>Feature sequence001 287 1249 gene locus_tag LOCUS_00010 287 1249 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170167.1 protein_id gnl|my_center|LOCUS_00010 1256 1441 gene locus_tag LOCUS_00020 1256 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1552 2391 gene locus_tag LOCUS_00030 1552 2391 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974725.1 protein_id gnl|my_center|LOCUS_00030 2472 2846 gene locus_tag LOCUS_00040 2472 2846 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971138.1 protein_id gnl|my_center|LOCUS_00040 2843 3577 gene locus_tag LOCUS_00050 2843 3577 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082985.1 protein_id gnl|my_center|LOCUS_00050 3574 5082 gene locus_tag LOCUS_00060 3574 5082 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390980.1 protein_id gnl|my_center|LOCUS_00060 5200 6606 gene locus_tag LOCUS_00070 gene thrC 5200 6606 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337015.1 protein_id gnl|my_center|LOCUS_00070 6650 7924 gene locus_tag LOCUS_00080 6650 7924 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_00080 7996 8583 gene locus_tag LOCUS_00090 7996 8583 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084002.1 protein_id gnl|my_center|LOCUS_00090 8640 11585 gene locus_tag LOCUS_00100 8640 11585 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173457.1 protein_id gnl|my_center|LOCUS_00100 12236 11625 gene locus_tag LOCUS_00110 12236 11625 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084308.1 protein_id gnl|my_center|LOCUS_00110 12432 13259 gene locus_tag LOCUS_00120 12432 13259 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084307.1 protein_id gnl|my_center|LOCUS_00120 13382 13870 gene locus_tag LOCUS_00130 13382 13870 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_00130 14386 13940 gene locus_tag LOCUS_00140 gene rnhA 14386 13940 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_00140 15348 14383 gene locus_tag LOCUS_00150 15348 14383 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968913.1 protein_id gnl|my_center|LOCUS_00150 16315 15359 gene locus_tag LOCUS_00160 gene ispH 16315 15359 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 protein_id gnl|my_center|LOCUS_00160 16656 17198 gene locus_tag LOCUS_00170 16656 17198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470665.1 protein_id gnl|my_center|LOCUS_00170 17591 18727 gene locus_tag LOCUS_00180 gene gcvT 17591 18727 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478448.1 protein_id gnl|my_center|LOCUS_00180 18764 19141 gene locus_tag LOCUS_00190 gene gcvH 18764 19141 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390798.1 protein_id gnl|my_center|LOCUS_00190 19198 20544 gene locus_tag LOCUS_00200 gene gcvPA 19198 20544 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921182.1 protein_id gnl|my_center|LOCUS_00200 20545 22125 gene locus_tag LOCUS_00210 gene gcvPB 20545 22125 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390796.1 protein_id gnl|my_center|LOCUS_00210 22180 23409 gene locus_tag LOCUS_00220 22180 23409 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_00220 23406 23963 gene locus_tag LOCUS_00230 23406 23963 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083985.1 protein_id gnl|my_center|LOCUS_00230 24738 23950 gene locus_tag LOCUS_00240 24738 23950 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_00240 25336 24851 gene locus_tag LOCUS_00250 25336 24851 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532841.1 protein_id gnl|my_center|LOCUS_00250 25918 25355 gene locus_tag LOCUS_00260 25918 25355 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974652.1 protein_id gnl|my_center|LOCUS_00260 26219 25995 gene locus_tag LOCUS_00270 26219 25995 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006206606.1 protein_id gnl|my_center|LOCUS_00270 27096 26314 gene locus_tag LOCUS_00280 27096 26314 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532843.1 protein_id gnl|my_center|LOCUS_00280 27536 27156 gene locus_tag LOCUS_00290 27536 27156 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721377.1 protein_id gnl|my_center|LOCUS_00290 31266 27805 gene locus_tag LOCUS_00300 gene smc 31266 27805 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532753.1 protein_id gnl|my_center|LOCUS_00300 32050 31322 gene locus_tag LOCUS_00310 32050 31322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32693 32154 gene locus_tag LOCUS_00320 32693 32154 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390998.1 protein_id gnl|my_center|LOCUS_00320 32830 33963 gene locus_tag LOCUS_00330 gene mutY 32830 33963 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921414.1 protein_id gnl|my_center|LOCUS_00330 35189 34062 gene locus_tag LOCUS_00340 gene ccrM 35189 34062 CDS product adenine-specific DNA-methyltransferase CcrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918266.1 protein_id gnl|my_center|LOCUS_00340 35993 35247 gene locus_tag LOCUS_00350 35993 35247 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722129.1 protein_id gnl|my_center|LOCUS_00350 36551 36264 gene locus_tag LOCUS_00360 36551 36264 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_00360 37842 36565 gene locus_tag LOCUS_00370 37842 36565 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085306.1 protein_id gnl|my_center|LOCUS_00370 37901 38296 gene locus_tag LOCUS_00380 37901 38296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38418 39047 gene locus_tag LOCUS_00390 38418 39047 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_00390 39048 39647 gene locus_tag LOCUS_00400 39048 39647 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_00400 39644 40399 gene locus_tag LOCUS_00410 39644 40399 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_00410 40890 40396 gene locus_tag LOCUS_00420 gene mscL 40890 40396 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399960.1 protein_id gnl|my_center|LOCUS_00420 41440 40901 gene locus_tag LOCUS_00430 gene moaB 41440 40901 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383185.1 protein_id gnl|my_center|LOCUS_00430 44781 41563 gene locus_tag LOCUS_00440 44781 41563 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974276.1 protein_id gnl|my_center|LOCUS_00440 46100 44886 gene locus_tag LOCUS_00450 46100 44886 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312103.1 protein_id gnl|my_center|LOCUS_00450 46319 46906 gene locus_tag LOCUS_00460 46319 46906 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141420.1 protein_id gnl|my_center|LOCUS_00460 48833 47019 gene locus_tag LOCUS_00470 48833 47019 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388020.1 protein_id gnl|my_center|LOCUS_00470 49812 48928 gene locus_tag LOCUS_00480 49812 48928 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171746.1 protein_id gnl|my_center|LOCUS_00480 50067 51743 gene locus_tag LOCUS_00490 50067 51743 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919211.1 protein_id gnl|my_center|LOCUS_00490 51847 53643 gene locus_tag LOCUS_00500 51847 53643 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085312.1 protein_id gnl|my_center|LOCUS_00500 53648 54514 gene locus_tag LOCUS_00510 53648 54514 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336977.1 protein_id gnl|my_center|LOCUS_00510 55579 54560 gene locus_tag LOCUS_00520 55579 54560 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085318.1 protein_id gnl|my_center|LOCUS_00520 55762 55977 gene locus_tag LOCUS_00530 55762 55977 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720934.1 protein_id gnl|my_center|LOCUS_00530 55974 56756 gene locus_tag LOCUS_00540 55974 56756 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390702.1 protein_id gnl|my_center|LOCUS_00540 56860 57726 gene locus_tag LOCUS_00550 56860 57726 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085321.1 protein_id gnl|my_center|LOCUS_00550 57784 57984 gene locus_tag LOCUS_00560 57784 57984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 58168 59061 gene locus_tag LOCUS_00570 58168 59061 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038645360.1 protein_id gnl|my_center|LOCUS_00570 59058 61196 gene locus_tag LOCUS_00580 gene glyS 59058 61196 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085323.1 protein_id gnl|my_center|LOCUS_00580 61239 63926 gene locus_tag LOCUS_00590 gene ppdK 61239 63926 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532744.1 protein_id gnl|my_center|LOCUS_00590 64386 65108 gene locus_tag LOCUS_00600 64386 65108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 65980 65156 gene locus_tag LOCUS_00610 65980 65156 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409413.1 protein_id gnl|my_center|LOCUS_00610 66918 66055 gene locus_tag LOCUS_00620 gene nadC 66918 66055 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973559.1 protein_id gnl|my_center|LOCUS_00620 68528 66915 gene locus_tag LOCUS_00630 68528 66915 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085328.1 protein_id gnl|my_center|LOCUS_00630 69630 68557 gene locus_tag LOCUS_00640 gene nadA 69630 68557 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391193.1 protein_id gnl|my_center|LOCUS_00640 70902 69847 gene locus_tag LOCUS_00650 70902 69847 CDS product NAD regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175624.1 protein_id gnl|my_center|LOCUS_00650 71430 70909 gene locus_tag LOCUS_00660 71430 70909 CDS product protein-tyrosine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085338.1 protein_id gnl|my_center|LOCUS_00660 72118 71549 gene locus_tag LOCUS_00670 72118 71549 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265716.1 protein_id gnl|my_center|LOCUS_00670 72364 74901 gene locus_tag LOCUS_00680 72364 74901 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943070.1 protein_id gnl|my_center|LOCUS_00680 74901 75788 gene locus_tag LOCUS_00690 74901 75788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75791 76651 gene locus_tag LOCUS_00700 75791 76651 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390362.1 protein_id gnl|my_center|LOCUS_00700 76692 77063 gene locus_tag LOCUS_00710 76692 77063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 78060 77065 gene locus_tag LOCUS_00720 78060 77065 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404758.1 protein_id gnl|my_center|LOCUS_00720 79319 78195 gene locus_tag LOCUS_00730 79319 78195 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265715.1 protein_id gnl|my_center|LOCUS_00730 79502 80167 gene locus_tag LOCUS_00740 79502 80167 CDS product flavin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188642117.1 protein_id gnl|my_center|LOCUS_00740 80842 80177 gene locus_tag LOCUS_00750 80842 80177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 81573 80965 gene locus_tag LOCUS_00760 81573 80965 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085340.1 protein_id gnl|my_center|LOCUS_00760 82453 81551 gene locus_tag LOCUS_00770 82453 81551 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085341.1 protein_id gnl|my_center|LOCUS_00770 82606 83577 gene locus_tag LOCUS_00780 82606 83577 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389885.1 protein_id gnl|my_center|LOCUS_00780 83609 84196 gene locus_tag LOCUS_00790 83609 84196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 84296 85633 gene locus_tag LOCUS_00800 84296 85633 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085342.1 protein_id gnl|my_center|LOCUS_00800 86049 85777 gene locus_tag LOCUS_00810 86049 85777 CDS product usg protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529022.1 protein_id gnl|my_center|LOCUS_00810 86351 87340 gene locus_tag LOCUS_00820 86351 87340 CDS product MDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085331.1 protein_id gnl|my_center|LOCUS_00820 87358 89205 gene locus_tag LOCUS_00830 87358 89205 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090526.1 protein_id gnl|my_center|LOCUS_00830 89238 89879 gene locus_tag LOCUS_00840 89238 89879 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_00840 89918 91468 gene locus_tag LOCUS_00850 89918 91468 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930411.1 protein_id gnl|my_center|LOCUS_00850 91908 91612 gene locus_tag LOCUS_00860 91908 91612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 92495 92085 gene locus_tag LOCUS_00870 92495 92085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 93560 92595 gene locus_tag LOCUS_00880 93560 92595 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921208.1 protein_id gnl|my_center|LOCUS_00880 93753 94913 gene locus_tag LOCUS_00890 gene hcuB 93753 94913 CDS product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_00890 96084 94930 gene locus_tag LOCUS_00900 gene lldD 96084 94930 CDS product FMN-dependent L-lactate dehydrogenase LldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919035.1 protein_id gnl|my_center|LOCUS_00900 96612 96115 gene locus_tag LOCUS_00910 96612 96115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 97401 96619 gene locus_tag LOCUS_00920 97401 96619 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921209.1 protein_id gnl|my_center|LOCUS_00920 97930 97580 gene locus_tag LOCUS_00930 97930 97580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 98519 98013 gene locus_tag LOCUS_00940 gene zur 98519 98013 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_00940 98616 99365 gene locus_tag LOCUS_00950 98616 99365 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085350.1 protein_id gnl|my_center|LOCUS_00950 99682 99536 gene locus_tag LOCUS_00960 99682 99536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 99802 101142 gene locus_tag LOCUS_00970 99802 101142 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_00970 102795 101368 gene locus_tag LOCUS_00980 102795 101368 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971098.1 protein_id gnl|my_center|LOCUS_00980 103186 102899 gene locus_tag LOCUS_00990 103186 102899 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089332.1 protein_id gnl|my_center|LOCUS_00990 104645 103275 gene locus_tag LOCUS_01000 104645 103275 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225318.1 protein_id gnl|my_center|LOCUS_01000 104952 105821 gene locus_tag LOCUS_01010 104952 105821 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174812.1 protein_id gnl|my_center|LOCUS_01010 106798 105818 gene locus_tag LOCUS_01020 106798 105818 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388203.1 protein_id gnl|my_center|LOCUS_01020 106895 108664 gene locus_tag LOCUS_01030 106895 108664 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532808.1 protein_id gnl|my_center|LOCUS_01030 108786 109841 gene locus_tag LOCUS_01040 108786 109841 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265540.1 protein_id gnl|my_center|LOCUS_01040 109873 110802 gene locus_tag LOCUS_01050 109873 110802 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390366.1 protein_id gnl|my_center|LOCUS_01050 110836 111096 gene locus_tag LOCUS_01060 110836 111096 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532792.1 protein_id gnl|my_center|LOCUS_01060 111110 112018 gene locus_tag LOCUS_01070 111110 112018 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626423.1 protein_id gnl|my_center|LOCUS_01070 112103 114049 gene locus_tag LOCUS_01080 gene dxs 112103 114049 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532789.1 protein_id gnl|my_center|LOCUS_01080 114073 114801 gene locus_tag LOCUS_01090 114073 114801 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974694.1 protein_id gnl|my_center|LOCUS_01090 114798 116042 gene locus_tag LOCUS_01100 114798 116042 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338785.1 protein_id gnl|my_center|LOCUS_01100 117139 116054 gene locus_tag LOCUS_01110 gene aroC 117139 116054 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085417.1 protein_id gnl|my_center|LOCUS_01110 118046 117207 gene locus_tag LOCUS_01120 gene fabI 118046 117207 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971127.1 protein_id gnl|my_center|LOCUS_01120 119070 118174 gene locus_tag LOCUS_01130 119070 118174 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101778793.1 protein_id gnl|my_center|LOCUS_01130 119831 119130 gene locus_tag LOCUS_01140 119831 119130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 120349 119861 gene locus_tag LOCUS_01150 120349 119861 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_01150 120495 121121 gene locus_tag LOCUS_01160 gene pdxH 120495 121121 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309812.1 protein_id gnl|my_center|LOCUS_01160 121177 122142 gene locus_tag LOCUS_01170 121177 122142 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_01170 122156 123733 gene locus_tag LOCUS_01180 122156 123733 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918804.1 protein_id gnl|my_center|LOCUS_01180 123849 124604 gene locus_tag LOCUS_01190 123849 124604 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085409.1 protein_id gnl|my_center|LOCUS_01190 125205 124789 gene locus_tag LOCUS_01200 125205 124789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 126595 125210 gene locus_tag LOCUS_01210 126595 125210 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975253.1 protein_id gnl|my_center|LOCUS_01210 128308 126851 gene locus_tag LOCUS_01220 128308 126851 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090620.1 protein_id gnl|my_center|LOCUS_01220 128494 130134 gene locus_tag LOCUS_01230 128494 130134 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532739.1 protein_id gnl|my_center|LOCUS_01230 130207 130956 gene locus_tag LOCUS_01240 130207 130956 CDS product DUF1499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085404.1 protein_id gnl|my_center|LOCUS_01240 131987 131079 gene locus_tag LOCUS_01250 131987 131079 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_01250 131895 132080 gene locus_tag LOCUS_01260 131895 132080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 132638 132087 gene locus_tag LOCUS_01270 132638 132087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 132774 133355 gene locus_tag LOCUS_01280 132774 133355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 133865 133389 gene locus_tag LOCUS_01290 133865 133389 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_01290 134275 134054 gene locus_tag LOCUS_01300 134275 134054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 136079 134529 gene locus_tag LOCUS_01310 136079 134529 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085735.1 protein_id gnl|my_center|LOCUS_01310 136348 136539 gene locus_tag LOCUS_01320 136348 136539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 138103 136661 gene locus_tag LOCUS_01330 138103 136661 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804244.1 protein_id gnl|my_center|LOCUS_01330 <138820 138112 gene locus_tag LOCUS_01340 <138820 138112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226839.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence002 1498 98 gene locus_tag LOCUS_01350 1498 98 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921144.1 protein_id gnl|my_center|LOCUS_01350 3270 1495 gene locus_tag LOCUS_01360 3270 1495 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173037.1 protein_id gnl|my_center|LOCUS_01360 4337 3501 gene locus_tag LOCUS_01370 4337 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4710 6284 gene locus_tag LOCUS_01380 4710 6284 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529737.1 protein_id gnl|my_center|LOCUS_01380 7047 6616 gene locus_tag LOCUS_01390 7047 6616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 7521 7111 gene locus_tag LOCUS_01400 7521 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 8181 9722 gene locus_tag LOCUS_01410 8181 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 10078 9758 gene locus_tag LOCUS_01420 10078 9758 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533838.1 protein_id gnl|my_center|LOCUS_01420 10542 10715 gene locus_tag LOCUS_01430 10542 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11408 10791 gene locus_tag LOCUS_01440 11408 10791 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083483.1 protein_id gnl|my_center|LOCUS_01440 11483 11887 gene locus_tag LOCUS_01450 11483 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 12773 11901 gene locus_tag LOCUS_01460 12773 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 13534 12899 gene locus_tag LOCUS_01470 13534 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14209 13838 gene locus_tag LOCUS_01480 14209 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 16122 14350 gene locus_tag LOCUS_01490 16122 14350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 18023 16251 gene locus_tag LOCUS_01500 18023 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 19181 18135 gene locus_tag LOCUS_01510 19181 18135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 19603 19340 gene locus_tag LOCUS_01520 19603 19340 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529099.1 protein_id gnl|my_center|LOCUS_01520 20035 19733 gene locus_tag LOCUS_01530 20035 19733 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037332.1 protein_id gnl|my_center|LOCUS_01530 20885 20052 gene locus_tag LOCUS_01540 20885 20052 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973301.1 protein_id gnl|my_center|LOCUS_01540 20942 22270 gene locus_tag LOCUS_01550 20942 22270 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090554.1 protein_id gnl|my_center|LOCUS_01550 22267 23700 gene locus_tag LOCUS_01560 gene pyk 22267 23700 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066892.1 protein_id gnl|my_center|LOCUS_01560 24716 23697 gene locus_tag LOCUS_01570 24716 23697 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529205.1 protein_id gnl|my_center|LOCUS_01570 25385 24777 gene locus_tag LOCUS_01580 25385 24777 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967322.1 protein_id gnl|my_center|LOCUS_01580 26490 25435 gene locus_tag LOCUS_01590 26490 25435 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256493.1 protein_id gnl|my_center|LOCUS_01590 26819 26694 gene locus_tag LOCUS_01600 gene ykgO 26819 26694 CDS product type B 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709334.1 protein_id gnl|my_center|LOCUS_01600 27096 28538 gene locus_tag LOCUS_01610 27096 28538 CDS product CHASE3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625987.1 protein_id gnl|my_center|LOCUS_01610 28541 29023 gene locus_tag LOCUS_01620 28541 29023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 29098 30093 gene locus_tag LOCUS_01630 29098 30093 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_01630 30146 30916 gene locus_tag LOCUS_01640 30146 30916 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_01640 32262 30913 gene locus_tag LOCUS_01650 32262 30913 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265614.1 protein_id gnl|my_center|LOCUS_01650 33147 32359 gene locus_tag LOCUS_01660 33147 32359 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_01660 33309 34544 gene locus_tag LOCUS_01670 33309 34544 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728213.1 protein_id gnl|my_center|LOCUS_01670 36316 34541 gene locus_tag LOCUS_01680 gene atsA 36316 34541 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_01680 37435 36578 gene locus_tag LOCUS_01690 37435 36578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 37588 38259 gene locus_tag LOCUS_01700 37588 38259 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173710.1 protein_id gnl|my_center|LOCUS_01700 38424 38681 gene locus_tag LOCUS_01710 38424 38681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 39146 38754 gene locus_tag LOCUS_01720 39146 38754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 39301 39714 gene locus_tag LOCUS_01730 39301 39714 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_01730 39719 40861 gene locus_tag LOCUS_01740 39719 40861 CDS product thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085742.1 protein_id gnl|my_center|LOCUS_01740 40891 41577 gene locus_tag LOCUS_01750 40891 