnl|my_center|LOCUS_07990 111124 111822 gene locus_tag LOCUS_08000 111124 111822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 111806 112618 gene locus_tag LOCUS_08010 111806 112618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08010 112618 113250 gene locus_tag LOCUS_08020 gene bioD 112618 113250 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533326.1 protein_id gnl|my_center|LOCUS_08020 113362 114627 gene locus_tag LOCUS_08030 gene bioA 113362 114627 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057770.1 protein_id gnl|my_center|LOCUS_08030 114831 115478 gene locus_tag LOCUS_08040 114831 115478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 115554 116147 gene locus_tag LOCUS_08050 115554 116147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 116723 116517 gene locus_tag LOCUS_08060 116723 116517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 117581 117051 gene locus_tag LOCUS_08070 117581 117051 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 protein_id gnl|my_center|LOCUS_08070 117957 119183 gene locus_tag LOCUS_08080 117957 119183 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964498.1 protein_id gnl|my_center|LOCUS_08080 119302 119775 gene locus_tag LOCUS_08090 gene greA 119302 119775 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_08090 119788 120246 gene locus_tag LOCUS_08100 119788 120246 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771224.1 protein_id gnl|my_center|LOCUS_08100 120156 121430 gene locus_tag LOCUS_08110 120156 121430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 121432 122649 gene locus_tag LOCUS_08120 121432 122649 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_08120 122697 124367 gene locus_tag LOCUS_08130 122697 124367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 124367 125221 gene locus_tag LOCUS_08140 124367 125221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 125223 126173 gene locus_tag LOCUS_08150 gene pta 125223 126173 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 protein_id gnl|my_center|LOCUS_08150 127184 128641 gene locus_tag LOCUS_08160 gene sufB 127184 128641 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_08160 128790 129563 gene locus_tag LOCUS_08170 gene sufC 128790 129563 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_08170 129563 130873 gene locus_tag LOCUS_08180 gene sufD 129563 130873 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_08180 130932 132179 gene locus_tag LOCUS_08190 130932 132179 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964478.1 protein_id gnl|my_center|LOCUS_08190 132193 132744 gene locus_tag LOCUS_08200 132193 132744 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_08200 132756 133091 gene locus_tag LOCUS_08210 132756 133091 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_08210 133162 133671 gene locus_tag LOCUS_08220 133162 133671 CDS product DUF2480 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_08220 134607 134083 gene locus_tag LOCUS_08230 134607 134083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 134698 135015 gene locus_tag LOCUS_08240 134698 135015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 135012 135731 gene locus_tag LOCUS_08250 135012 135731 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_08250 138734 136506 gene locus_tag LOCUS_08260 138734 136506 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_08260 138988 139191 gene locus_tag LOCUS_08270 138988 139191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 139203 141032 gene locus_tag LOCUS_08280 gene mutL 139203 141032 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963285.1 protein_id gnl|my_center|LOCUS_08280 141161 142276 gene locus_tag LOCUS_08290 141161 142276 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_08290 142366 145545 gene locus_tag LOCUS_08300 142366 145545 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_08300 145777 146763 gene locus_tag LOCUS_08310 145777 146763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 148069 146774 gene locus_tag LOCUS_08320 148069 146774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 148458 148066 gene locus_tag LOCUS_08330 148458 148066 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_08330 148652 148461 gene locus_tag LOCUS_08340 148652 148461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 150248 148713 gene locus_tag LOCUS_08350 gene dnaB 150248 148713 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962775.1 protein_id gnl|my_center|LOCUS_08350 151293 150454 gene locus_tag LOCUS_08360 151293 150454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 152623 151286 gene locus_tag LOCUS_08370 gene mtaB 152623 151286 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_08370 152808 153257 gene locus_tag LOCUS_08380 152808 153257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 153875 153333 gene locus_tag LOCUS_08390 153875 153333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence05 1135 152 gene locus_tag LOCUS_08400 1135 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1464 1132 gene locus_tag LOCUS_08410 1464 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2646 1468 gene locus_tag LOCUS_08420 gene aroC 2646 1468 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404791.1 protein_id gnl|my_center|LOCUS_08420 3710 2643 gene locus_tag LOCUS_08430 3710 2643 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838131.1 protein_id gnl|my_center|LOCUS_08430 4651 3713 gene locus_tag LOCUS_08440 4651 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4796 5533 gene locus_tag LOCUS_08450 4796 5533 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_08450 5536 6276 gene locus_tag LOCUS_08460 5536 6276 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_08460 6280 7227 gene locus_tag LOCUS_08470 6280 7227 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545262.1 protein_id gnl|my_center|LOCUS_08470 7350 9125 gene locus_tag LOCUS_08480 7350 9125 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404166.1 protein_id gnl|my_center|LOCUS_08480 9220 10344 gene locus_tag LOCUS_08490 gene ribD 9220 10344 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839710.1 protein_id gnl|my_center|LOCUS_08490 10349 10957 gene locus_tag LOCUS_08500 10349 10957 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405026.1 protein_id gnl|my_center|LOCUS_08500 11785 10961 gene locus_tag LOCUS_08510 11785 10961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 14641 11966 gene locus_tag LOCUS_08520 14641 11966 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838372.1 protein_id gnl|my_center|LOCUS_08520 15596 14652 gene locus_tag LOCUS_08530 15596 14652 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_08530 15917 15612 gene locus_tag LOCUS_08540 15917 15612 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403551.1 protein_id gnl|my_center|LOCUS_08540 15998 17929 gene locus_tag LOCUS_08550 15998 17929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 18675 17926 gene locus_tag LOCUS_08560 18675 17926 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405293.1 protein_id gnl|my_center|LOCUS_08560 18878 19207 gene locus_tag LOCUS_08570 18878 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 19207 19362 gene locus_tag LOCUS_08580 19207 19362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19500 19427 gene locus_tag LOCUS_t00050 19500 19427 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20108 19587 gene locus_tag LOCUS_08590 20108 19587 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070769.1 protein_id gnl|my_center|LOCUS_08590 20125 20523 gene locus_tag LOCUS_08600 20125 20523 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_08600 20520 20951 gene locus_tag LOCUS_08610 gene aroQ 20520 20951 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_08610 20955 22442 gene locus_tag LOCUS_08620 20955 22442 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_08620 22566 23621 gene locus_tag LOCUS_08630 22566 23621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 23646 24182 gene locus_tag LOCUS_08640 23646 24182 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_08640 24231 26588 gene locus_tag LOCUS_08650 24231 26588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 27742 26600 gene locus_tag LOCUS_08660 gene bshA 27742 26600 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_08660 27890 28648 gene locus_tag LOCUS_08670 27890 28648 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_08670 28654 29286 gene locus_tag LOCUS_08680 28654 29286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 29289 29822 gene locus_tag LOCUS_08690 29289 29822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 29806 31560 gene locus_tag LOCUS_08700 29806 31560 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405278.1 protein_id gnl|my_center|LOCUS_08700 31557 32321 gene locus_tag LOCUS_08710 31557 32321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 32335 33702 gene locus_tag LOCUS_08720 32335 33702 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404619.1 protein_id gnl|my_center|LOCUS_08720 34892 34008 gene locus_tag LOCUS_08730 34892 34008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 35620 35120 gene locus_tag LOCUS_08740 35620 35120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 36583 35918 gene locus_tag LOCUS_08750 36583 35918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 37593 38162 gene locus_tag LOCUS_08760 37593 38162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 38152 38703 gene locus_tag LOCUS_08770 38152 38703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 39177 39818 gene locus_tag LOCUS_08780 39177 39818 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_08780 39893 41089 gene locus_tag LOCUS_08790 39893 41089 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_08790 41082 42047 gene locus_tag LOCUS_08800 gene argC 41082 42047 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796494.1 protein_id gnl|my_center|LOCUS_08800 42050 42853 gene locus_tag LOCUS_08810 gene proC 42050 42853 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_08810 42850 43977 gene locus_tag LOCUS_08820 42850 43977 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_08820 43974 44921 gene locus_tag LOCUS_08830 43974 44921 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_08830 44914 45675 gene locus_tag LOCUS_08840 gene argB 44914 45675 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783875.1 protein_id gnl|my_center|LOCUS_08840 45685 46782 gene locus_tag LOCUS_08850 45685 46782 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_08850 46945 48243 gene locus_tag LOCUS_08860 gene argH 46945 48243 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_08860 48889 48653 gene locus_tag LOCUS_08870 48889 48653 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115113.1 protein_id gnl|my_center|LOCUS_08870 50873 50355 gene locus_tag LOCUS_08880 50873 50355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 52154 50889 gene locus_tag LOCUS_08890 52154 50889 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840191.1 protein_id gnl|my_center|LOCUS_08890 52628 52194 gene locus_tag LOCUS_08900 52628 52194 CDS product DUF3124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139455833.1 protein_id gnl|my_center|LOCUS_08900 53007 55412 gene locus_tag LOCUS_08910 53007 55412 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_08910 56815 55610 gene locus_tag LOCUS_08920 gene sucC 56815 55610 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403880.1 protein_id gnl|my_center|LOCUS_08920 56980 57534 gene locus_tag LOCUS_08930 gene pyrR 56980 57534 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552258.1 protein_id gnl|my_center|LOCUS_08930 57531 58481 gene locus_tag LOCUS_08940 57531 58481 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404086.1 protein_id gnl|my_center|LOCUS_08940 59624 58488 gene locus_tag LOCUS_08950 59624 58488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 59710 60774 gene locus_tag LOCUS_08960 59710 60774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 60811 61926 gene locus_tag LOCUS_08970 60811 61926 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_08970 61950 63149 gene locus_tag LOCUS_08980 61950 63149 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_08980 63146 64414 gene locus_tag LOCUS_08990 63146 64414 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529257.1 protein_id gnl|my_center|LOCUS_08990 65575 64403 gene locus_tag LOCUS_09000 65575 64403 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461034.1 protein_id gnl|my_center|LOCUS_09000 65630 67123 gene locus_tag LOCUS_09010 gene wzx 65630 67123 CDS product O13/O129/O135 family O-antigen flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022479.1 protein_id gnl|my_center|LOCUS_09010 67120 68004 gene locus_tag LOCUS_09020 67120 68004 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942605.1 protein_id gnl|my_center|LOCUS_09020 69721 68015 gene locus_tag LOCUS_09030 69721 68015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 70635 69730 gene locus_tag LOCUS_09040 70635 69730 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258947.1 protein_id gnl|my_center|LOCUS_09040 72507 70708 gene locus_tag LOCUS_09050 gene yidC 72507 70708 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_09050 72951 72520 gene locus_tag LOCUS_09060 72951 72520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 73087 72929 gene locus_tag LOCUS_09070 gene rpmH 73087 72929 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_09070 74385 73192 gene locus_tag LOCUS_09080 74385 73192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 74681 74890 gene locus_tag LOCUS_09090 74681 74890 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552331.1 protein_id gnl|my_center|LOCUS_09090 76201 75482 gene locus_tag LOCUS_09100 gene pyrH 76201 75482 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_09100 77116 76283 gene locus_tag LOCUS_09110 gene tsf 77116 76283 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402823.1 protein_id gnl|my_center|LOCUS_09110 78028 77147 gene locus_tag LOCUS_09120 gene rpsB 78028 77147 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_09120 78546 78160 gene locus_tag LOCUS_09130 gene rpsI 78546 78160 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_09130 79002 78559 gene locus_tag LOCUS_09140 gene rplM 79002 78559 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_09140 78956 79132 gene locus_tag LOCUS_09150 78956 79132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 79228 79644 gene locus_tag LOCUS_09160 79228 79644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 79709 80068 gene locus_tag LOCUS_09170 79709 80068 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227750.1 protein_id gnl|my_center|LOCUS_09170 80070 81458 gene locus_tag LOCUS_09180 80070 81458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 81459 82088 gene locus_tag LOCUS_09190 81459 82088 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568128.1 protein_id gnl|my_center|LOCUS_09190 82210 83100 gene locus_tag LOCUS_09200 82210 83100 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_09200 83211 86774 gene locus_tag LOCUS_09210 83211 86774 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_09210 86895 87563 gene locus_tag LOCUS_09220 86895 87563 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902962.1 protein_id gnl|my_center|LOCUS_09220 87710 87907 gene locus_tag LOCUS_09230 87710 87907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 87947 88114 gene locus_tag LOCUS_09240 87947 88114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 88125 89267 gene locus_tag LOCUS_09250 88125 89267 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972063.1 protein_id gnl|my_center|LOCUS_09250 90193 89315 gene locus_tag LOCUS_09260 90193 89315 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_09260 90265 90630 gene locus_tag LOCUS_09270 90265 90630 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_09270 91078 90701 gene locus_tag LOCUS_09280 91078 90701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 91681 91169 gene locus_tag LOCUS_09290 91681 91169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 92656 91910 gene locus_tag LOCUS_09300 92656 91910 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_09300 92731 93759 gene locus_tag LOCUS_09310 92731 93759 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 protein_id gnl|my_center|LOCUS_09310 94674 93820 gene locus_tag LOCUS_09320 94674 93820 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838346.1 protein_id gnl|my_center|LOCUS_09320 95183 94671 gene locus_tag LOCUS_09330 95183 94671 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_09330 95357 98518 gene locus_tag LOCUS_09340 gene ileS 95357 98518 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403234.1 protein_id gnl|my_center|LOCUS_09340 98529 98927 gene locus_tag LOCUS_09350 98529 98927 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403235.1 protein_id gnl|my_center|LOCUS_09350 98942 99529 gene locus_tag LOCUS_09360 98942 99529 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962395.1 protein_id gnl|my_center|LOCUS_09360 99699 99905 gene locus_tag LOCUS_09370 99699 99905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 100083 100871 gene locus_tag LOCUS_09380 100083 100871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 101758 101087 gene locus_tag LOCUS_09390 101758 101087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09390 102255 101755 gene locus_tag LOCUS_09400 102255 101755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 101766 101775 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 102564 102265 gene locus_tag LOCUS_09410 gene yajC 102564 102265 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_09410 103968 102682 gene locus_tag LOCUS_09420 103968 102682 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965326.1 protein_id gnl|my_center|LOCUS_09420 104702 104397 gene locus_tag LOCUS_09430 104702 104397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 107932 104789 gene locus_tag LOCUS_09440 107932 104789 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403935.1 protein_id gnl|my_center|LOCUS_09440 111057 107929 gene locus_tag LOCUS_09450 111057 107929 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_09450 112455 111061 gene locus_tag LOCUS_09460 112455 111061 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_09460 112633 113292 gene locus_tag LOCUS_09470 gene fsa 112633 113292 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403055.1 protein_id gnl|my_center|LOCUS_09470 113798 113388 gene locus_tag LOCUS_09480 113798 113388 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_09480 114017 116410 gene locus_tag LOCUS_09490 114017 116410 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_09490 116476 116826 gene locus_tag LOCUS_09500 116476 116826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 116858 117523 gene locus_tag LOCUS_09510 116858 117523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 117525 118244 gene locus_tag LOCUS_09520 117525 118244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 118685 119791 gene locus_tag LOCUS_09530 gene carA 118685 119791 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403719.1 protein_id gnl|my_center|LOCUS_09530 119960 122788 gene locus_tag LOCUS_09540 gene carB 119960 122788 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403720.1 protein_id gnl|my_center|LOCUS_09540 122901 125537 gene locus_tag LOCUS_09550 122901 125537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 126193 125636 gene locus_tag LOCUS_09560 126193 125636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 126314 127234 gene locus_tag LOCUS_09570 126314 127234 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_09570 128157 127231 gene locus_tag LOCUS_09580 128157 127231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 128964 128167 gene locus_tag LOCUS_09590 128964 128167 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_09590 129061 129762 gene locus_tag LOCUS_09600 129061 129762 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403350.1 protein_id gnl|my_center|LOCUS_09600 129759 131162 gene locus_tag LOCUS_09610 129759 131162 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421576.1 protein_id gnl|my_center|LOCUS_09610 131799 131140 gene locus_tag LOCUS_09620 131799 131140 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 protein_id gnl|my_center|LOCUS_09620 131946 132266 gene locus_tag LOCUS_09630 131946 132266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 132606 132250 gene locus_tag LOCUS_09640 132606 132250 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_09640 133065 132607 gene locus_tag LOCUS_09650 133065 132607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 133203 134186 gene locus_tag LOCUS_09660 gene tsaD 133203 134186 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_09660 135265 134810 gene locus_tag LOCUS_09670 gene rnhA 135265 134810 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_09670 136097 135258 gene locus_tag LOCUS_09680 gene pyrF 136097 135258 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839147.1 protein_id gnl|my_center|LOCUS_09680 136502 139834 gene locus_tag LOCUS_09690 136502 139834 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_09690 140577 139909 gene locus_tag LOCUS_09700 140577 139909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 143133 140923 gene locus_tag LOCUS_09710 143133 140923 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_09710 143722 143165 gene locus_tag LOCUS_09720 gene pth 143722 143165 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100438.1 protein_id gnl|my_center|LOCUS_09720 144458 143760 gene locus_tag LOCUS_09730 144458 143760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 145413 144481 gene locus_tag LOCUS_09740 145413 144481 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838396.1 protein_id gnl|my_center|LOCUS_09740 145561 145490 gene locus_tag LOCUS_t00060 145561 145490 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 146766 145618 gene locus_tag LOCUS_09750 146766 145618 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_09750 147025 146759 gene locus_tag LOCUS_09760 147025 146759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 147173 147652 gene locus_tag LOCUS_09770 gene pyrR 147173 147652 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987093.1 protein_id gnl|my_center|LOCUS_09770 147667 148539 gene locus_tag LOCUS_09780 147667 148539 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence06 400 2703 gene locus_tag LOCUS_09790 400 2703 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403314.1 protein_id gnl|my_center|LOCUS_09790 2726 4249 gene locus_tag LOCUS_09800 2726 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4370 6895 gene locus_tag LOCUS_09810 gene lon 4370 6895 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095512366.1 protein_id gnl|my_center|LOCUS_09810 7359 6934 gene locus_tag LOCUS_09820 7359 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7519 8430 gene locus_tag LOCUS_09830 gene rsgA 7519 8430 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403874.1 protein_id gnl|my_center|LOCUS_09830 8515 9621 gene locus_tag LOCUS_09840 8515 9621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 10412 9699 gene locus_tag LOCUS_09850 10412 9699 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_09850 11816 10422 gene locus_tag LOCUS_09860 11816 10422 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_09860 13281 11860 gene locus_tag LOCUS_09870 13281 11860 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405552.1 protein_id gnl|my_center|LOCUS_09870 13731 13402 gene locus_tag LOCUS_09880 13731 13402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 14140 13733 gene locus_tag LOCUS_09890 14140 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 14358 14143 gene locus_tag LOCUS_09900 14358 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 15651 14428 gene locus_tag LOCUS_09910 15651 14428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_09910 16763 15651 gene locus_tag LOCUS_09920 16763 15651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_09920 16968 17696 gene locus_tag LOCUS_09930 gene bshB1 16968 17696 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_09930 17696 19327 gene locus_tag LOCUS_09940 17696 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 20117 19320 gene locus_tag LOCUS_09950 20117 19320 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_09950 20213 20653 gene locus_tag LOCUS_09960 gene rpiB 20213 20653 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942251.1 protein_id gnl|my_center|LOCUS_09960 20662 21960 gene locus_tag LOCUS_09970 20662 21960 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403541.1 protein_id gnl|my_center|LOCUS_09970 21970 22815 gene locus_tag LOCUS_09980 gene tatC 21970 22815 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015780.1 protein_id gnl|my_center|LOCUS_09980 22920 23387 gene locus_tag LOCUS_09990 22920 23387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 24441 23377 gene locus_tag LOCUS_10000 gene alr 24441 23377 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281154.1 protein_id gnl|my_center|LOCUS_10000 26049 24454 gene locus_tag LOCUS_10010 26049 24454 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257221.1 protein_id gnl|my_center|LOCUS_10010 26954 27958 gene locus_tag LOCUS_10020 26954 27958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 28216 28845 gene locus_tag LOCUS_10030 28216 28845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 28976 29170 gene locus_tag LOCUS_10040 28976 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 29360 30175 gene locus_tag LOCUS_10050 29360 30175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 30380 31462 gene locus_tag LOCUS_10060 30380 31462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 31504 32244 gene locus_tag LOCUS_10070 31504 32244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 32796 32323 gene locus_tag LOCUS_10080 32796 32323 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161960933.1 protein_id gnl|my_center|LOCUS_10080 33900 32899 gene locus_tag LOCUS_10090 gene rfbB 33900 32899 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723092.1 protein_id gnl|my_center|LOCUS_10090 34442 33897 gene locus_tag LOCUS_10100 gene rfbC 34442 33897 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_10100 35302 34445 gene locus_tag LOCUS_10110 gene rfbD 35302 34445 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664667.1 protein_id gnl|my_center|LOCUS_10110 36007 35306 gene locus_tag LOCUS_10120 36007 35306 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_10120 36195 41450 gene locus_tag LOCUS_10130 36195 41450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 41541 42050 gene locus_tag LOCUS_10140 41541 42050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 42050 42628 gene locus_tag LOCUS_10150 42050 42628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 42621 43151 gene locus_tag LOCUS_10160 42621 43151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 43268 43783 gene locus_tag LOCUS_10170 43268 43783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 43923 44756 gene locus_tag LOCUS_10180 43923 44756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 44753 47044 gene locus_tag LOCUS_10190 44753 47044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 47007 47756 gene locus_tag LOCUS_10200 47007 47756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 47029 47038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47836 49590 gene locus_tag LOCUS_10210 47836 49590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 49488 49497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49613 50107 gene locus_tag LOCUS_10220 49613 50107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 50142 50939 gene locus_tag LOCUS_10230 50142 50939 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389559.1 protein_id gnl|my_center|LOCUS_10230 50954 52687 gene locus_tag LOCUS_10240 50954 52687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 54024 52756 gene locus_tag LOCUS_10250 54024 52756 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963512.1 protein_id gnl|my_center|LOCUS_10250 55032 54049 gene locus_tag LOCUS_10260 55032 54049 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404705.1 protein_id gnl|my_center|LOCUS_10260 56156 55056 gene locus_tag LOCUS_10270 56156 55056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 58922 56247 gene locus_tag LOCUS_10280 gene alaS 58922 56247 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_10280 59111 59686 gene locus_tag LOCUS_10290 59111 59686 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224946.1 protein_id gnl|my_center|LOCUS_10290 60738 59791 gene locus_tag LOCUS_10300 60738 59791 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125275.1 protein_id gnl|my_center|LOCUS_10300 61367 60795 gene locus_tag LOCUS_10310 61367 60795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 62138 61455 gene locus_tag LOCUS_10320 62138 61455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 62570 62205 gene locus_tag LOCUS_10330 62570 62205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 63493 62651 gene locus_tag LOCUS_10340 63493 62651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 63594 64745 gene locus_tag LOCUS_10350 63594 64745 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224549.1 protein_id gnl|my_center|LOCUS_10350 65118 64729 gene locus_tag LOCUS_10360 65118 64729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 65295 66164 gene locus_tag LOCUS_10370 65295 66164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 66298 68223 gene locus_tag LOCUS_10380 66298 68223 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_10380 69324 68236 gene locus_tag LOCUS_10390 69324 68236 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906005.1 protein_id gnl|my_center|LOCUS_10390 69295 69555 gene locus_tag LOCUS_10400 69295 69555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 69569 70864 gene locus_tag LOCUS_10410 69569 70864 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_10410 70929 71891 gene locus_tag LOCUS_10420 70929 71891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 71912 74470 gene locus_tag LOCUS_10430 71912 74470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 76401 74581 gene locus_tag LOCUS_10440 76401 74581 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888269.1 protein_id gnl|my_center|LOCUS_10440 77659 76406 gene locus_tag LOCUS_10450 77659 76406 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_10450 77760 78824 gene locus_tag LOCUS_10460 77760 78824 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_10460 79463 78843 gene locus_tag LOCUS_10470 79463 78843 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_10470 79926 79468 gene locus_tag LOCUS_10480 79926 79468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 80779 79979 gene locus_tag LOCUS_10490 80779 79979 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_10490 81531 80776 gene locus_tag LOCUS_10500 81531 80776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 82264 81644 gene locus_tag LOCUS_10510 82264 81644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 82365 83903 gene locus_tag LOCUS_10520 gene lysS 82365 83903 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_10520 83965 85200 gene locus_tag LOCUS_10530 83965 85200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404265.1 protein_id gnl|my_center|LOCUS_10530 85282 87939 gene locus_tag LOCUS_10540 85282 87939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 88020 88637 gene locus_tag LOCUS_10550 88020 88637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 88644 89543 gene locus_tag LOCUS_10560 88644 89543 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442783.1 protein_id gnl|my_center|LOCUS_10560 90036 89545 gene locus_tag LOCUS_10570 90036 89545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 91298 90183 gene locus_tag LOCUS_10580 gene ald 91298 90183 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107857.1 protein_id gnl|my_center|LOCUS_10580 91515 93011 gene locus_tag LOCUS_10590 91515 93011 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798918.1 protein_id gnl|my_center|LOCUS_10590 93082 95556 gene locus_tag LOCUS_10600 93082 95556 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_10600 95810 95604 gene locus_tag LOCUS_10610 95810 95604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 96098 98149 gene locus_tag LOCUS_10620 96098 98149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 98149 99906 gene locus_tag LOCUS_10630 98149 99906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 99923 104641 gene locus_tag LOCUS_10640 99923 104641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 104730 106088 gene locus_tag LOCUS_10650 gene trkA 104730 106088 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_10650 106081 107601 gene locus_tag LOCUS_10660 106081 107601 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_10660 