41577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 41656 42264 gene locus_tag LOCUS_01760 41656 42264 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088446.1 protein_id gnl|my_center|LOCUS_01760 42288 43133 gene locus_tag LOCUS_01770 42288 43133 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_01770 43295 44128 gene locus_tag LOCUS_01780 43295 44128 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_01780 44209 45408 gene locus_tag LOCUS_01790 44209 45408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_01790 48490 45410 gene locus_tag LOCUS_01800 48490 45410 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814731.1 protein_id gnl|my_center|LOCUS_01800 49645 48506 gene locus_tag LOCUS_01810 49645 48506 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_01810 49925 49851 gene locus_tag LOCUS_t00010 49925 49851 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 50394 50068 gene locus_tag LOCUS_01820 gene cpdR1 50394 50068 CDS product response regulator CpdR1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709376.1 protein_id gnl|my_center|LOCUS_01820 50717 51682 gene locus_tag LOCUS_01830 50717 51682 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970220.1 protein_id gnl|my_center|LOCUS_01830 52100 53038 gene locus_tag LOCUS_01840 52100 53038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 53078 54661 gene locus_tag LOCUS_01850 53078 54661 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_01850 55539 54658 gene locus_tag LOCUS_01860 55539 54658 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388335.1 protein_id gnl|my_center|LOCUS_01860 56356 55640 gene locus_tag LOCUS_01870 56356 55640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 58080 56353 gene locus_tag LOCUS_01880 58080 56353 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113468.1 protein_id gnl|my_center|LOCUS_01880 59551 58166 gene locus_tag LOCUS_01890 59551 58166 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086529.1 protein_id gnl|my_center|LOCUS_01890 60222 59548 gene locus_tag LOCUS_01900 60222 59548 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086528.1 protein_id gnl|my_center|LOCUS_01900 60450 61421 gene locus_tag LOCUS_01910 60450 61421 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_01910 61423 62616 gene locus_tag LOCUS_01920 61423 62616 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185574.1 protein_id gnl|my_center|LOCUS_01920 63358 62666 gene locus_tag LOCUS_01930 63358 62666 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504113.1 protein_id gnl|my_center|LOCUS_01930 63906 63358 gene locus_tag LOCUS_01940 63906 63358 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_01940 65176 63923 gene locus_tag LOCUS_01950 65176 63923 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563408.1 protein_id gnl|my_center|LOCUS_01950 65343 65912 gene locus_tag LOCUS_01960 65343 65912 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456641.1 protein_id gnl|my_center|LOCUS_01960 66024 66875 gene locus_tag LOCUS_01970 66024 66875 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083931.1 protein_id gnl|my_center|LOCUS_01970 66925 67275 gene locus_tag LOCUS_01980 66925 67275 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965261.1 protein_id gnl|my_center|LOCUS_01980 67283 67681 gene locus_tag LOCUS_01990 67283 67681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 67920 69776 gene locus_tag LOCUS_02000 gene typA 67920 69776 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387909.1 protein_id gnl|my_center|LOCUS_02000 69850 70854 gene locus_tag LOCUS_02010 69850 70854 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063668.1 protein_id gnl|my_center|LOCUS_02010 70921 71730 gene locus_tag LOCUS_02020 gene hisN 70921 71730 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384990.1 protein_id gnl|my_center|LOCUS_02020 72672 71734 gene locus_tag LOCUS_02030 72672 71734 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090464.1 protein_id gnl|my_center|LOCUS_02030 73049 72669 gene locus_tag LOCUS_02040 73049 72669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 73252 74733 gene locus_tag LOCUS_02050 73252 74733 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086717.1 protein_id gnl|my_center|LOCUS_02050 75226 74837 gene locus_tag LOCUS_02060 75226 74837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 76245 75382 gene locus_tag LOCUS_02070 76245 75382 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525180.1 protein_id gnl|my_center|LOCUS_02070 76988 76245 gene locus_tag LOCUS_02080 76988 76245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243767.1 protein_id gnl|my_center|LOCUS_02080 77947 76985 gene locus_tag LOCUS_02090 77947 76985 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_02090 78846 77944 gene locus_tag LOCUS_02100 78846 77944 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039248.1 protein_id gnl|my_center|LOCUS_02100 80071 78860 gene locus_tag LOCUS_02110 80071 78860 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_02110 80272 80736 gene locus_tag LOCUS_02120 80272 80736 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531141.1 protein_id gnl|my_center|LOCUS_02120 83467 80786 gene locus_tag LOCUS_02130 83467 80786 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626250.1 protein_id gnl|my_center|LOCUS_02130 83745 86300 gene locus_tag LOCUS_02140 83745 86300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 86753 86319 gene locus_tag LOCUS_02150 86753 86319 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390402.1 protein_id gnl|my_center|LOCUS_02150 87871 86834 gene locus_tag LOCUS_02160 87871 86834 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326310.1 protein_id gnl|my_center|LOCUS_02160 88797 87931 gene locus_tag LOCUS_02170 88797 87931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 89428 94122 gene locus_tag LOCUS_02180 gene gltB 89428 94122 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090468.1 protein_id gnl|my_center|LOCUS_02180 94123 95544 gene locus_tag LOCUS_02190 94123 95544 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_02190 95690 96676 gene locus_tag LOCUS_02200 95690 96676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 97086 96673 gene locus_tag LOCUS_02210 97086 96673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 98546 97095 gene locus_tag LOCUS_02220 98546 97095 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_02220 99921 98674 gene locus_tag LOCUS_02230 99921 98674 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 protein_id gnl|my_center|LOCUS_02230 100915 99890 gene locus_tag LOCUS_02240 100915 99890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 102649 101216 gene locus_tag LOCUS_02250 102649 101216 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088880.1 protein_id gnl|my_center|LOCUS_02250 103605 102658 gene locus_tag LOCUS_02260 103605 102658 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088879.1 protein_id gnl|my_center|LOCUS_02260 104889 103756 gene locus_tag LOCUS_02270 104889 103756 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_02270 106333 105017 gene locus_tag LOCUS_02280 106333 105017 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_02280 107172 106447 gene locus_tag LOCUS_02290 107172 106447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 107298 109376 gene locus_tag LOCUS_02300 107298 109376 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640693.1 protein_id gnl|my_center|LOCUS_02300 109492 109860 gene locus_tag LOCUS_02310 109492 109860 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742207.1 protein_id gnl|my_center|LOCUS_02310 110105 109857 gene locus_tag LOCUS_02320 110105 109857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 111355 110105 gene locus_tag LOCUS_02330 111355 110105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 112173 111430 gene locus_tag LOCUS_02340 112173 111430 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088363.1 protein_id gnl|my_center|LOCUS_02340 113045 112227 gene locus_tag LOCUS_02350 113045 112227 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967763.1 protein_id gnl|my_center|LOCUS_02350 114002 113055 gene locus_tag LOCUS_02360 114002 113055 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088359.1 protein_id gnl|my_center|LOCUS_02360 115428 114010 gene locus_tag LOCUS_02370 115428 114010 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175426.1 protein_id gnl|my_center|LOCUS_02370 116892 115612 gene locus_tag LOCUS_02380 116892 115612 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268984.1 protein_id gnl|my_center|LOCUS_02380 118956 116971 gene locus_tag LOCUS_02390 118956 116971 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040120974.1 protein_id gnl|my_center|LOCUS_02390 119058 120371 gene locus_tag LOCUS_02400 119058 120371 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530194.1 protein_id gnl|my_center|LOCUS_02400 120483 122180 gene locus_tag LOCUS_02410 120483 122180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 122223 123809 gene locus_tag LOCUS_02420 122223 123809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 124865 123819 gene locus_tag LOCUS_02430 gene galK 124865 123819 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_02430 125959 124862 gene locus_tag LOCUS_02440 gene galT 125959 124862 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_02440 126043 127044 gene locus_tag LOCUS_02450 gene pseB 126043 127044 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_02450 127041 128210 gene locus_tag LOCUS_02460 gene pseC 127041 128210 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_02460 128207 128896 gene locus_tag LOCUS_02470 gene pseF 128207 128896 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_02470 130093 128900 gene locus_tag LOCUS_02480 130093 128900 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230579.1 protein_id gnl|my_center|LOCUS_02480 130640 130086 gene locus_tag LOCUS_02490 130640 130086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 131128 130637 gene locus_tag LOCUS_02500 131128 130637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 131036 131554 gene locus_tag LOCUS_02510 131036 131554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence003 <1 599 gene locus_tag LOCUS_02520 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812990.1:ergothioneine biosynthesis protein EgtB 596 1573 gene locus_tag LOCUS_02530 gene egtD 596 1573 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_02530 1588 2214 gene locus_tag LOCUS_02540 1588 2214 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920924.1 protein_id gnl|my_center|LOCUS_02540 2697 2221 gene locus_tag LOCUS_02550 2697 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2611 2859 gene locus_tag LOCUS_02560 2611 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3163 2948 gene locus_tag LOCUS_02570 3163 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3242 3562 gene locus_tag LOCUS_02580 3242 3562 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775271.1 protein_id gnl|my_center|LOCUS_02580 3541 3762 gene locus_tag LOCUS_02590 3541 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4160 4441 gene locus_tag LOCUS_02600 4160 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 4722 4438 gene locus_tag LOCUS_02610 4722 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4908 4832 gene locus_tag LOCUS_t00020 4908 4832 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5736 5059 gene locus_tag LOCUS_02620 5736 5059 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_02620 7054 5831 gene locus_tag LOCUS_02630 gene mnmA 7054 5831 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089733.1 protein_id gnl|my_center|LOCUS_02630 7474 8865 gene locus_tag LOCUS_02640 7474 8865 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089734.1 protein_id gnl|my_center|LOCUS_02640 8886 9566 gene locus_tag LOCUS_02650 8886 9566 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089735.1 protein_id gnl|my_center|LOCUS_02650 9700 9975 gene locus_tag LOCUS_02660 9700 9975 CDS product DUF1153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002714638.1 protein_id gnl|my_center|LOCUS_02660 10273 11940 gene locus_tag LOCUS_02670 gene fliF 10273 11940 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089736.1 protein_id gnl|my_center|LOCUS_02670 11952 12977 gene locus_tag LOCUS_02680 gene fliG 11952 12977 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918790.1 protein_id gnl|my_center|LOCUS_02680 12974 13693 gene locus_tag LOCUS_02690 12974 13693 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089738.1 protein_id gnl|my_center|LOCUS_02690 13721 14074 gene locus_tag LOCUS_02700 gene fliN 13721 14074 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388300.1 protein_id gnl|my_center|LOCUS_02700 14129 15496 gene locus_tag LOCUS_02710 gene flbD 14129 15496 CDS product sigma-54-dependent transcriptional regulator FlbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918793.1 protein_id gnl|my_center|LOCUS_02710 15532 17667 gene locus_tag LOCUS_02720 gene flhA 15532 17667 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966504.1 protein_id gnl|my_center|LOCUS_02720 17953 18276 gene locus_tag LOCUS_02730 17953 18276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 18771 18286 gene locus_tag LOCUS_02740 18771 18286 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189237.1 protein_id gnl|my_center|LOCUS_02740 19261 18851 gene locus_tag LOCUS_02750 gene fliJ 19261 18851 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084990.1 protein_id gnl|my_center|LOCUS_02750 20598 19261 gene locus_tag LOCUS_02760 gene fliI 20598 19261 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084989.1 protein_id gnl|my_center|LOCUS_02760 20959 21666 gene locus_tag LOCUS_02770 gene ctrA 20959 21666 CDS product cell cycle two-component system response regulator CtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006203583.1 protein_id gnl|my_center|LOCUS_02770 22410 21748 gene locus_tag LOCUS_02780 22410 21748 CDS product histidine phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967810.1 protein_id gnl|my_center|LOCUS_02780 22545 23357 gene locus_tag LOCUS_02790 gene cysQ 22545 23357 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_02790 24024 23674 gene locus_tag LOCUS_02800 24024 23674 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098276.1 protein_id gnl|my_center|LOCUS_02800 24205 24038 gene locus_tag LOCUS_02810 24205 24038 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927077.1 protein_id gnl|my_center|LOCUS_02810 26355 24265 gene locus_tag LOCUS_02820 26355 24265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 26529 27161 gene locus_tag LOCUS_02830 26529 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 27292 28077 gene locus_tag LOCUS_02840 27292 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 28165 28575 gene locus_tag LOCUS_02850 28165 28575 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918016.1 protein_id gnl|my_center|LOCUS_02850 28680 28605 gene locus_tag LOCUS_t00030 28680 28605 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29734 29330 gene locus_tag LOCUS_02860 29734 29330 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031389.1 protein_id gnl|my_center|LOCUS_02860 29779 30780 gene locus_tag LOCUS_02870 29779 30780 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087640.1 protein_id gnl|my_center|LOCUS_02870 31427 31020 gene locus_tag LOCUS_02880 31427 31020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 31426 32508 gene locus_tag LOCUS_02890 31426 32508 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527565.1 protein_id gnl|my_center|LOCUS_02890 32510 33220 gene locus_tag LOCUS_02900 32510 33220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 33260 33490 gene locus_tag LOCUS_02910 33260 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 33578 34171 gene locus_tag LOCUS_02920 33578 34171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976044.1 protein_id gnl|my_center|LOCUS_02920 34485 34168 gene locus_tag LOCUS_02930 34485 34168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 34910 35839 gene locus_tag LOCUS_02940 gene rpoH 34910 35839 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388865.1 protein_id gnl|my_center|LOCUS_02940 36019 37149 gene locus_tag LOCUS_02950 36019 37149 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626611.1 protein_id gnl|my_center|LOCUS_02950 37815 37159 gene locus_tag LOCUS_02960 gene msrA 37815 37159 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083656.1 protein_id gnl|my_center|LOCUS_02960 38004 39731 gene locus_tag LOCUS_02970 38004 39731 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_02970 40404 39874 gene locus_tag LOCUS_02980 40404 39874 CDS product mismatch-specific DNA-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966411.1 protein_id gnl|my_center|LOCUS_02980 40778 40404 gene locus_tag LOCUS_02990 40778 40404 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047694002.1 protein_id gnl|my_center|LOCUS_02990 42876 41005 gene locus_tag LOCUS_03000 gene thiC 42876 41005 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089399.1 protein_id gnl|my_center|LOCUS_03000 43127 44191 gene locus_tag LOCUS_03010 43127 44191 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970396.1 protein_id gnl|my_center|LOCUS_03010 44216 44632 gene locus_tag LOCUS_03020 44216 44632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 44754 45158 gene locus_tag LOCUS_03030 44754 45158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 46527 45235 gene locus_tag LOCUS_03040 46527 45235 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243415.1 protein_id gnl|my_center|LOCUS_03040 46714 47631 gene locus_tag LOCUS_03050 46714 47631 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083635.1 protein_id gnl|my_center|LOCUS_03050 47636 48025 gene locus_tag LOCUS_03060 47636 48025 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190295.1 protein_id gnl|my_center|LOCUS_03060 48022 48672 gene locus_tag LOCUS_03070 48022 48672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 49176 48679 gene locus_tag LOCUS_03080 49176 48679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 49780 49292 gene locus_tag LOCUS_03090 49780 49292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 51511 49934 gene locus_tag LOCUS_03100 gene serA 51511 49934 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090136.1 protein_id gnl|my_center|LOCUS_03100 52768 51593 gene locus_tag LOCUS_03110 52768 51593 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529158.1 protein_id gnl|my_center|LOCUS_03110 52938 53864 gene locus_tag LOCUS_03120 52938 53864 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016348905.1 protein_id gnl|my_center|LOCUS_03120 54447 53854 gene locus_tag LOCUS_03130 54447 53854 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158301.1 protein_id gnl|my_center|LOCUS_03130 55268 54477 gene locus_tag LOCUS_03140 55268 54477 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776815.1 protein_id gnl|my_center|LOCUS_03140 55409 56839 gene locus_tag LOCUS_03150 55409 56839 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532134.1 protein_id gnl|my_center|LOCUS_03150 56920 57393 gene locus_tag LOCUS_03160 56920 57393 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868975.1 protein_id gnl|my_center|LOCUS_03160 58217 57396 gene locus_tag LOCUS_03170 gene thiD 58217 57396 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921056.1 protein_id gnl|my_center|LOCUS_03170 59594 58248 gene locus_tag LOCUS_03180 gene glmM 59594 58248 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174702.1 protein_id gnl|my_center|LOCUS_03180 60578 59760 gene locus_tag LOCUS_03190 gene sul2 60578 59760 CDS product sulfonamide-resistant dihydropteroate synthase Sul2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043265.1 protein_id gnl|my_center|LOCUS_03190 61251 60625 gene locus_tag LOCUS_03200 61251 60625 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707289.1 protein_id gnl|my_center|LOCUS_03200 61420 62685 gene locus_tag LOCUS_03210 61420 62685 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_03210 62699 63022 gene locus_tag LOCUS_03220 62699 63022 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_03220 65014 63098 gene locus_tag LOCUS_03230 gene ftsH 65014 63098 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089881.1 protein_id gnl|my_center|LOCUS_03230 65801 65163 gene locus_tag LOCUS_03240 65801 65163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 65745 66203 gene locus_tag LOCUS_03250 65745 66203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 67472 66546 gene locus_tag LOCUS_03260 67472 66546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 68134 67634 gene locus_tag LOCUS_03270 gene pal 68134 67634 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388850.1 protein_id gnl|my_center|LOCUS_03270 69840 68482 gene locus_tag LOCUS_03280 gene tolB 69840 68482 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973273.1 protein_id gnl|my_center|LOCUS_03280 70695 69877 gene locus_tag LOCUS_03290 70695 69877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 71163 70705 gene locus_tag LOCUS_03300 gene tolR 71163 70705 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527592.1 protein_id gnl|my_center|LOCUS_03300 71895 71167 gene locus_tag LOCUS_03310 gene tolQ 71895 71167 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089890.1 protein_id gnl|my_center|LOCUS_03310 72604 72137 gene locus_tag LOCUS_03320 gene ybgC 72604 72137 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921067.1 protein_id gnl|my_center|LOCUS_03320 73650 72601 gene locus_tag LOCUS_03330 gene ruvB 73650 72601 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094976806.1 protein_id gnl|my_center|LOCUS_03330 74264 73647 gene locus_tag LOCUS_03340 gene ruvA 74264 73647 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084352.1 protein_id gnl|my_center|LOCUS_03340 74788 74261 gene locus_tag LOCUS_03350 gene ruvC 74788 74261 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535966.1 protein_id gnl|my_center|LOCUS_03350 74714 74932 gene locus_tag LOCUS_03360 74714 74932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 75627 74881 gene locus_tag LOCUS_03370 75627 74881 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084350.1 protein_id gnl|my_center|LOCUS_03370 77010 75979 gene locus_tag LOCUS_03380 77010 75979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 77828 77016 gene locus_tag LOCUS_03390 77828 77016 CDS product YmdB family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921077.1 protein_id gnl|my_center|LOCUS_03390 78423 77833 gene locus_tag LOCUS_03400 78423 77833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 79030 78671 gene locus_tag LOCUS_03410 79030 78671 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921080.1 protein_id gnl|my_center|LOCUS_03410 79323 79057 gene locus_tag LOCUS_03420 79323 79057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 79721 81688 gene locus_tag LOCUS_03430 gene tkt 79721 81688 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024310980.1 protein_id gnl|my_center|LOCUS_03430 81711 82718 gene locus_tag LOCUS_03440 gene gap 81711 82718 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084339.1 protein_id gnl|my_center|LOCUS_03440 82738 83946 gene locus_tag LOCUS_03450 82738 83946 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393616.1 protein_id gnl|my_center|LOCUS_03450 83992 85011 gene locus_tag LOCUS_03460 83992 85011 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529246.1 protein_id gnl|my_center|LOCUS_03460 85096 85755 gene locus_tag LOCUS_03470 gene thiE 85096 85755 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388835.1 protein_id gnl|my_center|LOCUS_03470 85767 86810 gene locus_tag LOCUS_03480 85767 86810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 86943 87506 gene locus_tag LOCUS_03490 gene efp 86943 87506 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529127.1 protein_id gnl|my_center|LOCUS_03490 87517 88320 gene locus_tag LOCUS_03500 87517 88320 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529126.1 