107816 108553 gene locus_tag LOCUS_10670 107816 108553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 108884 109471 gene locus_tag LOCUS_10680 108884 109471 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198788.1 protein_id gnl|my_center|LOCUS_10680 109663 110397 gene locus_tag LOCUS_10690 109663 110397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 110591 111931 gene locus_tag LOCUS_10700 110591 111931 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921345.1 protein_id gnl|my_center|LOCUS_10700 111958 113253 gene locus_tag LOCUS_10710 111958 113253 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_10710 113284 113586 gene locus_tag LOCUS_10720 113284 113586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 114028 114651 gene locus_tag LOCUS_10730 114028 114651 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_10730 114852 115397 gene locus_tag LOCUS_10740 114852 115397 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262230.1 protein_id gnl|my_center|LOCUS_10740 117263 115407 gene locus_tag LOCUS_10750 117263 115407 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_10750 119248 117581 gene locus_tag LOCUS_10760 119248 117581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 120615 119371 gene locus_tag LOCUS_10770 120615 119371 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_10770 121046 120729 gene locus_tag LOCUS_10780 121046 120729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 121907 121059 gene locus_tag LOCUS_10790 gene pabC 121907 121059 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244544.1 protein_id gnl|my_center|LOCUS_10790 122431 121904 gene locus_tag LOCUS_10800 122431 121904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 124774 122495 gene locus_tag LOCUS_10810 124774 122495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 125193 124771 gene locus_tag LOCUS_10820 125193 124771 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_10820 125449 125171 gene locus_tag LOCUS_10830 125449 125171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 126887 125520 gene locus_tag LOCUS_10840 126887 125520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 128263 126896 gene locus_tag LOCUS_10850 128263 126896 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_10850 130621 128273 gene locus_tag LOCUS_10860 130621 128273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 133549 130637 gene locus_tag LOCUS_10870 133549 130637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 134547 133558 gene locus_tag LOCUS_10880 134547 133558 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838101.1 protein_id gnl|my_center|LOCUS_10880 137239 134612 gene locus_tag LOCUS_10890 137239 134612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 138296 137274 gene locus_tag LOCUS_10900 138296 137274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence07 146 219 gene locus_tag LOCUS_t00070 146 219 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 244 426 gene locus_tag LOCUS_10910 244 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 431 988 gene locus_tag LOCUS_10920 gene nusG 431 988 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404507.1 protein_id gnl|my_center|LOCUS_10920 1064 1495 gene locus_tag LOCUS_10930 gene rplK 1064 1495 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832298.1 protein_id gnl|my_center|LOCUS_10930 1508 2206 gene locus_tag LOCUS_10940 gene rplA 1508 2206 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404505.1 protein_id gnl|my_center|LOCUS_10940 2225 2746 gene locus_tag LOCUS_10950 gene rplJ 2225 2746 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791518.1 protein_id gnl|my_center|LOCUS_10950 2809 3186 gene locus_tag LOCUS_10960 gene rplL 2809 3186 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404503.1 protein_id gnl|my_center|LOCUS_10960 3332 7147 gene locus_tag LOCUS_10970 gene rpoB 3332 7147 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_10970 7179 11480 gene locus_tag LOCUS_10980 gene rpoC 7179 11480 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404501.1 protein_id gnl|my_center|LOCUS_10980 11748 13559 gene locus_tag LOCUS_10990 11748 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13562 14635 gene locus_tag LOCUS_11000 13562 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 14607 15239 gene locus_tag LOCUS_11010 14607 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 15239 16063 gene locus_tag LOCUS_11020 15239 16063 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263083.1 protein_id gnl|my_center|LOCUS_11020 16069 16743 gene locus_tag LOCUS_11030 16069 16743 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389560.1 protein_id gnl|my_center|LOCUS_11030 17777 16737 gene locus_tag LOCUS_11040 17777 16737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_11040 20072 17955 gene locus_tag LOCUS_11050 20072 17955 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404209.1 protein_id gnl|my_center|LOCUS_11050 21541 20246 gene locus_tag LOCUS_11060 21541 20246 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_11060 21662 21739 gene locus_tag LOCUS_t00080 21662 21739 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22085 23935 gene locus_tag LOCUS_11070 22085 23935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 24012 24263 gene locus_tag LOCUS_11080 24012 24263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 24331 25617 gene locus_tag LOCUS_11090 gene egtB 24331 25617 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339021.1 protein_id gnl|my_center|LOCUS_11090 25623 26567 gene locus_tag LOCUS_11100 gene egtD 25623 26567 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_11100 27764 27027 gene locus_tag LOCUS_11110 27764 27027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 28164 27799 gene locus_tag LOCUS_11120 28164 27799 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094547338.1 protein_id gnl|my_center|LOCUS_11120 28726 28157 gene locus_tag LOCUS_11130 28726 28157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831025.1 protein_id gnl|my_center|LOCUS_11130 29518 28769 gene locus_tag LOCUS_11140 29518 28769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 29929 29567 gene locus_tag LOCUS_11150 29929 29567 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097074.1 protein_id gnl|my_center|LOCUS_11150 30751 29975 gene locus_tag LOCUS_11160 30751 29975 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521726.1 protein_id gnl|my_center|LOCUS_11160 31187 30807 gene locus_tag LOCUS_11170 31187 30807 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119424.1 protein_id gnl|my_center|LOCUS_11170 32494 31301 gene locus_tag LOCUS_11180 32494 31301 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403699.1 protein_id gnl|my_center|LOCUS_11180 33220 32729 gene locus_tag LOCUS_11190 gene coaD 33220 32729 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_11190 33784 33230 gene locus_tag LOCUS_11200 gene rsmD 33784 33230 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932644.1 protein_id gnl|my_center|LOCUS_11200 34750 33890 gene locus_tag LOCUS_11210 34750 33890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 35226 34750 gene locus_tag LOCUS_11220 35226 34750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 35398 36708 gene locus_tag LOCUS_11230 35398 36708 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_11230 36713 37222 gene locus_tag LOCUS_11240 36713 37222 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_11240 37311 37658 gene locus_tag LOCUS_11250 37311 37658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 37744 37929 gene locus_tag LOCUS_11260 37744 37929 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544225.1 protein_id gnl|my_center|LOCUS_11260 38067 38885 gene locus_tag LOCUS_11270 gene mscS 38067 38885 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_11270 39017 41011 gene locus_tag LOCUS_11280 39017 41011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 41082 41945 gene locus_tag LOCUS_11290 41082 41945 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_11290 42436 41966 gene locus_tag LOCUS_11300 42436 41966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_11300 42520 43119 gene locus_tag LOCUS_11310 42520 43119 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_11310 43121 43804 gene locus_tag LOCUS_11320 43121 43804 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_11320 43902 46004 gene locus_tag LOCUS_11330 43902 46004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 46016 48703 gene locus_tag LOCUS_11340 46016 48703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 48768 50276 gene locus_tag LOCUS_11350 48768 50276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 50281 53235 gene locus_tag LOCUS_11360 50281 53235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 53235 54233 gene locus_tag LOCUS_11370 gene porV 53235 54233 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_11370 54230 55519 gene locus_tag LOCUS_11380 54230 55519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 55557 56756 gene locus_tag LOCUS_11390 55557 56756 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_11390 56826 57161 gene locus_tag LOCUS_11400 56826 57161 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403899.1 protein_id gnl|my_center|LOCUS_11400 57277 58059 gene locus_tag LOCUS_11410 gene folP 57277 58059 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082506.1 protein_id gnl|my_center|LOCUS_11410 58072 58887 gene locus_tag LOCUS_11420 gene cdaA 58072 58887 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_11420 59619 58903 gene locus_tag LOCUS_11430 59619 58903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 60601 60011 gene locus_tag LOCUS_11440 60601 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 61043 60744 gene locus_tag LOCUS_11450 61043 60744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 61364 63508 gene locus_tag LOCUS_11460 gene scpA 61364 63508 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_11460 63505 64464 gene locus_tag LOCUS_11470 gene meaB 63505 64464 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728859.1 protein_id gnl|my_center|LOCUS_11470 66891 64513 gene locus_tag LOCUS_11480 66891 64513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 67077 68240 gene locus_tag LOCUS_11490 gene acdA 67077 68240 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_11490 68931 68287 gene locus_tag LOCUS_11500 68931 68287 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_11500 69142 70401 gene locus_tag LOCUS_11510 69142 70401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 70454 70882 gene locus_tag LOCUS_11520 70454 70882 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_11520 70925 72754 gene locus_tag LOCUS_11530 70925 72754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 73370 72747 gene locus_tag LOCUS_11540 73370 72747 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206488.1 protein_id gnl|my_center|LOCUS_11540 73604 73485 gene locus_tag LOCUS_11550 73604 73485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 73927 74580 gene locus_tag LOCUS_11560 73927 74580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 74715 76496 gene locus_tag LOCUS_11570 74715 76496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 76695 76621 gene locus_tag LOCUS_t00090 76695 76621 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 78142 76835 gene locus_tag LOCUS_11580 gene ahcY 78142 76835 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_11580 78700 78158 gene locus_tag LOCUS_11590 78700 78158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 78875 81877 gene locus_tag LOCUS_11600 78875 81877 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108199.1 protein_id gnl|my_center|LOCUS_11600 81896 83239 gene locus_tag LOCUS_11610 81896 83239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 83314 84525 gene locus_tag LOCUS_11620 gene lhgO 83314 84525 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_11620 84559 87396 gene locus_tag LOCUS_11630 84559 87396 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_11630 87472 88092 gene locus_tag LOCUS_11640 87472 88092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 89800 88094 gene locus_tag LOCUS_11650 gene recN 89800 88094 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933282.1 protein_id gnl|my_center|LOCUS_11650 90178 89819 gene locus_tag LOCUS_11660 90178 89819 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384381.1 protein_id gnl|my_center|LOCUS_11660 90260 91267 gene locus_tag LOCUS_11670 90260 91267 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927015.1 protein_id gnl|my_center|LOCUS_11670 91908 91495 gene locus_tag LOCUS_11680 91908 91495 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_11680 92419 91922 gene locus_tag LOCUS_11690 92419 91922 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_210267556.1 protein_id gnl|my_center|LOCUS_11690 92978 92475 gene locus_tag LOCUS_11700 92978 92475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 93318 92968 gene locus_tag LOCUS_11710 93318 92968 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_11710 94846 93596 gene locus_tag LOCUS_11720 94846 93596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 95830 94952 gene locus_tag LOCUS_11730 95830 94952 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528187.1 protein_id gnl|my_center|LOCUS_11730 97131 95827 gene locus_tag LOCUS_11740 97131 95827 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_11740 97193 98284 gene locus_tag LOCUS_11750 97193 98284 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_11750 98350 98682 gene locus_tag LOCUS_11760 gene gldC 98350 98682 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_11760 99304 98798 gene locus_tag LOCUS_11770 99304 98798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 100642 99308 gene locus_tag LOCUS_11780 100642 99308 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_11780 102166 100925 gene locus_tag LOCUS_11790 gene amrB 102166 100925 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880857.1 protein_id gnl|my_center|LOCUS_11790 102684 102445 gene locus_tag LOCUS_11800 102684 102445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 104814 102883 gene locus_tag LOCUS_11810 gene dnaK 104814 102883 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963020.1 protein_id gnl|my_center|LOCUS_11810 105405 104971 gene locus_tag LOCUS_11820 105405 104971 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 protein_id gnl|my_center|LOCUS_11820 108609 105640 gene locus_tag LOCUS_11830 108609 105640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 110091 108754 gene locus_tag LOCUS_11840 110091 108754 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108638.1 protein_id gnl|my_center|LOCUS_11840 110767 110228 gene locus_tag LOCUS_11850 110767 110228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 112091 110811 gene locus_tag LOCUS_11860 112091 110811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 113010 112084 gene locus_tag LOCUS_11870 113010 112084 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_11870 114153 113104 gene locus_tag LOCUS_11880 gene asd 114153 113104 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404575.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence08 784 1995 gene locus_tag LOCUS_11890 784 1995 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093151333.1 protein_id gnl|my_center|LOCUS_11890 3068 1998 gene locus_tag LOCUS_11900 3068 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3329 3072 gene locus_tag LOCUS_11910 3329 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4523 3453 gene locus_tag LOCUS_11920 4523 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 5139 4534 gene locus_tag LOCUS_11930 5139 4534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 5663 5151 gene locus_tag LOCUS_11940 5663 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5906 6556 gene locus_tag LOCUS_11950 5906 6556 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_11950 7623 6589 gene locus_tag LOCUS_11960 7623 6589 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_11960 7728 9257 gene locus_tag LOCUS_11970 7728 9257 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695913.1 protein_id gnl|my_center|LOCUS_11970 10025 11404 gene locus_tag LOCUS_11980 10025 11404 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887075.1 protein_id gnl|my_center|LOCUS_11980 11432 12820 gene locus_tag LOCUS_11990 11432 12820 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_11990 12841 13908 gene locus_tag LOCUS_12000 12841 13908 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130602656.1 protein_id gnl|my_center|LOCUS_12000 13905 14759 gene locus_tag LOCUS_12010 13905 14759 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12010 14771 15517 gene locus_tag LOCUS_12020 14771 15517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 17095 15665 gene locus_tag LOCUS_12030 17095 15665 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796345.1 protein_id gnl|my_center|LOCUS_12030 20141 17112 gene locus_tag LOCUS_12040 20141 17112 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201981.1 protein_id gnl|my_center|LOCUS_12040 21709 20828 gene locus_tag LOCUS_12050 21709 20828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22334 21714 gene locus_tag LOCUS_12060 22334 21714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 22499 24352 gene locus_tag LOCUS_12070 22499 24352 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_12070 24414 25817 gene locus_tag LOCUS_12080 24414 25817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 25885 26790 gene locus_tag LOCUS_12090 25885 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 27303 26791 gene locus_tag LOCUS_12100 27303 26791 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962661.1 protein_id gnl|my_center|LOCUS_12100 28128 27352 gene locus_tag LOCUS_12110 28128 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 29388 28219 gene locus_tag LOCUS_12120 29388 28219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 29810 29412 gene locus_tag LOCUS_12130 29810 29412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 32404 29807 gene locus_tag LOCUS_12140 32404 29807 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581323.1 protein_id gnl|my_center|LOCUS_12140 34066 32411 gene locus_tag LOCUS_12150 34066 32411 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275546.1 protein_id gnl|my_center|LOCUS_12150 34177 35001 gene locus_tag LOCUS_12160 34177 35001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_12160 34998 36371 gene locus_tag LOCUS_12170 34998 36371 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_12170 36395 37390 gene locus_tag LOCUS_12180 36395 37390 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_12180 37549 39063 gene locus_tag LOCUS_12190 37549 39063 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_12190 39492 39106 gene locus_tag LOCUS_12200 39492 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 41108 39516 gene locus_tag LOCUS_12210 41108 39516 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258088.1 protein_id gnl|my_center|LOCUS_12210 41664 41242 gene locus_tag LOCUS_12220 gene rsbW 41664 41242 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829903.1 protein_id gnl|my_center|LOCUS_12220 42018 41671 gene locus_tag LOCUS_12230 42018 41671 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903963.1 protein_id gnl|my_center|LOCUS_12230 42764 42267 gene locus_tag LOCUS_12240 42764 42267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 42927 43979 gene locus_tag LOCUS_12250 42927 43979 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405115.1 protein_id gnl|my_center|LOCUS_12250 43984 44274 gene locus_tag LOCUS_12260 43984 44274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 44361 46814 gene locus_tag LOCUS_12270 44361 46814 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405549.1 protein_id gnl|my_center|LOCUS_12270 47789 46887 gene locus_tag LOCUS_12280 47789 46887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 47936 48010 gene locus_tag LOCUS_t00100 47936 48010 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 48147 49337 gene locus_tag LOCUS_12290 48147 49337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 49339 50079 gene locus_tag LOCUS_12300 49339 50079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 50116 52872 gene locus_tag LOCUS_12310 50116 52872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 52877 55072 gene locus_tag LOCUS_12320 52877 55072 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_12320 56256 55297 gene locus_tag LOCUS_12330 56256 55297 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_12330 57254 56310 gene locus_tag LOCUS_12340 57254 56310 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_12340 57381 58307 gene locus_tag LOCUS_12350 57381 58307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 58747 58304 gene locus_tag LOCUS_12360 58747 58304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 58884 59297 gene locus_tag LOCUS_12370 58884 59297 CDS product DUF3052 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929556.1 protein_id gnl|my_center|LOCUS_12370 59373 59864 gene locus_tag LOCUS_12380 59373 59864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 59871 60917 gene locus_tag LOCUS_12390 59871 60917 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966646.1 protein_id gnl|my_center|LOCUS_12390 61551 60928 gene locus_tag LOCUS_12400 61551 60928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 61651 63261 gene locus_tag LOCUS_12410 61651 63261 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_12410 64082 63324 gene locus_tag LOCUS_12420 64082 63324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 64227 64718 gene locus_tag LOCUS_12430 64227 64718 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809464.1 protein_id gnl|my_center|LOCUS_12430 65494 64715 gene locus_tag LOCUS_12440 65494 64715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 65643 67220 gene locus_tag LOCUS_12450 65643 67220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 67425 68843 gene locus_tag LOCUS_12460 gene lpdA 67425 68843 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_12460 68988 69524 gene locus_tag LOCUS_12470 68988 69524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 69524 70252 gene locus_tag LOCUS_12480 gene lipB 69524 70252 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_12480 70394 71269 gene locus_tag LOCUS_12490 gene lipA 70394 71269 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061389.1 protein_id gnl|my_center|LOCUS_12490 71317 72036 gene locus_tag LOCUS_12500 gene plsY 71317 72036 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404230.1 protein_id gnl|my_center|LOCUS_12500 72033 73043 gene locus_tag LOCUS_12510 72033 73043 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847058.1 protein_id gnl|my_center|LOCUS_12510 73077 73775 gene locus_tag LOCUS_12520 73077 73775 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061971.1 protein_id gnl|my_center|LOCUS_12520 73804 74235 gene locus_tag LOCUS_12530 73804 74235 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_12530 74381 76723 gene locus_tag LOCUS_12540 74381 76723 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_12540 76869 77069 gene locus_tag LOCUS_12550 76869 77069 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986443.1 protein_id gnl|my_center|LOCUS_12550 77076 78989 gene locus_tag LOCUS_12560 gene dxs 77076 78989 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_12560 78989 79633 gene locus_tag LOCUS_12570 78989 79633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 79633 80634 gene locus_tag LOCUS_12580 gene queA 79633 80634 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_12580 80817 80891 gene locus_tag LOCUS_t00110 80817 80891 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 81838 81071 gene locus_tag LOCUS_12590 81838 81071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 82775 81939 gene locus_tag LOCUS_12600 82775 81939 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_12600 83437 82793 gene locus_tag LOCUS_12610 83437 82793 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965417.1 protein_id gnl|my_center|LOCUS_12610 83833 83483 gene locus_tag LOCUS_12620 83833 83483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 84148 83843 gene locus_tag LOCUS_12630 84148 83843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 84893 84195 gene locus_tag LOCUS_12640 84893 84195 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_12640 85087 86148 gene locus_tag LOCUS_12650 85087 86148 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_12650 86159 86893 gene locus_tag LOCUS_12660 86159 86893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404841.1 protein_id gnl|my_center|LOCUS_12660 87581 86961 gene locus_tag LOCUS_12670 gene pnuC 87581 86961 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_12670 87624 89078 gene locus_tag LOCUS_12680 87624 89078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 89373 89086 gene locus_tag LOCUS_12690 89373 89086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 89811 89392 gene locus_tag LOCUS_12700 gene tsaE 89811 89392 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679136.1 protein_id gnl|my_center|LOCUS_12700 91354 89813 gene locus_tag LOCUS_12710 91354 89813 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_12710 91742 91371 gene locus_tag LOCUS_12720 91742 91371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 91935 92723 gene locus_tag LOCUS_12730 91935 92723 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_12730 92868 93230 gene locus_tag LOCUS_12740 92868 93230 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043553480.1 protein_id gnl|my_center|LOCUS_12740 94164 93241 gene locus_tag LOCUS_12750 94164 93241 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_12750 94568 94161 gene locus_tag LOCUS_12760 94568 94161 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_12760 95916 94690 gene locus_tag LOCUS_12770 95916 94690 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_12770 97467 96094 gene locus_tag LOCUS_12780 97467 96094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 97578 98102 gene locus_tag LOCUS_12790 97578 98102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 98105 99937 gene locus_tag LOCUS_12800 98105 99937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 103603 99998 gene locus_tag LOCUS_12810 103603 99998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 103868 104467 gene locus_tag LOCUS_12820 103868 104467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 105043 104738 gene locus_tag LOCUS_12830 105043 104738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12830 104749 104758 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 105435 105067 gene locus_tag LOCUS_12840 105435 105067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 106471 105545 gene locus_tag LOCUS_12850 106471 105545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 108180 106513 gene locus_tag LOCUS_12860 108180 106513 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_12860 109740 108343 gene locus_tag LOCUS_12870 109740 108343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223372.1 protein_id gnl|my_center|LOCUS_12870 110343 109819 gene locus_tag LOCUS_12880 110343 109819 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833874.1 protein_id gnl|my_center|LOCUS_12880 111913 110336 gene locus_tag LOCUS_12890 111913 110336 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228222.1 protein_id gnl|my_center|LOCUS_12890 112644 111973 gene locus_tag LOCUS_12900 112644 111973 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049924277.1 protein_id gnl|my_center|LOCUS_12900 <113340 112656 gene locus_tag LOCUS_12910 <113340 112656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000272954.1:ring-cleaving dioxygenase >Feature sequence09 1955 195 gene locus_tag LOCUS_12920 1955 195 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_12920 2840 2142 gene locus_tag LOCUS_12930 2840 2142 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045801381.1 protein_id gnl|my_center|LOCUS_12930 2927 3745 gene locus_tag LOCUS_12940 2927 3745 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255958.1 protein_id gnl|my_center|LOCUS_12940 4968 3742 gene locus_tag LOCUS_12950 4968 3742 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928864.1 protein_id gnl|my_center|LOCUS_12950 5921 5028 gene locus_tag LOCUS_12960 5921 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 6339 6046 gene locus_tag LOCUS_12970 6339 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6576 6343 gene locus_tag LOCUS_12980 6576 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 7622 6630 gene locus_tag LOCUS_12990 gene bioB 7622 6630 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962410.1 protein_id gnl|my_center|LOCUS_12990 7742 8431 gene locus_tag LOCUS_13000 7742 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 8539 9210 gene locus_tag LOCUS_13010 8539 9210 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357427.1 protein_id gnl|my_center|LOCUS_13010 9275 9955 gene locus_tag LOCUS_13020 9275 9955 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_13020 11325 9952 gene locus_tag LOCUS_13030 11325 9952 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_13030 12384 11410 gene locus_tag LOCUS_13040 12384 11410 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839616.1 protein_id gnl|my_center|LOCUS_13040 13489 12458 gene locus_tag LOCUS_13050 gene hprK 13489 12458 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_13050 13788 13489 gene locus_tag LOCUS_13060 gene raiA 13788 13489 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_13060 14747 13806 gene locus_tag LOCUS_13070 gene xerC 14747 13806 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_13070 15885 14788 gene locus_tag LOCUS_13080 gene cruC 15885 14788 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_13080 16008 17078 gene locus_tag LOCUS_13090 gene crtC 16008 17078 CDS product hydroxyneurosporene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931993.1 protein_id gnl|my_center|LOCUS_13090 17751 17086 gene locus_tag LOCUS_13100 17751 17086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 17800 18459 gene locus_tag LOCUS_13110 17800 18459 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_13110 19271 18507 gene locus_tag LOCUS_13120 19271 18507 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794868.1 protein_id gnl|my_center|LOCUS_13120 20374 19286 gene locus_tag LOCUS_13130 20374 19286 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456632.1 protein_id gnl|my_center|LOCUS_13130 20804 20385 gene locus_tag LOCUS_13140 20804 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 21708 20863 gene locus_tag LOCUS_13150 21708 20863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 22755 21712 gene locus_tag LOCUS_13160 22755 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 24110 22755 gene locus_tag LOCUS_13170 24110 22755 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_13170 24191 25216 gene locus_tag LOCUS_13180 gene fni 24191 25216 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931949.1 protein_id gnl|my_center|LOCUS_13180 25271 26266 gene locus_tag LOCUS_13190 25271 26266 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_13190 26280 27113 gene locus_tag LOCUS_13200 26280 27113 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_13200 27120 27698 gene locus_tag LOCUS_13210 27120 27698 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398676.1 protein_id gnl|my_center|LOCUS_13210 27723 28745 gene locus_tag LOCUS_13220 27723 28745 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_13220 28860 32345 gene locus_tag LOCUS_13230 28860 32345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 33464 32376 gene locus_tag LOCUS_13240 33464 32376 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401993.1 protein_id gnl|my_center|LOCUS_13240 34006 33467 gene locus_tag LOCUS_13250 34006 33467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 34106 34540 gene locus_tag LOCUS_13260 34106 34540 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_13260 34549 35472 gene locus_tag LOCUS_13270 gene rimK 34549 35472 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261388.1 protein_id gnl|my_center|LOCUS_13270 35465 36412 gene locus_tag LOCUS_13280 35465 36412 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_13280 36416 36763 gene locus_tag LOCUS_13290 36416 36763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 37122 36760 gene locus_tag LOCUS_13300 37122 36760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 37724 37254 gene locus_tag LOCUS_13310 37724 37254 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_13310 38323 37727 gene locus_tag LOCUS_13320 38323 37727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 38850 38332 gene locus_tag LOCUS_13330 38850 38332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 39559 38873 gene locus_tag LOCUS_13340 39559 38873 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015646.1 