protein_id gnl|my_center|LOCUS_03500 88450 89187 gene locus_tag LOCUS_03510 88450 89187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 89325 89762 gene locus_tag LOCUS_03520 89325 89762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 89797 90759 gene locus_tag LOCUS_03530 89797 90759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440088.1 protein_id gnl|my_center|LOCUS_03530 90766 91788 gene locus_tag LOCUS_03540 90766 91788 CDS product peptidoglycan -binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084326.1 protein_id gnl|my_center|LOCUS_03540 92883 91789 gene locus_tag LOCUS_03550 92883 91789 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_03550 94757 92907 gene locus_tag LOCUS_03560 94757 92907 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_03560 95102 95323 gene locus_tag LOCUS_03570 gene rpmE 95102 95323 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004616338.1 protein_id gnl|my_center|LOCUS_03570 95989 95399 gene locus_tag LOCUS_03580 gene rcdA 95989 95399 CDS product protease adaptor protein RcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921127.1 protein_id gnl|my_center|LOCUS_03580 96566 96366 gene locus_tag LOCUS_03590 96566 96366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 96668 97663 gene locus_tag LOCUS_03600 96668 97663 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_03600 97812 98375 gene locus_tag LOCUS_03610 97812 98375 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931004.1 protein_id gnl|my_center|LOCUS_03610 98557 99288 gene locus_tag LOCUS_03620 98557 99288 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531751.1 protein_id gnl|my_center|LOCUS_03620 100380 99550 gene locus_tag LOCUS_03630 100380 99550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089546.1 protein_id gnl|my_center|LOCUS_03630 100740 100877 gene locus_tag LOCUS_03640 100740 100877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03640 102888 100981 gene locus_tag LOCUS_03650 102888 100981 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528095.1 protein_id gnl|my_center|LOCUS_03650 103130 104758 gene locus_tag LOCUS_03660 103130 104758 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532916.1 protein_id gnl|my_center|LOCUS_03660 105132 105794 gene locus_tag LOCUS_03670 105132 105794 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086312.1 protein_id gnl|my_center|LOCUS_03670 105877 106083 gene locus_tag LOCUS_03680 105877 106083 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089847.1 protein_id gnl|my_center|LOCUS_03680 106803 106087 gene locus_tag LOCUS_03690 106803 106087 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921117.1 protein_id gnl|my_center|LOCUS_03690 106964 108841 gene locus_tag LOCUS_03700 106964 108841 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640264.1 protein_id gnl|my_center|LOCUS_03700 108967 109467 gene locus_tag LOCUS_03710 gene purE 108967 109467 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536030.1 protein_id gnl|my_center|LOCUS_03710 109471 110586 gene locus_tag LOCUS_03720 109471 110586 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921115.1 protein_id gnl|my_center|LOCUS_03720 110677 111312 gene locus_tag LOCUS_03730 110677 111312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 111404 112030 gene locus_tag LOCUS_03740 111404 112030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 112726 112031 gene locus_tag LOCUS_03750 112726 112031 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_03750 113363 112719 gene locus_tag LOCUS_03760 gene def 113363 112719 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388799.1 protein_id gnl|my_center|LOCUS_03760 113553 113771 gene locus_tag LOCUS_03770 gene rpsU 113553 113771 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066968.1 protein_id gnl|my_center|LOCUS_03770 114023 113838 gene locus_tag LOCUS_03780 114023 113838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 115215 114037 gene locus_tag LOCUS_03790 115215 114037 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088170.1 protein_id gnl|my_center|LOCUS_03790 117434 115236 gene locus_tag LOCUS_03800 117434 115236 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268301.1 protein_id gnl|my_center|LOCUS_03800 118090 117608 gene locus_tag LOCUS_03810 118090 117608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 118475 118092 gene locus_tag LOCUS_03820 118475 118092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 118897 118520 gene locus_tag LOCUS_03830 118897 118520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 119700 118987 gene locus_tag LOCUS_03840 119700 118987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03840 120392 119649 gene locus_tag LOCUS_03850 120392 119649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03850 120723 120406 gene locus_tag LOCUS_03860 120723 120406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 121856 120723 gene locus_tag LOCUS_03870 121856 120723 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390032.1 protein_id gnl|my_center|LOCUS_03870 122125 121982 gene locus_tag LOCUS_03880 122125 121982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 123269 122286 gene locus_tag LOCUS_03890 123269 122286 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921140.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence004 1579 695 gene locus_tag LOCUS_03900 1579 695 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703672.1 protein_id gnl|my_center|LOCUS_03900 2328 1576 gene locus_tag LOCUS_03910 2328 1576 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338043.1 protein_id gnl|my_center|LOCUS_03910 2659 2318 gene locus_tag LOCUS_03920 2659 2318 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975561.1 protein_id gnl|my_center|LOCUS_03920 3784 2672 gene locus_tag LOCUS_03930 3784 2672 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061884.1 protein_id gnl|my_center|LOCUS_03930 4661 3771 gene locus_tag LOCUS_03940 4661 3771 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398188.1 protein_id gnl|my_center|LOCUS_03940 5692 4658 gene locus_tag LOCUS_03950 5692 4658 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967740.1 protein_id gnl|my_center|LOCUS_03950 6675 5848 gene locus_tag LOCUS_03960 6675 5848 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039141.1 protein_id gnl|my_center|LOCUS_03960 6797 8095 gene locus_tag LOCUS_03970 6797 8095 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_03970 10482 8128 gene locus_tag LOCUS_03980 10482 8128 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 protein_id gnl|my_center|LOCUS_03980 11244 10522 gene locus_tag LOCUS_03990 11244 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12095 11295 gene locus_tag LOCUS_04000 12095 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 19808 12129 gene locus_tag LOCUS_04010 19808 12129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 20113 20682 gene locus_tag LOCUS_04020 gene rfbC 20113 20682 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387749.1 protein_id gnl|my_center|LOCUS_04020 20727 21788 gene locus_tag LOCUS_04030 gene rfbB 20727 21788 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706044.1 protein_id gnl|my_center|LOCUS_04030 21792 22727 gene locus_tag LOCUS_04040 gene rfbD 21792 22727 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_04040 22724 23593 gene locus_tag LOCUS_04050 gene rfbA 22724 23593 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097851.1 protein_id gnl|my_center|LOCUS_04050 23879 31249 gene locus_tag LOCUS_04060 23879 31249 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550042.1 protein_id gnl|my_center|LOCUS_04060 31348 32619 gene locus_tag LOCUS_04070 31348 32619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 33026 32658 gene locus_tag LOCUS_04080 33026 32658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 34146 33088 gene locus_tag LOCUS_04090 34146 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 35913 34156 gene locus_tag LOCUS_04100 35913 34156 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940398.1 protein_id gnl|my_center|LOCUS_04100 37010 35910 gene locus_tag LOCUS_04110 37010 35910 CDS product capsule polysaccharide export inner-membrane protein KpsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905920.1 protein_id gnl|my_center|LOCUS_04110 37789 37133 gene locus_tag LOCUS_04120 37789 37133 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590233.1 protein_id gnl|my_center|LOCUS_04120 38652 37786 gene locus_tag LOCUS_04130 38652 37786 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930466.1 protein_id gnl|my_center|LOCUS_04130 39436 39669 gene locus_tag LOCUS_04140 39436 39669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 41076 39727 gene locus_tag LOCUS_04150 41076 39727 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063856.1 protein_id gnl|my_center|LOCUS_04150 42680 41076 gene locus_tag LOCUS_04160 42680 41076 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811237.1 protein_id gnl|my_center|LOCUS_04160 43507 42710 gene locus_tag LOCUS_04170 43507 42710 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194054.1 protein_id gnl|my_center|LOCUS_04170 44093 43509 gene locus_tag LOCUS_04180 44093 43509 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389514.1 protein_id gnl|my_center|LOCUS_04180 45936 44131 gene locus_tag LOCUS_04190 45936 44131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 46047 46943 gene locus_tag LOCUS_04200 46047 46943 CDS product UDP-3-O-acyl N-acetylglycosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527661.1 protein_id gnl|my_center|LOCUS_04200 47718 46948 gene locus_tag LOCUS_04210 47718 46948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 50293 47708 gene locus_tag LOCUS_04220 50293 47708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 51948 50446 gene locus_tag LOCUS_04230 51948 50446 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_04230 52820 52170 gene locus_tag LOCUS_04240 52820 52170 CDS product OmpW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160062.1 protein_id gnl|my_center|LOCUS_04240 54404 52971 gene locus_tag LOCUS_04250 gene mltF 54404 52971 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266923.1 protein_id gnl|my_center|LOCUS_04250 55335 54769 gene locus_tag LOCUS_04260 55335 54769 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258313.1 protein_id gnl|my_center|LOCUS_04260 55513 56361 gene locus_tag LOCUS_04270 55513 56361 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220354845.1 protein_id gnl|my_center|LOCUS_04270 56835 57470 gene locus_tag LOCUS_04280 56835 57470 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066656.1 protein_id gnl|my_center|LOCUS_04280 57520 57999 gene locus_tag LOCUS_04290 57520 57999 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943074.1 protein_id gnl|my_center|LOCUS_04290 57996 58679 gene locus_tag LOCUS_04300 57996 58679 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968191.1 protein_id gnl|my_center|LOCUS_04300 58712 59176 gene locus_tag LOCUS_04310 58712 59176 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090697.1 protein_id gnl|my_center|LOCUS_04310 59166 59864 gene locus_tag LOCUS_04320 59166 59864 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090698.1 protein_id gnl|my_center|LOCUS_04320 61207 59855 gene locus_tag LOCUS_04330 61207 59855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 61757 61329 gene locus_tag LOCUS_04340 61757 61329 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971197.1 protein_id gnl|my_center|LOCUS_04340 62019 62663 gene locus_tag LOCUS_04350 62019 62663 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920739.1 protein_id gnl|my_center|LOCUS_04350 63960 62731 gene locus_tag LOCUS_04360 63960 62731 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920336.1 protein_id gnl|my_center|LOCUS_04360 65128 64001 gene locus_tag LOCUS_04370 65128 64001 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090525.1 protein_id gnl|my_center|LOCUS_04370 66557 65328 gene locus_tag LOCUS_04380 66557 65328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 67145 66630 gene locus_tag LOCUS_04390 67145 66630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 67253 68461 gene locus_tag LOCUS_04400 67253 68461 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791602.1 protein_id gnl|my_center|LOCUS_04400 68487 71633 gene locus_tag LOCUS_04410 68487 71633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 71763 72308 gene locus_tag LOCUS_04420 71763 72308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640507.1 protein_id gnl|my_center|LOCUS_04420 72400 73308 gene locus_tag LOCUS_04430 72400 73308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 73967 73359 gene locus_tag LOCUS_04440 73967 73359 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971535.1 protein_id gnl|my_center|LOCUS_04440 74041 76692 gene locus_tag LOCUS_04450 gene pepN 74041 76692 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_04450 76963 78825 gene locus_tag LOCUS_04460 76963 78825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 80225 78822 gene locus_tag LOCUS_04470 80225 78822 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_04470 81602 80283 gene locus_tag LOCUS_04480 81602 80283 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064276.1 protein_id gnl|my_center|LOCUS_04480 82462 81620 gene locus_tag LOCUS_04490 82462 81620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 83130 82537 gene locus_tag LOCUS_04500 83130 82537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 83639 83127 gene locus_tag LOCUS_04510 83639 83127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 84282 83665 gene locus_tag LOCUS_04520 84282 83665 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920592.1 protein_id gnl|my_center|LOCUS_04520 85034 84378 gene locus_tag LOCUS_04530 85034 84378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 86524 85244 gene locus_tag LOCUS_04540 86524 85244 CDS product aminomethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529879.1 protein_id gnl|my_center|LOCUS_04540 88095 86521 gene locus_tag LOCUS_04550 88095 86521 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_04550 89696 88092 gene locus_tag LOCUS_04560 89696 88092 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_04560 92896 89954 gene locus_tag LOCUS_04570 92896 89954 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389791.1 protein_id gnl|my_center|LOCUS_04570 94358 92958 gene locus_tag LOCUS_04580 94358 92958 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085916.1 protein_id gnl|my_center|LOCUS_04580 95022 94345 gene locus_tag LOCUS_04590 95022 94345 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965709.1 protein_id gnl|my_center|LOCUS_04590 96658 95180 gene locus_tag LOCUS_04600 96658 95180 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974839.1 protein_id gnl|my_center|LOCUS_04600 97284 96802 gene locus_tag LOCUS_04610 97284 96802 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974838.1 protein_id gnl|my_center|LOCUS_04610 99265 97289 gene locus_tag LOCUS_04620 99265 97289 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387796.1 protein_id gnl|my_center|LOCUS_04620 99744 99262 gene locus_tag LOCUS_04630 gene ccmE 99744 99262 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_04630 100791 99859 gene locus_tag LOCUS_04640 100791 99859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 101943 100855 gene locus_tag LOCUS_04650 gene ccmI 101943 100855 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085909.1 protein_id gnl|my_center|LOCUS_04650 102125 104299 gene locus_tag LOCUS_04660 102125 104299 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640121.1 protein_id gnl|my_center|LOCUS_04660 106149 104293 gene locus_tag LOCUS_04670 106149 104293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 106347 107564 gene locus_tag LOCUS_04680 106347 107564 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089644.1 protein_id gnl|my_center|LOCUS_04680 107568 108593 gene locus_tag LOCUS_04690 107568 108593 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_04690 110015 108597 gene locus_tag LOCUS_04700 110015 108597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965713.1 protein_id gnl|my_center|LOCUS_04700 110314 110520 gene locus_tag LOCUS_04710 110314 110520 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312807.1 protein_id gnl|my_center|LOCUS_04710 110663 112030 gene locus_tag LOCUS_04720 110663 112030 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_04720 113125 112646 gene locus_tag LOCUS_04730 113125 112646 CDS product RT0821/Lpp0805 family surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596824.1 protein_id gnl|my_center|LOCUS_04730 114625 113252 gene locus_tag LOCUS_04740 114625 113252 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920606.1 protein_id gnl|my_center|LOCUS_04740 115286 114615 gene locus_tag LOCUS_04750 gene feuP 115286 114615 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974832.1 protein_id gnl|my_center|LOCUS_04750 115639 115316 gene locus_tag LOCUS_04760 115639 115316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 116384 115713 gene locus_tag LOCUS_04770 116384 115713 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_04770 117429 116410 gene locus_tag LOCUS_04780 117429 116410 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082970.1 protein_id gnl|my_center|LOCUS_04780 118592 117441 gene locus_tag LOCUS_04790 118592 117441 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033450234.1 protein_id gnl|my_center|LOCUS_04790 119433 118642 gene locus_tag LOCUS_04800 119433 118642 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338355.1 protein_id gnl|my_center|LOCUS_04800 119755 119564 gene locus_tag LOCUS_04810 119755 119564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 120919 119894 gene locus_tag LOCUS_04820 120919 119894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence005 606 1286 gene locus_tag LOCUS_04830 606 1286 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197238.1 protein_id gnl|my_center|LOCUS_04830 2445 1312 gene locus_tag LOCUS_04840 2445 1312 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_04840 2662 3579 gene locus_tag LOCUS_04850 2662 3579 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970735.1 protein_id gnl|my_center|LOCUS_04850 4653 3676 gene locus_tag LOCUS_04860 4653 3676 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920777.1 protein_id gnl|my_center|LOCUS_04860 5654 4665 gene locus_tag LOCUS_04870 5654 4665 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173506.1 protein_id gnl|my_center|LOCUS_04870 7025 5664 gene locus_tag LOCUS_04880 7025 5664 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084253.1 protein_id gnl|my_center|LOCUS_04880 8495 7146 gene locus_tag LOCUS_04890 gene cpaE 8495 7146 CDS product pilus assembly protein CpaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920780.1 protein_id gnl|my_center|LOCUS_04890 9193 8495 gene locus_tag LOCUS_04900 9193 8495 CDS product CpaD family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651427.1 protein_id gnl|my_center|LOCUS_04900 10671 9205 gene locus_tag LOCUS_04910 10671 9205 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173504.1 protein_id gnl|my_center|LOCUS_04910 11441 10686 gene locus_tag LOCUS_04920 gene cpaB 11441 10686 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083494.1 protein_id gnl|my_center|LOCUS_04920 12007 11498 gene locus_tag LOCUS_04930 12007 11498 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084258.1 protein_id gnl|my_center|LOCUS_04930 12418 12254 gene locus_tag LOCUS_04940 12418 12254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 13562 12801 gene locus_tag LOCUS_04950 13562 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13749 14264 gene locus_tag LOCUS_04960 13749 14264 CDS product pilus assembly protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084261.1 protein_id gnl|my_center|LOCUS_04960 15589 14348 gene locus_tag LOCUS_04970 15589 14348 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529018.1 protein_id gnl|my_center|LOCUS_04970 15796 16368 gene locus_tag LOCUS_04980 15796 16368 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920787.1 protein_id gnl|my_center|LOCUS_04980 16391 16948 gene locus_tag LOCUS_04990 16391 16948 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920788.1 protein_id gnl|my_center|LOCUS_04990 17244 17155 gene locus_tag LOCUS_t00040 17244 17155 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17356 17733 gene locus_tag LOCUS_05000 17356 17733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 19618 17816 gene locus_tag LOCUS_05010 gene lepA 19618 17816 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528692.1 protein_id gnl|my_center|LOCUS_05010 20263 19685 gene locus_tag LOCUS_05020 20263 19685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 21092 20268 gene locus_tag LOCUS_05030 21092 20268 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_05030 21897 21094 gene locus_tag LOCUS_05040 21897 21094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 24360 21925 gene locus_tag LOCUS_05050 gene pheT 24360 21925 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528307.1 protein_id gnl|my_center|LOCUS_05050 25448 24357 gene locus_tag LOCUS_05060 gene pheS 25448 24357 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083532.1 protein_id gnl|my_center|LOCUS_05060 26013 25657 gene locus_tag LOCUS_05070 gene rplT 26013 25657 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_131615061.1 protein_id gnl|my_center|LOCUS_05070 26256 26050 gene locus_tag LOCUS_05080 gene rpmI 26256 26050 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710090.1 protein_id gnl|my_center|LOCUS_05080 26485 26712 gene locus_tag LOCUS_05090 26485 26712 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125566.1 protein_id gnl|my_center|LOCUS_05090 26712 27029 gene locus_tag LOCUS_05100 26712 27029 CDS product CcdB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330696.1 protein_id gnl|my_center|LOCUS_05100 27041 27568 gene locus_tag LOCUS_05110 27041 27568 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085038.1 protein_id gnl|my_center|LOCUS_05110 28075 27596 gene locus_tag LOCUS_05120 28075 27596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 29112 28264 gene locus_tag LOCUS_05130 29112 28264 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_05130 29321 30676 gene locus_tag LOCUS_05140 29321 30676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 31113 30673 gene locus_tag LOCUS_05150 31113 30673 CDS product oxidation-sensing regulator MosR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405595.1 protein_id gnl|my_center|LOCUS_05150 32433 31183 gene locus_tag LOCUS_05160 32433 31183 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173087.1 protein_id gnl|my_center|LOCUS_05160 32887 32597 gene locus_tag LOCUS_05170 32887 32597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 33191 34129 gene locus_tag LOCUS_05180 33191 34129 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921532.1 protein_id gnl|my_center|LOCUS_05180 34724 34182 gene locus_tag LOCUS_05190 gene infC 34724 34182 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918933.1 protein_id gnl|my_center|LOCUS_05190 35263 34895 gene locus_tag LOCUS_05200 35263 34895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 36386 35256 gene locus_tag LOCUS_05210 36386 35256 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640128.1 protein_id gnl|my_center|LOCUS_05210 36483 37277 gene locus_tag LOCUS_05220 36483 37277 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128777536.1 protein_id gnl|my_center|LOCUS_05220 37817 37419 gene locus_tag LOCUS_05230 37817 37419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171331.1 protein_id gnl|my_center|LOCUS_05230 38799 37921 gene locus_tag LOCUS_05240 38799 37921 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_05240 38855 39616 gene locus_tag LOCUS_05250 38855 39616 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391126.1 protein_id gnl|my_center|LOCUS_05250 