protein_id gnl|my_center|LOCUS_13340 40956 39649 gene locus_tag LOCUS_13350 gene der 40956 39649 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_13350 41017 41274 gene locus_tag LOCUS_13360 41017 41274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 43287 41263 gene locus_tag LOCUS_13370 43287 41263 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_13370 44650 43388 gene locus_tag LOCUS_13380 44650 43388 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839416.1 protein_id gnl|my_center|LOCUS_13380 45307 44762 gene locus_tag LOCUS_13390 45307 44762 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_13390 45435 46091 gene locus_tag LOCUS_13400 45435 46091 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_13400 46091 47422 gene locus_tag LOCUS_13410 46091 47422 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_13410 47462 49393 gene locus_tag LOCUS_13420 47462 49393 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_13420 49394 50290 gene locus_tag LOCUS_13430 49394 50290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 50290 51657 gene locus_tag LOCUS_13440 gene surA 50290 51657 CDS product peptidylprolyl isomerase SurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780524.1 protein_id gnl|my_center|LOCUS_13440 51657 52649 gene locus_tag LOCUS_13450 51657 52649 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_13450 52651 54735 gene locus_tag LOCUS_13460 52651 54735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 55269 54736 gene locus_tag LOCUS_13470 55269 54736 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_13470 56572 55346 gene locus_tag LOCUS_13480 56572 55346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 57042 56569 gene locus_tag LOCUS_13490 57042 56569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 57653 57114 gene locus_tag LOCUS_13500 57653 57114 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944687.1 protein_id gnl|my_center|LOCUS_13500 57746 58174 gene locus_tag LOCUS_13510 57746 58174 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932073.1 protein_id gnl|my_center|LOCUS_13510 60643 58175 gene locus_tag LOCUS_13520 60643 58175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 61188 60649 gene locus_tag LOCUS_13530 61188 60649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881788.1 protein_id gnl|my_center|LOCUS_13530 61954 61178 gene locus_tag LOCUS_13540 61954 61178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 62747 61971 gene locus_tag LOCUS_13550 62747 61971 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536473.1 protein_id gnl|my_center|LOCUS_13550 62867 63655 gene locus_tag LOCUS_13560 62867 63655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 protein_id gnl|my_center|LOCUS_13560 65505 63652 gene locus_tag LOCUS_13570 65505 63652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 66362 65502 gene locus_tag LOCUS_13580 66362 65502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 68106 66364 gene locus_tag LOCUS_13590 68106 66364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 69364 68111 gene locus_tag LOCUS_13600 69364 68111 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838690.1 protein_id gnl|my_center|LOCUS_13600 69939 69439 gene locus_tag LOCUS_13610 69939 69439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 71792 70014 gene locus_tag LOCUS_13620 71792 70014 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404025.1 protein_id gnl|my_center|LOCUS_13620 73123 71792 gene locus_tag LOCUS_13630 73123 71792 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840114.1 protein_id gnl|my_center|LOCUS_13630 73429 73142 gene locus_tag LOCUS_13640 73429 73142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 73988 73548 gene locus_tag LOCUS_13650 73988 73548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 74335 75480 gene locus_tag LOCUS_13660 74335 75480 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403215.1 protein_id gnl|my_center|LOCUS_13660 75595 77013 gene locus_tag LOCUS_13670 75595 77013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 77045 77587 gene locus_tag LOCUS_13680 77045 77587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 77592 79007 gene locus_tag LOCUS_13690 77592 79007 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583129.1 protein_id gnl|my_center|LOCUS_13690 79008 79229 gene locus_tag LOCUS_13700 79008 79229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 79717 79226 gene locus_tag LOCUS_13710 79717 79226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 80220 79714 gene locus_tag LOCUS_13720 80220 79714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 80270 80737 gene locus_tag LOCUS_13730 80270 80737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 80718 81929 gene locus_tag LOCUS_13740 80718 81929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_13740 83079 81916 gene locus_tag LOCUS_13750 83079 81916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 84642 83131 gene locus_tag LOCUS_13760 84642 83131 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_13760 84809 85507 gene locus_tag LOCUS_13770 gene fkpA 84809 85507 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071319.1 protein_id gnl|my_center|LOCUS_13770 86830 85574 gene locus_tag LOCUS_13780 86830 85574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 88875 87163 gene locus_tag LOCUS_13790 gene recD 88875 87163 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703320.1 protein_id gnl|my_center|LOCUS_13790 92383 88868 gene locus_tag LOCUS_13800 gene recB 92383 88868 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261335.1 protein_id gnl|my_center|LOCUS_13800 95499 92380 gene locus_tag LOCUS_13810 gene recC 95499 92380 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980978.1 protein_id gnl|my_center|LOCUS_13810 95817 95551 gene locus_tag LOCUS_13820 95817 95551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 96576 95821 gene locus_tag LOCUS_13830 96576 95821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_13830 96766 97137 gene locus_tag LOCUS_13840 96766 97137 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 protein_id gnl|my_center|LOCUS_13840 97140 97487 gene locus_tag LOCUS_13850 97140 97487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 97550 98275 gene locus_tag LOCUS_13860 97550 98275 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_13860 98272 99747 gene locus_tag LOCUS_13870 98272 99747 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_13870 99816 100826 gene locus_tag LOCUS_13880 gene galE 99816 100826 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_13880 100877 100959 gene locus_tag LOCUS_t00120 100877 100959 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 101758 101264 gene locus_tag LOCUS_13890 101758 101264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 101890 102711 gene locus_tag LOCUS_13900 gene lolS 101890 102711 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747187.1 protein_id gnl|my_center|LOCUS_13900 103313 102795 gene locus_tag LOCUS_13910 103313 102795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 104094 103402 gene locus_tag LOCUS_13920 104094 103402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 105818 104187 gene locus_tag LOCUS_13930 105818 104187 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118826328.1 protein_id gnl|my_center|LOCUS_13930 105988 107310 gene locus_tag LOCUS_13940 105988 107310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence10 1162 149 gene locus_tag LOCUS_13950 1162 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2001 1300 gene locus_tag LOCUS_13960 2001 1300 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_13960 2635 2003 gene locus_tag LOCUS_13970 2635 2003 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421612.1 protein_id gnl|my_center|LOCUS_13970 3539 2595 gene locus_tag LOCUS_13980 3539 2595 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403291.1 protein_id gnl|my_center|LOCUS_13980 4348 3551 gene locus_tag LOCUS_13990 4348 3551 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_13990 4978 4460 gene locus_tag LOCUS_14000 4978 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5651 5007 gene locus_tag LOCUS_14010 5651 5007 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 protein_id gnl|my_center|LOCUS_14010 7733 5889 gene locus_tag LOCUS_14020 gene uvrC 7733 5889 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404327.1 protein_id gnl|my_center|LOCUS_14020 8117 8857 gene locus_tag LOCUS_14030 8117 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14030 8864 9595 gene locus_tag LOCUS_14040 8864 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14040 9592 10617 gene locus_tag LOCUS_14050 9592 10617 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_14050 10614 11033 gene locus_tag LOCUS_14060 10614 11033 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_14060 11566 11880 gene locus_tag LOCUS_14070 11566 11880 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529430.1 protein_id gnl|my_center|LOCUS_14070 11886 12311 gene locus_tag LOCUS_14080 11886 12311 CDS product SRPBCC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969809.1 protein_id gnl|my_center|LOCUS_14080 12357 12572 gene locus_tag LOCUS_14090 12357 12572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 13009 12635 gene locus_tag LOCUS_14100 13009 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13303 14007 gene locus_tag LOCUS_14110 13303 14007 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_14110 14615 14004 gene locus_tag LOCUS_14120 14615 14004 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_14120 15162 14716 gene locus_tag LOCUS_14130 gene tnpA 15162 14716 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_14130 15385 16278 gene locus_tag LOCUS_14140 15385 16278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226805.1 protein_id gnl|my_center|LOCUS_14140 17407 16286 gene locus_tag LOCUS_14150 gene anmK 17407 16286 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_14150 17452 17697 gene locus_tag LOCUS_14160 17452 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 17759 18241 gene locus_tag LOCUS_14170 17759 18241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 18285 19991 gene locus_tag LOCUS_14180 18285 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 20141 21244 gene locus_tag LOCUS_14190 20141 21244 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020079396.1 protein_id gnl|my_center|LOCUS_14190 21384 22151 gene locus_tag LOCUS_14200 21384 22151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 22953 22207 gene locus_tag LOCUS_14210 22953 22207 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_14210 23947 23051 gene locus_tag LOCUS_14220 gene dapA 23947 23051 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883683.1 protein_id gnl|my_center|LOCUS_14220 24617 23940 gene locus_tag LOCUS_14230 gene dapB 24617 23940 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_14230 25372 24716 gene locus_tag LOCUS_14240 25372 24716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 25929 25375 gene locus_tag LOCUS_14250 25929 25375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 27410 26082 gene locus_tag LOCUS_14260 gene lysC 27410 26082 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706390.1 protein_id gnl|my_center|LOCUS_14260 27649 28788 gene locus_tag LOCUS_14270 27649 28788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 28810 30051 gene locus_tag LOCUS_14280 28810 30051 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_14280 30247 30591 gene locus_tag LOCUS_14290 30247 30591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 31308 32468 gene locus_tag LOCUS_14300 31308 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 32468 32956 gene locus_tag LOCUS_14310 32468 32956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 32953 33663 gene locus_tag LOCUS_14320 32953 33663 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524612.1 protein_id gnl|my_center|LOCUS_14320 34863 33922 gene locus_tag LOCUS_14330 34863 33922 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 protein_id gnl|my_center|LOCUS_14330 36064 34865 gene locus_tag LOCUS_14340 36064 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 36592 37647 gene locus_tag LOCUS_14350 36592 37647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 37640 38266 gene locus_tag LOCUS_14360 gene udk 37640 38266 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_14360 38996 38253 gene locus_tag LOCUS_14370 38996 38253 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723743.1 protein_id gnl|my_center|LOCUS_14370 39048 39764 gene locus_tag LOCUS_14380 39048 39764 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_14380 39768 40142 gene locus_tag LOCUS_14390 39768 40142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 42055 40115 gene locus_tag LOCUS_14400 42055 40115 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404418.1 protein_id gnl|my_center|LOCUS_14400 42207 43085 gene locus_tag LOCUS_14410 42207 43085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 44221 43106 gene locus_tag LOCUS_14420 gene leuB 44221 43106 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_14420 44817 44224 gene locus_tag LOCUS_14430 gene leuD 44817 44224 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_14430 46214 44817 gene locus_tag LOCUS_14440 gene leuC 46214 44817 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072959918.1 protein_id gnl|my_center|LOCUS_14440 47390 46224 gene locus_tag LOCUS_14450 47390 46224 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_14450 47589 49127 gene locus_tag LOCUS_14460 47589 49127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_14460 49380 51059 gene locus_tag LOCUS_14470 gene ilvD 49380 51059 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962618.1 protein_id gnl|my_center|LOCUS_14470 51074 52813 gene locus_tag LOCUS_14480 gene ilvB 51074 52813 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_14480 52819 53349 gene locus_tag LOCUS_14490 gene ilvN 52819 53349 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_14490 53393 54439 gene locus_tag LOCUS_14500 gene ilvC 53393 54439 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_14500 54470 55726 gene locus_tag LOCUS_14510 gene ilvA 54470 55726 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962614.1 protein_id gnl|my_center|LOCUS_14510 55760 58192 gene locus_tag LOCUS_14520 gene thrA 55760 58192 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_14520 58192 59112 gene locus_tag LOCUS_14530 58192 59112 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933689.1 protein_id gnl|my_center|LOCUS_14530 59109 60395 gene locus_tag LOCUS_14540 gene thrC 59109 60395 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_14540 60888 60406 gene locus_tag LOCUS_14550 60888 60406 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531271.1 protein_id gnl|my_center|LOCUS_14550 61062 62210 gene locus_tag LOCUS_14560 61062 62210 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_14560 62215 63471 gene locus_tag LOCUS_14570 62215 63471 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206548.1 protein_id gnl|my_center|LOCUS_14570 64164 63460 gene locus_tag LOCUS_14580 64164 63460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 65160 64246 gene locus_tag LOCUS_14590 gene fmt 65160 64246 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404897.1 protein_id gnl|my_center|LOCUS_14590 65718 65164 gene locus_tag LOCUS_14600 gene def 65718 65164 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404043.1 protein_id gnl|my_center|LOCUS_14600 66146 65724 gene locus_tag LOCUS_14610 gene ruvX 66146 65724 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403824.1 protein_id gnl|my_center|LOCUS_14610 66469 66149 gene locus_tag LOCUS_14620 66469 66149 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_14620 68882 66627 gene locus_tag LOCUS_14630 68882 66627 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_14630 69551 68988 gene locus_tag LOCUS_14640 69551 68988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 72914 69678 gene locus_tag LOCUS_14650 72914 69678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14650 73107 73194 gene locus_tag LOCUS_t00130 73107 73194 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 73860 73495 gene locus_tag LOCUS_14660 73860 73495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 75814 74033 gene locus_tag LOCUS_14670 75814 74033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 76038 76415 gene locus_tag LOCUS_14680 76038 76415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 76556 78163 gene locus_tag LOCUS_14690 76556 78163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 78207 78911 gene locus_tag LOCUS_14700 gene walR 78207 78911 CDS product cell wall metabolism DNA-binding response regulator WalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244363.1 protein_id gnl|my_center|LOCUS_14700 79447 78908 gene locus_tag LOCUS_14710 79447 78908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 80126 80923 gene locus_tag LOCUS_14720 80126 80923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 82278 80911 gene locus_tag LOCUS_14730 82278 80911 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680871.1 protein_id gnl|my_center|LOCUS_14730 82948 82352 gene locus_tag LOCUS_14740 82948 82352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 84433 82949 gene locus_tag LOCUS_14750 84433 82949 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_14750 85197 84481 gene locus_tag LOCUS_14760 85197 84481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 85807 85181 gene locus_tag LOCUS_14770 85807 85181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 85996 87096 gene locus_tag LOCUS_14780 85996 87096 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_14780 87231 87614 gene locus_tag LOCUS_14790 87231 87614 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_14790 87611 89620 gene locus_tag LOCUS_14800 87611 89620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 89691 89870 gene locus_tag LOCUS_14810 89691 89870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 89981 90835 gene locus_tag LOCUS_14820 89981 90835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 91727 90873 gene locus_tag LOCUS_14830 91727 90873 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097527.1 protein_id gnl|my_center|LOCUS_14830 92939 91752 gene locus_tag LOCUS_14840 92939 91752 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403964.1 protein_id gnl|my_center|LOCUS_14840 95327 92970 gene locus_tag LOCUS_14850 95327 92970 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_14850 97118 95331 gene locus_tag LOCUS_14860 97118 95331 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_14860 97233 97664 gene locus_tag LOCUS_14870 97233 97664 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140609.1 protein_id gnl|my_center|LOCUS_14870 99353 97701 gene locus_tag LOCUS_14880 99353 97701 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187695.1 protein_id gnl|my_center|LOCUS_14880 101057 99462 gene locus_tag LOCUS_14890 101057 99462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_14890 103215 101320 gene locus_tag LOCUS_14900 103215 101320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 <104181 103267 gene locus_tag LOCUS_14910 <104181 103267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256013.1:M24 family metallopeptidase >Feature sequence11 1073 195 gene locus_tag LOCUS_14920 1073 195 CDS product DUF1460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_14920 2445 1099 gene locus_tag LOCUS_14930 gene glmM 2445 1099 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_14930 4459 2450 gene locus_tag LOCUS_14940 4459 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5008 4463 gene locus_tag LOCUS_14950 5008 4463 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_14950 5134 5889 gene locus_tag LOCUS_14960 5134 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7194 6211 gene locus_tag LOCUS_14970 7194 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8240 7185 gene locus_tag LOCUS_14980 8240 7185 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_14980 8477 9436 gene locus_tag LOCUS_14990 8477 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 9800 9447 gene locus_tag LOCUS_15000 9800 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 10315 10968 gene locus_tag LOCUS_15010 10315 10968 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941836.1 protein_id gnl|my_center|LOCUS_15010 10982 12904 gene locus_tag LOCUS_15020 10982 12904 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_15020 12985 13737 gene locus_tag LOCUS_15030 12985 13737 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_15030 13795 13935 gene locus_tag LOCUS_15040 13795 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 14610 14152 gene locus_tag LOCUS_15050 14610 14152 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112599.1 protein_id gnl|my_center|LOCUS_15050 14951 15949 gene locus_tag LOCUS_15060 gene gap 14951 15949 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_15060 16082 17977 gene locus_tag LOCUS_15070 16082 17977 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_15070 18070 19161 gene locus_tag LOCUS_15080 18070 19161 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_15080 19294 19824 gene locus_tag LOCUS_15090 19294 19824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 20066 21133 gene locus_tag LOCUS_15100 20066 21133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 22090 21143 gene locus_tag LOCUS_15110 22090 21143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 23782 22163 gene locus_tag LOCUS_15120 23782 22163 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_15120 24996 24010 gene locus_tag LOCUS_15130 24996 24010 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394113.1 protein_id gnl|my_center|LOCUS_15130 25288 26046 gene locus_tag LOCUS_15140 25288 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 26155 26544 gene locus_tag LOCUS_15150 26155 26544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 26881 27603 gene locus_tag LOCUS_15160 26881 27603 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_15160 28797 28456 gene locus_tag LOCUS_15170 28797 28456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 29447 28794 gene locus_tag LOCUS_15180 29447 28794 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_15180 31240 29486 gene locus_tag LOCUS_15190 gene ctaD 31240 29486 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404827.1 protein_id gnl|my_center|LOCUS_15190 32180 31242 gene locus_tag LOCUS_15200 gene coxB 32180 31242 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404828.1 protein_id gnl|my_center|LOCUS_15200 33016 32180 gene locus_tag LOCUS_15210 33016 32180 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_15210 33560 33021 gene locus_tag LOCUS_15220 33560 33021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 34791 33571 gene locus_tag LOCUS_15230 34791 33571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062436.1 protein_id gnl|my_center|LOCUS_15230 35848 34814 gene locus_tag LOCUS_15240 35848 34814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 36404 35841 gene locus_tag LOCUS_15250 36404 35841 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_15250 37832 36408 gene locus_tag LOCUS_15260 gene nrfD 37832 36408 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_15260 40861 37859 gene locus_tag LOCUS_15270 40861 37859 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_15270 41537 40893 gene locus_tag LOCUS_15280 41537 40893 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404835.1 protein_id gnl|my_center|LOCUS_15280 44022 41857 gene locus_tag LOCUS_15290 44022 41857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 46297 44120 gene locus_tag LOCUS_15300 46297 44120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 47266 46298 gene locus_tag LOCUS_15310 47266 46298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 47670 48356 gene locus_tag LOCUS_15320 47670 48356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 48356 49414 gene locus_tag LOCUS_15330 48356 49414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 50746 49418 gene locus_tag LOCUS_15340 50746 49418 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_15340 51783 50746 gene locus_tag LOCUS_15350 51783 50746 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_15350 52982 51780 gene locus_tag LOCUS_15360 52982 51780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 53614 52979 gene locus_tag LOCUS_15370 53614 52979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 54554 53715 gene locus_tag LOCUS_15380 54554 53715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 55515 54547 gene locus_tag LOCUS_15390 55515 54547 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_15390 55607 56356 gene locus_tag LOCUS_15400 55607 56356 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_15400 56395 56628 gene locus_tag LOCUS_15410 56395 56628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 57629 56727 gene locus_tag LOCUS_15420 gene cyoE 57629 56727 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062574.1 protein_id gnl|my_center|LOCUS_15420 57688 58740 gene locus_tag LOCUS_15430 57688 58740 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_15430 58999 59931 gene locus_tag LOCUS_15440 58999 59931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 59956 60321 gene locus_tag LOCUS_15450 59956 60321 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721457.1 protein_id gnl|my_center|LOCUS_15450 60453 60896 gene locus_tag LOCUS_15460 60453 60896 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258524.1 protein_id gnl|my_center|LOCUS_15460 60880 61515 gene locus_tag LOCUS_15470 60880 61515 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256364.1 protein_id gnl|my_center|LOCUS_15470 61512 63320 gene locus_tag LOCUS_15480 61512 63320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 63331 63969 gene locus_tag LOCUS_15490 gene rqpR 63331 63969 CDS product response regulator transcription factor RqpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197176.1 protein_id gnl|my_center|LOCUS_15490 64350 65480 gene locus_tag LOCUS_15500 64350 65480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 65586 66272 gene locus_tag LOCUS_15510 65586 66272 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_15510 66289 67311 gene locus_tag LOCUS_15520 66289 67311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 67649 67308 gene locus_tag LOCUS_15530 67649 67308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 70686 67891 gene locus_tag LOCUS_15540 70686 67891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 72370 71150 gene locus_tag LOCUS_15550 72370 71150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 75117 72592 gene locus_tag LOCUS_15560 75117 72592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 75645 75130 gene locus_tag LOCUS_15570 75645 75130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 77575 75635 gene locus_tag LOCUS_15580 77575 75635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 78537 77590 gene locus_tag LOCUS_15590 78537 77590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 79486 78566 gene locus_tag LOCUS_15600 79486 78566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 80242 79571 gene locus_tag LOCUS_15610 80242 79571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 80933 82120 gene locus_tag LOCUS_15620 80933 82120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 82125 82808 gene locus_tag LOCUS_15630 82125 82808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 82997 84145 gene locus_tag LOCUS_15640 82997 84145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 84129 84138 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 84196 84558 gene locus_tag LOCUS_15650 84196 84558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 84561 85358 gene locus_tag LOCUS_15660 84561 85358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 85351 86838 gene locus_tag LOCUS_15670 85351 86838 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257351.1 protein_id gnl|my_center|LOCUS_15670 86840 88081 gene locus_tag LOCUS_15680 86840 88081 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259387.1 protein_id gnl|my_center|LOCUS_15680 88226 89110 gene locus_tag LOCUS_15690 88226 89110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 89137 90297 gene locus_tag LOCUS_15700 89137 90297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 90297 91682 gene locus_tag LOCUS_15710 90297 91682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 91696 92676 gene locus_tag LOCUS_15720 91696 92676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 92688 93866 gene locus_tag LOCUS_15730 92688 93866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 93863 95590 gene locus_tag LOCUS_15740 93863 95590 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037529.1 protein_id gnl|my_center|LOCUS_15740 95662 96813 gene locus_tag LOCUS_15750 95662 96813 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_15750 96853 98169 gene locus_tag LOCUS_15760 96853 98169 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_15760 98492 98184 gene locus_tag LOCUS_15770 98492 98184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 98591 99541 gene locus_tag LOCUS_15780 98591 99541 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_15780 102880 99554 gene locus_tag LOCUS_15790 102880 99554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence12 1573 293 gene locus_tag LOCUS_15800 gene purD 1573 293 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933338.1 protein_id gnl|my_center|LOCUS_15800 2350 1577 gene locus_tag LOCUS_15810 gene tpiA 2350 1577 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_15810 3643 2351 gene locus_tag LOCUS_15820 3643 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5185 3737 gene locus_tag LOCUS_15830 gene gatB 5185 3737 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_15830 5309 6664 gene locus_tag LOCUS_15840 5309 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 6661 8127 gene locus_tag LOCUS_15850 6661 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 9218 8157 gene locus_tag LOCUS_15860 9218 8157 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_15860 10131 9253 gene locus_tag LOCUS_15870 10131 9253 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933176.1 protein_id gnl|my_center|LOCUS_15870 10356 11963 gene locus_tag LOCUS_15880 gene pckA 10356 11963 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_15880 12067 12348 gene locus_tag LOCUS_15890 12067 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 12345 12758 gene locus_tag LOCUS_15900 12345 12758 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_15900 13834 12755 gene locus_tag LOCUS_15910 gene prfA 13834 12755 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_15910 14243 13881 gene locus_tag LOCUS_15920 14243 13881 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957424.1 protein_id gnl|my_center|LOCUS_15920 14312 15469 gene locus_tag LOCUS_15930 14312 15469 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909198.1 protein_id gnl|my_center|LOCUS_15930 15567 16052 gene locus_tag LOCUS_15940 gene purE 15567 16052 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165488.1 protein_id gnl|my_center|LOCUS_15940 16173 17366 gene locus_tag LOCUS_15950 16173 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 17539 17793 gene locus_tag LOCUS_15960 17539 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 17933 18253 gene locus_tag LOCUS_15970 17933 18253 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160731.1 protein_id gnl|my_center|LOCUS_15970 19490 18312 gene locus_tag LOCUS_15980 gene dnaJ 19490 18312 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405069.1 protein_id gnl|my_center|LOCUS_15980 20075 19494 gene locus_tag LOCUS_15990 20075 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 21737 20235 gene locus_tag LOCUS_16000 21737 20235 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_16000 24677 21753 gene locus_tag LOCUS_16010 24677 21753 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_16010 24891 25583 gene locus_tag LOCUS_16020 24891 25583 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_16020 25667 26404 gene locus_tag LOCUS_16030 25667 26404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 27350 26481 gene locus_tag LOCUS_16040 27350 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 28067 27447 gene locus_tag LOCUS_16050 28067 27447 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839642.1 protein_id gnl|my_center|LOCUS_16050 28864 28085 gene locus_tag LOCUS_16060 28864 28085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 30366 28861 gene locus_tag LOCUS_16070 30366 28861 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_16070 31467 30382 gene locus_tag LOCUS_16080 31467 30382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 31943 31482 gene locus_tag LOCUS_16090 31943 31482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 32050 32757 