40707 39601 gene locus_tag LOCUS_05260 gene queG 40707 39601 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528621.1 protein_id gnl|my_center|LOCUS_05260 41410 40730 gene locus_tag LOCUS_05270 41410 40730 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083540.1 protein_id gnl|my_center|LOCUS_05270 41861 41448 gene locus_tag LOCUS_05280 gene cueR 41861 41448 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_05280 42874 41867 gene locus_tag LOCUS_05290 42874 41867 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083542.1 protein_id gnl|my_center|LOCUS_05290 43048 43134 gene locus_tag LOCUS_t00050 43048 43134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43203 43814 gene locus_tag LOCUS_05300 43203 43814 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083544.1 protein_id gnl|my_center|LOCUS_05300 43953 44666 gene locus_tag LOCUS_05310 gene lptC 43953 44666 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387774.1 protein_id gnl|my_center|LOCUS_05310 44663 45217 gene locus_tag LOCUS_05320 44663 45217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 45310 46113 gene locus_tag LOCUS_05330 gene lptB 45310 46113 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083547.1 protein_id gnl|my_center|LOCUS_05330 46142 47677 gene locus_tag LOCUS_05340 gene rpoN 46142 47677 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083548.1 protein_id gnl|my_center|LOCUS_05340 48002 48583 gene locus_tag LOCUS_05350 gene raiA 48002 48583 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_05350 48699 49163 gene locus_tag LOCUS_05360 gene ptsN 48699 49163 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_05360 49594 49292 gene locus_tag LOCUS_05370 49594 49292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 50118 49660 gene locus_tag LOCUS_05380 50118 49660 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527659.1 protein_id gnl|my_center|LOCUS_05380 50365 50976 gene locus_tag LOCUS_05390 50365 50976 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144310.1 protein_id gnl|my_center|LOCUS_05390 51138 51398 gene locus_tag LOCUS_05400 51138 51398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 51519 53777 gene locus_tag LOCUS_05410 51519 53777 CDS product TonB-dependent hemoglobin/transferrin/lactoferrin family receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920055.1 protein_id gnl|my_center|LOCUS_05410 53792 54628 gene locus_tag LOCUS_05420 53792 54628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 54665 55720 gene locus_tag LOCUS_05430 54665 55720 CDS product hemin-degrading factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187023.1 protein_id gnl|my_center|LOCUS_05430 55840 56781 gene locus_tag LOCUS_05440 55840 56781 CDS product hemin ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140583.1 protein_id gnl|my_center|LOCUS_05440 56778 57833 gene locus_tag LOCUS_05450 56778 57833 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240161.1 protein_id gnl|my_center|LOCUS_05450 57830 58612 gene locus_tag LOCUS_05460 57830 58612 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050725350.1 protein_id gnl|my_center|LOCUS_05460 59796 58771 gene locus_tag LOCUS_05470 59796 58771 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_05470 60937 59897 gene locus_tag LOCUS_05480 60937 59897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388525.1 protein_id gnl|my_center|LOCUS_05480 61035 62747 gene locus_tag LOCUS_05490 61035 62747 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338036.1 protein_id gnl|my_center|LOCUS_05490 62884 63951 gene locus_tag LOCUS_05500 62884 63951 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_05500 63963 67103 gene locus_tag LOCUS_05510 63963 67103 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_05510 67153 69417 gene locus_tag LOCUS_05520 67153 69417 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967383.1 protein_id gnl|my_center|LOCUS_05520 69588 71333 gene locus_tag LOCUS_05530 69588 71333 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123719.1 protein_id gnl|my_center|LOCUS_05530 71617 72150 gene locus_tag LOCUS_05540 71617 72150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 72143 73279 gene locus_tag LOCUS_05550 72143 73279 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529194.1 protein_id gnl|my_center|LOCUS_05550 73276 76479 gene locus_tag LOCUS_05560 73276 76479 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529195.1 protein_id gnl|my_center|LOCUS_05560 77341 76484 gene locus_tag LOCUS_05570 77341 76484 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152827762.1 protein_id gnl|my_center|LOCUS_05570 78618 77509 gene locus_tag LOCUS_05580 78618 77509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 79084 78635 gene locus_tag LOCUS_05590 79084 78635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 79875 79096 gene locus_tag LOCUS_05600 79875 79096 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076053361.1 protein_id gnl|my_center|LOCUS_05600 81576 79891 gene locus_tag LOCUS_05610 81576 79891 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112322.1 protein_id gnl|my_center|LOCUS_05610 81469 81669 gene locus_tag LOCUS_05620 81469 81669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 81681 82298 gene locus_tag LOCUS_05630 81681 82298 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014162.1 protein_id gnl|my_center|LOCUS_05630 83562 82306 gene locus_tag LOCUS_05640 83562 82306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703847.1 protein_id gnl|my_center|LOCUS_05640 83766 87047 gene locus_tag LOCUS_05650 83766 87047 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965449.1 protein_id gnl|my_center|LOCUS_05650 87115 87843 gene locus_tag LOCUS_05660 87115 87843 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640625.1 protein_id gnl|my_center|LOCUS_05660 87840 88235 gene locus_tag LOCUS_05670 87840 88235 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640610.1 protein_id gnl|my_center|LOCUS_05670 88405 89940 gene locus_tag LOCUS_05680 88405 89940 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_05680 90813 89956 gene locus_tag LOCUS_05690 gene yghU 90813 89956 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085723.1 protein_id gnl|my_center|LOCUS_05690 91949 90858 gene locus_tag LOCUS_05700 91949 90858 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_05700 93480 92161 gene locus_tag LOCUS_05710 93480 92161 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938317.1 protein_id gnl|my_center|LOCUS_05710 95645 93477 gene locus_tag LOCUS_05720 95645 93477 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464845.1 protein_id gnl|my_center|LOCUS_05720 104772 95656 gene locus_tag LOCUS_05730 104772 95656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 106130 104850 gene locus_tag LOCUS_05740 106130 104850 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706511.1 protein_id gnl|my_center|LOCUS_05740 106476 107423 gene locus_tag LOCUS_05750 106476 107423 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113629.1 protein_id gnl|my_center|LOCUS_05750 109028 110308 gene locus_tag LOCUS_05760 109028 110308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 111014 112330 gene locus_tag LOCUS_05770 111014 112330 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_05770 112397 112849 gene locus_tag LOCUS_05780 112397 112849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 113148 113354 gene locus_tag LOCUS_05790 113148 113354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 114351 113584 gene locus_tag LOCUS_05800 114351 113584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231443.1 protein_id gnl|my_center|LOCUS_05800 114622 114353 gene locus_tag LOCUS_05810 114622 114353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 115716 114625 gene locus_tag LOCUS_05820 115716 114625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 115945 117087 gene locus_tag LOCUS_05830 115945 117087 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_05830 117114 120290 gene locus_tag LOCUS_05840 117114 120290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence006 2232 235 gene locus_tag LOCUS_05850 2232 235 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_05850 2958 2281 gene locus_tag LOCUS_05860 2958 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 3661 4299 gene locus_tag LOCUS_05870 3661 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5245 4379 gene locus_tag LOCUS_05880 5245 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6356 5292 gene locus_tag LOCUS_05890 gene oruR 6356 5292 CDS product ornithine utilization transcriptional regulator OruR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114220.1 protein_id gnl|my_center|LOCUS_05890 6472 7320 gene locus_tag LOCUS_05900 6472 7320 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_05900 7348 8766 gene locus_tag LOCUS_05910 7348 8766 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083386.1 protein_id gnl|my_center|LOCUS_05910 8908 9324 gene locus_tag LOCUS_05920 8908 9324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9565 9350 gene locus_tag LOCUS_05930 9565 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9909 10685 gene locus_tag LOCUS_05940 9909 10685 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_05940 11925 10693 gene locus_tag LOCUS_05950 11925 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13311 12817 gene locus_tag LOCUS_05960 13311 12817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 13519 13322 gene locus_tag LOCUS_05970 13519 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 14003 13767 gene locus_tag LOCUS_05980 14003 13767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 14716 14003 gene locus_tag LOCUS_05990 14716 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 15654 14713 gene locus_tag LOCUS_06000 15654 14713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 16599 15670 gene locus_tag LOCUS_06010 16599 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 17828 16611 gene locus_tag LOCUS_06020 17828 16611 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_06020 19024 17834 gene locus_tag LOCUS_06030 19024 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 20413 19031 gene locus_tag LOCUS_06040 20413 19031 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192085.1 protein_id gnl|my_center|LOCUS_06040 21332 20442 gene locus_tag LOCUS_06050 gene cpaB 21332 20442 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939395.1 protein_id gnl|my_center|LOCUS_06050 21850 23526 gene locus_tag LOCUS_06060 21850 23526 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550550.1 protein_id gnl|my_center|LOCUS_06060 24691 23627 gene locus_tag LOCUS_06070 24691 23627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 24967 26652 gene locus_tag LOCUS_06080 24967 26652 CDS product TadG family pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971737.1 protein_id gnl|my_center|LOCUS_06080 26751 27131 gene locus_tag LOCUS_06090 26751 27131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 27210 27647 gene locus_tag LOCUS_06100 27210 27647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 27737 28180 gene locus_tag LOCUS_06110 27737 28180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 28722 28222 gene locus_tag LOCUS_06120 28722 28222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29577 30155 gene locus_tag LOCUS_06130 29577 30155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 30168 30680 gene locus_tag LOCUS_06140 30168 30680 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968781.1 protein_id gnl|my_center|LOCUS_06140 30781 30957 gene locus_tag LOCUS_06150 30781 30957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 31003 31200 gene locus_tag LOCUS_06160 31003 31200 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974103.1 protein_id gnl|my_center|LOCUS_06160 31433 31669 gene locus_tag LOCUS_06170 31433 31669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 31674 32282 gene locus_tag LOCUS_06180 31674 32282 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921304.1 protein_id gnl|my_center|LOCUS_06180 33163 32369 gene locus_tag LOCUS_06190 gene phyR 33163 32369 CDS product anti-anti sigma factor/receiver protein PhyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921306.1 protein_id gnl|my_center|LOCUS_06190 33374 33586 gene locus_tag LOCUS_06200 33374 33586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 33708 35414 gene locus_tag LOCUS_06210 33708 35414 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626556.1 protein_id gnl|my_center|LOCUS_06210 36511 35711 gene locus_tag LOCUS_06220 36511 35711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 36716 37945 gene locus_tag LOCUS_06230 36716 37945 CDS product bifunctional alpha/beta hydrolase/OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400275.1 protein_id gnl|my_center|LOCUS_06230 38278 40371 gene locus_tag LOCUS_06240 38278 40371 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081570352.1 protein_id gnl|my_center|LOCUS_06240 40730 42100 gene locus_tag LOCUS_06250 40730 42100 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967062.1 protein_id gnl|my_center|LOCUS_06250 43198 42407 gene locus_tag LOCUS_06260 43198 42407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 44368 43361 gene locus_tag LOCUS_06270 44368 43361 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_06270 45163 44603 gene locus_tag LOCUS_06280 45163 44603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 45788 45468 gene locus_tag LOCUS_06290 45788 45468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 47526 46192 gene locus_tag LOCUS_06300 47526 46192 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087688.1 protein_id gnl|my_center|LOCUS_06300 47740 49206 gene locus_tag LOCUS_06310 47740 49206 CDS product DNA-3-methyladenine glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391104.1 protein_id gnl|my_center|LOCUS_06310 49227 49742 gene locus_tag LOCUS_06320 49227 49742 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_06320 49883 50062 gene locus_tag LOCUS_06330 49883 50062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 50143 50445 gene locus_tag LOCUS_06340 50143 50445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 51089 50442 gene locus_tag LOCUS_06350 gene bioD 51089 50442 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_06350 52280 51105 gene locus_tag LOCUS_06360 gene bioF 52280 51105 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640275.1 protein_id gnl|my_center|LOCUS_06360 53322 52411 gene locus_tag LOCUS_06370 53322 52411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 53432 54115 gene locus_tag LOCUS_06380 53432 54115 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057744.1 protein_id gnl|my_center|LOCUS_06380 54429 55481 gene locus_tag LOCUS_06390 gene bioB 54429 55481 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533324.1 protein_id gnl|my_center|LOCUS_06390 55679 56980 gene locus_tag LOCUS_06400 55679 56980 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818556.1 protein_id gnl|my_center|LOCUS_06400 57249 57965 gene locus_tag LOCUS_06410 57249 57965 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088682.1 protein_id gnl|my_center|LOCUS_06410 57965 58987 gene locus_tag LOCUS_06420 57965 58987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 59062 59703 gene locus_tag LOCUS_06430 59062 59703 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918133.1 protein_id gnl|my_center|LOCUS_06430 59766 61019 gene locus_tag LOCUS_06440 59766 61019 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172947.1 protein_id gnl|my_center|LOCUS_06440 63449 61095 gene locus_tag LOCUS_06450 63449 61095 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_06450 64020 65153 gene locus_tag LOCUS_06460 64020 65153 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_06460 66638 65364 gene locus_tag LOCUS_06470 66638 65364 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_06470 68140 66827 gene locus_tag LOCUS_06480 68140 66827 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391508.1 protein_id gnl|my_center|LOCUS_06480 68419 69543 gene locus_tag LOCUS_06490 68419 69543 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_06490 69659 70552 gene locus_tag LOCUS_06500 69659 70552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 70561 71049 gene locus_tag LOCUS_06510 70561 71049 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183417335.1 protein_id gnl|my_center|LOCUS_06510 71108 71974 gene locus_tag LOCUS_06520 71108 71974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 72574 72002 gene locus_tag LOCUS_06530 72574 72002 CDS product ActR/PrrA/RegA family redox response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528072.1 protein_id gnl|my_center|LOCUS_06530 74035 72647 gene locus_tag LOCUS_06540 gene actS 74035 72647 CDS product two-component system sensor histidine kinase ActS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970627.1 protein_id gnl|my_center|LOCUS_06540 75041 74115 gene locus_tag LOCUS_06550 75041 74115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 75912 75283 gene locus_tag LOCUS_06560 75912 75283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 76072 76680 gene locus_tag LOCUS_06570 76072 76680 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_06570 77094 76723 gene locus_tag LOCUS_06580 77094 76723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 76988 78679 gene locus_tag LOCUS_06590 gene leuA 76988 78679 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113805.1 protein_id gnl|my_center|LOCUS_06590 78930 80168 gene locus_tag LOCUS_06600 gene phaZ 78930 80168 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536442.1 protein_id gnl|my_center|LOCUS_06600 80388 80173 gene locus_tag LOCUS_06610 80388 80173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 80470 80619 gene locus_tag LOCUS_06620 80470 80619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 80725 81537 gene locus_tag LOCUS_06630 80725 81537 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391101.1 protein_id gnl|my_center|LOCUS_06630 81534 82718 gene locus_tag LOCUS_06640 81534 82718 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223726.1 protein_id gnl|my_center|LOCUS_06640 85384 82997 gene locus_tag LOCUS_06650 85384 82997 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083732.1 protein_id gnl|my_center|LOCUS_06650 87995 85551 gene locus_tag LOCUS_06660 gene gyrB 87995 85551 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390482.1 protein_id gnl|my_center|LOCUS_06660 88631 88038 gene locus_tag LOCUS_06670 88631 88038 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066512.1 protein_id gnl|my_center|LOCUS_06670 89877 88666 gene locus_tag LOCUS_06680 gene recF 89877 88666 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527878.1 protein_id gnl|my_center|LOCUS_06680 91026 89908 gene locus_tag LOCUS_06690 gene dnaN 91026 89908 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387763.1 protein_id gnl|my_center|LOCUS_06690 93005 91458 gene locus_tag LOCUS_06700 gene dnaA 93005 91458 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387762.1 protein_id gnl|my_center|LOCUS_06700 93603 93127 gene locus_tag LOCUS_06710 93603 93127 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892192.1 protein_id gnl|my_center|LOCUS_06710 94413 94150 gene locus_tag LOCUS_06720 gene rpsT 94413 94150 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974216.1 protein_id gnl|my_center|LOCUS_06720 95389 94613 gene locus_tag LOCUS_06730 95389 94613 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391548.1 protein_id gnl|my_center|LOCUS_06730 95879 95463 gene locus_tag LOCUS_06740 95879 95463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626665.1 protein_id gnl|my_center|LOCUS_06740 96700 95891 gene locus_tag LOCUS_06750 gene mutM 96700 95891 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533692.1 protein_id gnl|my_center|LOCUS_06750 96587 96853 gene locus_tag LOCUS_06760 96587 96853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 96918 97730 gene locus_tag LOCUS_06770 gene ubiE 96918 97730 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529624.1 protein_id gnl|my_center|LOCUS_06770 97732 99336 gene locus_tag LOCUS_06780 gene ubiB 97732 99336 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067765.1 protein_id gnl|my_center|LOCUS_06780 99474 100718 gene locus_tag LOCUS_06790 gene coaBC 99474 100718 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_06790 100715 101179 gene locus_tag LOCUS_06800 gene dut 100715 101179 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_06800 101187 101636 gene locus_tag LOCUS_06810 101187 101636 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391542.1 protein_id gnl|my_center|LOCUS_06810 101692 102648 gene locus_tag LOCUS_06820 gene cysK 101692 102648 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310159.1 protein_id gnl|my_center|LOCUS_06820 103134 102649 gene locus_tag LOCUS_06830 103134 102649 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083753.1 protein_id gnl|my_center|LOCUS_06830 103240 103968 gene locus_tag LOCUS_06840 103240 103968 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_06840 103985 104587 gene locus_tag LOCUS_06850 103985 104587 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640024.1 protein_id gnl|my_center|LOCUS_06850 104580 105392 gene locus_tag LOCUS_06860 104580 105392 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226742.1 protein_id gnl|my_center|LOCUS_06860 105421 106227 gene locus_tag LOCUS_06870 gene moeB 105421 106227 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083588.1 protein_id gnl|my_center|LOCUS_06870 107229 106237 gene locus_tag LOCUS_06880 107229 106237 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391537.1 protein_id gnl|my_center|LOCUS_06880 107429 108031 gene locus_tag LOCUS_06890 107429 108031 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083590.1 protein_id gnl|my_center|LOCUS_06890 108638 108033 gene locus_tag LOCUS_06900 108638 108033 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190872.1 protein_id gnl|my_center|LOCUS_06900 110026 108668 gene locus_tag LOCUS_06910 110026 108668 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_06910 110537 110115 gene locus_tag LOCUS_06920 110537 110115 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_06920 111239 110814 gene locus_tag LOCUS_06930 111239 110814 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_06930 111562 112083 gene locus_tag LOCUS_06940 gene fabA 111562 112083 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921547.1 protein_id gnl|my_center|LOCUS_06940 112135 113361 gene locus_tag LOCUS_06950 gene fabB 112135 113361 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330670.1 protein_id gnl|my_center|LOCUS_06950 113433 114299 gene locus_tag LOCUS_06960 gene fabI 113433 114299 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083593.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence007 341 631 gene locus_tag LOCUS_06970 341 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 628 1317 gene locus_tag LOCUS_06980 628 1317 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_06980 1659 1414 gene locus_tag LOCUS_06990 1659 1414 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532600.1 protein_id gnl|my_center|LOCUS_06990 1887 1798 gene locus_tag LOCUS_t00060 1887 1798 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2044 2811 gene locus_tag LOCUS_07000 2044 2811 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105024.1 protein_id gnl|my_center|LOCUS_07000 2931 3242 gene locus_tag LOCUS_07010 gene rplU 2931 3242 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067213.1 protein_id gnl|my_center|LOCUS_07010 3264 3539 gene locus_tag LOCUS_07020 gene rpmA 3264 3539 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003492686.1 protein_id gnl|my_center|LOCUS_07020 3649 4173 gene locus_tag LOCUS_07030 3649 4173 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918206.1 protein_id gnl|my_center|LOCUS_07030 4175 5215 gene locus_tag LOCUS_07040 gene obgE 4175 5215 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529067.1 protein_id gnl|my_center|LOCUS_07040 5212 6330 gene locus_tag LOCUS_07050 gene proB 5212 6330 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972562.1 protein_id gnl|my_center|LOCUS_07050 6436 7734 gene locus_tag LOCUS_07060 6436 7734 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529069.1 protein_id gnl|my_center|LOCUS_07060 7745 8344 gene locus_tag LOCUS_07070 7745 8344 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 protein_id gnl|my_center|LOCUS_07070 8474 8938 gene locus_tag LOCUS_07080 8474 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9017 9499 gene locus_tag LOCUS_07090 gene rlmH 9017 9499 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083264.1 protein_id gnl|my_center|LOCUS_07090 9646 11172 gene locus_tag LOCUS_07100 gene gpmI 9646 11172 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388989.1 protein_id gnl|my_center|LOCUS_07100 11165 12520 gene locus_tag LOCUS_07110 11165 12520 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083265.1 protein_id gnl|my_center|LOCUS_07110 12521 13852 gene locus_tag LOCUS_07120 12521 13852 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083266.1 protein_id gnl|my_center|LOCUS_07120 13888 15147 gene locus_tag LOCUS_07130 13888 15147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 15198 15722 gene locus_tag LOCUS_07140 15198 15722 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529078.1 protein_id gnl|my_center|LOCUS_07140 16811 15729 gene locus_tag LOCUS_07150 16811 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 17041 17799 gene locus_tag LOCUS_07160 17041 17799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 18637 17813 gene locus_tag LOCUS_07170 18637 17813 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388983.1 protein_id gnl|my_center|LOCUS_07170 19237 18839 gene locus_tag LOCUS_07180 19237 18839 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529039.1 protein_id gnl|my_center|LOCUS_07180 20972 19266 gene locus_tag LOCUS_07190 gene atpD 20972 19266 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083272.1 protein_id gnl|my_center|LOCUS_07190 21937 21050 gene locus_tag LOCUS_07200 21937 21050 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529037.1 protein_id gnl|my_center|LOCUS_07200 23510 21981 gene locus_tag LOCUS_07210 gene atpA 23510 21981 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389785.1 protein_id gnl|my_center|LOCUS_07210 24067 23510 gene locus_tag LOCUS_07220 24067 23510 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083275.1 protein_id gnl|my_center|LOCUS_07220 26530 24335 gene locus_tag LOCUS_07230 26530 24335 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529032.1 protein_id gnl|my_center|LOCUS_07230 26714 27370 gene locus_tag LOCUS_07240 gene fsa 26714 27370 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 protein_id gnl|my_center|LOCUS_07240 27398 28138 gene locus_tag LOCUS_07250 27398 28138 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338318.1 protein_id gnl|my_center|LOCUS_07250 28243 29091 gene locus_tag LOCUS_07260 28243 29091 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162145490.1 protein_id gnl|my_center|LOCUS_07260 29094 29636 gene locus_tag LOCUS_07270 29094 29636 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480299.1 protein_id gnl|my_center|LOCUS_07270 31037 29646 gene locus_tag LOCUS_07280 gene lpdA 31037 29646 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083281.1 protein_id gnl|my_center|LOCUS_07280 32288 31047 gene locus_tag LOCUS_07290 gene odhB 32288 31047 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083283.1 protein_id gnl|my_center|LOCUS_07290 35528 32337 gene locus_tag LOCUS_07300 35528 32337 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970380.1 protein_id gnl|my_center|LOCUS_07300 36659 35784 gene locus_tag LOCUS_07310 gene sucD 36659 35784 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388967.1 protein_id gnl|my_center|LOCUS_07310 37828 36659 gene locus_tag LOCUS_07320 gene sucC 37828 36659 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_07320 39119 38043 gene locus_tag LOCUS_07330 39119 38043 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_07330 40283 39264 gene locus_tag LOCUS_07340 gene mdh 40283 39264 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530257.1 protein_id gnl|my_center|LOCUS_07340 40590 41225 gene locus_tag LOCUS_07350 40590 41225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 42357 41236 gene locus_tag LOCUS_07360 gene zapE 42357 41236 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083288.1 protein_id gnl|my_center|LOCUS_07360 43268 42429 gene locus_tag LOCUS_07370 43268 42429 CDS product arylamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195415.1 protein_id gnl|my_center|LOCUS_07370 44911 43358 gene locus_tag LOCUS_07380 44911 43358 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920135.1 protein_id gnl|my_center|LOCUS_07380 45210 45608 gene locus_tag LOCUS_07390 45210 45608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 46731 45667 gene locus_tag LOCUS_07400 gene arsB 46731 45667 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969943.1 protein_id gnl|my_center|LOCUS_07400 47246 46731 gene locus_tag LOCUS_07410 47246 46731 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140066.1 protein_id gnl|my_center|LOCUS_07410 47749 47273 gene locus_tag LOCUS_07420 47749 47273 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184724.1 protein_id gnl|my_center|LOCUS_07420 48111 47746 gene locus_tag LOCUS_07430 48111 47746 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640254.1 protein_id gnl|my_center|LOCUS_07430 48637 48933 gene locus_tag LOCUS_07440 48637 48933 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084274.1 protein_id gnl|my_center|LOCUS_07440 49191 49724 gene locus_tag LOCUS_07450 49191 49724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 50796 50017 gene locus_tag LOCUS_07460 50796 50017 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972458.1 protein_id gnl|my_center|LOCUS_07460 52609 50819 gene locus_tag LOCUS_07470 gene sdhA 52609 50819 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083345.1 protein_id gnl|my_center|LOCUS_07470 53036 52641 gene locus_tag LOCUS_07480 gene sdhD 53036 52641 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_07480 53443 53036 gene locus_tag LOCUS_07490 gene sdhC 53443 53036 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083343.1 protein_id gnl|my_center|LOCUS_07490 53736 54203 gene locus_tag LOCUS_07500 53736 54203 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337636.1 protein_id gnl|my_center|LOCUS_07500 54800 54207 gene locus_tag LOCUS_07510 54800 54207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 55923 54862 gene locus_tag LOCUS_07520 55923 54862 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111198133.1 protein_id gnl|my_center|LOCUS_07520 56087 55920 gene locus_tag LOCUS_07530 56087 55920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 56996 56100 gene locus_tag LOCUS_07540 56996 56100 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_07540 59243 57093 gene locus_tag LOCUS_07550 59243 57093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 60447 59425 gene locus_tag LOCUS_07560 60447 59425 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003514078.1 protein_id gnl|my_center|LOCUS_07560 60825 60478 gene locus_tag LOCUS_07570 60825 60478 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 protein_id gnl|my_center|LOCUS_07570 62152 61046 gene locus_tag LOCUS_07580 gene leuB 62152 61046 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390438.1 protein_id gnl|my_center|LOCUS_07580 62791 62186 gene locus_tag LOCUS_07590 gene leuD 62791 62186 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528787.1 protein_id gnl|my_center|LOCUS_07590 63429 62842 gene locus_tag LOCUS_07600 63429 62842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 64896 63466 gene locus_tag LOCUS_07610 gene leuC 64896 63466 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067266.1 protein_id gnl|my_center|LOCUS_07610 65472 65047 gene locus_tag LOCUS_07620 gene rplS 65472 65047 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083318.1 protein_id gnl|my_center|LOCUS_07620 66244 65537 gene locus_tag LOCUS_07630 gene trmD 66244 65537 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528859.1 protein_id gnl|my_center|LOCUS_07630 66809 66237 gene locus_tag LOCUS_07640 gene rimM 66809 66237 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083314.1 protein_id gnl|my_center|LOCUS_07640 67241 66831 gene locus_tag LOCUS_07650 67241 66831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 68866 67331 gene locus_tag LOCUS_07660 gene ffh 68866 67331 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972497.1 protein_id gnl|my_center|LOCUS_07660 69502 69020 gene locus_tag LOCUS_07670 69502 69020 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919960.1 protein_id gnl|my_center|LOCUS_07670 70323 69502 gene locus_tag LOCUS_07680 70323 69502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 70406 71275 gene locus_tag LOCUS_07690 gene dapF 70406 71275 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083308.1 protein_id gnl|my_center|LOCUS_07690 71272 72534 gene locus_tag LOCUS_07700 gene mtaB 71272 72534 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528840.1 protein_id gnl|my_center|LOCUS_07700 72531 73487 gene locus_tag LOCUS_07710 72531 73487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 73537 74166 gene locus_tag LOCUS_07720 73537 74166 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330142.1 protein_id gnl|my_center|LOCUS_07720 75825 74170 gene locus_tag LOCUS_07730 75825 74170 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820458.1 protein_id gnl|my_center|LOCUS_07730 76503 75916 gene locus_tag LOCUS_07740 76503 75916 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140927.1 protein_id gnl|my_center|LOCUS_07740 76877 77437 gene locus_tag LOCUS_07750 76877 77437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 78034 77474 gene locus_tag LOCUS_07760 78034 77474 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528832.1 protein_id gnl|my_center|LOCUS_07760 78231 78031 gene locus_tag LOCUS_07770 78231 78031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 79001 78234 gene locus_tag LOCUS_07780 79001 78234 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970511.1 protein_id gnl|my_center|LOCUS_07780 79769 79092 gene locus_tag LOCUS_07790 gene ccmB 79769 79092 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384158.1 protein_id gnl|my_center|LOCUS_07790 80422 79766 gene locus_tag LOCUS_07800 gene ccmA 80422 79766 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083298.1 protein_id gnl|my_center|LOCUS_07800 81182 80379 gene locus_tag LOCUS_07810 81182 80379 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296694.1 protein_id gnl|my_center|LOCUS_07810 82075 81407 gene locus_tag LOCUS_07820 82075 81407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 82032 84800 gene locus_tag LOCUS_07830 gene acnA 82032 84800 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529712.1 protein_id gnl|my_center|LOCUS_07830 84953 85690 gene locus_tag LOCUS_07840 84953 85690 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393976.1 protein_id gnl|my_center|LOCUS_07840 86828 85695 gene locus_tag LOCUS_07850 86828 85695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 88783 86834 gene locus_tag LOCUS_07860 88783 86834 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_07860 89523 88789 gene locus_tag LOCUS_07870 89523 88789 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_07870 90491 89520 gene locus_tag LOCUS_07880 90491 89520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_07880 91102 91524 gene locus_tag LOCUS_07890 91102 91524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 92351 91593 gene locus_tag LOCUS_07900 92351 91593 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_07900 95090 92529 gene locus_tag LOCUS_07910 95090 92529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252344.1 protein_id gnl|my_center|LOCUS_07910 95779 95087 gene locus_tag LOCUS_07920 95779 95087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470636.1 protein_id gnl|my_center|LOCUS_07920 95899 96600 gene locus_tag LOCUS_07930 95899 96600 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391397.1 protein_id gnl|my_center|LOCUS_07930 96661 97701 gene locus_tag LOCUS_07940 96661 97701 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923333.1 protein_id gnl|my_center|LOCUS_07940 97712 98257 gene locus_tag LOCUS_07950 gene thpR 97712 98257 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921488.1 protein_id gnl|my_center|LOCUS_07950 98717 98313 gene locus_tag LOCUS_07960 98717 98313 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965074.1 protein_id gnl|my_center|LOCUS_07960 98801 99115 gene locus_tag LOCUS_07970 98801 99115 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201313.1 protein_id gnl|my_center|LOCUS_07970 99132 100400 gene locus_tag LOCUS_07980 99132 100400 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328867.1 protein_id gnl|my_center|LOCUS_07980 101268 100486 gene locus_tag LOCUS_07990 101268 100486 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_07990 101540 101959 gene locus_tag LOCUS_08000 101540 101959 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918012.1 protein_id gnl|my_center|LOCUS_08000 103229 101961 gene locus_tag LOCUS_08010 103229 101961 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_08010 103990 103268 gene locus_tag LOCUS_08020 103990 103268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 105046 104042 gene locus_tag LOCUS_08030 105046 104042 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917985.1 protein_id gnl|my_center|LOCUS_08030 105349 105915 gene locus_tag LOCUS_08040 105349 105915 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391120.1 protein_id gnl|my_center|LOCUS_08040 106044 107255 gene locus_tag LOCUS_08050 gene rlmN 106044 107255 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162688154.1 protein_id gnl|my_center|LOCUS_08050 107296 107628 gene locus_tag LOCUS_08060 107296 107628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772705.1 protein_id gnl|my_center|LOCUS_08060 108212 107625 gene locus_tag LOCUS_08070 108212 107625 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815398.1 protein_id gnl|my_center|LOCUS_08070 109237 108302 gene locus_tag LOCUS_08080 109237 108302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 109823 109242 gene locus_tag LOCUS_08090 109823 109242 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 protein_id gnl|my_center|LOCUS_08090 109965 111194 gene locus_tag LOCUS_08100 109965 111194 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529681.1 protein_id gnl|my_center|LOCUS_08100 111200 111730 gene locus_tag LOCUS_08110 gene ppa 111200 111730 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531185.1 protein_id gnl|my_center|LOCUS_08110 113138 111765 gene locus_tag LOCUS_08120 113138 111765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 113434 113691 gene locus_tag LOCUS_08130 113434 113691 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639915.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence008 971 1606 gene locus_tag LOCUS_08140 971 1606 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552516.1 protein_id gnl|my_center|LOCUS_08140 3890 1713 gene locus_tag LOCUS_08150 gene katG 3890 1713 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444101.1 protein_id gnl|my_center|LOCUS_08150 4734 4051 gene locus_tag LOCUS_08160 4734 4051 CDS product TIGR02466 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265868.1 protein_id gnl|my_center|LOCUS_08160 4940 6085 gene locus_tag LOCUS_08170 4940 6085 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_08170 6436 12117 gene locus_tag LOCUS_08180 6436 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12580 12311 gene locus_tag LOCUS_08190 12580 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 13073 12600 gene locus_tag LOCUS_08200 13073 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 15316 13220 gene locus_tag LOCUS_08210 15316 13220 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103467.1 protein_id gnl|my_center|LOCUS_08210 16344 15592 gene locus_tag LOCUS_08220 16344 15592 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087714.1 protein_id gnl|my_center|LOCUS_08220 17786 16389 gene locus_tag LOCUS_08230 17786 16389 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087715.1 protein_id gnl|my_center|LOCUS_08230 17960 18166 gene locus_tag LOCUS_08240 17960 18166 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084181.1 protein_id gnl|my_center|LOCUS_08240 18686 18321 gene locus_tag LOCUS_08250 18686 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 18666 21284 gene locus_tag LOCUS_08260 18666 21284 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012596252.1 protein_id gnl|my_center|LOCUS_08260 21880 21281 gene locus_tag LOCUS_08270 21880 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 22079 21813 gene locus_tag LOCUS_08280 22079 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 22642 22214 gene locus_tag LOCUS_08290 22642 22214 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531555.1 protein_id gnl|my_center|LOCUS_08290 22785 23564 gene locus_tag LOCUS_08300 22785 23564 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965382.1 protein_id gnl|my_center|LOCUS_08300 24786 23551 gene locus_tag LOCUS_08310 24786 23551 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387848.1 protein_id gnl|my_center|LOCUS_08310 24787 25299 gene locus_tag LOCUS_08320 24787 25299 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387847.1 protein_id gnl|my_center|LOCUS_08320 26117 25335 gene locus_tag LOCUS_08330 26117 25335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 26752 26249 gene locus_tag LOCUS_08340 gene msrB 26752 26249 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967753.1 protein_id gnl|my_center|LOCUS_08340 27383 26763 gene locus_tag LOCUS_08350 gene msrA 27383 26763 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_08350 27590 28390 gene locus_tag LOCUS_08360 27590 28390 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_08360 28566 28387 gene locus_tag LOCUS_08370 28566 28387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 30785 28563 gene locus_tag LOCUS_08380 30785 28563 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391071.1 protein_id gnl|my_center|LOCUS_08380 31320 30793 gene locus_tag LOCUS_08390 31320 30793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 32843 31317 gene locus_tag LOCUS_08400 gene ccoG 32843 31317 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919281.1 protein_id gnl|my_center|LOCUS_08400 33796 32912 gene locus_tag LOCUS_08410 gene ccoP 33796 32912 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085551.1 protein_id gnl|my_center|LOCUS_08410 33996 33793 gene locus_tag LOCUS_08420 33996 33793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 34737 34006 gene locus_tag LOCUS_08430 gene ccoO 34737 34006 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970734.1 protein_id gnl|my_center|LOCUS_08430 36438 34750 gene locus_tag LOCUS_08440 gene ccoN 36438 34750 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085548.1 protein_id gnl|my_center|LOCUS_08440 37766 36618 gene locus_tag LOCUS_08450 37766 36618 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099197.1 protein_id gnl|my_center|LOCUS_08450 40527 37768 gene locus_tag LOCUS_08460 gene rbbA 40527 37768 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_08460 41597 40524 gene locus_tag LOCUS_08470 41597 40524 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099200.1 protein_id gnl|my_center|LOCUS_08470 42157 44514 gene locus_tag LOCUS_08480 42157 44514 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072544.1 protein_id gnl|my_center|LOCUS_08480 47740 44642 gene locus_tag LOCUS_08490 47740 44642 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920956.1 protein_id gnl|my_center|LOCUS_08490 48846 47737 gene locus_tag LOCUS_08500 48846 47737 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391447.1 protein_id gnl|my_center|LOCUS_08500 48933 49682 gene locus_tag LOCUS_08510 48933 49682 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920954.1 protein_id gnl|my_center|LOCUS_08510 49833 50504 gene locus_tag LOCUS_08520 49833 50504 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140311.1 protein_id gnl|my_center|LOCUS_08520 50539 51459 gene locus_tag LOCUS_08530 50539 51459 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227175.1 protein_id gnl|my_center|LOCUS_08530 51487 52362 gene locus_tag LOCUS_08540 51487 52362 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_08540 52384 53877 gene locus_tag LOCUS_08550 52384 53877 CDS product bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088040.1 protein_id gnl|my_center|LOCUS_08550 53954 54751 gene locus_tag LOCUS_08560 53954 54751 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172853.1 protein_id gnl|my_center|LOCUS_08560 56079 54823 gene locus_tag LOCUS_08570 56079 54823 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_08570 56408 57580 gene locus_tag LOCUS_08580 56408 57580 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090530.1 protein_id gnl|my_center|LOCUS_08580 57684 58400 gene locus_tag LOCUS_08590 57684 58400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 58538 59266 gene locus_tag LOCUS_08600 58538 59266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 60383 59271 gene locus_tag LOCUS_08610 60383 59271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920970.1 protein_id gnl|my_center|LOCUS_08610 61264 60410 gene locus_tag LOCUS_08620 61264 60410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640674.1 protein_id gnl|my_center|LOCUS_08620 62178 61261 gene locus_tag LOCUS_08630 62178 61261 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265910.1 protein_id gnl|my_center|LOCUS_08630 63454 62363 gene locus_tag LOCUS_08640 63454 62363 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920973.1 protein_id gnl|my_center|LOCUS_08640 63815 64501 gene locus_tag LOCUS_08650 63815 64501 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114590.1 protein_id gnl|my_center|LOCUS_08650 64761 65507 gene locus_tag LOCUS_08660 gene map 64761 65507 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037387469.1 protein_id gnl|my_center|LOCUS_08660 66059 65817 gene locus_tag LOCUS_08670 66059 65817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 66347 66595 gene locus_tag LOCUS_08680 66347 66595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 67258 66599 gene locus_tag LOCUS_08690 67258 66599 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062378.1 protein_id gnl|my_center|LOCUS_08690 67523 68641 gene locus_tag LOCUS_08700 gene ald 67523 68641 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946659.1 protein_id gnl|my_center|LOCUS_08700 68771 69385 gene locus_tag LOCUS_08710 68771 69385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 69578 69760 gene locus_tag LOCUS_08720 gene rpmF 69578 69760 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067326.1 protein_id gnl|my_center|LOCUS_08720 70910 69825 gene locus_tag LOCUS_08730 70910 69825 CDS product DUF2817 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533436.1 protein_id gnl|my_center|LOCUS_08730 71056 71448 gene locus_tag LOCUS_08740 71056 71448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529226.1 protein_id gnl|my_center|LOCUS_08740 72297 71449 gene locus_tag LOCUS_08750 72297 71449 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388886.1 protein_id gnl|my_center|LOCUS_08750 72893 72294 gene locus_tag LOCUS_08760 72893 72294 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_08760 74317 72890 gene locus_tag LOCUS_08770 74317 72890 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388887.1 protein_id gnl|my_center|LOCUS_08770 75447 74356 gene locus_tag LOCUS_08780 75447 74356 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_08780 