gene locus_tag LOCUS_16100 32050 32757 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_16100 32754 35291 gene locus_tag LOCUS_16110 32754 35291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_16110 35385 36056 gene locus_tag LOCUS_16120 35385 36056 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838096.1 protein_id gnl|my_center|LOCUS_16120 36145 37230 gene locus_tag LOCUS_16130 gene corA 36145 37230 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_16130 38752 37334 gene locus_tag LOCUS_16140 38752 37334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 38908 39270 gene locus_tag LOCUS_16150 38908 39270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 39586 39428 gene locus_tag LOCUS_16160 39586 39428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 40857 40225 gene locus_tag LOCUS_16170 40857 40225 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_16170 43691 40869 gene locus_tag LOCUS_16180 43691 40869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 43810 44919 gene locus_tag LOCUS_16190 43810 44919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 45846 44992 gene locus_tag LOCUS_16200 45846 44992 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_16200 46119 46544 gene locus_tag LOCUS_16210 46119 46544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 46622 47494 gene locus_tag LOCUS_16220 46622 47494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 48238 47495 gene locus_tag LOCUS_16230 48238 47495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 50726 48231 gene locus_tag LOCUS_16240 gene ccsA 50726 48231 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_16240 51118 50729 gene locus_tag LOCUS_16250 51118 50729 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_16250 51368 51108 gene locus_tag LOCUS_16260 51368 51108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 52034 51378 gene locus_tag LOCUS_16270 gene ccsA 52034 51378 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_16270 52447 52965 gene locus_tag LOCUS_16280 52447 52965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 53071 55392 gene locus_tag LOCUS_16290 53071 55392 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_16290 56748 55534 gene locus_tag LOCUS_16300 56748 55534 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117040.1 protein_id gnl|my_center|LOCUS_16300 57796 56912 gene locus_tag LOCUS_16310 57796 56912 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_16310 58342 58160 gene locus_tag LOCUS_16320 58342 58160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 62037 58657 gene locus_tag LOCUS_16330 62037 58657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 62569 62216 gene locus_tag LOCUS_16340 62569 62216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 62773 63450 gene locus_tag LOCUS_16350 62773 63450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 63470 65290 gene locus_tag LOCUS_16360 63470 65290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 65996 65343 gene locus_tag LOCUS_16370 65996 65343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_16370 69001 65993 gene locus_tag LOCUS_16380 69001 65993 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097677775.1 protein_id gnl|my_center|LOCUS_16380 69215 73666 gene locus_tag LOCUS_16390 69215 73666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 73975 73775 gene locus_tag LOCUS_16400 73975 73775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 78637 74060 gene locus_tag LOCUS_16410 78637 74060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 83168 79299 gene locus_tag LOCUS_16420 83168 79299 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201933.1 protein_id gnl|my_center|LOCUS_16420 85322 83640 gene locus_tag LOCUS_16430 gene groL 85322 83640 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_16430 85665 85378 gene locus_tag LOCUS_16440 gene groES 85665 85378 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404849.1 protein_id gnl|my_center|LOCUS_16440 86532 85759 gene locus_tag LOCUS_16450 gene rsmA 86532 85759 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_16450 86656 89046 gene locus_tag LOCUS_16460 86656 89046 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_16460 89046 89960 gene locus_tag LOCUS_16470 gene xerD 89046 89960 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_16470 89966 91648 gene locus_tag LOCUS_16480 gene ggt 89966 91648 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_16480 92093 91698 gene locus_tag LOCUS_16490 gene ytxJ 92093 91698 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229280.1 protein_id gnl|my_center|LOCUS_16490 92195 92899 gene locus_tag LOCUS_16500 92195 92899 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_16500 94202 92901 gene locus_tag LOCUS_16510 94202 92901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 95880 94354 gene locus_tag LOCUS_16520 95880 94354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_16520 96062 96781 gene locus_tag LOCUS_16530 96062 96781 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480398.1 protein_id gnl|my_center|LOCUS_16530 97009 98187 gene locus_tag LOCUS_16540 97009 98187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 98242 99048 gene locus_tag LOCUS_16550 98242 99048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 99050 99574 gene locus_tag LOCUS_16560 99050 99574 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963697.1 protein_id gnl|my_center|LOCUS_16560 100439 99558 gene locus_tag LOCUS_16570 100439 99558 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_16570 101073 100432 gene locus_tag LOCUS_16580 gene pxpB 101073 100432 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 protein_id gnl|my_center|LOCUS_16580 101857 101099 gene locus_tag LOCUS_16590 101857 101099 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868110.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence13 824 123 gene locus_tag LOCUS_16600 824 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1002 2255 gene locus_tag LOCUS_16610 1002 2255 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_16610 2796 2314 gene locus_tag LOCUS_16620 2796 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 3372 2878 gene locus_tag LOCUS_16630 3372 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 4839 3418 gene locus_tag LOCUS_16640 4839 3418 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_16640 5027 4836 gene locus_tag LOCUS_16650 5027 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 4993 5199 gene locus_tag LOCUS_16660 4993 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 6310 5192 gene locus_tag LOCUS_16670 6310 5192 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_16670 6492 7469 gene locus_tag LOCUS_16680 gene trxB 6492 7469 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_16680 7460 8107 gene locus_tag LOCUS_16690 7460 8107 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_16690 8224 8790 gene locus_tag LOCUS_16700 8224 8790 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889422.1 protein_id gnl|my_center|LOCUS_16700 8803 9222 gene locus_tag LOCUS_16710 8803 9222 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_16710 9245 10639 gene locus_tag LOCUS_16720 9245 10639 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838082.1 protein_id gnl|my_center|LOCUS_16720 10639 11397 gene locus_tag LOCUS_16730 10639 11397 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403106.1 protein_id gnl|my_center|LOCUS_16730 11423 11818 gene locus_tag LOCUS_16740 11423 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 11834 12646 gene locus_tag LOCUS_16750 11834 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 12646 13098 gene locus_tag LOCUS_16760 12646 13098 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462646.1 protein_id gnl|my_center|LOCUS_16760 13596 13165 gene locus_tag LOCUS_16770 13596 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 13688 15229 gene locus_tag LOCUS_16780 13688 15229 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_16780 15279 15653 gene locus_tag LOCUS_16790 15279 15653 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405056.1 protein_id gnl|my_center|LOCUS_16790 15963 18395 gene locus_tag LOCUS_16800 gene priA 15963 18395 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405449.1 protein_id gnl|my_center|LOCUS_16800 18548 20485 gene locus_tag LOCUS_16810 18548 20485 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_16810 20486 21451 gene locus_tag LOCUS_16820 20486 21451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 21798 22541 gene locus_tag LOCUS_16830 21798 22541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 22541 23380 gene locus_tag LOCUS_16840 22541 23380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 23390 24265 gene locus_tag LOCUS_16850 23390 24265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 24327 24336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26756 24354 gene locus_tag LOCUS_16860 26756 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 27929 26952 gene locus_tag LOCUS_16870 27929 26952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 28175 30658 gene locus_tag LOCUS_16880 28175 30658 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_16880 30725 33925 gene locus_tag LOCUS_16890 30725 33925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_16890 36425 34146 gene locus_tag LOCUS_16900 36425 34146 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_16900 37427 36621 gene locus_tag LOCUS_16910 gene murI 37427 36621 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223465.1 protein_id gnl|my_center|LOCUS_16910 37638 39659 gene locus_tag LOCUS_16920 gene pqqU 37638 39659 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096489.1 protein_id gnl|my_center|LOCUS_16920 40161 39694 gene locus_tag LOCUS_16930 40161 39694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 44354 40200 gene locus_tag LOCUS_16940 44354 40200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 44619 44996 gene locus_tag LOCUS_16950 44619 44996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 45896 45141 gene locus_tag LOCUS_16960 45896 45141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 46070 46495 gene locus_tag LOCUS_16970 46070 46495 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_16970 47026 46517 gene locus_tag LOCUS_16980 47026 46517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 49035 47068 gene locus_tag LOCUS_16990 49035 47068 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_16990 49330 50439 gene locus_tag LOCUS_17000 49330 50439 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_17000 51782 50421 gene locus_tag LOCUS_17010 gene lysC 51782 50421 CDS product lysine-sensitive aspartokinase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931789.1 protein_id gnl|my_center|LOCUS_17010 51903 53138 gene locus_tag LOCUS_17020 51903 53138 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_17020 54327 53164 gene locus_tag LOCUS_17030 gene lysA 54327 53164 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_17030 56180 54327 gene locus_tag LOCUS_17040 56180 54327 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_17040 57516 56257 gene locus_tag LOCUS_17050 gene hisS 57516 56257 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403603.1 protein_id gnl|my_center|LOCUS_17050 57633 58118 gene locus_tag LOCUS_17060 57633 58118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 58174 58470 gene locus_tag LOCUS_17070 58174 58470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 58443 58452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58589 58861 gene locus_tag LOCUS_17080 58589 58861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 58858 59937 gene locus_tag LOCUS_17090 58858 59937 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202147.1 protein_id gnl|my_center|LOCUS_17090 59937 60872 gene locus_tag LOCUS_17100 59937 60872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 60878 61360 gene locus_tag LOCUS_17110 60878 61360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 61420 62400 gene locus_tag LOCUS_17120 61420 62400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 62418 63578 gene locus_tag LOCUS_17130 62418 63578 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208048.1 protein_id gnl|my_center|LOCUS_17130 64509 63592 gene locus_tag LOCUS_17140 64509 63592 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 protein_id gnl|my_center|LOCUS_17140 65447 64506 gene locus_tag LOCUS_17150 65447 64506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 66744 65434 gene locus_tag LOCUS_17160 66744 65434 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_17160 68051 66741 gene locus_tag LOCUS_17170 68051 66741 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_17170 70521 68044 gene locus_tag LOCUS_17180 70521 68044 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838538.1 protein_id gnl|my_center|LOCUS_17180 70812 70525 gene locus_tag LOCUS_17190 gene gatC 70812 70525 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_17190 70954 71226 gene locus_tag LOCUS_17200 70954 71226 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_17200 71219 72514 gene locus_tag LOCUS_17210 71219 72514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 72490 72499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 72511 72942 gene locus_tag LOCUS_17220 72511 72942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17220 72943 73992 gene locus_tag LOCUS_17230 72943 73992 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_17230 74013 74792 gene locus_tag LOCUS_17240 74013 74792 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_17240 74785 76092 gene locus_tag LOCUS_17250 gene tilS 74785 76092 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_17250 76089 76655 gene locus_tag LOCUS_17260 gene hpt 76089 76655 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_17260 76708 76797 gene locus_tag LOCUS_t00140 76708 76797 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 76856 77434 gene locus_tag LOCUS_17270 76856 77434 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_17270 77590 78264 gene locus_tag LOCUS_17280 77590 78264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 79051 78317 gene locus_tag LOCUS_17290 79051 78317 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_17290 79971 79048 gene locus_tag LOCUS_17300 79971 79048 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_17300 80176 81312 gene locus_tag LOCUS_17310 80176 81312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404253.1 protein_id gnl|my_center|LOCUS_17310 81758 81336 gene locus_tag LOCUS_17320 81758 81336 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_17320 82148 83683 gene locus_tag LOCUS_17330 82148 83683 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_17330 83732 84559 gene locus_tag LOCUS_17340 83732 84559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 84809 84600 gene locus_tag LOCUS_17350 84809 84600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 88253 85185 gene locus_tag LOCUS_17360 88253 85185 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864285.1 protein_id gnl|my_center|LOCUS_17360 88901 88422 gene locus_tag LOCUS_17370 88901 88422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 89378 88920 gene locus_tag LOCUS_17380 89378 88920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 90727 89435 gene locus_tag LOCUS_17390 90727 89435 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_17390 91077 90727 gene locus_tag LOCUS_17400 91077 90727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 91461 93281 gene locus_tag LOCUS_17410 gene typA 91461 93281 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183842.1 protein_id gnl|my_center|LOCUS_17410 93589 93314 gene locus_tag LOCUS_17420 93589 93314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 95929 93860 gene locus_tag LOCUS_17430 gene recG 95929 93860 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_17430 96190 96495 gene locus_tag LOCUS_17440 gene rpsL 96190 96495 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_17440 96521 96988 gene locus_tag LOCUS_17450 gene rpsG 96521 96988 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403791.1 protein_id gnl|my_center|LOCUS_17450 97007 99145 gene locus_tag LOCUS_17460 gene fusA 97007 99145 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403792.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence14 1482 895 gene locus_tag LOCUS_17470 1482 895 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764211.1 protein_id gnl|my_center|LOCUS_17470 2472 1579 gene locus_tag LOCUS_17480 gene ygiD 2472 1579 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184346.1 protein_id gnl|my_center|LOCUS_17480 2886 2479 gene locus_tag LOCUS_17490 2886 2479 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093947400.1 protein_id gnl|my_center|LOCUS_17490 3772 2891 gene locus_tag LOCUS_17500 3772 2891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206307.1 protein_id gnl|my_center|LOCUS_17500 3902 4291 gene locus_tag LOCUS_17510 3902 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 5384 4824 gene locus_tag LOCUS_17520 5384 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6253 5402 gene locus_tag LOCUS_17530 gene ygiD 6253 5402 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184346.1 protein_id gnl|my_center|LOCUS_17530 6641 6258 gene locus_tag LOCUS_17540 6641 6258 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922498.1 protein_id gnl|my_center|LOCUS_17540 7125 6670 gene locus_tag LOCUS_17550 7125 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 7502 7134 gene locus_tag LOCUS_17560 7502 7134 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_17560 7860 7594 gene locus_tag LOCUS_17570 7860 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 8530 9231 gene locus_tag LOCUS_17580 8530 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 9882 9208 gene locus_tag LOCUS_17590 9882 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 10093 9851 gene locus_tag LOCUS_17600 10093 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10450 11292 gene locus_tag LOCUS_17610 10450 11292 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_17610 12242 11289 gene locus_tag LOCUS_17620 12242 11289 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404262.1 protein_id gnl|my_center|LOCUS_17620 13260 12244 gene locus_tag LOCUS_17630 13260 12244 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404261.1 protein_id gnl|my_center|LOCUS_17630 13484 14407 gene locus_tag LOCUS_17640 13484 14407 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_17640 14469 15953 gene locus_tag LOCUS_17650 gene accC 14469 15953 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_17650 15963 16883 gene locus_tag LOCUS_17660 gene murQ 15963 16883 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_17660 16888 17613 gene locus_tag LOCUS_17670 16888 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 17610 18287 gene locus_tag LOCUS_17680 17610 18287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 18345 18433 gene locus_tag LOCUS_t00150 18345 18433 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18941 21160 gene locus_tag LOCUS_17690 18941 21160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 20669 20678 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21171 22676 gene locus_tag LOCUS_17700 21171 22676 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404084.1 protein_id gnl|my_center|LOCUS_17700 23828 22737 gene locus_tag LOCUS_17710 23828 22737 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838662.1 protein_id gnl|my_center|LOCUS_17710 24456 23830 gene locus_tag LOCUS_17720 gene pncA 24456 23830 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_17720 25861 24458 gene locus_tag LOCUS_17730 25861 24458 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957965.1 protein_id gnl|my_center|LOCUS_17730 25989 26840 gene locus_tag LOCUS_17740 25989 26840 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_17740 26931 28001 gene locus_tag LOCUS_17750 26931 28001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 28683 28072 gene locus_tag LOCUS_17760 gene lpoB 28683 28072 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750164.1 protein_id gnl|my_center|LOCUS_17760 30009 28714 gene locus_tag LOCUS_17770 30009 28714 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_17770 30176 31765 gene locus_tag LOCUS_17780 30176 31765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 31765 32640 gene locus_tag LOCUS_17790 31765 32640 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755895.1 protein_id gnl|my_center|LOCUS_17790 32637 33197 gene locus_tag LOCUS_17800 32637 33197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 33536 33303 gene locus_tag LOCUS_17810 33536 33303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 33767 33612 gene locus_tag LOCUS_17820 33767 33612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 33906 34214 gene locus_tag LOCUS_17830 33906 34214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 34327 34683 gene locus_tag LOCUS_17840 34327 34683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 34872 38342 gene locus_tag LOCUS_17850 34872 38342 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839103.1 protein_id gnl|my_center|LOCUS_17850 39004 38588 gene locus_tag LOCUS_17860 39004 38588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 39717 39274 gene locus_tag LOCUS_17870 39717 39274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 40357 39785 gene locus_tag LOCUS_17880 40357 39785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 40428 41672 gene locus_tag LOCUS_17890 40428 41672 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_17890 41715 42569 gene locus_tag LOCUS_17900 41715 42569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 43105 42578 gene locus_tag LOCUS_17910 43105 42578 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922026.1 protein_id gnl|my_center|LOCUS_17910 43739 43185 gene locus_tag LOCUS_17920 43739 43185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 45298 43817 gene locus_tag LOCUS_17930 45298 43817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 45894 45388 gene locus_tag LOCUS_17940 45894 45388 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036141.1 protein_id gnl|my_center|LOCUS_17940 46365 45901 gene locus_tag LOCUS_17950 46365 45901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 46820 46500 gene locus_tag LOCUS_17960 46820 46500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 47464 46874 gene locus_tag LOCUS_17970 47464 46874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 48020 47535 gene locus_tag LOCUS_17980 48020 47535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 48148 49302 gene locus_tag LOCUS_17990 48148 49302 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_17990 49305 50237 gene locus_tag LOCUS_18000 49305 50237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 50234 51421 gene locus_tag LOCUS_18010 50234 51421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 51424 53013 gene locus_tag LOCUS_18020 gene pelF 51424 53013 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_18020 53003 54631 gene locus_tag LOCUS_18030 53003 54631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 54641 56263 gene locus_tag LOCUS_18040 54641 56263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 56273 57127 gene locus_tag LOCUS_18050 56273 57127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 57129 59189 gene locus_tag LOCUS_18060 57129 59189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 59224 63054 gene locus_tag LOCUS_18070 59224 63054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 63076 63384 gene locus_tag LOCUS_18080 63076 63384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 63377 63718 gene locus_tag LOCUS_18090 63377 63718 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_18090 64570 63713 gene locus_tag LOCUS_18100 64570 63713 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_18100 65118 64573 gene locus_tag LOCUS_18110 65118 64573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 65492 65133 gene locus_tag LOCUS_18120 65492 65133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 65850 66920 gene locus_tag LOCUS_18130 gene mltG 65850 66920 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405256.1 protein_id gnl|my_center|LOCUS_18130 68646 66934 gene locus_tag LOCUS_18140 68646 66934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 70249 68702 gene locus_tag LOCUS_18150 gene guaA 70249 68702 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404803.1 protein_id gnl|my_center|LOCUS_18150 70645 70265 gene locus_tag LOCUS_18160 gene gcvH 70645 70265 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831963.1 protein_id gnl|my_center|LOCUS_18160 71997 70642 gene locus_tag LOCUS_18170 gene accC 71997 70642 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_18170 72489 72007 gene locus_tag LOCUS_18180 gene accB 72489 72007 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110495.1 protein_id gnl|my_center|LOCUS_18180 73065 72496 gene locus_tag LOCUS_18190 gene efp 73065 72496 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766998.1 protein_id gnl|my_center|LOCUS_18190 74475 73129 gene locus_tag LOCUS_18200 74475 73129 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014164074.1 protein_id gnl|my_center|LOCUS_18200 76521 74524 gene locus_tag LOCUS_18210 76521 74524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 78551 76518 gene locus_tag LOCUS_18220 gene metG 78551 76518 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404304.1 protein_id gnl|my_center|LOCUS_18220 78706 80247 gene locus_tag LOCUS_18230 78706 80247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 80257 81873 gene locus_tag LOCUS_18240 80257 81873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 83555 81990 gene locus_tag LOCUS_18250 83555 81990 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205766.1 protein_id gnl|my_center|LOCUS_18250 84578 83796 gene locus_tag LOCUS_18260 84578 83796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 86027 84885 gene locus_tag LOCUS_18270 86027 84885 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_18270 86516 86088 gene locus_tag LOCUS_18280 86516 86088 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404934.1 protein_id gnl|my_center|LOCUS_18280 86609 87037 gene locus_tag LOCUS_18290 86609 87037 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403693.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence15 1343 597 gene locus_tag LOCUS_18300 1343 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1446 2153 gene locus_tag LOCUS_18310 1446 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2146 3465 gene locus_tag LOCUS_18320 2146 3465 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838492.1 protein_id gnl|my_center|LOCUS_18320 3625 4860 gene locus_tag LOCUS_18330 3625 4860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 7302 4987 gene locus_tag LOCUS_18340 gene pbpC 7302 4987 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992445.1 protein_id gnl|my_center|LOCUS_18340 13066 7517 gene locus_tag LOCUS_18350 13066 7517 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_18350 13321 15030 gene locus_tag LOCUS_18360 13321 15030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 15803 15345 gene locus_tag LOCUS_18370 15803 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 16209 17819 gene locus_tag LOCUS_18380 16209 17819 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730646.1 protein_id gnl|my_center|LOCUS_18380 17868 19778 gene locus_tag LOCUS_18390 17868 19778 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_18390 19782 20609 gene locus_tag LOCUS_18400 19782 20609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 21126 20671 gene locus_tag LOCUS_18410 21126 20671 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_18410 21766 21218 gene locus_tag LOCUS_18420 21766 21218 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369089.1 protein_id gnl|my_center|LOCUS_18420 22908 22009 gene locus_tag LOCUS_18430 22908 22009 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423226.1 protein_id gnl|my_center|LOCUS_18430 22973 24535 gene locus_tag LOCUS_18440 gene hutH 22973 24535 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838340.1 protein_id gnl|my_center|LOCUS_18440 24513 26183 gene locus_tag LOCUS_18450 24513 26183 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704355.1 protein_id gnl|my_center|LOCUS_18450 26348 26656 gene locus_tag LOCUS_18460 26348 26656 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_18460 26657 27895 gene locus_tag LOCUS_18470 gene hutI 26657 27895 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483557.1 protein_id gnl|my_center|LOCUS_18470 27885 28865 gene locus_tag LOCUS_18480 gene hutG 27885 28865 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113438.1 protein_id gnl|my_center|LOCUS_18480 30221 29262 gene locus_tag LOCUS_18490 30221 29262 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216609.1 protein_id gnl|my_center|LOCUS_18490 30832 30245 gene locus_tag LOCUS_18500 30832 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 31276 30944 gene locus_tag LOCUS_18510 31276 30944 CDS product TraR/DksA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_18510 31343 33355 gene locus_tag LOCUS_18520 31343 33355 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868463.1 protein_id gnl|my_center|LOCUS_18520 33649 35910 gene locus_tag LOCUS_18530 33649 35910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 36064 38304 gene locus_tag LOCUS_18540 36064 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 38289 38465 gene locus_tag LOCUS_18550 38289 38465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 38462 40699 gene locus_tag LOCUS_18560 38462 40699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 40672 40860 gene locus_tag LOCUS_18570 40672 40860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 40857 43088 gene locus_tag LOCUS_18580 40857 43088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 43073 43249 gene locus_tag LOCUS_18590 43073 43249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 43246 45498 gene locus_tag LOCUS_18600 43246 45498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 45480 45659 gene locus_tag LOCUS_18610 45480 45659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 45656 47899 gene locus_tag LOCUS_18620 45656 47899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 47884 48060 gene locus_tag LOCUS_18630 47884 48060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 48105 48425 gene locus_tag LOCUS_18640 48105 48425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 48579 50624 gene locus_tag LOCUS_18650 48579 50624 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839774.1 protein_id gnl|my_center|LOCUS_18650 52212 50788 gene locus_tag LOCUS_18660 52212 50788 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405517.1 protein_id gnl|my_center|LOCUS_18660 52409 55066 gene locus_tag LOCUS_18670 52409 55066 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_18670 55712 55236 gene locus_tag LOCUS_18680 55712 55236 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_18680 55866 57560 gene locus_tag LOCUS_18690 55866 57560 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118829520.1 protein_id gnl|my_center|LOCUS_18690 58732 58022 gene locus_tag LOCUS_18700 58732 58022 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403572.1 protein_id gnl|my_center|LOCUS_18700 58762 60153 gene locus_tag LOCUS_18710 gene mnmE 58762 60153 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402842.1 protein_id gnl|my_center|LOCUS_18710 60611 60213 gene locus_tag LOCUS_18720 60611 60213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 60707 61630 gene locus_tag LOCUS_18730 60707 61630 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_18730 61825 62481 gene locus_tag LOCUS_18740 61825 62481 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464880.1 protein_id gnl|my_center|LOCUS_18740 62497 63411 gene locus_tag LOCUS_18750 62497 63411 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838741.1 protein_id gnl|my_center|LOCUS_18750 68300 63759 gene locus_tag LOCUS_18760 68300 63759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 70234 68300 gene locus_tag LOCUS_18770 70234 68300 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840112.1 protein_id gnl|my_center|LOCUS_18770 70383 71633 gene locus_tag LOCUS_18780 70383 71633 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261016.1 protein_id gnl|my_center|LOCUS_18780 71673 72131 gene locus_tag LOCUS_18790 71673 72131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 72269 72853 gene locus_tag LOCUS_18800 72269 72853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 72859 73311 gene locus_tag LOCUS_18810 72859 73311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 74082 73579 gene locus_tag LOCUS_18820 74082 73579 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197050165.1 protein_id gnl|my_center|LOCUS_18820 74259 75131 gene locus_tag LOCUS_18830 74259 