75631 76434 gene locus_tag LOCUS_08790 75631 76434 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_08790 76474 77295 gene locus_tag LOCUS_08800 76474 77295 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_08800 77304 77669 gene locus_tag LOCUS_08810 77304 77669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918395.1 protein_id gnl|my_center|LOCUS_08810 77677 79263 gene locus_tag LOCUS_08820 gene ggt 77677 79263 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528519.1 protein_id gnl|my_center|LOCUS_08820 79611 79276 gene locus_tag LOCUS_08830 79611 79276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 79849 81642 gene locus_tag LOCUS_08840 79849 81642 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965204.1 protein_id gnl|my_center|LOCUS_08840 82269 81646 gene locus_tag LOCUS_08850 gene phaR 82269 81646 CDS product polyhydroxyalkanoate synthesis repressor PhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918397.1 protein_id gnl|my_center|LOCUS_08850 82534 83721 gene locus_tag LOCUS_08860 82534 83721 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175239.1 protein_id gnl|my_center|LOCUS_08860 83764 84489 gene locus_tag LOCUS_08870 83764 84489 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709750.1 protein_id gnl|my_center|LOCUS_08870 85154 84543 gene locus_tag LOCUS_08880 85154 84543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 86084 85194 gene locus_tag LOCUS_08890 86084 85194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 86651 86208 gene locus_tag LOCUS_08900 86651 86208 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066774.1 protein_id gnl|my_center|LOCUS_08900 87423 86653 gene locus_tag LOCUS_08910 gene gloB 87423 86653 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066773.1 protein_id gnl|my_center|LOCUS_08910 87568 88326 gene locus_tag LOCUS_08920 87568 88326 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083053.1 protein_id gnl|my_center|LOCUS_08920 88956 88330 gene locus_tag LOCUS_08930 gene metW 88956 88330 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_08930 90158 88953 gene locus_tag LOCUS_08940 90158 88953 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529386.1 protein_id gnl|my_center|LOCUS_08940 90368 91264 gene locus_tag LOCUS_08950 90368 91264 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391013.1 protein_id gnl|my_center|LOCUS_08950 91272 92372 gene locus_tag LOCUS_08960 gene hisC 91272 92372 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084214.1 protein_id gnl|my_center|LOCUS_08960 92372 93319 gene locus_tag LOCUS_08970 92372 93319 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_08970 94407 93313 gene locus_tag LOCUS_08980 94407 93313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 94480 95013 gene locus_tag LOCUS_08990 94480 95013 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173537.1 protein_id gnl|my_center|LOCUS_08990 96175 94970 gene locus_tag LOCUS_09000 96175 94970 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241156.1 protein_id gnl|my_center|LOCUS_09000 96596 96180 gene locus_tag LOCUS_09010 96596 96180 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019237965.1 protein_id gnl|my_center|LOCUS_09010 97076 96615 gene locus_tag LOCUS_09020 97076 96615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 97951 97073 gene locus_tag LOCUS_09030 97951 97073 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_09030 100359 98032 gene locus_tag LOCUS_09040 100359 98032 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_09040 101236 100520 gene locus_tag LOCUS_09050 101236 100520 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338448.1 protein_id gnl|my_center|LOCUS_09050 101886 101260 gene locus_tag LOCUS_09060 101886 101260 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529398.1 protein_id gnl|my_center|LOCUS_09060 102983 102024 gene locus_tag LOCUS_09070 102983 102024 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066765.1 protein_id gnl|my_center|LOCUS_09070 103635 102976 gene locus_tag LOCUS_09080 gene ftsE 103635 102976 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010911739.1 protein_id gnl|my_center|LOCUS_09080 104121 103888 gene locus_tag LOCUS_09090 104121 103888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 104255 104746 gene locus_tag LOCUS_09100 104255 104746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 104743 105288 gene locus_tag LOCUS_09110 gene hpt 104743 105288 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066762.1 protein_id gnl|my_center|LOCUS_09110 105293 105673 gene locus_tag LOCUS_09120 105293 105673 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084205.1 protein_id gnl|my_center|LOCUS_09120 <106668 105674 gene locus_tag LOCUS_09130 <106668 105674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066760.1:TIGR02302 family protein >Feature sequence009 196 729 gene locus_tag LOCUS_09140 196 729 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388878.1 protein_id gnl|my_center|LOCUS_09140 857 1768 gene locus_tag LOCUS_09150 gene trxA 857 1768 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083423.1 protein_id gnl|my_center|LOCUS_09150 1779 2462 gene locus_tag LOCUS_09160 1779 2462 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083424.1 protein_id gnl|my_center|LOCUS_09160 2488 2700 gene locus_tag LOCUS_09170 2488 2700 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083431.1 protein_id gnl|my_center|LOCUS_09170 2693 3055 gene locus_tag LOCUS_09180 2693 3055 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314414.1 protein_id gnl|my_center|LOCUS_09180 4348 3059 gene locus_tag LOCUS_09190 4348 3059 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336782.1 protein_id gnl|my_center|LOCUS_09190 4382 5737 gene locus_tag LOCUS_09200 4382 5737 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140029.1 protein_id gnl|my_center|LOCUS_09200 8024 5793 gene locus_tag LOCUS_09210 8024 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8441 9775 gene locus_tag LOCUS_09220 8441 9775 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027163308.1 protein_id gnl|my_center|LOCUS_09220 10188 10526 gene locus_tag LOCUS_09230 10188 10526 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528889.1 protein_id gnl|my_center|LOCUS_09230 10626 11921 gene locus_tag LOCUS_09240 gene amt 10626 11921 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383316.1 protein_id gnl|my_center|LOCUS_09240 12372 13628 gene locus_tag LOCUS_09250 12372 13628 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_09250 13867 15096 gene locus_tag LOCUS_09260 13867 15096 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_09260 15093 17780 gene locus_tag LOCUS_09270 15093 17780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 17869 18591 gene locus_tag LOCUS_09280 17869 18591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 18701 19585 gene locus_tag LOCUS_09290 18701 19585 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533989.1 protein_id gnl|my_center|LOCUS_09290 19521 20903 gene locus_tag LOCUS_09300 19521 20903 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389832.1 protein_id gnl|my_center|LOCUS_09300 21185 22567 gene locus_tag LOCUS_09310 21185 22567 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269274.1 protein_id gnl|my_center|LOCUS_09310 22984 23607 gene locus_tag LOCUS_09320 22984 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 23644 24450 gene locus_tag LOCUS_09330 23644 24450 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067261.1 protein_id gnl|my_center|LOCUS_09330 24758 25381 gene locus_tag LOCUS_09340 24758 25381 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971718.1 protein_id gnl|my_center|LOCUS_09340 25845 25372 gene locus_tag LOCUS_09350 25845 25372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 26338 25838 gene locus_tag LOCUS_09360 26338 25838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 26437 26901 gene locus_tag LOCUS_09370 26437 26901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 26991 27155 gene locus_tag LOCUS_09380 26991 27155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 27801 27160 gene locus_tag LOCUS_09390 27801 27160 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266002.1 protein_id gnl|my_center|LOCUS_09390 29644 27851 gene locus_tag LOCUS_09400 29644 27851 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_09400 29995 30690 gene locus_tag LOCUS_09410 29995 30690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 30952 31296 gene locus_tag LOCUS_09420 30952 31296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 31982 31293 gene locus_tag LOCUS_09430 31982 31293 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083450.1 protein_id gnl|my_center|LOCUS_09430 32030 32647 gene locus_tag LOCUS_09440 32030 32647 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266003.1 protein_id gnl|my_center|LOCUS_09440 33480 32644 gene locus_tag LOCUS_09450 33480 32644 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388612.1 protein_id gnl|my_center|LOCUS_09450 34392 33511 gene locus_tag LOCUS_09460 34392 33511 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389217.1 protein_id gnl|my_center|LOCUS_09460 35639 34521 gene locus_tag LOCUS_09470 35639 34521 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389867.1 protein_id gnl|my_center|LOCUS_09470 36233 36805 gene locus_tag LOCUS_09480 36233 36805 CDS product DUF3576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391379.1 protein_id gnl|my_center|LOCUS_09480 36900 39506 gene locus_tag LOCUS_09490 gene leuS 36900 39506 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398680.1 protein_id gnl|my_center|LOCUS_09490 39508 40026 gene locus_tag LOCUS_09500 39508 40026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 40038 41081 gene locus_tag LOCUS_09510 gene holA 40038 41081 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391376.1 protein_id gnl|my_center|LOCUS_09510 42294 41380 gene locus_tag LOCUS_09520 42294 41380 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528737.1 protein_id gnl|my_center|LOCUS_09520 43392 42496 gene locus_tag LOCUS_09530 43392 42496 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083458.1 protein_id gnl|my_center|LOCUS_09530 44011 43415 gene locus_tag LOCUS_09540 gene rsmG 44011 43415 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923358.1 protein_id gnl|my_center|LOCUS_09540 45966 44110 gene locus_tag LOCUS_09550 gene mnmG 45966 44110 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024266007.1 protein_id gnl|my_center|LOCUS_09550 47613 46306 gene locus_tag LOCUS_09560 gene mnmE 47613 46306 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391371.1 protein_id gnl|my_center|LOCUS_09560 47934 47647 gene locus_tag LOCUS_09570 47934 47647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 48036 50069 gene locus_tag LOCUS_09580 48036 50069 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391369.1 protein_id gnl|my_center|LOCUS_09580 51018 50071 gene locus_tag LOCUS_09590 51018 50071 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530654.1 protein_id gnl|my_center|LOCUS_09590 51185 51364 gene locus_tag LOCUS_09600 51185 51364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 51653 52345 gene locus_tag LOCUS_09610 51653 52345 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921585.1 protein_id gnl|my_center|LOCUS_09610 52372 52995 gene locus_tag LOCUS_09620 52372 52995 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529595.1 protein_id gnl|my_center|LOCUS_09620 53046 54029 gene locus_tag LOCUS_09630 53046 54029 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_09630 54051 54467 gene locus_tag LOCUS_09640 54051 54467 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064295.1 protein_id gnl|my_center|LOCUS_09640 54464 55483 gene locus_tag LOCUS_09650 54464 55483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_09650 56106 55429 gene locus_tag LOCUS_09660 56106 55429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 57444 56179 gene locus_tag LOCUS_09670 gene rho 57444 56179 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067411.1 protein_id gnl|my_center|LOCUS_09670 58265 57822 gene locus_tag LOCUS_09680 gene hemJ 58265 57822 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083463.1 protein_id gnl|my_center|LOCUS_09680 59328 58285 gene locus_tag LOCUS_09690 gene hemH 59328 58285 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391364.1 protein_id gnl|my_center|LOCUS_09690 60365 59325 gene locus_tag LOCUS_09700 gene hemE 60365 59325 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391363.1 protein_id gnl|my_center|LOCUS_09700 60923 61771 gene locus_tag LOCUS_09710 60923 61771 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639851.1 protein_id gnl|my_center|LOCUS_09710 61777 62391 gene locus_tag LOCUS_09720 61777 62391 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917893.1 protein_id gnl|my_center|LOCUS_09720 62388 63233 gene locus_tag LOCUS_09730 62388 63233 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528727.1 protein_id gnl|my_center|LOCUS_09730 63260 63886 gene locus_tag LOCUS_09740 gene coaE 63260 63886 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639852.1 protein_id gnl|my_center|LOCUS_09740 63919 64347 gene locus_tag LOCUS_09750 63919 64347 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094613.1 protein_id gnl|my_center|LOCUS_09750 64405 65088 gene locus_tag LOCUS_09760 gene dnaQ 64405 65088 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538049.1 protein_id gnl|my_center|LOCUS_09760 65574 65089 gene locus_tag LOCUS_09770 gene secB 65574 65089 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067419.1 protein_id gnl|my_center|LOCUS_09770 66206 65664 gene locus_tag LOCUS_09780 66206 65664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 66474 67241 gene locus_tag LOCUS_09790 66474 67241 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083469.1 protein_id gnl|my_center|LOCUS_09790 67323 68384 gene locus_tag LOCUS_09800 67323 68384 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338813.1 protein_id gnl|my_center|LOCUS_09800 68441 69058 gene locus_tag LOCUS_09810 68441 69058 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083471.1 protein_id gnl|my_center|LOCUS_09810 69055 69426 gene locus_tag LOCUS_09820 69055 69426 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528719.1 protein_id gnl|my_center|LOCUS_09820 69566 70504 gene locus_tag LOCUS_09830 69566 70504 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897067.1 protein_id gnl|my_center|LOCUS_09830 70574 71401 gene locus_tag LOCUS_09840 70574 71401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144328.1 protein_id gnl|my_center|LOCUS_09840 71398 72459 gene locus_tag LOCUS_09850 71398 72459 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827578.1 protein_id gnl|my_center|LOCUS_09850 72582 73661 gene locus_tag LOCUS_09860 72582 73661 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_09860 75136 73829 gene locus_tag LOCUS_09870 gene hslU 75136 73829 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083473.1 protein_id gnl|my_center|LOCUS_09870 75725 75141 gene locus_tag LOCUS_09880 75725 75141 CDS product DUF2585 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528354.1 protein_id gnl|my_center|LOCUS_09880 76342 75722 gene locus_tag LOCUS_09890 gene hslV 76342 75722 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083476.1 protein_id gnl|my_center|LOCUS_09890 76433 77047 gene locus_tag LOCUS_09900 76433 77047 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528837.1 protein_id gnl|my_center|LOCUS_09900 77596 77066 gene locus_tag LOCUS_09910 77596 77066 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529397.1 protein_id gnl|my_center|LOCUS_09910 77969 78580 gene locus_tag LOCUS_09920 gene hisB 77969 78580 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391344.1 protein_id gnl|my_center|LOCUS_09920 78674 79180 gene locus_tag LOCUS_09930 78674 79180 CDS product DUF2628 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083478.1 protein_id gnl|my_center|LOCUS_09930 79181 79819 gene locus_tag LOCUS_09940 gene hisH 79181 79819 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391343.1 protein_id gnl|my_center|LOCUS_09940 79807 80547 gene locus_tag LOCUS_09950 gene hisA 79807 80547 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965127.1 protein_id gnl|my_center|LOCUS_09950 80547 81305 gene locus_tag LOCUS_09960 gene hisF 80547 81305 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067464.1 protein_id gnl|my_center|LOCUS_09960 81463 82992 gene locus_tag LOCUS_09970 81463 82992 CDS product inorganic triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921351.1 protein_id gnl|my_center|LOCUS_09970 83130 84224 gene locus_tag LOCUS_09980 83130 84224 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640013.1 protein_id gnl|my_center|LOCUS_09980 84393 84722 gene locus_tag LOCUS_09990 84393 84722 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 protein_id gnl|my_center|LOCUS_09990 84734 85702 gene locus_tag LOCUS_10000 gene coaA 84734 85702 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027543772.1 protein_id gnl|my_center|LOCUS_10000 85939 85709 gene locus_tag LOCUS_10010 85939 85709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 86196 87527 gene locus_tag LOCUS_10020 86196 87527 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531687.1 protein_id gnl|my_center|LOCUS_10020 88064 88960 gene locus_tag LOCUS_10030 88064 88960 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389414.1 protein_id gnl|my_center|LOCUS_10030 89094 89471 gene locus_tag LOCUS_10040 89094 89471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 89620 90231 gene locus_tag LOCUS_10050 89620 90231 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_10050 90374 90228 gene locus_tag LOCUS_10060 90374 90228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 90652 91032 gene locus_tag LOCUS_10070 90652 91032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 91362 91562 gene locus_tag LOCUS_10080 91362 91562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 91951 92619 gene locus_tag LOCUS_10090 91951 92619 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920292.1 protein_id gnl|my_center|LOCUS_10090 92868 93080 gene locus_tag LOCUS_10100 92868 93080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 93176 94153 gene locus_tag LOCUS_10110 93176 94153 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085392.1 protein_id gnl|my_center|LOCUS_10110 94184 95005 gene locus_tag LOCUS_10120 94184 95005 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082975.1 protein_id gnl|my_center|LOCUS_10120 96482 95526 gene locus_tag LOCUS_10130 96482 95526 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_10130 97843 96929 gene locus_tag LOCUS_10140 97843 96929 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_10140 97932 99020 gene locus_tag LOCUS_10150 97932 99020 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640168.1 protein_id gnl|my_center|LOCUS_10150 100699 99407 gene locus_tag LOCUS_10160 100699 99407 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_10160 101058 100717 gene locus_tag LOCUS_10170 101058 100717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 <101659 101040 gene locus_tag LOCUS_10180 <101659 101040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083381.1:enoyl-CoA hydratase >Feature sequence010 <1 754 gene locus_tag LOCUS_10190 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083032.1:alpha-L-fucosidase 847 2526 gene locus_tag LOCUS_10200 847 2526 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_10200 2589 3914 gene locus_tag LOCUS_10210 2589 3914 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_10210 4137 5108 gene locus_tag LOCUS_10220 gene dusA 4137 5108 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086515.1 protein_id gnl|my_center|LOCUS_10220 5179 7635 gene locus_tag LOCUS_10230 5179 7635 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275305.1 protein_id gnl|my_center|LOCUS_10230 7696 8532 gene locus_tag LOCUS_10240 7696 8532 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971950.1 protein_id gnl|my_center|LOCUS_10240 9633 8536 gene locus_tag LOCUS_10250 9633 8536 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084168.1 protein_id gnl|my_center|LOCUS_10250 11203 9704 gene locus_tag LOCUS_10260 11203 9704 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090848.1 protein_id gnl|my_center|LOCUS_10260 12027 11332 gene locus_tag LOCUS_10270 12027 11332 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314021.1 protein_id gnl|my_center|LOCUS_10270 12156 13061 gene locus_tag LOCUS_10280 gene cobA 12156 13061 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395418.1 protein_id gnl|my_center|LOCUS_10280 13671 14432 gene locus_tag LOCUS_10290 13671 14432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 14680 14441 gene locus_tag LOCUS_10300 14680 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 14762 15742 gene locus_tag LOCUS_10310 14762 15742 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531715.1 protein_id gnl|my_center|LOCUS_10310 15968 17155 gene locus_tag LOCUS_10320 15968 17155 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_10320 17200 18330 gene locus_tag LOCUS_10330 17200 18330 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265695.1 protein_id gnl|my_center|LOCUS_10330 18453 19538 gene locus_tag LOCUS_10340 18453 19538 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038986.1 protein_id gnl|my_center|LOCUS_10340 21072 19546 gene locus_tag LOCUS_10350 21072 19546 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400593.1 protein_id gnl|my_center|LOCUS_10350 21289 22089 gene locus_tag LOCUS_10360 21289 22089 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_10360 22119 22526 gene locus_tag LOCUS_10370 22119 22526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 22569 23777 gene locus_tag LOCUS_10380 22569 23777 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919992.1 protein_id gnl|my_center|LOCUS_10380 25755 23848 gene locus_tag LOCUS_10390 25755 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 26758 25853 gene locus_tag LOCUS_10400 26758 25853 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919954.1 protein_id gnl|my_center|LOCUS_10400 26980 28239 gene locus_tag LOCUS_10410 26980 28239 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088367.1 protein_id gnl|my_center|LOCUS_10410 28483 29898 gene locus_tag LOCUS_10420 28483 29898 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388484.1 protein_id gnl|my_center|LOCUS_10420 30935 29895 gene locus_tag LOCUS_10430 30935 29895 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594067.1 protein_id gnl|my_center|LOCUS_10430 31415 30972 gene locus_tag LOCUS_10440 31415 30972 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919948.1 protein_id gnl|my_center|LOCUS_10440 31557 32060 gene locus_tag LOCUS_10450 31557 32060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 32066 32620 gene locus_tag LOCUS_10460 32066 32620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 32720 33259 gene locus_tag LOCUS_10470 32720 33259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 33356 34507 gene locus_tag LOCUS_10480 33356 34507 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918315.1 protein_id gnl|my_center|LOCUS_10480 34515 35150 gene locus_tag LOCUS_10490 34515 35150 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531711.1 protein_id gnl|my_center|LOCUS_10490 35576 35253 gene locus_tag LOCUS_10500 35576 35253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 35725 37848 gene locus_tag LOCUS_10510 35725 37848 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_10510 37922 38926 gene locus_tag LOCUS_10520 37922 38926 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_10520 39016 39516 gene locus_tag LOCUS_10530 39016 39516 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_10530 42008 39522 gene locus_tag LOCUS_10540 42008 39522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 42195 43004 gene locus_tag LOCUS_10550 42195 43004 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_10550 43114 43039 gene locus_tag LOCUS_t00070 43114 43039 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 43277 44446 gene locus_tag LOCUS_10560 43277 44446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 45133 44450 gene locus_tag LOCUS_10570 45133 44450 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086535.1 protein_id gnl|my_center|LOCUS_10570 45307 45798 gene locus_tag LOCUS_10580 45307 45798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414102.1 protein_id gnl|my_center|LOCUS_10580 46947 45802 gene locus_tag LOCUS_10590 46947 45802 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064658.1 protein_id gnl|my_center|LOCUS_10590 47111 48571 gene locus_tag LOCUS_10600 gene gabD 47111 48571 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971372.1 protein_id gnl|my_center|LOCUS_10600 48575 49273 gene locus_tag LOCUS_10610 gene rpiA 48575 49273 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035258577.1 protein_id gnl|my_center|LOCUS_10610 49297 50682 gene locus_tag LOCUS_10620 gene gor 49297 50682 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086538.1 protein_id gnl|my_center|LOCUS_10620 50824 52215 gene locus_tag LOCUS_10630 50824 52215 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_10630 53281 52268 gene locus_tag LOCUS_10640 53281 52268 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966893.1 protein_id gnl|my_center|LOCUS_10640 54389 53364 gene locus_tag LOCUS_10650 54389 53364 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919882.1 protein_id gnl|my_center|LOCUS_10650 55825 54500 gene locus_tag LOCUS_10660 55825 54500 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390985.1 protein_id gnl|my_center|LOCUS_10660 57892 55934 gene locus_tag LOCUS_10670 57892 55934 CDS product MacB family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390984.1 protein_id gnl|my_center|LOCUS_10670 59131 57908 gene locus_tag LOCUS_10680 gene macA 59131 57908 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397100.1 protein_id gnl|my_center|LOCUS_10680 60261 59260 gene locus_tag LOCUS_10690 60261 59260 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082936.1 protein_id gnl|my_center|LOCUS_10690 60471 62138 gene locus_tag LOCUS_10700 60471 62138 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969513.1 protein_id gnl|my_center|LOCUS_10700 62135 63499 gene locus_tag LOCUS_10710 gene gltX 62135 63499 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388446.1 protein_id gnl|my_center|LOCUS_10710 63709 65367 gene locus_tag LOCUS_10720 gene cimA 63709 65367 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086573.1 protein_id gnl|my_center|LOCUS_10720 67079 65469 gene locus_tag LOCUS_10730 67079 65469 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974107.1 protein_id gnl|my_center|LOCUS_10730 67944 67444 gene locus_tag LOCUS_10740 67944 67444 CDS product DUF1772 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141194.1 protein_id gnl|my_center|LOCUS_10740 68960 68019 gene locus_tag LOCUS_10750 68960 68019 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391305.1 protein_id gnl|my_center|LOCUS_10750 69122 70090 gene locus_tag LOCUS_10760 69122 70090 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966800.1 protein_id gnl|my_center|LOCUS_10760 70168 71106 gene locus_tag LOCUS_10770 gene rarD 70168 71106 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532555.1 protein_id gnl|my_center|LOCUS_10770 71719 71171 gene locus_tag LOCUS_10780 71719 71171 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388110.1 protein_id gnl|my_center|LOCUS_10780 71868 72833 gene locus_tag LOCUS_10790 71868 72833 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391333.1 protein_id gnl|my_center|LOCUS_10790 73043 74932 gene locus_tag LOCUS_10800 73043 74932 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023852913.1 protein_id gnl|my_center|LOCUS_10800 75002 75682 gene locus_tag LOCUS_10810 75002 75682 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_10810 75718 76581 gene locus_tag LOCUS_10820 75718 76581 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_10820 76862 76587 gene locus_tag LOCUS_10830 76862 76587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 78105 76780 gene locus_tag LOCUS_10840 78105 76780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 78361 80664 gene locus_tag LOCUS_10850 78361 80664 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_10850 80911 81579 gene locus_tag LOCUS_10860 80911 81579 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025085.1 protein_id gnl|my_center|LOCUS_10860 81584 82528 gene locus_tag LOCUS_10870 81584 82528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 82525 83526 gene locus_tag LOCUS_10880 82525 83526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 83561 84364 gene locus_tag LOCUS_10890 83561 84364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 85216 84422 gene locus_tag LOCUS_10900 85216 84422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 85875 85690 gene locus_tag LOCUS_10910 85875 85690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 85819 86973 gene locus_tag LOCUS_10920 85819 86973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 88386 86980 gene locus_tag LOCUS_10930 88386 86980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 88656 89927 gene locus_tag LOCUS_10940 88656 89927 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536249.1 protein_id gnl|my_center|LOCUS_10940 90740 89934 gene locus_tag LOCUS_10950 90740 89934 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528623.1 protein_id gnl|my_center|LOCUS_10950 92104 90863 gene locus_tag LOCUS_10960 92104 90863 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_10960 92973 92251 gene locus_tag LOCUS_10970 92973 92251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 92947 93612 gene locus_tag LOCUS_10980 92947 93612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 93722 94528 gene locus_tag LOCUS_10990 93722 94528 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038823.1 protein_id gnl|my_center|LOCUS_10990 94542 96413 gene locus_tag LOCUS_11000 94542 96413 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064354.1 protein_id gnl|my_center|LOCUS_11000 96427 97944 gene locus_tag LOCUS_11010 96427 97944 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_11010 98465 97857 gene locus_tag LOCUS_11020 98465 97857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 98571 98837 gene locus_tag LOCUS_11030 98571 98837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence011 1197 133 gene locus_tag LOCUS_11040 1197 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1629 3479 gene locus_tag LOCUS_11050 1629 3479 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_11050 3594 4052 gene locus_tag LOCUS_11060 3594 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4138 4905 gene locus_tag LOCUS_11070 4138 4905 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919445.1 protein_id gnl|my_center|LOCUS_11070 5977 4913 gene locus_tag LOCUS_11080 5977 4913 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_11080 6914 6198 gene locus_tag LOCUS_11090 6914 6198 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810926.1 protein_id gnl|my_center|LOCUS_11090 8034 7123 gene locus_tag LOCUS_11100 8034 7123 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_11100 8945 8040 gene locus_tag LOCUS_11110 8945 8040 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890781.1 protein_id gnl|my_center|LOCUS_11110 9106 9756 gene locus_tag LOCUS_11120 9106 9756 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083641.1 protein_id gnl|my_center|LOCUS_11120 10874 9759 gene locus_tag LOCUS_11130 10874 9759 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269088.1 protein_id gnl|my_center|LOCUS_11130 11692 10877 gene locus_tag LOCUS_11140 11692 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 11849 13525 gene locus_tag LOCUS_11150 11849 13525 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_11150 13550 14512 gene locus_tag LOCUS_11160 13550 14512 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530044.1 protein_id gnl|my_center|LOCUS_11160 14532 16202 gene locus_tag LOCUS_11170 14532 16202 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000500125.1 protein_id gnl|my_center|LOCUS_11170 17937 16306 gene locus_tag LOCUS_11180 17937 16306 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387925.1 protein_id gnl|my_center|LOCUS_11180 19607 18021 gene locus_tag LOCUS_11190 19607 18021 CDS product ATP-dependent acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083665.1 protein_id gnl|my_center|LOCUS_11190 19755 20531 gene locus_tag LOCUS_11200 19755 20531 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392177.1 protein_id gnl|my_center|LOCUS_11200 21469 20528 gene locus_tag LOCUS_11210 21469 20528 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_11210 21798 21592 gene locus_tag LOCUS_11220 21798 21592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 22704 21976 gene locus_tag LOCUS_11230 22704 21976 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089892.1 protein_id gnl|my_center|LOCUS_11230 23316 22774 gene locus_tag LOCUS_11240 23316 22774 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_11240 25236 23380 gene locus_tag LOCUS_11250 25236 23380 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921167.1 protein_id gnl|my_center|LOCUS_11250 26899 25328 gene locus_tag LOCUS_11260 26899 25328 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918850.1 protein_id gnl|my_center|LOCUS_11260 27079 27726 gene locus_tag LOCUS_11270 27079 27726 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086710.1 protein_id gnl|my_center|LOCUS_11270 27730 28296 gene locus_tag LOCUS_11280 27730 28296 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086710.1 protein_id gnl|my_center|LOCUS_11280 28289 29128 gene locus_tag LOCUS_11290 28289 29128 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966527.1 protein_id gnl|my_center|LOCUS_11290 29161 30141 gene locus_tag LOCUS_11300 29161 30141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 30266 31051 gene locus_tag LOCUS_11310 30266 31051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 31061 31993 gene locus_tag LOCUS_11320 31061 31993 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092916.1 protein_id gnl|my_center|LOCUS_11320 32007 33071 gene locus_tag LOCUS_11330 32007 33071 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_11330 33894 33076 gene locus_tag LOCUS_11340 33894 33076 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_11340 34079 34708 gene locus_tag LOCUS_11350 34079 34708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 34746 35921 gene locus_tag LOCUS_11360 34746 35921 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_11360 36005 37222 gene locus_tag LOCUS_11370 36005 37222 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113133.1 protein_id gnl|my_center|LOCUS_11370 39092 37290 gene locus_tag LOCUS_11380 39092 37290 CDS product long-chain-acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640463.1 protein_id gnl|my_center|LOCUS_11380 39286 39603 gene locus_tag LOCUS_11390 39286 39603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 40196 39600 gene locus_tag LOCUS_11400 40196 39600 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228061.1 protein_id gnl|my_center|LOCUS_11400 40561 40193 gene locus_tag LOCUS_11410 40561 40193 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043162216.1 protein_id gnl|my_center|LOCUS_11410 41444 40641 gene locus_tag LOCUS_11420 41444 40641 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083453.1 protein_id gnl|my_center|LOCUS_11420 41554 42237 gene locus_tag LOCUS_11430 41554 42237 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224791.1 protein_id gnl|my_center|LOCUS_11430 42863 42234 gene locus_tag LOCUS_11440 42863 42234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 43627 42860 gene locus_tag LOCUS_11450 43627 42860 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485703.1 protein_id gnl|my_center|LOCUS_11450 45023 43644 gene locus_tag LOCUS_11460 gene glnT 45023 43644 CDS product type III glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267555.1 protein_id gnl|my_center|LOCUS_11460 45641 45063 gene locus_tag LOCUS_11470 45641 45063 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816959.1 protein_id gnl|my_center|LOCUS_11470 45844 46350 gene locus_tag LOCUS_11480 45844 46350 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969303.1 protein_id gnl|my_center|LOCUS_11480 47131 46361 gene locus_tag LOCUS_11490 47131 46361 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_11490 47284 47703 gene locus_tag LOCUS_11500 47284 47703 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328750.1 protein_id gnl|my_center|LOCUS_11500 47933 47715 gene locus_tag LOCUS_11510 47933 47715 CDS product ChaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087407.1 protein_id gnl|my_center|LOCUS_11510 48051 47966 gene locus_tag LOCUS_t00080 48051 47966 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 48185 48706 gene locus_tag LOCUS_11520 48185 48706 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329529.1 protein_id gnl|my_center|LOCUS_11520 48706 49296 gene locus_tag LOCUS_11530 48706 49296 CDS product demethoxyubiquinone hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640434.1 protein_id gnl|my_center|LOCUS_11530 49860 49300 gene locus_tag LOCUS_11540 49860 49300 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006328497.1 protein_id gnl|my_center|LOCUS_11540 50644 49970 gene locus_tag LOCUS_11550 50644 49970 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_11550 50724 51626 gene locus_tag LOCUS_11560 gene gluQRS 50724 51626 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084190.1 protein_id gnl|my_center|LOCUS_11560 51753 52811 gene locus_tag LOCUS_11570 51753 52811 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967713.1 protein_id gnl|my_center|LOCUS_11570 53759 52815 gene locus_tag LOCUS_11580 53759 52815 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090122.1 protein_id gnl|my_center|LOCUS_11580 54514 53837 gene locus_tag LOCUS_11590 54514 53837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 55632 54511 gene locus_tag LOCUS_11600 55632 54511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 55916 55629 gene locus_tag LOCUS_11610 55916 55629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 56246 56893 gene locus_tag LOCUS_11620 56246 56893 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_11620 58928 56925 gene locus_tag LOCUS_11630 58928 56925 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390810.1 protein_id gnl|my_center|LOCUS_11630 59092 60339 gene locus_tag LOCUS_11640 59092 60339 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172378.1 protein_id gnl|my_center|LOCUS_11640 60843 60424 gene locus_tag LOCUS_11650 60843 60424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 62087 60987 gene locus_tag LOCUS_11660 62087 60987 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_11660 62292 63557 gene locus_tag LOCUS_11670 gene ccrA 62292 63557 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721248.1 protein_id gnl|my_center|LOCUS_11670 64447 63767 gene locus_tag LOCUS_11680 64447 63767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 65240 64560 gene locus_tag LOCUS_11690 65240 64560 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966152.1 protein_id gnl|my_center|LOCUS_11690 66814 65339 gene locus_tag LOCUS_11700 66814 65339 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388889.1 protein_id gnl|my_center|LOCUS_11700 67039 68742 gene locus_tag LOCUS_11710 67039 68742 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_11710 68746 68937 gene locus_tag LOCUS_11720 68746 68937 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027544319.1 protein_id gnl|my_center|LOCUS_11720 69073 69618 gene locus_tag LOCUS_11730 69073 69618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 69779 70672 gene locus_tag LOCUS_11740 69779 70672 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413363.1 protein_id gnl|my_center|LOCUS_11740 70784 71305 gene locus_tag LOCUS_11750 70784 71305 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947309.1 protein_id gnl|my_center|LOCUS_11750 71316 71906 gene locus_tag LOCUS_11760 71316 71906 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_11760 72166 72915 gene locus_tag LOCUS_11770 72166 72915 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982194.1 protein_id gnl|my_center|LOCUS_11770 72912 73853 gene locus_tag LOCUS_11780 72912 73853 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_11780 73999 74874 gene locus_tag LOCUS_11790 73999 74874 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084197.1 protein_id gnl|my_center|LOCUS_11790 74981 75523 gene locus_tag LOCUS_11800 74981 75523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 76163 75534 gene locus_tag LOCUS_11810 76163 75534 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209606167.1 protein_id gnl|my_center|LOCUS_11810 76244 77638 gene locus_tag LOCUS_11820 gene argH 76244 77638 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388156.1 protein_id gnl|my_center|LOCUS_11820 77655 77894 gene locus_tag LOCUS_11830 77655 77894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 77920 78183 gene locus_tag LOCUS_11840 77920 78183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 78105 79115 gene locus_tag LOCUS_11850 gene lysA 78105 79115 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720913.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11850 >Feature sequence012 <1 747 gene locus_tag LOCUS_11860 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085392.1:nitronate monooxygenase family protein 2500 815 gene locus_tag LOCUS_11870 2500 815 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_11870 3636 2548 gene locus_tag LOCUS_11880 3636 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4054 3683 gene locus_tag LOCUS_11890 4054 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 5307 4051 gene locus_tag LOCUS_11900 5307 4051 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227131.1 protein_id gnl|my_center|LOCUS_11900 5505 6539 gene locus_tag LOCUS_11910 5505 6539 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112789.1 protein_id gnl|my_center|LOCUS_11910 6576 7313 gene locus_tag LOCUS_11920 6576 7313 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084311.1 protein_id gnl|my_center|LOCUS_11920 8158 7379 gene locus_tag LOCUS_11930 8158 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8580 8155 gene locus_tag LOCUS_11940 gene exbD 8580 8155 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385082.1 protein_id gnl|my_center|LOCUS_11940 9507 8584 gene locus_tag LOCUS_11950 gene exbB 9507 8584 CDS product tonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528968.1 protein_id gnl|my_center|LOCUS_11950 9803 10315 gene locus_tag LOCUS_11960 9803 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10402 12285 gene locus_tag LOCUS_11970 10402 12285 CDS product alkyl sulfatase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110061.1 protein_id gnl|my_center|LOCUS_11970 12341 13351 gene locus_tag LOCUS_11980 12341 13351 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496169.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11980 14114 13365 gene locus_tag LOCUS_11990 14114 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 15333 14239 gene locus_tag LOCUS_12000 15333 14239 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195328.1 protein_id gnl|my_center|LOCUS_12000 15714 15394 gene locus_tag LOCUS_12010 15714 15394 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312579.1 protein_id gnl|my_center|LOCUS_12010 16095 16439 gene locus_tag LOCUS_12020 16095 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 20633 16446 gene locus_tag LOCUS_12030 20633 16446 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389851.1 protein_id gnl|my_center|LOCUS_12030 22510 20633 gene locus_tag LOCUS_12040 22510 20633 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626303.1 protein_id gnl|my_center|LOCUS_12040 22639 25014 gene locus_tag LOCUS_12050 22639 25014 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921601.1 protein_id gnl|my_center|LOCUS_12050 25957 25016 gene locus_tag LOCUS_12060 25957 25016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 26433 25951 gene locus_tag LOCUS_12070 26433 25951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 26952 26728 gene locus_tag LOCUS_12080 26952 26728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 26845 27471 gene locus_tag LOCUS_12090 26845 27471 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225313.1 protein_id gnl|my_center|LOCUS_12090 27912 27478 gene locus_tag LOCUS_12100 27912 27478 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208261.1 protein_id gnl|my_center|LOCUS_12100 29078 28188 gene locus_tag LOCUS_12110 29078 28188 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085314.1 protein_id gnl|my_center|LOCUS_12110 30531 29683 gene locus_tag LOCUS_12120 30531 29683 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061558.1 protein_id gnl|my_center|LOCUS_12120 30747 32057 gene locus_tag LOCUS_12130 30747 32057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083910.1 protein_id gnl|my_center|LOCUS_12130 32209 33288 gene locus_tag LOCUS_12140 32209 33288 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_12140 33366 34745 gene locus_tag LOCUS_12150 gene pstC 33366 34745 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_12150 34738 36030 gene locus_tag LOCUS_12160 gene pstA 34738 36030 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_12160 36032 36892 gene locus_tag LOCUS_12170 gene pstB 36032 36892 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081467712.1 protein_id gnl|my_center|LOCUS_12170 36930 37646 gene locus_tag LOCUS_12180 gene phoU 36930 37646 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918182.1 protein_id gnl|my_center|LOCUS_12180 37663 38484 gene locus_tag LOCUS_12190 gene phoB 37663 38484 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918183.1 protein_id gnl|my_center|LOCUS_12190 39140 38625 gene locus_tag LOCUS_12200 gene gcrA 39140 38625 CDS product cell cycle sigma 70 cofactor GcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265783.1 protein_id gnl|my_center|LOCUS_12200 39545 40354 gene locus_tag LOCUS_12210 39545 40354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_12210 40721 41932 gene locus_tag LOCUS_12220 40721 41932 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974339.1 protein_id gnl|my_center|LOCUS_12220 41929 42858 gene locus_tag LOCUS_12230 gene argF 41929 42858 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083918.1 protein_id gnl|my_center|LOCUS_12230 42877 43836 gene locus_tag LOCUS_12240 42877 43836 CDS product Hsp33 family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083919.1 protein_id gnl|my_center|LOCUS_12240 43850 44470 gene locus_tag LOCUS_12250 43850 44470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 44552 45004 gene locus_tag LOCUS_12260 44552 45004 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331343.1 protein_id gnl|my_center|LOCUS_12260 46174 44996 gene locus_tag LOCUS_12270 gene argE 46174 44996 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_12270 46652 46260 gene locus_tag LOCUS_12280 gene apaG 46652 46260 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970890.1 protein_id gnl|my_center|LOCUS_12280 48037 46847 gene locus_tag LOCUS_12290 48037 46847 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965254.1 protein_id gnl|my_center|LOCUS_12290 48319 49476 gene locus_tag LOCUS_12300 48319 49476 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533637.1 protein_id gnl|my_center|LOCUS_12300 50202 49477 gene locus_tag LOCUS_12310 50202 49477 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928540.1 protein_id gnl|my_center|LOCUS_12310 50336 50713 gene locus_tag LOCUS_12320 50336 50713 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258957.1 protein_id gnl|my_center|LOCUS_12320 50710 51435 gene locus_tag LOCUS_12330 50710 51435 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390180.1 protein_id gnl|my_center|LOCUS_12330 51918 51502 gene locus_tag LOCUS_12340 51918 51502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 52993 52043 gene locus_tag LOCUS_12350 52993 52043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 53083 54102 gene locus_tag LOCUS_12360 53083 54102 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_12360 54147 54220 gene locus_tag LOCUS_t00090 54147 54220 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 55222 54350 gene locus_tag LOCUS_12370 55222 54350 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257650.1 protein_id gnl|my_center|LOCUS_12370 55760 55317 gene locus_tag LOCUS_12380 55760 55317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 55656 56891 gene locus_tag LOCUS_12390 55656 56891 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257649.1 protein_id gnl|my_center|LOCUS_12390 56971 59352 gene locus_tag LOCUS_12400 56971 59352 CDS product DUF2309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257648.1 protein_id gnl|my_center|LOCUS_12400 59367 60161 gene locus_tag LOCUS_12410 59367 60161 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_12410 60183 60362 gene locus_tag LOCUS_12420 60183 60362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 60503 61813 gene locus_tag LOCUS_12430 60503 61813 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640165.1 protein_id gnl|my_center|LOCUS_12430 62664 62047 gene locus_tag LOCUS_12440 62664 62047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 62901 64877 gene locus_tag LOCUS_12450 gene betT 62901 64877 CDS product choline BCCT transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096496.1 protein_id gnl|my_center|LOCUS_12450 64949 66481 gene locus_tag LOCUS_12460 64949 66481 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970025.1 protein_id gnl|my_center|LOCUS_12460 67011 66490 gene locus_tag LOCUS_12470 67011 66490 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920110.1 protein_id gnl|my_center|LOCUS_12470 68984 67077 gene locus_tag LOCUS_12480 68984 67077 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228162.1 protein_id gnl|my_center|LOCUS_12480 69248 70297 gene locus_tag LOCUS_12490 69248 70297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314058.1 protein_id gnl|my_center|LOCUS_12490 70835 70302 gene locus_tag LOCUS_12500 70835 70302 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_12500 71674 70832 gene locus_tag LOCUS_12510 71674 70832 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974348.1 protein_id gnl|my_center|LOCUS_12510 71897 72688 gene locus_tag LOCUS_12520 71897 72688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 73100 72693 gene locus_tag LOCUS_12530 73100 72693 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327209.1 protein_id gnl|my_center|LOCUS_12530 76084 73133 gene locus_tag LOCUS_12540 76084 73133 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390784.1 protein_id gnl|my_center|LOCUS_12540 77994 76111 gene locus_tag LOCUS_12550 77994 76111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 78193 79848 gene locus_tag LOCUS_12560 78193 79848 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099307999.