75131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 75138 75800 gene locus_tag LOCUS_18840 75138 75800 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_18840 75793 76176 gene locus_tag LOCUS_18850 75793 76176 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494334.1 protein_id gnl|my_center|LOCUS_18850 76173 76514 gene locus_tag LOCUS_18860 76173 76514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 76511 76792 gene locus_tag LOCUS_18870 76511 76792 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887568.1 protein_id gnl|my_center|LOCUS_18870 77925 76804 gene locus_tag LOCUS_18880 77925 76804 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 78136 77963 gene locus_tag LOCUS_18890 78136 77963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18890 79171 78305 gene locus_tag LOCUS_18900 79171 78305 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_18900 79253 80761 gene locus_tag LOCUS_18910 79253 80761 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_18910 81316 81843 gene locus_tag LOCUS_18920 81316 81843 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_18920 81930 83672 gene locus_tag LOCUS_18930 81930 83672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence16 726 85 gene locus_tag LOCUS_18940 726 85 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_18940 2025 736 gene locus_tag LOCUS_18950 2025 736 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_18950 3014 2025 gene locus_tag LOCUS_18960 gene pfkA 3014 2025 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838402.1 protein_id gnl|my_center|LOCUS_18960 3117 4136 gene locus_tag LOCUS_18970 3117 4136 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_18970 4142 4921 gene locus_tag LOCUS_18980 4142 4921 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_18980 4918 7266 gene locus_tag LOCUS_18990 4918 7266 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403457.1 protein_id gnl|my_center|LOCUS_18990 9071 7686 gene locus_tag LOCUS_19000 gene xylE 9071 7686 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 protein_id gnl|my_center|LOCUS_19000 9434 9177 gene locus_tag LOCUS_19010 9434 9177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 10937 9444 gene locus_tag LOCUS_19020 gene atpD 10937 9444 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_19020 11660 14443 gene locus_tag LOCUS_19030 11660 14443 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_19030 14522 15022 gene locus_tag LOCUS_19040 14522 15022 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_19040 15112 16848 gene locus_tag LOCUS_19050 15112 16848 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_19050 17973 16849 gene locus_tag LOCUS_19060 gene dprA 17973 16849 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_19060 18946 17951 gene locus_tag LOCUS_19070 gene obgE 18946 17951 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_19070 19884 19039 gene locus_tag LOCUS_19080 gene accD 19884 19039 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_19080 20620 19949 gene locus_tag LOCUS_19090 20620 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 22031 20751 gene locus_tag LOCUS_19100 22031 20751 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_19100 22675 22328 gene locus_tag LOCUS_19110 gene tnpA 22675 22328 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_19110 22880 23203 gene locus_tag LOCUS_19120 22880 23203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 23206 23538 gene locus_tag LOCUS_19130 23206 23538 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_19130 23541 24197 gene locus_tag LOCUS_19140 23541 24197 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_19140 24760 26142 gene locus_tag LOCUS_19150 gene mgtE 24760 26142 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_19150 26158 27006 gene locus_tag LOCUS_19160 26158 27006 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_19160 27003 27470 gene locus_tag LOCUS_19170 gene folA 27003 27470 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073447.1 protein_id gnl|my_center|LOCUS_19170 28116 27559 gene locus_tag LOCUS_19180 28116 27559 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_19180 28218 28895 gene locus_tag LOCUS_19190 28218 28895 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062803978.1 protein_id gnl|my_center|LOCUS_19190 30144 29092 gene locus_tag LOCUS_19200 30144 29092 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346242.1 protein_id gnl|my_center|LOCUS_19200 30508 30236 gene locus_tag LOCUS_19210 30508 30236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 30761 30396 gene locus_tag LOCUS_19220 30761 30396 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035971.1 protein_id gnl|my_center|LOCUS_19220 32028 30907 gene locus_tag LOCUS_19230 32028 30907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 32639 32223 gene locus_tag LOCUS_19240 32639 32223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 33626 32946 gene locus_tag LOCUS_19250 33626 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 34263 33652 gene locus_tag LOCUS_19260 34263 33652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 35322 34399 gene locus_tag LOCUS_19270 35322 34399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 36165 35524 gene locus_tag LOCUS_19280 36165 35524 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_19280 36806 36162 gene locus_tag LOCUS_19290 36806 36162 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_19290 37292 36825 gene locus_tag LOCUS_19300 37292 36825 CDS product DUF6428 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_19300 37652 37317 gene locus_tag LOCUS_19310 37652 37317 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_19310 37815 39107 gene locus_tag LOCUS_19320 gene purB 37815 39107 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733238.1 protein_id gnl|my_center|LOCUS_19320 39316 40383 gene locus_tag LOCUS_19330 gene hitS 39316 40383 CDS product envelope stress sensor histidine kinase HitS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231621.1 protein_id gnl|my_center|LOCUS_19330 41883 40393 gene locus_tag LOCUS_19340 41883 40393 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989778.1 protein_id gnl|my_center|LOCUS_19340 42960 41887 gene locus_tag LOCUS_19350 42960 41887 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438474.1 protein_id gnl|my_center|LOCUS_19350 43844 42960 gene locus_tag LOCUS_19360 43844 42960 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902772.1 protein_id gnl|my_center|LOCUS_19360 44119 45129 gene locus_tag LOCUS_19370 44119 45129 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922049.1 protein_id gnl|my_center|LOCUS_19370 45228 46943 gene locus_tag LOCUS_19380 45228 46943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 46997 47641 gene locus_tag LOCUS_19390 46997 47641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 47876 49102 gene locus_tag LOCUS_19400 47876 49102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 49191 49529 gene locus_tag LOCUS_19410 49191 49529 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_19410 49608 50054 gene locus_tag LOCUS_19420 49608 50054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 50132 50383 gene locus_tag LOCUS_19430 50132 50383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 50487 51701 gene locus_tag LOCUS_19440 50487 51701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_19440 53058 51712 gene locus_tag LOCUS_19450 53058 51712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 53549 53055 gene locus_tag LOCUS_19460 53549 53055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 54070 53546 gene locus_tag LOCUS_19470 54070 53546 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931266.1 protein_id gnl|my_center|LOCUS_19470 54543 54172 gene locus_tag LOCUS_19480 54543 54172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 54730 55326 gene locus_tag LOCUS_19490 54730 55326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 55644 55366 gene locus_tag LOCUS_19500 55644 55366 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025680.1 protein_id gnl|my_center|LOCUS_19500 55691 56548 gene locus_tag LOCUS_19510 55691 56548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 57059 56550 gene locus_tag LOCUS_19520 57059 56550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 57892 57056 gene locus_tag LOCUS_19530 57892 57056 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962642.1 protein_id gnl|my_center|LOCUS_19530 58710 57889 gene locus_tag LOCUS_19540 gene menH 58710 57889 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869224.1 protein_id gnl|my_center|LOCUS_19540 60421 58700 gene locus_tag LOCUS_19550 gene menD 60421 58700 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229050.1 protein_id gnl|my_center|LOCUS_19550 61877 60408 gene locus_tag LOCUS_19560 61877 60408 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259490.1 protein_id gnl|my_center|LOCUS_19560 62269 61994 gene locus_tag LOCUS_19570 62269 61994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 62399 62599 gene locus_tag LOCUS_19580 62399 62599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 62813 63796 gene locus_tag LOCUS_19590 62813 63796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19590 63803 64123 gene locus_tag LOCUS_19600 63803 64123 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_19600 65206 64124 gene locus_tag LOCUS_19610 65206 64124 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838596.1 protein_id gnl|my_center|LOCUS_19610 66524 65199 gene locus_tag LOCUS_19620 66524 65199 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404815.1 protein_id gnl|my_center|LOCUS_19620 66886 74040 gene locus_tag LOCUS_19630 gene sprA 66886 74040 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405265.1 protein_id gnl|my_center|LOCUS_19630 74891 74124 gene locus_tag LOCUS_19640 74891 74124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 75810 75169 gene locus_tag LOCUS_19650 75810 75169 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856201.1 protein_id gnl|my_center|LOCUS_19650 77415 75865 gene locus_tag LOCUS_19660 gene lnt 77415 75865 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_19660 78209 77526 gene locus_tag LOCUS_19670 gene rsmI 78209 77526 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404816.1 protein_id gnl|my_center|LOCUS_19670 78311 78694 gene locus_tag LOCUS_19680 78311 78694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 79953 81452 gene locus_tag LOCUS_19690 79953 81452 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036501.1 protein_id gnl|my_center|LOCUS_19690 81546 82253 gene locus_tag LOCUS_19700 81546 82253 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065753.1 protein_id gnl|my_center|LOCUS_19700 82427 82804 gene locus_tag LOCUS_19710 82427 82804 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence17 155 775 gene locus_tag LOCUS_19720 155 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 784 1488 gene locus_tag LOCUS_19730 784 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 3478 1571 gene locus_tag LOCUS_19740 3478 1571 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839403.1 protein_id gnl|my_center|LOCUS_19740 4979 3570 gene locus_tag LOCUS_19750 gene hslU 4979 3570 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404390.1 protein_id gnl|my_center|LOCUS_19750 5528 4980 gene locus_tag LOCUS_19760 gene hslV 5528 4980 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062117.1 protein_id gnl|my_center|LOCUS_19760 7325 5592 gene locus_tag LOCUS_19770 7325 5592 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403267.1 protein_id gnl|my_center|LOCUS_19770 8108 7764 gene locus_tag LOCUS_19780 8108 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 8696 8151 gene locus_tag LOCUS_19790 8696 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 9014 8763 gene locus_tag LOCUS_19800 9014 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 9552 9004 gene locus_tag LOCUS_19810 9552 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 13278 10246 gene locus_tag LOCUS_19820 13278 10246 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037292.1 protein_id gnl|my_center|LOCUS_19820 16588 13280 gene locus_tag LOCUS_19830 16588 13280 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037293.1 protein_id gnl|my_center|LOCUS_19830 17651 16602 gene locus_tag LOCUS_19840 17651 16602 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_19840 18739 18005 gene locus_tag LOCUS_19850 18739 18005 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838970.1 protein_id gnl|my_center|LOCUS_19850 19255 21153 gene locus_tag LOCUS_19860 19255 21153 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_19860 21153 22199 gene locus_tag LOCUS_19870 21153 22199 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_19870 22694 26299 gene locus_tag LOCUS_19880 22694 26299 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_19880 27001 26792 gene locus_tag LOCUS_19890 27001 26792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 27522 27019 gene locus_tag LOCUS_19900 27522 27019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 27977 27525 gene locus_tag LOCUS_19910 27977 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447940.1 protein_id gnl|my_center|LOCUS_19910 28369 28016 gene locus_tag LOCUS_19920 28369 28016 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528790.1 protein_id gnl|my_center|LOCUS_19920 28812 28411 gene locus_tag LOCUS_19930 28812 28411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 29279 28860 gene locus_tag LOCUS_19940 29279 28860 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_19940 29883 29308 gene locus_tag LOCUS_19950 29883 29308 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_19950 30042 31025 gene locus_tag LOCUS_19960 30042 31025 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_19960 31720 31040 gene locus_tag LOCUS_19970 31720 31040 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_19970 31844 32224 gene locus_tag LOCUS_19980 31844 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 34482 32278 gene locus_tag LOCUS_19990 34482 32278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 35701 34652 gene locus_tag LOCUS_20000 35701 34652 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877125.1 protein_id gnl|my_center|LOCUS_20000 35748 35757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36560 35931 gene locus_tag LOCUS_20010 36560 35931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 36466 36672 gene locus_tag LOCUS_20020 36466 36672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 36832 37098 gene locus_tag LOCUS_20030 36832 37098 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_20030 37098 38861 gene locus_tag LOCUS_20040 37098 38861 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_20040 38869 39390 gene locus_tag LOCUS_20050 38869 39390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 39590 42820 gene locus_tag LOCUS_20060 39590 42820 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201854.1 protein_id gnl|my_center|LOCUS_20060 43150 46068 gene locus_tag LOCUS_20070 43150 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 46069 46452 gene locus_tag LOCUS_20080 46069 46452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 46527 47633 gene locus_tag LOCUS_20090 46527 47633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20090 47595 47604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 47615 48265 gene locus_tag LOCUS_20100 47615 48265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20100 48368 50356 gene locus_tag LOCUS_20110 48368 50356 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838057.1 protein_id gnl|my_center|LOCUS_20110 50359 51999 gene locus_tag LOCUS_20120 50359 51999 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_20120 51999 52850 gene locus_tag LOCUS_20130 51999 52850 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_20130 52852 53322 gene locus_tag LOCUS_20140 gene ribE 52852 53322 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073313.1 protein_id gnl|my_center|LOCUS_20140 53393 54223 gene locus_tag LOCUS_20150 53393 54223 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839293.1 protein_id gnl|my_center|LOCUS_20150 54220 56712 gene locus_tag LOCUS_20160 gene bamA 54220 56712 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404583.1 protein_id gnl|my_center|LOCUS_20160 56712 57248 gene locus_tag LOCUS_20170 56712 57248 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_20170 57272 57790 gene locus_tag LOCUS_20180 57272 57790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 57801 58343 gene locus_tag LOCUS_20190 57801 58343 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_20190 59504 58395 gene locus_tag LOCUS_20200 59504 58395 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_20200 59578 60198 gene locus_tag LOCUS_20210 59578 60198 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405090.1 protein_id gnl|my_center|LOCUS_20210 61445 60195 gene locus_tag LOCUS_20220 gene rodA 61445 60195 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405102.1 protein_id gnl|my_center|LOCUS_20220 63280 61442 gene locus_tag LOCUS_20230 gene mrdA 63280 61442 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405101.1 protein_id gnl|my_center|LOCUS_20230 63756 63280 gene locus_tag LOCUS_20240 63756 63280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 64595 63753 gene locus_tag LOCUS_20250 gene mreC 64595 63753 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099559.1 protein_id gnl|my_center|LOCUS_20250 65672 64608 gene locus_tag LOCUS_20260 65672 64608 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_20260 67327 65756 gene locus_tag LOCUS_20270 gene purH 67327 65756 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404385.1 protein_id gnl|my_center|LOCUS_20270 67967 67332 gene locus_tag LOCUS_20280 gene purN 67967 67332 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_20280 69087 67999 gene locus_tag LOCUS_20290 69087 67999 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_20290 69767 69084 gene locus_tag LOCUS_20300 69767 69084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 70891 69830 gene locus_tag LOCUS_20310 gene recA 70891 69830 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_20310 71236 71051 gene locus_tag LOCUS_20320 71236 71051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 71595 72230 gene locus_tag LOCUS_20330 71595 72230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 73420 72299 gene locus_tag LOCUS_20340 73420 72299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 74597 73410 gene locus_tag LOCUS_20350 74597 73410 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228728.1 protein_id gnl|my_center|LOCUS_20350 75338 74745 gene locus_tag LOCUS_20360 75338 74745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 76224 75445 gene locus_tag LOCUS_20370 76224 75445 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228729.1 protein_id gnl|my_center|LOCUS_20370 77368 76367 gene locus_tag LOCUS_20380 77368 76367 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_20380 77521 79647 gene locus_tag LOCUS_20390 77521 79647 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_20390 80090 79644 gene locus_tag LOCUS_20400 80090 79644 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706546.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence18 1055 351 gene locus_tag LOCUS_20410 1055 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1474 1133 gene locus_tag LOCUS_20420 1474 1133 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_20420 1719 1462 gene locus_tag LOCUS_20430 1719 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 1807 2124 gene locus_tag LOCUS_20440 1807 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 2165 3400 gene locus_tag LOCUS_20450 2165 3400 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_20450 3440 3622 gene locus_tag LOCUS_20460 3440 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 3606 3920 gene locus_tag LOCUS_20470 3606 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3966 5096 gene locus_tag LOCUS_20480 3966 5096 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229838.1 protein_id gnl|my_center|LOCUS_20480 5241 7028 gene locus_tag LOCUS_20490 gene sucB 5241 7028 CDS product 2-oxoglutarate dehydrogenase, E2 component, dihydrolipoamide succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421581.1 protein_id gnl|my_center|LOCUS_20490 7155 8006 gene locus_tag LOCUS_20500 gene panC 7155 8006 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266657.1 protein_id gnl|my_center|LOCUS_20500 8017 8436 gene locus_tag LOCUS_20510 8017 8436 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_20510 8490 10727 gene locus_tag LOCUS_20520 8490 10727 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_20520 10830 12092 gene locus_tag LOCUS_20530 10830 12092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 12102 13460 gene locus_tag LOCUS_20540 12102 13460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_20540 13453 14925 gene locus_tag LOCUS_20550 13453 14925 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_20550 15005 15925 gene locus_tag LOCUS_20560 15005 15925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 18457 15947 gene locus_tag LOCUS_20570 18457 15947 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_20570 18572 19342 gene locus_tag LOCUS_20580 18572 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 19480 21186 gene locus_tag LOCUS_20590 gene polX 19480 21186 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229538.1 protein_id gnl|my_center|LOCUS_20590 21575 21192 gene locus_tag LOCUS_20600 21575 21192 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_20600 21826 21572 gene locus_tag LOCUS_20610 21826 21572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 22845 21886 gene locus_tag LOCUS_20620 22845 21886 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_20620 24827 22962 gene locus_tag LOCUS_20630 24827 22962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 25732 24911 gene locus_tag LOCUS_20640 25732 24911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 26792 27190 gene locus_tag LOCUS_20650 gene mce 26792 27190 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_20650 27887 30400 gene locus_tag LOCUS_20660 27887 30400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 30569 30811 gene locus_tag LOCUS_20670 30569 30811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 31502 31059 gene locus_tag LOCUS_20680 31502 31059 CDS product JAB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108556.1 protein_id gnl|my_center|LOCUS_20680 32265 31561 gene locus_tag LOCUS_20690 32265 31561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 32717 33478 gene locus_tag LOCUS_20700 32717 33478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 33469 33948 gene locus_tag LOCUS_20710 33469 33948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 34188 36680 gene locus_tag LOCUS_20720 34188 36680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 36842 37543 gene locus_tag LOCUS_20730 36842 37543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 37955 38191 gene locus_tag LOCUS_20740 37955 38191 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870223.1 protein_id gnl|my_center|LOCUS_20740 38204 39256 gene locus_tag LOCUS_20750 38204 39256 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062610134.1 protein_id gnl|my_center|LOCUS_20750 39269 40300 gene locus_tag LOCUS_20760 39269 40300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 40281 40718 gene locus_tag LOCUS_20770 40281 40718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 41963 40749 gene locus_tag LOCUS_20780 41963 40749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 41968 42042 gene locus_tag LOCUS_t00160 41968 42042 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42209 42706 gene locus_tag LOCUS_20790 42209 42706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 42873 43196 gene locus_tag LOCUS_20800 42873 43196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 43330 43899 gene locus_tag LOCUS_20810 gene frr 43330 43899 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402821.1 protein_id gnl|my_center|LOCUS_20810 44004 47528 gene locus_tag LOCUS_20820 gene smc 44004 47528 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933370.1 protein_id gnl|my_center|LOCUS_20820 48709 49257 gene locus_tag LOCUS_20830 48709 49257 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207309.1 protein_id gnl|my_center|LOCUS_20830 49324 50463 gene locus_tag LOCUS_20840 gene hemW 49324 50463 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_20840 51599 50460 gene locus_tag LOCUS_20850 51599 50460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 51880 51596 gene locus_tag LOCUS_20860 51880 51596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 52170 53033 gene locus_tag LOCUS_20870 52170 53033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 55870 53087 gene locus_tag LOCUS_20880 55870 53087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 56071 57330 gene locus_tag LOCUS_20890 gene fahA 56071 57330 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_20890 58068 57871 gene locus_tag LOCUS_20900 58068 57871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 58215 58400 gene locus_tag LOCUS_20910 58215 58400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 60549 58867 gene locus_tag LOCUS_20920 60549 58867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 60684 61649 gene locus_tag LOCUS_20930 60684 61649 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246230.1 protein_id gnl|my_center|LOCUS_20930 61732 62511 gene locus_tag LOCUS_20940 61732 62511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 62559 63188 gene locus_tag LOCUS_20950 62559 63188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 64646 63552 gene locus_tag LOCUS_20960 64646 63552 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387767.1 protein_id gnl|my_center|LOCUS_20960 64983 64651 gene locus_tag LOCUS_20970 64983 64651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 65300 65028 gene locus_tag LOCUS_20980 65300 65028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 66163 65309 gene locus_tag LOCUS_20990 66163 65309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 68037 66166 gene locus_tag LOCUS_21000 68037 66166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 68369 68040 gene locus_tag LOCUS_21010 68369 68040 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_21010 69062 68679 gene locus_tag LOCUS_21020 69062 68679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 71457 70333 gene locus_tag LOCUS_21030 gene metK 71457 70333 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405459.1 protein_id gnl|my_center|LOCUS_21030 72550 71534 gene locus_tag LOCUS_21040 gene ruvB 72550 71534 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403900.1 protein_id gnl|my_center|LOCUS_21040 72637 74877 gene locus_tag LOCUS_21050 gene ppk1 72637 74877 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_21050 75683 74874 gene locus_tag LOCUS_21060 75683 74874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 76310 75765 gene locus_tag LOCUS_21070 76310 75765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 76400 77143 gene locus_tag LOCUS_21080 76400 77143 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_21080 >Feature sequence19 98 1075 gene locus_tag LOCUS_21090 98 1075 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_21090 1414 1716 gene locus_tag LOCUS_21100 1414 1716 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234907.1 protein_id gnl|my_center|LOCUS_21100 1761 2036 gene locus_tag LOCUS_21110 1761 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 2041 2643 gene locus_tag LOCUS_21120 2041 2643 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_21120 2810 3184 gene locus_tag LOCUS_21130 2810 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3757 3338 gene locus_tag LOCUS_21140 3757 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3850 5019 gene locus_tag LOCUS_21150 gene hpxO 3850 5019 CDS product FAD-dependent urate hydroxylase HpxO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_21150 5108 6079 gene locus_tag LOCUS_21160 5108 6079 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_21160 6227 6802 gene locus_tag LOCUS_21170 6227 6802 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_21170 6829 7863 gene locus_tag LOCUS_21180 6829 7863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 7885 8895 gene locus_tag LOCUS_21190 7885 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 9412 9041 gene locus_tag LOCUS_21200 9412 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 11140 9428 gene locus_tag LOCUS_21210 11140 9428 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_21210 12420 11146 gene locus_tag LOCUS_21220 12420 11146 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_21220 13283 12504 gene locus_tag LOCUS_21230 13283 12504 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025568069.1 protein_id gnl|my_center|LOCUS_21230 14174 13287 gene locus_tag LOCUS_21240 14174 13287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 14650 14174 gene locus_tag LOCUS_21250 14650 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 15405 14662 gene locus_tag LOCUS_21260 15405 14662 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403918.1 protein_id gnl|my_center|LOCUS_21260 16822 15479 gene locus_tag LOCUS_21270 16822 15479 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_21270 16860 17681 gene locus_tag LOCUS_21280 16860 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 17707 18828 gene locus_tag LOCUS_21290 gene pdxB 17707 18828 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_21290 19195 18818 gene locus_tag LOCUS_21300 19195 18818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072486.1 protein_id gnl|my_center|LOCUS_21300 20686 19196 gene locus_tag LOCUS_21310 20686 19196 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402854.1 protein_id gnl|my_center|LOCUS_21310 21722 20703 gene locus_tag LOCUS_21320 gene murB 21722 20703 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_21320 23113 21728 gene locus_tag LOCUS_21330 23113 21728 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_21330 23681 23223 gene locus_tag LOCUS_21340 23681 23223 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_21340 25714 23798 gene locus_tag LOCUS_21350 25714 23798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 27681 25711 gene locus_tag LOCUS_21360 27681 25711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 29805 27808 gene locus_tag LOCUS_21370 29805 27808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 30178 31788 gene locus_tag LOCUS_21380 30178 31788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 31812 33440 gene locus_tag LOCUS_21390 31812 33440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 33447 34490 gene locus_tag LOCUS_21400 33447 34490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21400 34494 35558 gene locus_tag LOCUS_21410 34494 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21410 35677 36267 gene locus_tag LOCUS_21420 35677 36267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 36339 37313 gene locus_tag LOCUS_21430 36339 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 37482 38414 gene locus_tag LOCUS_21440 37482 38414 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444469.1 protein_id gnl|my_center|LOCUS_21440 39046 38423 gene locus_tag LOCUS_21450 39046 38423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 39621 39187 gene locus_tag LOCUS_21460 39621 39187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 41619 39676 gene locus_tag LOCUS_21470 41619 39676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 42817 41624 gene locus_tag LOCUS_21480 42817 41624 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_21480 42983 46735 gene locus_tag LOCUS_21490 42983 46735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 46848 48008 gene locus_tag LOCUS_21500 gene nifS 46848 48008 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_21500 48005 48550 gene locus_tag LOCUS_21510 48005 48550 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_21510 48553 49011 gene locus_tag LOCUS_21520 48553 49011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 49017 49457 gene locus_tag LOCUS_21530 49017 49457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_21530 50434 49454 gene locus_tag LOCUS_21540 50434 49454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 52321 50438 gene locus_tag LOCUS_21550 52321 50438 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405097.1 protein_id gnl|my_center|LOCUS_21550 52435 52938 gene locus_tag LOCUS_21560 52435 52938 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_21560 53043 54047 gene locus_tag LOCUS_21570 53043 54047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 54970 54086 gene locus_tag LOCUS_21580 54970 54086 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839411.1 protein_id gnl|my_center|LOCUS_21580 56951 54972 gene locus_tag LOCUS_21590 56951 54972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 58264 56948 gene locus_tag LOCUS_21600 58264 56948 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404055.1 protein_id gnl|my_center|LOCUS_21600 58383 58904 gene locus_tag LOCUS_21610 gene pgsA 58383 58904 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_21610 58901 59368 gene locus_tag LOCUS_21620 58901 59368 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_21620 59422 60063 gene locus_tag LOCUS_21630 gene pyrE 59422 60063 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232105.1 protein_id gnl|my_center|LOCUS_21630 60132 61448 gene locus_tag LOCUS_21640 gene miaB 60132 61448 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_21640 61503 62834 gene locus_tag LOCUS_21650 61503 62834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 64909 63404 gene locus_tag LOCUS_21660 gene rpoN 64909 63404 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_21660 65496 64912 gene locus_tag LOCUS_21670 65496 64912 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_21670 65815 67713 gene locus_tag LOCUS_21680 65815 67713 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_21680 67727 69088 gene locus_tag LOCUS_21690 gene creD 67727 69088 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_21690 69246 70568 gene locus_tag LOCUS_21700 gene rsmB 69246 70568 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838452.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence20 952 563 gene locus_tag LOCUS_21710 gene queD 952 563 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389277.1 protein_id gnl|my_center|LOCUS_21710 1648 1040 gene locus_tag LOCUS_21720 1648 1040 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 protein_id gnl|my_center|LOCUS_21720 2021 1683 gene locus_tag LOCUS_21730 2021 1683 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831246.1 protein_id gnl|my_center|LOCUS_21730 2782 2018 gene locus_tag LOCUS_21740 2782 2018 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_21740 5324 2817 gene locus_tag LOCUS_21750 5324 2817 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402856.1 protein_id gnl|my_center|LOCUS_21750 5875 6891 gene locus_tag LOCUS_21760 5875 6891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 7610 6888 gene locus_tag LOCUS_21770 7610 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 8936 7614 gene locus_tag LOCUS_21780 8936 7614 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_21780 10208 9033 gene locus_tag LOCUS_21790 10208 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 10344 11486 gene locus_tag LOCUS_21800 10344 11486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 11467 12954 gene locus_tag LOCUS_21810 11467 12954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 13836 12985 gene locus_tag LOCUS_21820 13836 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 14396 13836 gene locus_tag LOCUS_21830 14396 13836 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840193.1 protein_id gnl|my_center|LOCUS_21830 15806 14427 gene locus_tag LOCUS_21840 15806 14427 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941480.1 protein_id gnl|my_center|LOCUS_21840 16185 15943 gene locus_tag LOCUS_21850 16185 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 16271 16186 gene locus_tag LOCUS_t00170 16271 16186 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17196 16306 gene locus_tag LOCUS_21860 17196 16306 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_21860 18816 17200 gene locus_tag LOCUS_21870 gene atpA 18816 17200 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_21870 19400 18852 gene locus_tag LOCUS_21880 19400 18852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 19925 19410 gene locus_tag LOCUS_21890 19925 19410 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_21890 20160 19939 gene locus_tag LOCUS_21900 20160 19939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 21267 20206 gene locus_tag LOCUS_21910 gene atpB 21267 20206 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838475.1 protein_id gnl|my_center|LOCUS_21910 21404 21688 gene locus_tag LOCUS_21920 21404 21688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 21853 21632 gene locus_tag LOCUS_21930 21853 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 22303 21857 gene locus_tag LOCUS_21940 22303 21857 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838472.1 protein_id gnl|my_center|LOCUS_21940 23163 22303 gene locus_tag LOCUS_21950 23163 22303 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_21950 24461 23160 gene locus_tag LOCUS_21960 24461 23160 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21960 25958 24474 gene locus_tag LOCUS_21970 gene guaB 25958 24474 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404245.1 protein_id gnl|my_center|LOCUS_21970 26078 26839 gene locus_tag LOCUS_21980 26078 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 27207 26860 gene locus_tag LOCUS_21990 27207 26860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 27729 27298 gene locus_tag LOCUS_22000 27729 27298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 27846 28385 gene locus_tag LOCUS_22010 27846 28385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 28452 28691 gene locus_tag LOCUS_22020 28452 28691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 28691 29104 gene locus_tag LOCUS_22030 28691 29104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 31874 29247 gene locus_tag LOCUS_22040 31874 29247 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404864.1 protein_id gnl|my_center|LOCUS_22040 32832 31882 gene locus_tag LOCUS_22050 32832 31882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 34527 32839 gene locus_tag LOCUS_22060 34527 32839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 35088 34555 gene locus_tag LOCUS_22070 35088 34555 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_22070 36152 35310 gene locus_tag LOCUS_22080 36152 35310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 37774 36884 gene locus_tag LOCUS_22090 gene folD 37774 36884 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_22090 39149 37776 gene locus_tag LOCUS_22100 39149 37776 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_22100 40685 39162 gene locus_tag LOCUS_22110 gene dacB 40685 39162 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_22110 41157 40687 gene locus_tag LOCUS_22120 41157 40687 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403602.1 protein_id gnl|my_center|LOCUS_22120 41277 41945 gene locus_tag LOCUS_22130 41277 41945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 41946 43130 gene locus_tag LOCUS_22140 41946 43130 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_22140 43130 43957 gene locus_tag LOCUS_22150 gene dapF 43130 43957 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_22150 43950 45239 gene locus_tag LOCUS_22160 43950 45239 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_22160 48531 45244 gene locus_tag LOCUS_22170 48531 45244 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_22170 50700 48544 gene locus_tag LOCUS_22180 gene rnr 50700 48544 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_22180 54683 50712 gene locus_tag LOCUS_22190 54683 50712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 55368 54607 gene locus_tag LOCUS_22200 55368 54607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 54646 54655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 56459 55368 gene locus_tag LOCUS_22210 gene aroB 56459 55368 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933073.1 protein_id gnl|my_center|LOCUS_22210 57015 56452 gene locus_tag LOCUS_22220 57015 56452 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933072.1 protein_id gnl|my_center|LOCUS_22220 58043 57012 gene locus_tag LOCUS_22230 58043 57012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 58603 58040 gene locus_tag LOCUS_22240 58603 58040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 58059 58068 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 58646 59299 gene locus_tag LOCUS_22250 58646 59299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 59299 59718 gene locus_tag LOCUS_22260 59299 59718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 60223 59936 gene locus_tag LOCUS_22270 60223 59936 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_22270 60390 60229 gene locus_tag LOCUS_22280 60390 60229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence21 <1 7041 gene locus_tag LOCUS_22290 <1 7041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876698.1:DUF11 domain-containing protein 7051 7446 gene locus_tag LOCUS_22300 7051 7446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7499 8236 gene locus_tag LOCUS_22310 7499 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 8239 9753 gene locus_tag LOCUS_22320 8239 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 9753 10292 gene locus_tag LOCUS_22330 9753 10292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 10374 11009 gene locus_tag LOCUS_22340 10374 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 11385 11564 gene locus_tag LOCUS_22350 11385 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11711 11923 gene locus_tag LOCUS_22360 11711 11923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 12006 12536 gene locus_tag LOCUS_22370 12006 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 12552 15467 gene locus_tag LOCUS_22380 12552 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 15535 16176 gene locus_tag LOCUS_22390 15535 16176 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_22390 16273 18255 gene locus_tag LOCUS_22400 16273 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 18319 21231 gene locus_tag LOCUS_22410 18319 21231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 21281 21910 gene locus_tag LOCUS_22420 gene yxjL 21281 21910 CDS product two-component system response regulator YxJL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243101.1 protein_id gnl|my_center|LOCUS_22420 22008 27320 gene locus_tag LOCUS_22430 22008 27320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 27371 32287 gene locus_tag LOCUS_22440 27371 32287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 32516 35035 gene locus_tag LOCUS_22450 32516 35035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 35226 39206 gene locus_tag LOCUS_22460 35226 39206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 39552 39953 gene locus_tag LOCUS_22470 39552 39953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 40085 45643 gene locus_tag LOCUS_22480 40085 45643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 45813 46517 gene locus_tag LOCUS_22490 45813 46517 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_22490 46522 47226 gene locus_tag LOCUS_22500 46522 47226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 47642 51583 gene locus_tag LOCUS_22510 47642 51583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 51592 53010 gene locus_tag LOCUS_22520 51592 53010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 53203 54573 gene locus_tag LOCUS_22530 53203 54573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 54595 55626 gene locus_tag LOCUS_22540 54595 55626 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_22540 55780 57459 gene locus_tag LOCUS_22550 55780 57459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_22550 57526 58743 gene locus_tag LOCUS_22560 57526 58743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 >Feature sequence22 1210 4830 gene locus_tag LOCUS_22570 1210 4830 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_22570 4948 5703 gene locus_tag LOCUS_22580 4948 5703 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890775.1 protein_id gnl|my_center|LOCUS_22580 8396 5799 gene locus_tag LOCUS_22590 8396 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 8585 8941 gene locus_tag LOCUS_22600 8585 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 8938 9813 gene locus_tag LOCUS_22610 8938 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 9932 11617 gene locus_tag LOCUS_22620 9932 11617 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839376.1 protein_id gnl|my_center|LOCUS_22620 11619 12995 gene locus_tag LOCUS_22630 11619 12995 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_22630 13004 14317 gene locus_tag LOCUS_22640 13004 14317 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_22640 14538 16001 gene locus_tag LOCUS_22650 14538 16001 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224909.1 protein_id gnl|my_center|LOCUS_22650 16062 16442 gene locus_tag LOCUS_22660 16062 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 16467 17804 gene locus_tag LOCUS_22670 16467 17804 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110217.1 protein_id gnl|my_center|LOCUS_22670 17825 19570 gene locus_tag LOCUS_22680 17825 19570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 19583 20968 gene locus_tag LOCUS_22690 gene hydA 19583 20968 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_22690 21032 21898 gene locus_tag LOCUS_22700 21032 21898 CDS product nitrilase-related carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084641929.1 protein_id gnl|my_center|LOCUS_22700 21949 23274 gene locus_tag LOCUS_22710 21949 23274 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969941.1 protein_id gnl|my_center|LOCUS_22710 23307 24647 gene locus_tag LOCUS_22720 gene preA 23307 24647 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530894.1 protein_id gnl|my_center|LOCUS_22720 24631 25122 gene locus_tag LOCUS_22730 24631 25122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 25313 25690 gene locus_tag LOCUS_22740 25313 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 25831 26214 gene locus_tag LOCUS_22750 25831 26214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 27606 27175 gene locus_tag LOCUS_22760 27606 27175 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_22760 29112 27814 gene locus_tag LOCUS_22770 29112 27814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_22770 31843 29144 gene locus_tag LOCUS_22780 31843 29144 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038525.1 protein_id gnl|my_center|LOCUS_22780 34116 32002 gene locus_tag LOCUS_22790 gene ftsH 34116 32002 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962764.1 protein_id gnl|my_center|LOCUS_22790 35257 34229 gene locus_tag LOCUS_22800 gene thiL 35257 34229 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_22800 35787 35332 gene locus_tag LOCUS_22810 35787 35332 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_22810 36332 35793 gene locus_tag LOCUS_22820 36332 35793 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_22820 36618 36343 gene locus_tag LOCUS_22830 36618 36343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 37374 36655 gene locus_tag LOCUS_22840 37374 36655 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_22840 40998 37543 gene locus_tag LOCUS_22850 40998 37543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840147.1 protein_id gnl|my_center|LOCUS_22850 43150 41285 gene locus_tag LOCUS_22860 43150 41285 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_22860 43749 43303 gene locus_tag LOCUS_22870 gene rplI 43749 43303 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_22870 44015 43764 gene locus_tag LOCUS_22880 gene rpsR 44015 43764 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_22880 44432 44043 gene locus_tag LOCUS_22890 gene rpsF 44432 44043 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552273.1 protein_id gnl|my_center|LOCUS_22890 46540 45110 gene locus_tag LOCUS_22900 46540 45110 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404198.1 protein_id gnl|my_center|LOCUS_22900 46831 46550 gene locus_tag LOCUS_22910 46831 46550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 48455 46839 gene locus_tag LOCUS_22920 48455 46839 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061939.1 protein_id gnl|my_center|LOCUS_22920 50493 48472 gene locus_tag LOCUS_22930 gene nuoL 50493 48472 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404195.1 protein_id gnl|my_center|LOCUS_22930 50730 52169 gene locus_tag LOCUS_22940 50730 52169 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939629.1 protein_id gnl|my_center|LOCUS_22940 52170 53333 gene locus_tag LOCUS_22950 52170 53333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 54637 53513 gene locus_tag LOCUS_22960 54637 53513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 55142 54840 gene locus_tag LOCUS_22970 gene nuoK 55142 54840 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404194.1 protein_id gnl|my_center|LOCUS_22970 55657 55148 gene locus_tag LOCUS_22980 55657 55148 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_22980 56538 55732 gene locus_tag LOCUS_22990 56538 55732 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403116.1 protein_id gnl|my_center|LOCUS_22990 56617 57618 gene locus_tag LOCUS_23000 56617 57618 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_23000 57649 57933 gene locus_tag LOCUS_23010 57649 57933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 58039 58686 gene locus_tag LOCUS_23020 58039 58686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 >Feature sequence23 120 2435 gene locus_tag LOCUS_23030 120 2435 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_23030 2435 3085 gene locus_tag LOCUS_23040 2435 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 3085 5175 gene locus_tag LOCUS_23050 3085 5175 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_23050 6303 5176 gene locus_tag LOCUS_23060 gene tgt 6303 5176 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_23060 6501 7799 gene locus_tag LOCUS_23070 6501 7799 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_23070 7796 8527 gene locus_tag LOCUS_23080 7796 8527 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404707.1 protein_id gnl|my_center|LOCUS_23080 8595 9551 gene locus_tag LOCUS_23090 8595 9551 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_23090 9551 9988 gene locus_tag LOCUS_23100 9551 9988 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405066.1 protein_id gnl|my_center|LOCUS_23100 9990 10466 gene locus_tag LOCUS_23110 9990 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 10468 11031 gene locus_tag LOCUS_23120 10468 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 11114 12073 gene locus_tag LOCUS_23130 11114 12073 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840143.1 protein_id gnl|my_center|LOCUS_23130 12066 12335 gene locus_tag LOCUS_23140 12066 12335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 12332 13153 gene locus_tag LOCUS_23150 12332 13153 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_23150 13140 14207 gene locus_tag LOCUS_23160 13140 14207 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_23160 14269 14895 gene locus_tag LOCUS_23170 14269 14895 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755401.1 protein_id gnl|my_center|LOCUS_23170 14892 15791 gene locus_tag LOCUS_23180 14892 15791 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_23180 18163 16049 gene locus_tag LOCUS_23190 18163 16049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 18378 18719 gene locus_tag LOCUS_23200 18378 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 19105 20898 gene locus_tag LOCUS_23210 19105 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 20899 21483 gene locus_tag LOCUS_23220 20899 21483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 21506 22795 gene locus_tag LOCUS_23230 gene hflX 21506 22795 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_23230 22799 23464 gene locus_tag LOCUS_23240 22799 23464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 23497 26484 gene locus_tag LOCUS_23250 23497 26484 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838961.1 protein_id gnl|my_center|LOCUS_23250 26582 27874 gene locus_tag LOCUS_23260 gene aroA 26582 27874 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403445.1 protein_id gnl|my_center|LOCUS_23260 27867 28292 gene locus_tag LOCUS_23270 27867 28292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 28602 29036 gene locus_tag LOCUS_23280 28602 29036 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_23280 29188 30687 gene locus_tag LOCUS_23290 29188 30687 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_23290 31970 30753 gene locus_tag LOCUS_23300 31970 30753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 32384 35026 gene locus_tag LOCUS_23310 gene clpB 32384 35026 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405536.1 protein_id gnl|my_center|LOCUS_23310 36124 35153 gene locus_tag LOCUS_23320 36124 35153 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_23320 37461 36130 gene locus_tag LOCUS_23330 37461 36130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 39620 37461 gene locus_tag LOCUS_23340 39620 37461 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_23340 40431 39853 gene locus_tag LOCUS_23350 40431 39853 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_23350 40696 40424 gene locus_tag LOCUS_23360 40696 40424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250157.1 protein_id gnl|my_center|LOCUS_23360 41688 40693 gene locus_tag LOCUS_23370 41688 40693 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_23370 43064 41853 gene locus_tag LOCUS_23380 43064 41853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 43272 43910 gene locus_tag LOCUS_23390 43272 43910 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_23390 45080 43977 gene locus_tag LOCUS_23400 45080 43977 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191163231.1 protein_id gnl|my_center|LOCUS_23400 46270 45083 gene locus_tag LOCUS_23410 46270 45083 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901936.1 protein_id gnl|my_center|LOCUS_23410 46383 47657 gene locus_tag LOCUS_23420 46383 47657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 47650 48426 gene locus_tag LOCUS_23430 47650 48426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 48837 48499 gene locus_tag LOCUS_23440 48837 48499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 50566 48977 gene locus_tag LOCUS_23450 gene serA 50566 48977 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_23450 51185 50589 gene locus_tag LOCUS_23460 gene yihA 51185 50589 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816879.1 protein_id gnl|my_center|LOCUS_23460 52674 51172 gene locus_tag LOCUS_23470 gene purF 52674 51172 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421582.1 protein_id gnl|my_center|LOCUS_23470 54907 52784 gene locus_tag LOCUS_23480 54907 52784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 55436 55008 gene locus_tag LOCUS_23490 55436 55008 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838707.1 protein_id gnl|my_center|LOCUS_23490 56716 55514 gene locus_tag LOCUS_23500 56716 55514 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_23500 56834 59050 gene locus_tag LOCUS_23510 gene katG 56834 59050 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence24 1498 257 gene locus_tag LOCUS_23520 1498 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2085 1516 gene locus_tag LOCUS_23530 2085 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 2302 4461 gene locus_tag LOCUS_23540 2302 4461 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296403.1 protein_id gnl|my_center|LOCUS_23540 4991 4593 gene locus_tag LOCUS_23550 4991 4593 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687278.1 protein_id gnl|my_center|LOCUS_23550 5340 6830 gene locus_tag LOCUS_23560 5340 6830 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001983276.1 protein_id gnl|my_center|LOCUS_23560 6892 7524 gene locus_tag LOCUS_23570 6892 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 7584 8018 gene locus_tag LOCUS_23580 7584 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 8171 9337 gene locus_tag LOCUS_23590 8171 9337 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870226.1 protein_id gnl|my_center|LOCUS_23590 9388 10674 gene locus_tag LOCUS_23600 9388 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 11145 10678 gene locus_tag LOCUS_23610 11145 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 11742 11245 gene locus_tag LOCUS_23620 11742 11245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 11836 12207 gene locus_tag LOCUS_23630 11836 12207 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693817.1 protein_id gnl|my_center|LOCUS_23630 12223 13023 gene locus_tag LOCUS_23640 12223 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 13020 13466 gene locus_tag LOCUS_23650 gene dut 13020 13466 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_23650 13685 13512 gene locus_tag LOCUS_23660 13685 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 14196 13777 gene locus_tag LOCUS_23670 14196 13777 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969495.1 protein_id gnl|my_center|LOCUS_23670 14302 15294 gene locus_tag LOCUS_23680 14302 15294 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978088.1 protein_id gnl|my_center|LOCUS_23680 15775 15296 gene locus_tag LOCUS_23690 15775 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 15835 16248 gene locus_tag LOCUS_23700 gene mscL 15835 16248 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_23700 16264 16623 gene locus_tag LOCUS_23710 16264 16623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 16662 17552 gene locus_tag LOCUS_23720 16662 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 17953 17615 gene locus_tag LOCUS_23730 gene hisE 17953 17615 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394955.1 protein_id gnl|my_center|LOCUS_23730 18132 18644 gene locus_tag LOCUS_23740 18132 18644 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124116.1 protein_id gnl|my_center|LOCUS_23740 18634 19212 gene locus_tag LOCUS_23750 18634 19212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 23646 19222 gene locus_tag LOCUS_23760 gene gltB 23646 19222 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_23760 24672 23914 gene locus_tag LOCUS_23770 gene hisF 24672 23914 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963102.1 protein_id gnl|my_center|LOCUS_23770 24754 25485 gene locus_tag LOCUS_23780 24754 25485 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_23780 26317 25493 gene locus_tag LOCUS_23790 26317 25493 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974782.1 protein_id gnl|my_center|LOCUS_23790 29140 26357 gene locus_tag LOCUS_23800 29140 26357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 27899 27908 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30522 29221 gene locus_tag LOCUS_23810 30522 29221 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_23810 31294 30524 gene locus_tag LOCUS_23820 31294 30524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 31595 31344 gene locus_tag LOCUS_23830 31595 31344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 31688 32293 gene locus_tag LOCUS_23840 31688 32293 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_23840 32395 34167 gene locus_tag LOCUS_23850 32395 34167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 34252 35436 gene locus_tag LOCUS_23860 34252 35436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404588.1 protein_id gnl|my_center|LOCUS_23860 35508 36269 gene locus_tag LOCUS_23870 gene mazG 35508 36269 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_23870 36503 37672 gene locus_tag LOCUS_23880 36503 37672 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_23880 40639 37676 gene locus_tag LOCUS_23890 40639 37676 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022738.1 protein_id gnl|my_center|LOCUS_23890 43276 40739 gene locus_tag LOCUS_23900 gene leuS 43276 40739 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403694.1 protein_id gnl|my_center|LOCUS_23900 43428 44756 gene locus_tag LOCUS_23910 43428 44756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 44776 46992 gene locus_tag LOCUS_23920 44776 46992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 48026 46989 gene locus_tag LOCUS_23930 48026 46989 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_23930 49130 48141 gene locus_tag LOCUS_23940 49130 48141 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_23940 >Feature sequence25 <1 819 gene locus_tag LOCUS_23950 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404064.1:M3 family oligoendopeptidase 898 2361 gene locus_tag LOCUS_23960 898 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2361 3548 gene locus_tag LOCUS_23970 2361 3548 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_23970 3609 4769 gene locus_tag LOCUS_23980 3609 4769 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_23980 4836 5369 gene locus_tag LOCUS_23990 4836 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 5751 6566 gene locus_tag LOCUS_24000 5751 6566 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_24000 6572 7855 gene locus_tag LOCUS_24010 6572 7855 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_24010 7855 9162 gene locus_tag LOCUS_24020 7855 9162 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_24020 9531 10481 gene locus_tag LOCUS_24030 9531 10481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 11360 10482 gene locus_tag LOCUS_24040 11360 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 13884 11422 gene locus_tag LOCUS_24050 13884 11422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24050 15066 14095 gene locus_tag LOCUS_24060 15066 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 15391 15113 gene locus_tag LOCUS_24070 15391 15113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 16074 15388 gene locus_tag LOCUS_24080 16074 15388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_24080 18544 16082 gene locus_tag LOCUS_24090 18544 16082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24090 21002 18561 gene locus_tag LOCUS_24100 21002 18561 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24100 23426 21012 gene locus_tag LOCUS_24110 23426 21012 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24110 25861 23438 gene locus_tag LOCUS_24120 25861 23438 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24120 28280 25872 gene locus_tag LOCUS_24130 28280 25872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_24130 29048 28359 gene locus_tag LOCUS_24140 29048 28359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_24140 29172 29534 gene locus_tag LOCUS_24150 29172 29534 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_24150 30811 29555 gene locus_tag LOCUS_24160 30811 29555 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_24160 31074 32450 gene locus_tag LOCUS_24170 31074 32450 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107494.1 protein_id gnl|my_center|LOCUS_24170 32462 33826 gene locus_tag LOCUS_24180 32462 33826 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_24180 36432 33823 gene locus_tag LOCUS_24190 36432 33823 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_24190 37410 36439 gene locus_tag LOCUS_24200 37410 36439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 38450 37473 gene locus_tag LOCUS_24210 38450 37473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 39077 38490 gene locus_tag LOCUS_24220 39077 38490 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_24220 39107 39955 gene locus_tag LOCUS_24230 39107 39955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 40938 40003 gene locus_tag LOCUS_24240 40938 40003 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404954.1 protein_id gnl|my_center|LOCUS_24240 41876 40941 gene locus_tag LOCUS_24250 41876 40941 CDS product stomatin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404955.1 protein_id gnl|my_center|LOCUS_24250 42418 41885 gene locus_tag LOCUS_24260 42418 41885 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404956.1 protein_id gnl|my_center|LOCUS_24260 42627 44420 gene locus_tag LOCUS_24270 42627 44420 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_24270 44821 44579 gene locus_tag LOCUS_24280 44821 44579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 46038 45154 gene locus_tag LOCUS_24290 46038 45154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 46298 46666 gene locus_tag LOCUS_24300 46298 46666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 48180 47284 gene locus_tag LOCUS_24310 48180 47284 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931393.1 protein_id gnl|my_center|LOCUS_24310 48970 48566 gene locus_tag LOCUS_24320 48970 48566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 >Feature sequence26 433 789 gene locus_tag LOCUS_24330 433 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 1471 782 gene locus_tag LOCUS_24340 1471 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1818 3596 gene locus_tag LOCUS_24350 1818 3596 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_24350 3593 4492 gene locus_tag LOCUS_24360 3593 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_24360 5563 5000 gene locus_tag LOCUS_24370 5563 5000 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_24370 5963 5571 gene locus_tag LOCUS_24380 5963 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 6080 6580 gene locus_tag LOCUS_24390 6080 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 7119 6643 gene locus_tag LOCUS_24400 7119 6643 CDS product YHS domain-containing (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263462.1 protein_id gnl|my_center|LOCUS_24400 7761 7279 gene locus_tag LOCUS_24410 gene hisI 7761 7279 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_24410 8090 7818 gene locus_tag LOCUS_24420 gene yidD 8090 7818 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690475.1 protein_id gnl|my_center|LOCUS_24420 9544 8090 gene locus_tag LOCUS_24430 gene cysS 9544 8090 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_24430 10230 9550 gene locus_tag LOCUS_24440 gene folE 10230 9550 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962758.1 protein_id gnl|my_center|LOCUS_24440 10470 10775 gene locus_tag LOCUS_24450 10470 10775 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986755.1 protein_id gnl|my_center|LOCUS_24450 10830 11096 gene locus_tag LOCUS_24460 10830 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 11228 13042 gene locus_tag LOCUS_24470 11228 13042 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966315.1 protein_id gnl|my_center|LOCUS_24470 13184 13747 gene locus_tag LOCUS_24480 13184 13747 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404669.1 protein_id gnl|my_center|LOCUS_24480 13740 14519 gene locus_tag LOCUS_24490 13740 14519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 14533 15411 gene locus_tag LOCUS_24500 14533 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 15432 16235 gene locus_tag LOCUS_24510 15432 16235 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_24510 16357 19188 gene locus_tag LOCUS_24520 16357 19188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 19262 19966 gene locus_tag LOCUS_24530 19262 19966 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 protein_id gnl|my_center|LOCUS_24530 20318 23455 gene locus_tag LOCUS_24540 20318 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 23542 25656 gene locus_tag LOCUS_24550 23542 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 25671 26678 gene locus_tag LOCUS_24560 25671 26678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 26679 27965 gene locus_tag LOCUS_24570 26679 27965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 28045 29442 gene locus_tag LOCUS_24580 28045 29442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 29521 31506 gene locus_tag LOCUS_24590 29521 31506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 31595 33994 gene locus_tag LOCUS_24600 31595 33994 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583480.1 protein_id gnl|my_center|LOCUS_24600 34061 34411 gene locus_tag LOCUS_24610 34061 34411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 35597 34437 gene locus_tag LOCUS_24620 35597 34437 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_24620 35698 36537 gene locus_tag LOCUS_24630 35698 36537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_24630 37809 36559 gene locus_tag LOCUS_24640 37809 36559 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404451.1 protein_id gnl|my_center|LOCUS_24640 38248 37802 gene locus_tag LOCUS_24650 38248 37802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 38442 39524 gene locus_tag LOCUS_24660 38442 39524 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_24660 39776 39525 gene locus_tag LOCUS_24670 39776 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 40057 39866 gene locus_tag LOCUS_24680 40057 39866 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_24680 40329 40075 gene locus_tag LOCUS_24690 40329 40075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 41667 40399 gene locus_tag LOCUS_24700 41667 40399 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_24700 42754 41828 gene locus_tag LOCUS_24710 42754 41828 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557336.1 protein_id gnl|my_center|LOCUS_24710 46519 43193 gene locus_tag LOCUS_24720 gene mfd 46519 43193 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402849.1 protein_id gnl|my_center|LOCUS_24720 <47535 46691 gene locus_tag LOCUS_24730 <47535 46691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839880.1:VWA domain-containing protein >Feature sequence27 250 3375 gene locus_tag LOCUS_24740 250 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 3445 4344 gene locus_tag LOCUS_24750 gene deoC 3445 4344 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222794.1 protein_id gnl|my_center|LOCUS_24750 4359 5864 gene locus_tag LOCUS_24760 4359 5864 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 protein_id gnl|my_center|LOCUS_24760 5874 6740 gene locus_tag LOCUS_24770 5874 6740 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403982.1 protein_id gnl|my_center|LOCUS_24770 6740 7300 gene locus_tag LOCUS_24780 6740 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 7371 8135 gene locus_tag LOCUS_24790 7371 8135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 8138 9841 gene locus_tag LOCUS_24800 8138 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 9882 11093 gene locus_tag LOCUS_24810 9882 11093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 12163 11159 gene locus_tag LOCUS_24820 12163 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 13268 12252 gene locus_tag LOCUS_24830 13268 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 14409 13315 gene locus_tag LOCUS_24840 gene ychF 14409 13315 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_24840 14908 14447 gene locus_tag LOCUS_24850 gene nusB 14908 14447 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402806.1 protein_id gnl|my_center|LOCUS_24850 14999 15073 gene locus_tag LOCUS_t00180 14999 15073 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16669 15116 gene locus_tag LOCUS_24860 16669 15116 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261373.1 protein_id gnl|my_center|LOCUS_24860 18817 16745 gene locus_tag LOCUS_24870 18817 16745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 18977 20920 gene locus_tag LOCUS_24880 gene thrS 18977 20920 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421565.1 protein_id gnl|my_center|LOCUS_24880 21163 21474 gene locus_tag LOCUS_24890 21163 21474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 21556 21756 gene locus_tag LOCUS_24900 gene rpmI 21556 21756 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_24900 21776 22123 gene locus_tag LOCUS_24910 gene rplT 21776 22123 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405508.1 protein_id gnl|my_center|LOCUS_24910 22218 23225 gene locus_tag LOCUS_24920 gene pheS 22218 23225 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405509.1 protein_id gnl|my_center|LOCUS_24920 23246 25648 gene locus_tag LOCUS_24930 gene pheT 23246 25648 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963186.1 protein_id gnl|my_center|LOCUS_24930 25659 25913 gene locus_tag LOCUS_24940 25659 25913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 25910 26206 gene locus_tag LOCUS_24950 25910 26206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 26222 27037 gene locus_tag LOCUS_24960 26222 27037 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932049.1 protein_id gnl|my_center|LOCUS_24960 27037 27717 gene locus_tag LOCUS_24970 gene lolD 27037 27717 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_24970 27787 28470 gene locus_tag LOCUS_24980 27787 28470 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840104.1 protein_id gnl|my_center|LOCUS_24980 29905 29084 gene locus_tag LOCUS_24990 29905 29084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 31659 30163 gene locus_tag LOCUS_25000 31659 30163 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_25000 31838 34828 gene locus_tag LOCUS_25010 31838 34828 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404818.1 protein_id gnl|my_center|LOCUS_25010 34887 35333 gene locus_tag LOCUS_25020 34887 35333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 35334 35783 gene locus_tag LOCUS_25030 gene ybeY 35334 35783 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933051.1 protein_id gnl|my_center|LOCUS_25030 35825 36973 gene locus_tag LOCUS_25040 35825 36973 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405216.1 protein_id gnl|my_center|LOCUS_25040 36997 38643 gene locus_tag LOCUS_25050 36997 38643 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_25050 38644 40092 gene locus_tag LOCUS_25060 38644 40092 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405092.1 protein_id gnl|my_center|LOCUS_25060 40117 41817 gene locus_tag LOCUS_25070 40117 41817 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_25070 43029 42013 gene locus_tag LOCUS_25080 43029 42013 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_25080 44088 43762 gene locus_tag LOCUS_25090 44088 43762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 >Feature sequence28 <1 519 gene locus_tag LOCUS_25100 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162139584.1:carbon-nitrogen hydrolase family protein 509 1666 gene locus_tag LOCUS_25110 509 1666 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_25110 1717 2850 gene locus_tag LOCUS_25120 gene chrA 1717 2850 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_25120 4544 3366 gene locus_tag LOCUS_25130 4544 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 4713 6422 gene locus_tag LOCUS_25140 4713 6422 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_25140 6474 6899 gene locus_tag LOCUS_25150 6474 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 7593 6892 gene locus_tag LOCUS_25160 7593 6892 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404844.1 protein_id gnl|my_center|LOCUS_25160 8674 8456 gene locus_tag LOCUS_25170 8674 8456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 9876 8671 gene locus_tag LOCUS_25180 9876 8671 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172745.1 protein_id gnl|my_center|LOCUS_25180 10067 11797 gene locus_tag LOCUS_25190 10067 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 11891 12325 gene locus_tag LOCUS_25200 11891 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 12470 13420 gene locus_tag LOCUS_25210 12470 13420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120056.1 protein_id gnl|my_center|LOCUS_25210 13430 14341 gene locus_tag LOCUS_25220 13430 14341 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_25220 14346 14867 gene locus_tag LOCUS_25230 14346 14867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 14978 15166 gene locus_tag LOCUS_25240 14978 15166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 15144 15635 gene locus_tag LOCUS_25250 gene tnpA 15144 15635 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_25250 15910 16470 gene locus_tag LOCUS_25260 15910 16470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 16676 17053 gene locus_tag LOCUS_25270 16676 17053 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258310.1 protein_id gnl|my_center|LOCUS_25270 17187 17894 gene locus_tag LOCUS_25280 17187 17894 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191371.1 protein_id gnl|my_center|LOCUS_25280 17904 18506 gene locus_tag LOCUS_25290 17904 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 18503 20047 gene locus_tag LOCUS_25300 18503 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 20179 21732 gene locus_tag LOCUS_25310 20179 21732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 21939 21948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21988 23133 gene locus_tag LOCUS_25320 21988 23133 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_25320 24950 23130 gene locus_tag LOCUS_25330 24950 23130 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_25330 25070 25378 gene locus_tag LOCUS_25340 25070 25378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 25439 25921 gene locus_tag LOCUS_25350 25439 25921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 25960 28191 gene locus_tag LOCUS_25360 25960 28191 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037788.1 protein_id gnl|my_center|LOCUS_25360 28380 29240 gene locus_tag LOCUS_25370 28380 29240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 29244 29702 gene locus_tag LOCUS_25380 29244 29702 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000283897.1 protein_id gnl|my_center|LOCUS_25380 29798 31381 gene locus_tag LOCUS_25390 29798 31381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 31399 31863 gene locus_tag LOCUS_25400 31399 31863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_25400 31888 32430 gene locus_tag LOCUS_25410 31888 32430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 32516 33259 gene locus_tag LOCUS_25420 32516 33259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 33383 34114 gene locus_tag LOCUS_25430 33383 34114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 34370 35056 gene locus_tag LOCUS_25440 34370 35056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 35305 35997 gene locus_tag LOCUS_25450 35305 35997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 36112 36867 gene locus_tag LOCUS_25460 36112 36867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 37019 37798 gene locus_tag LOCUS_25470 37019 37798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 37842 38624 gene locus_tag LOCUS_25480 37842 38624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 38745 39500 gene locus_tag LOCUS_25490 38745 39500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 39506 40324 gene locus_tag LOCUS_25500 39506 40324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 40496 41200 gene locus_tag LOCUS_25510 40496 41200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 41209 41622 gene locus_tag LOCUS_25520 41209 41622 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_25520 41917 42585 gene locus_tag LOCUS_25530 41917 42585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25530 42763 43227 gene locus_tag LOCUS_25540 42763 43227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25540 >Feature sequence29 434 1432 gene locus_tag LOCUS_25550 434 1432 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403376.1 protein_id gnl|my_center|LOCUS_25550 1473 2600 gene locus_tag LOCUS_25560 gene neuC 1473 2600 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_25560 2625 3776 gene locus_tag LOCUS_25570 2625 3776 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202419.1 protein_id gnl|my_center|LOCUS_25570 3773 4405 gene locus_tag LOCUS_25580 3773 4405 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289363.1 protein_id gnl|my_center|LOCUS_25580 4395 5435 gene locus_tag LOCUS_25590 gene neuB 4395 5435 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001230564.1 protein_id gnl|my_center|LOCUS_25590 5581 5775 gene locus_tag LOCUS_25600 5581 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5772 6818 gene locus_tag LOCUS_25610 5772 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 6815 7504 gene locus_tag LOCUS_25620 6815 7504 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_25620 7813 8658 gene locus_tag LOCUS_25630 7813 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 8651 9898 gene locus_tag LOCUS_25640 8651 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 9901 11562 gene locus_tag LOCUS_25650 gene asnB 9901 11562 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333816.1 protein_id gnl|my_center|LOCUS_25650 11564 12667 gene locus_tag LOCUS_25660 11564 12667 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023682.1 protein_id gnl|my_center|LOCUS_25660 12688 13938 gene locus_tag LOCUS_25670 12688 13938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 13986 14792 gene locus_tag LOCUS_25680 13986 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 14964 15347 gene locus_tag LOCUS_25690 14964 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 15347 17104 gene locus_tag LOCUS_25700 gene asnB 15347 17104 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_25700 17138 18556 gene locus_tag LOCUS_25710 17138 18556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 18622 19932 gene locus_tag LOCUS_25720 18622 19932 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427766.1 protein_id gnl|my_center|LOCUS_25720 19936 21093 gene locus_tag LOCUS_25730 19936 21093 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_25730 21093 22121 gene locus_tag LOCUS_25740 gene wlbA 21093 22121 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_25740 22240 22334 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22445 23014 gene locus_tag LOCUS_25750 22445 23014 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_25750 23099 24322 gene locus_tag LOCUS_25760 23099 24322 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_25760 24319 25890 gene locus_tag LOCUS_25770 24319 25890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 26154 26657 gene locus_tag LOCUS_25780 26154 26657 CDS product archaeosortase/exosortase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403397.1 protein_id gnl|my_center|LOCUS_25780 26650 27132 gene locus_tag LOCUS_25790 26650 27132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 27122 28402 gene locus_tag LOCUS_25800 27122 28402 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_25800 28490 29509 gene locus_tag LOCUS_25810 28490 29509 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839879.1 protein_id gnl|my_center|LOCUS_25810 29510 30259 gene locus_tag LOCUS_25820 29510 30259 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838205.1 protein_id gnl|my_center|LOCUS_25820 33755 30378 gene locus_tag LOCUS_25830 33755 30378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 34699 33824 gene locus_tag LOCUS_25840 34699 33824 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_25840 35950 34760 gene locus_tag LOCUS_25850 gene coaBC 35950 34760 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402817.1 protein_id gnl|my_center|LOCUS_25850 36246 35953 gene locus_tag LOCUS_25860 36246 35953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 36821 36252 gene locus_tag LOCUS_25870 gene gmk 36821 36252 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_25870 37763 36882 gene locus_tag LOCUS_25880 37763 36882 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402820.1 protein_id gnl|my_center|LOCUS_25880 37881 39725 gene locus_tag LOCUS_25890 37881 39725 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_25890 40120 40509 gene locus_tag LOCUS_25900 40120 40509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 41278 40565 gene locus_tag LOCUS_25910 41278 40565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 41812 41369 gene locus_tag LOCUS_25920 41812 41369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 42202 41819 gene locus_tag LOCUS_25930 42202 41819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 42650 42195 gene locus_tag LOCUS_25940 gene msrB 42650 42195 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence30 195 833 gene locus_tag LOCUS_25950 195 833 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_25950 1692 1036 gene locus_tag LOCUS_25960 1692 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1929 1855 gene locus_tag LOCUS_t00190 1929 1855 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2287 3756 gene locus_tag LOCUS_25970 gene proS 2287 3756 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_25970 3893 5341 gene locus_tag LOCUS_25980 3893 5341 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_25980 5827 6468 gene locus_tag LOCUS_25990 5827 6468 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108463.1 protein_id gnl|my_center|LOCUS_25990 6595 7248 gene locus_tag LOCUS_26000 6595 7248 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_26000 7730 7290 gene locus_tag LOCUS_26010 7730 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8037 7720 gene locus_tag LOCUS_26020 8037 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 8150 9355 gene locus_tag LOCUS_26030 8150 9355 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421517.1 protein_id gnl|my_center|LOCUS_26030 9374 10453 gene locus_tag LOCUS_26040 gene serC 9374 10453 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404933.1 protein_id gnl|my_center|LOCUS_26040 11116 10523 gene locus_tag LOCUS_26050 11116 10523 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036598.1 protein_id gnl|my_center|LOCUS_26050 13781 11322 gene locus_tag LOCUS_26060 13781 11322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 14254 13790 gene locus_tag LOCUS_26070 14254 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 14460 15116 gene locus_tag LOCUS_26080 14460 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 15179 16657 gene locus_tag LOCUS_26090 15179 16657 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258284.1 protein_id gnl|my_center|LOCUS_26090 16896 18527 gene locus_tag LOCUS_26100 gene pruA 16896 18527 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_26100 21367 19193 gene locus_tag LOCUS_26110 21367 19193 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_26110 22399 21503 gene locus_tag LOCUS_26120 22399 21503 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403948.1 protein_id gnl|my_center|LOCUS_26120 22537 23730 gene locus_tag LOCUS_26130 22537 23730 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_26130 23734 25164 gene locus_tag LOCUS_26140 23734 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 25166 26035 gene locus_tag LOCUS_26150 25166 26035 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838999.1 protein_id gnl|my_center|LOCUS_26150 26158 27114 gene locus_tag LOCUS_26160 gene mdh 26158 27114 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_26160 27284 28648 gene locus_tag LOCUS_26170 27284 28648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 28675 29259 gene locus_tag LOCUS_26180 28675 29259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 29270 29818 gene locus_tag LOCUS_26190 29270 29818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 29940 30332 gene locus_tag LOCUS_26200 29940 30332 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402858.1 protein_id gnl|my_center|LOCUS_26200 30335 30556 gene locus_tag LOCUS_26210 30335 30556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 31334 30702 gene locus_tag LOCUS_26220 gene msrA 31334 30702 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_26220 31555 33525 gene locus_tag LOCUS_26230 31555 33525 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037605.1 protein_id gnl|my_center|LOCUS_26230 33599 33934 gene locus_tag LOCUS_26240 33599 33934 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145104183.1 protein_id gnl|my_center|LOCUS_26240 34004 35215 gene locus_tag LOCUS_26250 34004 35215 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121878.1 protein_id gnl|my_center|LOCUS_26250 35277 36524 gene locus_tag LOCUS_26260 35277 36524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 36668 37363 gene locus_tag LOCUS_26270 36668 37363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 37487 37403 gene locus_tag LOCUS_t00200 37487 37403 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence31 3332 2328 gene locus_tag LOCUS_26280 3332 2328 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964012.1 protein_id gnl|my_center|LOCUS_26280 3526 6813 gene locus_tag LOCUS_26290 3526 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 6895 9633 gene locus_tag LOCUS_26300 6895 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 9696 12998 gene locus_tag LOCUS_26310 9696 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 13010 14050 gene locus_tag LOCUS_26320 13010 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 14072 15775 gene locus_tag LOCUS_26330 14072 15775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 17120 15792 gene locus_tag LOCUS_26340 gene fucP 17120 15792 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_26340 18999 17137 gene locus_tag LOCUS_26350 18999 17137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 19776 19000 gene locus_tag LOCUS_26360 19776 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 19979 21520 gene locus_tag LOCUS_26370 19979 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 21674 21601 gene locus_tag LOCUS_t00210 21674 21601 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 21821 21747 gene locus_tag LOCUS_t00220 21821 21747 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21986 21913 gene locus_tag LOCUS_t00230 21986 21913 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22097 22026 gene locus_tag LOCUS_t00240 22097 22026 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 22189 22115 gene locus_tag LOCUS_t00250 22189 22115 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22286 22212 gene locus_tag LOCUS_t00260 22286 22212 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 23651 22383 gene locus_tag LOCUS_26380 23651 22383 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023659.1 protein_id gnl|my_center|LOCUS_26380 24696 23653 gene locus_tag LOCUS_26390 24696 23653 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252964.1 protein_id gnl|my_center|LOCUS_26390 24948 25793 gene locus_tag LOCUS_26400 24948 25793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 28424 25839 gene locus_tag LOCUS_26410 28424 25839 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404069.1 protein_id gnl|my_center|LOCUS_26410 30090 28570 gene locus_tag LOCUS_26420 gene gpmI 30090 28570 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_26420 30354 30103 gene locus_tag LOCUS_26430 gene rpsT 30354 30103 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274021.1 protein_id gnl|my_center|LOCUS_26430 30472 31137 gene locus_tag LOCUS_26440 gene cmk 30472 31137 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361264.1 protein_id gnl|my_center|LOCUS_26440 31192 33147 gene locus_tag LOCUS_26450 31192 33147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence32 1379 213 gene locus_tag LOCUS_26460 1379 213 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_26460 1580 5008 gene locus_tag LOCUS_26470 1580 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 5089 5571 gene locus_tag LOCUS_26480 5089 5571 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840149.1 protein_id gnl|my_center|LOCUS_26480 5582 6094 gene locus_tag LOCUS_26490 5582 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 6771 6130 gene locus_tag LOCUS_26500 6771 6130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 7714 6809 gene locus_tag LOCUS_26510 7714 6809 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015684.1 protein_id gnl|my_center|LOCUS_26510 8037 7741 gene locus_tag LOCUS_26520 8037 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 8293 8117 gene locus_tag LOCUS_26530 8293 8117 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_26530 9064 8420 gene locus_tag LOCUS_26540 9064 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9771 9067 gene locus_tag LOCUS_26550 9771 9067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 12283 9806 gene locus_tag LOCUS_26560 12283 9806 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078404016.1 protein_id gnl|my_center|LOCUS_26560 12494 13348 gene locus_tag LOCUS_26570 12494 13348 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_26570 14503 15336 gene locus_tag LOCUS_26580 14503 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 15277 15286 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15321 16496 gene locus_tag LOCUS_26590 15321 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 16589 16780 gene locus_tag LOCUS_26600 16589 16780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 17869 19308 gene locus_tag LOCUS_26610 17869 19308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 19397 19594 gene locus_tag LOCUS_26620 19397 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 19878 20615 gene locus_tag LOCUS_26630 19878 20615 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142245.1 protein_id gnl|my_center|LOCUS_26630 20622 22142 gene locus_tag LOCUS_26640 20622 22142 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035422.1 protein_id gnl|my_center|LOCUS_26640 22634 22149 gene locus_tag LOCUS_26650 22634 22149 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_26650 24417 22855 gene locus_tag LOCUS_26660 24417 22855 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_26660 25489 24614 gene locus_tag LOCUS_26670 gene sucD 25489 24614 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403441.1 protein_id gnl|my_center|LOCUS_26670 25726 27744 gene locus_tag LOCUS_26680 gene dnaG 25726 27744 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403730.1 protein_id gnl|my_center|LOCUS_26680 27820 29181 gene locus_tag LOCUS_26690 27820 29181 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933237.1 protein_id gnl|my_center|LOCUS_26690 29546 31057 gene locus_tag LOCUS_26700 29546 31057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence33 1547 198 gene locus_tag LOCUS_26710 1547 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2040 3248 gene locus_tag LOCUS_26720 2040 3248 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338075.1 protein_id gnl|my_center|LOCUS_26720 3248 3436 gene locus_tag LOCUS_26730 3248 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 3444 4376 gene locus_tag LOCUS_26740 3444 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 4450 4635 gene locus_tag LOCUS_26750 4450 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 4727 4990 gene locus_tag LOCUS_26760 4727 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4983 5174 gene locus_tag LOCUS_26770 4983 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5180 5938 gene locus_tag LOCUS_26780 5180 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 6896 6823 gene locus_tag LOCUS_t00270 6896 6823 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 8991 7291 gene locus_tag LOCUS_26790 gene recJ 8991 7291 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_26790 9356 10531 gene locus_tag LOCUS_26800 9356 10531 CDS product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162675.1 protein_id gnl|my_center|LOCUS_26800 11244 12146 gene locus_tag LOCUS_26810 gene hslO 11244 12146 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656372.1 protein_id gnl|my_center|LOCUS_26810 12155 12967 gene locus_tag LOCUS_26820 12155 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 14154 13009 gene locus_tag LOCUS_26830 14154 13009 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_26830 14652 14185 gene locus_tag LOCUS_26840 14652 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26840 14752 15192 gene locus_tag LOCUS_26850 14752 15192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 15192 16244 gene locus_tag LOCUS_26860 15192 16244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 16294 16497 gene locus_tag LOCUS_26870 16294 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 16976 16494 gene locus_tag LOCUS_26880 16976 16494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 19073 17133 gene locus_tag LOCUS_26890 19073 17133 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111546765.1 protein_id gnl|my_center|LOCUS_26890 22864 19139 gene locus_tag LOCUS_26900 22864 19139 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_163515044.1 protein_id gnl|my_center|LOCUS_26900 23108 23518 gene locus_tag LOCUS_26910 23108 23518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 23505 23789 gene locus_tag LOCUS_26920 23505 23789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 24346 23786 gene locus_tag LOCUS_26930 24346 23786 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_26930 24409 24786 gene locus_tag LOCUS_26940 24409 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 24892 25482 gene locus_tag LOCUS_26950 gene pgsA 24892 25482 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712132.1 protein_id gnl|my_center|LOCUS_26950 25486 26439 gene locus_tag LOCUS_26960 gene ftsY 25486 26439 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_26960 26774 26523 gene locus_tag LOCUS_26970 26774 26523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 26743 29622 gene locus_tag LOCUS_26980 26743 29622 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057920.1 protein_id gnl|my_center|LOCUS_26980 <31067 29676 gene locus_tag LOCUS_26990 <31067 29676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962811.1:M28 family metallopeptidase >Feature sequence34 1770 289 gene locus_tag LOCUS_27000 gene gltX 1770 289 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112904198.1 protein_id gnl|my_center|LOCUS_27000 1938 2597 gene locus_tag LOCUS_27010 1938 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 4197 2737 gene locus_tag LOCUS_27020 4197 2737 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_27020 6903 4216 gene locus_tag LOCUS_27030 6903 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 7771 6911 gene locus_tag LOCUS_27040 7771 6911 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_27040 9049 7805 gene locus_tag LOCUS_27050 9049 7805 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_27050 10551 9181 gene locus_tag LOCUS_27060 10551 9181 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_27060 14173 10577 gene locus_tag LOCUS_27070 14173 10577 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_27070 15305 14256 gene locus_tag LOCUS_27080 15305 14256 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816609.1 protein_id gnl|my_center|LOCUS_27080 15967 15368 gene locus_tag LOCUS_27090 15967 15368 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767907.1 protein_id gnl|my_center|LOCUS_27090 17036 16170 gene locus_tag LOCUS_27100 17036 16170 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256262.1 protein_id gnl|my_center|LOCUS_27100 17885 17055 gene locus_tag LOCUS_27110 17885 17055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 18020 19747 gene locus_tag LOCUS_27120 18020 19747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 19766 20977 gene locus_tag LOCUS_27130 19766 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 21227 21048 gene locus_tag LOCUS_27140 21227 21048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 21302 21985 gene locus_tag LOCUS_27150 21302 21985 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_27150 22906 22028 gene locus_tag LOCUS_27160 22906 22028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 23070 23993 gene locus_tag LOCUS_27170 23070 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 <25065 23986 gene locus_tag LOCUS_27180 <25065 23986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405055.1:glycine--tRNA ligase >Feature sequence35 236 433 gene locus_tag LOCUS_27190 236 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 459 1229 gene locus_tag LOCUS_27200 459 1229 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_27200 1340 3631 gene locus_tag LOCUS_27210 1340 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 5861 3750 gene locus_tag LOCUS_27220 5861 3750 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404999.1 protein_id gnl|my_center|LOCUS_27220 7936 6626 gene locus_tag LOCUS_27230 7936 6626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_27230 8865 7936 gene locus_tag LOCUS_27240 8865 7936 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_27240 8995 10440 gene locus_tag LOCUS_27250 gene glgA 8995 10440 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836716.1 protein_id gnl|my_center|LOCUS_27250 10440 11711 gene locus_tag LOCUS_27260 10440 11711 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_27260 11812 12570 gene locus_tag LOCUS_27270 gene truA 11812 12570 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764438.1 protein_id gnl|my_center|LOCUS_27270 12638 12710 gene locus_tag LOCUS_t00280 12638 12710 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 13828 12827 gene locus_tag LOCUS_27280 13828 12827 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478452.1 protein_id gnl|my_center|LOCUS_27280 14952 14008 gene locus_tag LOCUS_27290 14952 14008 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643797.1 protein_id gnl|my_center|LOCUS_27290 19315 15242 gene locus_tag LOCUS_27300 19315 15242 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_27300 19338 19505 gene locus_tag LOCUS_27310 19338 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 19647 21713 gene locus_tag LOCUS_27320 19647 21713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 >Feature sequence36 1395 535 gene locus_tag LOCUS_27330 1395 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 2111 1392 gene locus_tag LOCUS_27340 2111 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 3610 2477 gene locus_tag LOCUS_27350 gene lepB 3610 2477 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403185.1 protein_id gnl|my_center|LOCUS_27350 4219 3620 gene locus_tag LOCUS_27360 4219 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 6022 4220 gene locus_tag LOCUS_27370 gene lepA 6022 4220 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403183.1 protein_id gnl|my_center|LOCUS_27370 6421 6107 gene locus_tag LOCUS_27380 6421 6107 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_27380 6735 6490 gene locus_tag LOCUS_27390 6735 6490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 7044 7925 gene locus_tag LOCUS_27400 gene hisG 7044 7925 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_27400 7948 9246 gene locus_tag LOCUS_27410 gene hisD 7948 9246 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963107.1 protein_id gnl|my_center|LOCUS_27410 9373 10431 gene locus_tag LOCUS_27420 gene hisC 9373 10431 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963106.1 protein_id gnl|my_center|LOCUS_27420 10874 10473 gene locus_tag LOCUS_27430 10874 10473 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_27430 10954 11841 gene locus_tag LOCUS_27440 10954 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 11845 12447 gene locus_tag LOCUS_27450 gene hisH 11845 12447 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_27450 12465 13181 gene locus_tag LOCUS_27460 gene hisA 12465 13181 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603770.1 protein_id gnl|my_center|LOCUS_27460 13792 13217 gene locus_tag LOCUS_27470 13792 13217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 15210 13945 gene locus_tag LOCUS_27480 gene murA 15210 13945 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021586.1 protein_id gnl|my_center|LOCUS_27480 15709 15203 gene locus_tag LOCUS_27490 15709 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 15975 15706 gene locus_tag LOCUS_27500 15975 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 16114 17175 gene locus_tag LOCUS_27510 gene thrC 16114 17175 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_27510 17268 18350 gene locus_tag LOCUS_27520 17268 18350 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_27520 18350 19402 gene locus_tag LOCUS_27530 18350 19402 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_27530 20680 19661 gene locus_tag LOCUS_27540 20680 19661 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_27540 >Feature sequence37 812 150 gene locus_tag LOCUS_27550 812 150 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_27550 1721 825 gene locus_tag LOCUS_27560 1721 825 CDS product DUF4249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837965.1 protein_id gnl|my_center|LOCUS_27560 3984 1726 gene locus_tag LOCUS_27570 3984 1726 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_27570 4972 4079 gene locus_tag LOCUS_27580 4972 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 5176 5543 gene locus_tag LOCUS_tm00010 5176 5543 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6796 5657 gene locus_tag LOCUS_27590 6796 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 8067 7150 gene locus_tag LOCUS_27600 gene add 8067 7150 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966287.1 protein_id gnl|my_center|LOCUS_27600 8228 10978 gene locus_tag LOCUS_27610 gene polA 8228 10978 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_27610 11098 12606 gene locus_tag LOCUS_27620 gene crtD 11098 12606 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142868.1 protein_id gnl|my_center|LOCUS_27620 12739 13242 gene locus_tag LOCUS_27630 12739 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 13263 14120 gene locus_tag LOCUS_27640 13263 14120 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_27640 14128 15342 gene locus_tag LOCUS_27650 gene ispG 14128 15342 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887031.1 protein_id gnl|my_center|LOCUS_27650 15524 17197 gene locus_tag LOCUS_27660 15524 17197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 17206 20157 gene locus_tag LOCUS_27670 17206 20157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence38 <1 410 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aatctaattcatctcgaaaagagttcaaaccacaac 1067 429 gene locus_tag LOCUS_27680 1067 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 1325 4030 gene locus_tag LOCUS_27690 gene acnA 1325 4030 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_27690 4143 5258 gene locus_tag LOCUS_27700 4143 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 5436 6500 gene locus_tag LOCUS_27710 5436 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7640 6492 gene locus_tag LOCUS_27720 7640 6492 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187767773.1 protein_id gnl|my_center|LOCUS_27720 8325 7627 gene locus_tag LOCUS_27730 8325 7627 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_27730 9416 8325 gene locus_tag LOCUS_27740 9416 8325 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480137.1 protein_id gnl|my_center|LOCUS_27740 10836 9496 gene locus_tag LOCUS_27750 10836 9496 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839967.1 protein_id gnl|my_center|LOCUS_27750 14731 10886 gene locus_tag LOCUS_27760 14731 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 15711 14734 gene locus_tag LOCUS_27770 15711 14734 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062847.1 protein_id gnl|my_center|LOCUS_27770 16119 15718 gene locus_tag LOCUS_27780 gene rsfS 16119 15718 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_27780 16599 16135 gene locus_tag LOCUS_27790 16599 16135 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405259.1 protein_id gnl|my_center|LOCUS_27790 17122 16607 gene locus_tag LOCUS_27800 17122 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405258.1 protein_id gnl|my_center|LOCUS_27800 17294 18349 gene locus_tag LOCUS_27810 gene queA 17294 18349 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_27810 18398 19042 gene locus_tag LOCUS_27820 gene ispD 18398 19042 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235019.1 protein_id gnl|my_center|LOCUS_27820 19039 19524 gene locus_tag LOCUS_27830 gene ispF 19039 19524 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_27830 19525 20166 gene locus_tag LOCUS_27840 19525 20166 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_27840 20239 20312 gene locus_tag LOCUS_t00290 20239 20312 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 20338 20421 gene locus_tag LOCUS_t00300 20338 20421 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 20428 20501 gene locus_tag LOCUS_t00310 20428 20501 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 20514 20586 gene locus_tag LOCUS_t00320 20514 20586 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence39 <1 559 gene locus_tag LOCUS_27850 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931951.1:ABC transporter ATP-binding protein 1307 681 gene locus_tag LOCUS_27860 1307 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2386 1295 gene locus_tag LOCUS_27870 2386 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 4069 2597 gene locus_tag LOCUS_27880 gene crtI 4069 2597 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_27880 4239 5420 gene locus_tag LOCUS_27890 4239 5420 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_27890 6852 5512 gene locus_tag LOCUS_27900 6852 5512 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202473.1 protein_id gnl|my_center|LOCUS_27900 7513 6911 gene locus_tag LOCUS_27910 7513 6911 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082103.1 protein_id gnl|my_center|LOCUS_27910 8946 7534 gene locus_tag LOCUS_27920 gene rlmD 8946 7534 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_27920 9488 8949 gene locus_tag LOCUS_27930 9488 8949 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_27930 11903 9501 gene locus_tag LOCUS_27940 11903 9501 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404893.1 protein_id gnl|my_center|LOCUS_27940 12201 11947 gene locus_tag LOCUS_27950 12201 11947 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_27950 12356 12571 gene locus_tag LOCUS_27960 gene tatA 12356 12571 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_27960 12579 14102 gene locus_tag LOCUS_27970 12579 14102 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403442.1 protein_id gnl|my_center|LOCUS_27970 14130 14897 gene locus_tag LOCUS_27980 14130 14897 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 protein_id gnl|my_center|LOCUS_27980 14890 15849 gene locus_tag LOCUS_27990 14890 15849 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_27990 15849 16682 gene locus_tag LOCUS_28000 gene prmA 15849 16682 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931792.1 protein_id gnl|my_center|LOCUS_28000 16679 17602 gene locus_tag LOCUS_28010 16679 17602 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838399.1 protein_id gnl|my_center|LOCUS_28010 17674 18303 gene locus_tag LOCUS_28020 gene sigW 17674 18303 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_28020 19253 18312 gene locus_tag LOCUS_28030 gene queG 19253 18312 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_28030 <19854 19261 gene locus_tag LOCUS_28040 <19854 19261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421584.1:ATP-binding cassette domain-containing protein >Feature sequence40 673 47 gene locus_tag LOCUS_28050 673 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1855 746 gene locus_tag LOCUS_28060 gene nadA 1855 746 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025295.1 protein_id gnl|my_center|LOCUS_28060 2760 1927 gene locus_tag LOCUS_28070 gene nadC 2760 1927 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092232.1 protein_id gnl|my_center|LOCUS_28070 2836 3975 gene locus_tag LOCUS_28080 2836 3975 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973777.1 protein_id gnl|my_center|LOCUS_28080 4013 4585 gene locus_tag LOCUS_28090 4013 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 4707 5948 gene locus_tag LOCUS_28100 4707 5948 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_28100 5973 6332 gene locus_tag LOCUS_28110 5973 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 7565 6552 gene locus_tag LOCUS_28120 7565 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 7893 7600 gene locus_tag LOCUS_28130 7893 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 9020 7890 gene locus_tag LOCUS_28140 9020 7890 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402853.1 protein_id gnl|my_center|LOCUS_28140 10155 9073 gene locus_tag LOCUS_28150 10155 9073 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962855.1 protein_id gnl|my_center|LOCUS_28150 11458 10172 gene locus_tag LOCUS_28160 gene eno 11458 10172 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357098.1 protein_id gnl|my_center|LOCUS_28160 11568 12266 gene locus_tag LOCUS_28170 11568 12266 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_28170 13090 12263 gene locus_tag LOCUS_28180 13090 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 13199 13597 gene locus_tag LOCUS_28190 13199 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 13597 14460 gene locus_tag LOCUS_28200 gene prmC 13597 14460 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964123.1 protein_id gnl|my_center|LOCUS_28200 14828 16270 gene locus_tag LOCUS_28210 gene dnaA 14828 16270 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_28210 16275 16631 gene locus_tag LOCUS_28220 gene folB 16275 16631 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897503.1 protein_id gnl|my_center|LOCUS_28220 16619 17107 gene locus_tag LOCUS_28230 gene folK 16619 17107 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693858.1 protein_id gnl|my_center|LOCUS_28230 17108 17749 gene locus_tag LOCUS_28240 17108 17749 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_28240 17752 17964 gene locus_tag LOCUS_28250 17752 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 17961 18506 gene locus_tag LOCUS_28260 17961 18506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence41 <1 668 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgaactcttttcgagatgaattagatt 1064 726 gene locus_tag LOCUS_28270 gene cas2 1064 726 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_28270 1963 1070 gene locus_tag LOCUS_28280 gene cas1 1963 1070 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_28280 5039 1956 gene locus_tag LOCUS_28290 gene cas9 5039 1956 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_28290 5586 5383 gene locus_tag LOCUS_28300 5586 5383 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812516.1 protein_id gnl|my_center|LOCUS_28300 5768 9154 gene locus_tag LOCUS_28310 gene secA 5768 9154 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403566.1 protein_id gnl|my_center|LOCUS_28310 11496 9262 gene locus_tag LOCUS_28320 11496 9262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 12659 11688 gene locus_tag LOCUS_28330 12659 11688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 12855 13616 gene locus_tag LOCUS_28340 12855 13616 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 protein_id gnl|my_center|LOCUS_28340 15544 13748 gene locus_tag LOCUS_28350 15544 13748 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_28350 15959 15576 gene locus_tag LOCUS_28360 15959 15576 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_28360 16678 16025 gene locus_tag LOCUS_28370 16678 16025 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_28370 16837 17664 gene locus_tag LOCUS_28380 16837 17664 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296628.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence42 183 677 gene locus_tag LOCUS_28390 gene msrA 183 677 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897888.1 protein_id gnl|my_center|LOCUS_28390 3495 895 gene locus_tag LOCUS_28400 3495 895 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830376.1 protein_id gnl|my_center|LOCUS_28400 5835 3577 gene locus_tag LOCUS_28410 5835 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 5988 6944 gene locus_tag LOCUS_28420 5988 6944 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_28420 7112 8971 gene locus_tag LOCUS_28430 7112 8971 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_28430 9137 10666 gene locus_tag LOCUS_28440 9137 10666 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 protein_id gnl|my_center|LOCUS_28440 11623 10742 gene locus_tag LOCUS_28450 11623 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 11810 12664 gene locus_tag LOCUS_28460 11810 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 12672 13613 gene locus_tag LOCUS_28470 12672 13613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 13619 14371 gene locus_tag LOCUS_28480 13619 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 14376 15443 gene locus_tag LOCUS_28490 14376 15443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 >Feature sequence43 1144 3486 gene locus_tag LOCUS_28500 1144 3486 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_28500 4154 4720 gene locus_tag LOCUS_28510 4154 4720 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082042.1 protein_id gnl|my_center|LOCUS_28510 4737 5123 gene locus_tag LOCUS_28520 4737 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 5520 5146 gene locus_tag LOCUS_28530 gene azu 5520 5146 CDS product azurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463034.1 protein_id gnl|my_center|LOCUS_28530 5707 6879 gene locus_tag LOCUS_28540 5707 6879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 8250 6880 gene locus_tag LOCUS_28550 8250 6880 CDS product glycoside hydrolase family 125 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794945.1 protein_id gnl|my_center|LOCUS_28550 8757 10085 gene locus_tag LOCUS_28560 gene pheA 8757 10085 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468591.1 protein_id gnl|my_center|LOCUS_28560 11116 10088 gene locus_tag LOCUS_28570 11116 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 11783 11241 gene locus_tag LOCUS_28580 11783 11241 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_28580 12756 11776 gene locus_tag LOCUS_28590 12756 11776 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_28590 13943 12753 gene locus_tag LOCUS_28600 gene xseA 13943 12753 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838345.1 protein_id gnl|my_center|LOCUS_28600 14018 14773 gene locus_tag LOCUS_28610 14018 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 15093 14770 gene locus_tag LOCUS_28620 15093 14770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 15219 15641 gene locus_tag LOCUS_28630 15219 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 >Feature sequence44 829 260 gene locus_tag LOCUS_28640 829 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 1798 848 gene locus_tag LOCUS_28650 1798 848 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_28650 2446 1841 gene locus_tag LOCUS_28660 gene rpsD 2446 1841 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403819.1 protein_id gnl|my_center|LOCUS_28660 2875 2465 gene locus_tag LOCUS_28670 gene rpsK 2875 2465 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923548.1 protein_id gnl|my_center|LOCUS_28670 3265 2888 gene locus_tag LOCUS_28680 gene rpsM 3265 2888 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_28680 3625 3407 gene locus_tag LOCUS_28690 gene infA 3625 3407 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_28690 4427 3618 gene locus_tag LOCUS_28700 gene map 4427 3618 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_28700 5740 4430 gene locus_tag LOCUS_28710 gene secY 5740 4430 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403814.1 protein_id gnl|my_center|LOCUS_28710 6222 5767 gene locus_tag LOCUS_28720 gene rplO 6222 5767 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_28720 6760 6236 gene locus_tag LOCUS_28730 gene rpsE 6760 6236 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_28730 7112 6777 gene locus_tag LOCUS_28740 gene rplR 7112 6777 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_28740 7678 7124 gene locus_tag LOCUS_28750 gene rplF 7678 7124 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403810.1 protein_id gnl|my_center|LOCUS_28750 8086 7694 gene locus_tag LOCUS_28760 gene rpsH 8086 7694 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403809.1 protein_id gnl|my_center|LOCUS_28760 8375 8106 gene locus_tag LOCUS_28770 gene rpsN 8375 8106 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_28770 8940 8389 gene locus_tag LOCUS_28780 gene rplE 8940 8389 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_28780 9310 8957 gene locus_tag LOCUS_28790 gene rplX 9310 8957 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_28790 9692 9324 gene locus_tag LOCUS_28800 gene rplN 9692 9324 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_28800 9969 9706 gene locus_tag LOCUS_28810 gene rpsQ 9969 9706 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_28810 10184 9984 gene locus_tag LOCUS_28820 gene rpmC 10184 9984 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_28820 10618 10196 gene locus_tag LOCUS_28830 gene rplP 10618 10196 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_28830 11393 10638 gene locus_tag LOCUS_28840 gene rpsC 11393 10638 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_28840 11783 11406 gene locus_tag LOCUS_28850 gene rplV 11783 11406 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_28850 12065 11796 gene locus_tag LOCUS_28860 gene rpsS 12065 11796 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403799.1 protein_id gnl|my_center|LOCUS_28860 12907 12077 gene locus_tag LOCUS_28870 gene rplB 12907 12077 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_28870 13210 12920 gene locus_tag LOCUS_28880 gene rplW 13210 12920 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879929.1 protein_id gnl|my_center|LOCUS_28880 13857 13207 gene locus_tag LOCUS_28890 gene rplD 13857 13207 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_28890 14500 13862 gene locus_tag LOCUS_28900 gene rplC 14500 13862 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403795.1 protein_id gnl|my_center|LOCUS_28900 14831 14520 gene locus_tag LOCUS_28910 gene rpsJ 14831 14520 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence45 1238 294 gene locus_tag LOCUS_28920 1238 294 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_28920 2242 1250 gene locus_tag LOCUS_28930 gene hflK 2242 1250 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678884.1 protein_id gnl|my_center|LOCUS_28930 4799 2265 gene locus_tag LOCUS_28940 4799 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 5067 6632 gene locus_tag LOCUS_28950 5067 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 7007 6633 gene locus_tag LOCUS_28960 7007 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 7573 7127 gene locus_tag LOCUS_28970 7573 7127 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_28970 8230 7622 gene locus_tag LOCUS_28980 gene sodA 8230 7622 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_28980 8448 9905 gene locus_tag LOCUS_28990 gene sthA 8448 9905 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091177.1 protein_id gnl|my_center|LOCUS_28990 10628 9921 gene locus_tag LOCUS_29000 10628 9921 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528989.1 protein_id gnl|my_center|LOCUS_29000 12400 10628 gene locus_tag LOCUS_29010 gene aspS 12400 10628 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404698.1 protein_id gnl|my_center|LOCUS_29010 12533 12910 gene locus_tag LOCUS_29020 12533 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence46 6990 4321 gene locus_tag LOCUS_29030 6990 4321 CDS product DUF11 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229124.1 protein_id gnl|my_center|LOCUS_29030 7556 7077 gene locus_tag LOCUS_29040 7556 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 7862 8737 gene locus_tag LOCUS_29050 7862 8737 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_29050 10012 8738 gene locus_tag LOCUS_29060 10012 8738 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_29060 10177 11175 gene locus_tag LOCUS_29070 10177 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence47 365 468 gene locus_tag LOCUS_r00010 365 468 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 598 2097 gene locus_tag LOCUS_29080 598 2097 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403298.1 protein_id gnl|my_center|LOCUS_29080 2087 2788 gene locus_tag LOCUS_29090 2087 2788 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_29090 2781 3641 gene locus_tag LOCUS_29100 2781 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 4303 3638 gene locus_tag LOCUS_29110 4303 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 5049 4357 gene locus_tag LOCUS_29120 5049 4357 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_29120 5187 6302 gene locus_tag LOCUS_29130 gene hisC 5187 6302 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_29130 6320 8389 gene locus_tag LOCUS_29140 6320 8389 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974947.1 protein_id gnl|my_center|LOCUS_29140 8485 10272 gene locus_tag LOCUS_29150 8485 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 >Feature sequence48 1237 65 gene locus_tag LOCUS_29160 1237 65 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963131.1 protein_id gnl|my_center|LOCUS_29160 1949 2530 gene locus_tag LOCUS_29170 1949 2530 CDS product YdeI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234230.1 protein_id gnl|my_center|LOCUS_29170 2868 5168 gene locus_tag LOCUS_29180 2868 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 5249 6793 gene locus_tag LOCUS_29190 5249 6793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 6975 7787 gene locus_tag LOCUS_29200 6975 7787 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_29200 7885 8127 gene locus_tag LOCUS_29210 7885 8127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 8120 8407 gene locus_tag LOCUS_29220 8120 8407 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_29220 9142 8429 gene locus_tag LOCUS_29230 9142 8429 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_29230 9786 9142 gene locus_tag LOCUS_29240 9786 9142 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_29240 >Feature sequence49 1739 516 gene locus_tag LOCUS_29250 1739 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_29250 2170 1736 gene locus_tag LOCUS_29260 2170 1736 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962255.1 protein_id gnl|my_center|LOCUS_29260 3372 2170 gene locus_tag LOCUS_29270 3372 2170 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_29270 3665 7462 gene locus_tag LOCUS_29280 3665 7462 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108607.1 protein_id gnl|my_center|LOCUS_29280 7563 9002 gene locus_tag LOCUS_29290 7563 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 9653 9123 gene locus_tag LOCUS_29300 9653 9123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 >Feature sequence50 104 361 gene locus_tag LOCUS_29310 104 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 494 1165 gene locus_tag LOCUS_29320 494 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1278 2231 gene locus_tag LOCUS_29330 1278 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2362 2727 gene locus_tag LOCUS_29340 2362 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 2855 3556 gene locus_tag LOCUS_29350 2855 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3705 4202 gene locus_tag LOCUS_29360 3705 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 4348 5259 gene locus_tag LOCUS_29370 4348 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 5445 5909 gene locus_tag LOCUS_29380 5445 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 6108 6491 gene locus_tag LOCUS_29390 6108 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 7290 6895 gene locus_tag LOCUS_29400 7290 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence51 <1 1984 gene locus_tag LOCUS_29410 <1 1984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000019766.1:transketolase 4915 2060 gene locus_tag LOCUS_29420 4915 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 5322 4918 gene locus_tag LOCUS_29430 5322 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 5416 6597 gene locus_tag LOCUS_29440 5416 6597 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_29440 >Feature sequence52 887 141 gene locus_tag LOCUS_29450 gene rnc 887 141 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933773.1 protein_id gnl|my_center|LOCUS_29450 2138 894 gene locus_tag LOCUS_29460 gene fabF 2138 894 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405457.1 protein_id gnl|my_center|LOCUS_29460 2395 2156 gene locus_tag LOCUS_29470 2395 2156 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405458.1 protein_id gnl|my_center|LOCUS_29470 3228 2479 gene locus_tag LOCUS_29480 gene fabG 3228 2479 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_29480 4126 3239 gene locus_tag LOCUS_29490 gene fabD 4126 3239 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962577.1 protein_id gnl|my_center|LOCUS_29490 5118 4126 gene locus_tag LOCUS_29500 5118 4126 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402830.1 protein_id gnl|my_center|LOCUS_29500 6113 5130 gene locus_tag LOCUS_29510 gene plsX 6113 5130 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927157.1 protein_id gnl|my_center|LOCUS_29510 >Feature sequence53 195 641 gene locus_tag LOCUS_29520 195 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2667 949 gene locus_tag LOCUS_29530 2667 949 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_29530 3906 2944 gene locus_tag LOCUS_29540 3906 2944 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_29540 >Feature sequence54 <1 653 gene locus_tag LOCUS_29550 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838694.1:sodium:alanine symporter family protein 658 1284 gene locus_tag LOCUS_29560 gene upp 658 1284 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404039.1 protein_id gnl|my_center|LOCUS_29560 1271 1822 gene locus_tag LOCUS_29570 1271 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 1819 3234 gene locus_tag LOCUS_29580 1819 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 3231 3881 gene locus_tag LOCUS_29590 3231 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 >Feature sequence55 1016 135 gene locus_tag LOCUS_29600 gene cysM 1016 135 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_29600 1852 1049 gene locus_tag LOCUS_29610 1852 1049 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_29610 >Feature sequence56 499 717 gene locus_tag LOCUS_29620 499 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 967 1233 gene locus_tag LOCUS_29630 967 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 1387 1818 gene locus_tag LOCUS_29640 1387 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 >Feature sequence57 814 38 gene locus_tag LOCUS_29650 814 38 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_29650 <1781 819 gene locus_tag LOCUS_29660 <1781 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838548.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence58 <1 1203 gene locus_tag LOCUS_29670 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023620081.1:elongation factor Tu >Feature sequence59 965 456 gene locus_tag LOCUS_29680 965 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141565.1 protein_id gnl|my_center|LOCUS_29680 >Feature sequence60 73 396 gene locus_tag LOCUS_29690 73 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 >Feature sequence61 >Feature sequence62 500 426 gene locus_tag LOCUS_t00330 500 426 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38