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence013 <1 1299 gene locus_tag LOCUS_12570 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918571.1:chaperonin GroEL 1466 2647 gene locus_tag LOCUS_12580 1466 2647 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_12580 2841 4103 gene locus_tag LOCUS_12590 2841 4103 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967039.1 protein_id gnl|my_center|LOCUS_12590 4905 4108 gene locus_tag LOCUS_12600 4905 4108 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338609.1 protein_id gnl|my_center|LOCUS_12600 5618 4998 gene locus_tag LOCUS_12610 5618 4998 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529117.1 protein_id gnl|my_center|LOCUS_12610 5716 7071 gene locus_tag LOCUS_12620 5716 7071 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198286.1 protein_id gnl|my_center|LOCUS_12620 7068 7880 gene locus_tag LOCUS_12630 7068 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 8618 7866 gene locus_tag LOCUS_12640 8618 7866 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090163.1 protein_id gnl|my_center|LOCUS_12640 9605 8625 gene locus_tag LOCUS_12650 gene hisG 9605 8625 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090257.1 protein_id gnl|my_center|LOCUS_12650 10765 9602 gene locus_tag LOCUS_12660 10765 9602 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090256.1 protein_id gnl|my_center|LOCUS_12660 12394 10874 gene locus_tag LOCUS_12670 gene hisS 12394 10874 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530357.1 protein_id gnl|my_center|LOCUS_12670 12819 14381 gene locus_tag LOCUS_12680 12819 14381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 14521 15912 gene locus_tag LOCUS_12690 14521 15912 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339133.1 protein_id gnl|my_center|LOCUS_12690 15925 16941 gene locus_tag LOCUS_12700 gene cydB 15925 16941 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391964.1 protein_id gnl|my_center|LOCUS_12700 16919 17056 gene locus_tag LOCUS_12710 16919 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 18503 17058 gene locus_tag LOCUS_12720 18503 17058 CDS product short-chain fatty acyl-CoA regulator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085241.1 protein_id gnl|my_center|LOCUS_12720 18717 20336 gene locus_tag LOCUS_12730 gene aceB 18717 20336 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919633.1 protein_id gnl|my_center|LOCUS_12730 20370 21662 gene locus_tag LOCUS_12740 gene aceA 20370 21662 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527089.1 protein_id gnl|my_center|LOCUS_12740 21792 22583 gene locus_tag LOCUS_12750 21792 22583 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971115.1 protein_id gnl|my_center|LOCUS_12750 24285 22747 gene locus_tag LOCUS_12760 24285 22747 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107859.1 protein_id gnl|my_center|LOCUS_12760 24490 24981 gene locus_tag LOCUS_12770 gene rraA 24490 24981 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191744.1 protein_id gnl|my_center|LOCUS_12770 25207 25004 gene locus_tag LOCUS_12780 25207 25004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 26301 25429 gene locus_tag LOCUS_12790 gene speE 26301 25429 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003371548.1 protein_id gnl|my_center|LOCUS_12790 26816 26301 gene locus_tag LOCUS_12800 gene speD 26816 26301 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389382.1 protein_id gnl|my_center|LOCUS_12800 26906 27097 gene locus_tag LOCUS_12810 26906 27097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 27608 28129 gene locus_tag LOCUS_12820 27608 28129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 29154 28216 gene locus_tag LOCUS_12830 29154 28216 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919444.1 protein_id gnl|my_center|LOCUS_12830 29912 29304 gene locus_tag LOCUS_12840 29912 29304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 30121 31017 gene locus_tag LOCUS_12850 30121 31017 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921271.1 protein_id gnl|my_center|LOCUS_12850 32772 31033 gene locus_tag LOCUS_12860 32772 31033 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_12860 33261 32857 gene locus_tag LOCUS_12870 33261 32857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 34772 33579 gene locus_tag LOCUS_12880 34772 33579 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266545.1 protein_id gnl|my_center|LOCUS_12880 36481 34901 gene locus_tag LOCUS_12890 36481 34901 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083171434.1 protein_id gnl|my_center|LOCUS_12890 36657 37718 gene locus_tag LOCUS_12900 36657 37718 CDS product lipid A deacylase LpxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389754.1 protein_id gnl|my_center|LOCUS_12900 37994 37722 gene locus_tag LOCUS_12910 37994 37722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 38161 39303 gene locus_tag LOCUS_12920 38161 39303 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_12920 39378 40154 gene locus_tag LOCUS_12930 39378 40154 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919591.1 protein_id gnl|my_center|LOCUS_12930 41068 40151 gene locus_tag LOCUS_12940 41068 40151 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525413.1 protein_id gnl|my_center|LOCUS_12940 41222 42970 gene locus_tag LOCUS_12950 41222 42970 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_12950 43162 45891 gene locus_tag LOCUS_12960 gene ndvB 43162 45891 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_12960 47691 45970 gene locus_tag LOCUS_12970 47691 45970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 47838 48305 gene locus_tag LOCUS_12980 47838 48305 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494078.1 protein_id gnl|my_center|LOCUS_12980 49202 48486 gene locus_tag LOCUS_12990 49202 48486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 50980 49202 gene locus_tag LOCUS_13000 50980 49202 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_13000 51385 51044 gene locus_tag LOCUS_13010 51385 51044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 52325 51552 gene locus_tag LOCUS_13020 gene fabG 52325 51552 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_13020 54208 52457 gene locus_tag LOCUS_13030 54208 52457 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919198.1 protein_id gnl|my_center|LOCUS_13030 54998 54333 gene locus_tag LOCUS_13040 54998 54333 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114770.1 protein_id gnl|my_center|LOCUS_13040 55197 55121 gene locus_tag LOCUS_t00100 55197 55121 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 56706 55333 gene locus_tag LOCUS_13050 56706 55333 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_13050 56896 57828 gene locus_tag LOCUS_13060 56896 57828 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920780.1 protein_id gnl|my_center|LOCUS_13060 59795 57825 gene locus_tag LOCUS_13070 59795 57825 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395243.1 protein_id gnl|my_center|LOCUS_13070 61471 59867 gene locus_tag LOCUS_13080 61471 59867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930051.1 protein_id gnl|my_center|LOCUS_13080 61415 61624 gene locus_tag LOCUS_13090 61415 61624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 62210 64243 gene locus_tag LOCUS_13100 62210 64243 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337150.1 protein_id gnl|my_center|LOCUS_13100 64368 64619 gene locus_tag LOCUS_13110 64368 64619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 64734 65087 gene locus_tag LOCUS_13120 64734 65087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 65389 65147 gene locus_tag LOCUS_13130 65389 65147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 65288 65947 gene locus_tag LOCUS_13140 65288 65947 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088192.1 protein_id gnl|my_center|LOCUS_13140 66244 65975 gene locus_tag LOCUS_13150 66244 65975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 66615 66540 gene locus_tag LOCUS_t00110 66615 66540 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 66982 66737 gene locus_tag LOCUS_13160 66982 66737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 68490 66985 gene locus_tag LOCUS_13170 gene rng 68490 66985 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_13170 69211 68630 gene locus_tag LOCUS_13180 69211 68630 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640472.1 protein_id gnl|my_center|LOCUS_13180 69426 69208 gene locus_tag LOCUS_13190 gene infA 69426 69208 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327290.1 protein_id gnl|my_center|LOCUS_13190 70284 69559 gene locus_tag LOCUS_13200 70284 69559 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925340.1 protein_id gnl|my_center|LOCUS_13200 70443 70925 gene locus_tag LOCUS_13210 70443 70925 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_13210 71418 70936 gene locus_tag LOCUS_13220 71418 70936 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390579.1 protein_id gnl|my_center|LOCUS_13220 71846 71424 gene locus_tag LOCUS_13230 71846 71424 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327288.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence014 358 636 gene locus_tag LOCUS_13240 358 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 715 1416 gene locus_tag LOCUS_13250 gene pyrF 715 1416 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391171.1 protein_id gnl|my_center|LOCUS_13250 1424 2074 gene locus_tag LOCUS_13260 1424 2074 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339435.1 protein_id gnl|my_center|LOCUS_13260 2106 3353 gene locus_tag LOCUS_13270 gene trpB 2106 3353 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724529.1 protein_id gnl|my_center|LOCUS_13270 3350 4189 gene locus_tag LOCUS_13280 gene trpA 3350 4189 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083570.1 protein_id gnl|my_center|LOCUS_13280 4202 5116 gene locus_tag LOCUS_13290 gene accD 4202 5116 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083571.1 protein_id gnl|my_center|LOCUS_13290 5113 6444 gene locus_tag LOCUS_13300 5113 6444 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338601.1 protein_id gnl|my_center|LOCUS_13300 6818 6498 gene locus_tag LOCUS_13310 gene trxA 6818 6498 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391180.1 protein_id gnl|my_center|LOCUS_13310 10397 6930 gene locus_tag LOCUS_13320 gene addA 10397 6930 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391181.1 protein_id gnl|my_center|LOCUS_13320 13438 10394 gene locus_tag LOCUS_13330 gene addB 13438 10394 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391182.1 protein_id gnl|my_center|LOCUS_13330 14158 13463 gene locus_tag LOCUS_13340 14158 13463 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083577.1 protein_id gnl|my_center|LOCUS_13340 15255 14173 gene locus_tag LOCUS_13350 15255 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 15746 15252 gene locus_tag LOCUS_13360 15746 15252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 16271 15792 gene locus_tag LOCUS_13370 16271 15792 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090322.1 protein_id gnl|my_center|LOCUS_13370 16902 18122 gene locus_tag LOCUS_13380 16902 18122 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_13380 18172 18492 gene locus_tag LOCUS_13390 18172 18492 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_13390 18763 19326 gene locus_tag LOCUS_13400 18763 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 20066 19629 gene locus_tag LOCUS_13410 20066 19629 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972826.1 protein_id gnl|my_center|LOCUS_13410 20355 20522 gene locus_tag LOCUS_13420 20355 20522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 20551 22851 gene locus_tag LOCUS_13430 20551 22851 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 protein_id gnl|my_center|LOCUS_13430 22885 23292 gene locus_tag LOCUS_13440 22885 23292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 25604 23343 gene locus_tag LOCUS_13450 25604 23343 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_13450 26086 25619 gene locus_tag LOCUS_13460 26086 25619 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_13460 26279 26839 gene locus_tag LOCUS_13470 26279 26839 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919453.1 protein_id gnl|my_center|LOCUS_13470 27608 26865 gene locus_tag LOCUS_13480 27608 26865 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976098.1 protein_id gnl|my_center|LOCUS_13480 27791 28219 gene locus_tag LOCUS_13490 27791 28219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 28216 28524 gene locus_tag LOCUS_13500 28216 28524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 31399 28718 gene locus_tag LOCUS_13510 31399 28718 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970612.1 protein_id gnl|my_center|LOCUS_13510 32945 31527 gene locus_tag LOCUS_13520 gene ahcY 32945 31527 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088685.1 protein_id gnl|my_center|LOCUS_13520 33260 34078 gene locus_tag LOCUS_13530 33260 34078 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090862.1 protein_id gnl|my_center|LOCUS_13530 34419 34123 gene locus_tag LOCUS_13540 34419 34123 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311103.1 protein_id gnl|my_center|LOCUS_13540 34830 34423 gene locus_tag LOCUS_13550 34830 34423 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639920.1 protein_id gnl|my_center|LOCUS_13550 35488 35003 gene locus_tag LOCUS_13560 35488 35003 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391196.1 protein_id gnl|my_center|LOCUS_13560 37307 35505 gene locus_tag LOCUS_13570 37307 35505 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528336.1 protein_id gnl|my_center|LOCUS_13570 38158 37364 gene locus_tag LOCUS_13580 38158 37364 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528337.1 protein_id gnl|my_center|LOCUS_13580 38385 39935 gene locus_tag LOCUS_13590 38385 39935 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_13590 40391 42004 gene locus_tag LOCUS_13600 40391 42004 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330413.1 protein_id gnl|my_center|LOCUS_13600 42802 42068 gene locus_tag LOCUS_13610 42802 42068 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529238.1 protein_id gnl|my_center|LOCUS_13610 42908 43642 gene locus_tag LOCUS_13620 42908 43642 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092922.1 protein_id gnl|my_center|LOCUS_13620 44050 43712 gene locus_tag LOCUS_13630 44050 43712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 45146 44103 gene locus_tag LOCUS_13640 45146 44103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 48126 45178 gene locus_tag LOCUS_13650 gene polA 48126 45178 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398238.1 protein_id gnl|my_center|LOCUS_13650 48249 49250 gene locus_tag LOCUS_13660 48249 49250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265509.1 protein_id gnl|my_center|LOCUS_13660 49739 49251 gene locus_tag LOCUS_13670 49739 49251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 50294 49854 gene locus_tag LOCUS_13680 50294 49854 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098308.1 protein_id gnl|my_center|LOCUS_13680 50428 51069 gene locus_tag LOCUS_13690 50428 51069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 51697 51074 gene locus_tag LOCUS_13700 51697 51074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 51788 52864 gene locus_tag LOCUS_13710 51788 52864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 53256 53332 gene locus_tag LOCUS_t00120 53256 53332 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 53968 53372 gene locus_tag LOCUS_13720 53968 53372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 54588 54049 gene locus_tag LOCUS_13730 54588 54049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 55156 56502 gene locus_tag LOCUS_13740 55156 56502 CDS product globin-coupled sensor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390989.1 protein_id gnl|my_center|LOCUS_13740 56526 59222 gene locus_tag LOCUS_13750 56526 59222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 59332 62289 gene locus_tag LOCUS_13760 59332 62289 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083225.1 protein_id gnl|my_center|LOCUS_13760 62286 62780 gene locus_tag LOCUS_13770 62286 62780 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084983.1 protein_id gnl|my_center|LOCUS_13770 62795 63181 gene locus_tag LOCUS_13780 62795 63181 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390464.1 protein_id gnl|my_center|LOCUS_13780 63181 63681 gene locus_tag LOCUS_13790 63181 63681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 63697 64827 gene locus_tag LOCUS_13800 63697 64827 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388281.1 protein_id gnl|my_center|LOCUS_13800 64824 65642 gene locus_tag LOCUS_13810 64824 65642 CDS product chemotaxis protein CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388282.1 protein_id gnl|my_center|LOCUS_13810 65790 66143 gene locus_tag LOCUS_13820 65790 66143 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563264.1 protein_id gnl|my_center|LOCUS_13820 67605 66202 gene locus_tag LOCUS_13830 67605 66202 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_13830 68126 67713 gene locus_tag LOCUS_13840 68126 67713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 69438 68194 gene locus_tag LOCUS_13850 69438 68194 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918154.1 protein_id gnl|my_center|LOCUS_13850 70586 69480 gene locus_tag LOCUS_13860 70586 69480 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920254.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence015 610 1785 gene locus_tag LOCUS_13870 610 1785 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919935.1 protein_id gnl|my_center|LOCUS_13870 2482 1790 gene locus_tag LOCUS_13880 2482 1790 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975248.1 protein_id gnl|my_center|LOCUS_13880 3729 2479 gene locus_tag LOCUS_13890 3729 2479 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946586.1 protein_id gnl|my_center|LOCUS_13890 4770 3742 gene locus_tag LOCUS_13900 4770 3742 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946587.1 protein_id gnl|my_center|LOCUS_13900 4897 5286 gene locus_tag LOCUS_13910 4897 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8349 5305 gene locus_tag LOCUS_13920 8349 5305 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067229.1 protein_id gnl|my_center|LOCUS_13920 8742 9083 gene locus_tag LOCUS_13930 8742 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9189 9686 gene locus_tag LOCUS_13940 9189 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10312 10575 gene locus_tag LOCUS_13950 10312 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 10593 10889 gene locus_tag LOCUS_13960 10593 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 12390 11776 gene locus_tag LOCUS_13970 12390 11776 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929057.1 protein_id gnl|my_center|LOCUS_13970 13028 12411 gene locus_tag LOCUS_13980 13028 12411 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118644.1 protein_id gnl|my_center|LOCUS_13980 13879 13079 gene locus_tag LOCUS_13990 13879 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 14345 13944 gene locus_tag LOCUS_14000 14345 13944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 14740 14417 gene locus_tag LOCUS_14010 14740 14417 CDS product ferredoxin family 2Fe-2S iron-sulfur cluster binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389779.1 protein_id gnl|my_center|LOCUS_14010 15798 14767 gene locus_tag LOCUS_14020 15798 14767 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531877.1 protein_id gnl|my_center|LOCUS_14020 16031 16336 gene locus_tag LOCUS_14030 16031 16336 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265672.1 protein_id gnl|my_center|LOCUS_14030 16667 16347 gene locus_tag LOCUS_14040 16667 16347 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088626.1 protein_id gnl|my_center|LOCUS_14040 16889 18412 gene locus_tag LOCUS_14050 16889 18412 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529293.1 protein_id gnl|my_center|LOCUS_14050 19070 20197 gene locus_tag LOCUS_14060 19070 20197 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_14060 20927 20541 gene locus_tag LOCUS_14070 20927 20541 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088627.1 protein_id gnl|my_center|LOCUS_14070 21291 23504 gene locus_tag LOCUS_14080 21291 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14080 24271 23609 gene locus_tag LOCUS_14090 24271 23609 CDS product ABC-type transport auxiliary lipoprotein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109195.1 protein_id gnl|my_center|LOCUS_14090 25191 24283 gene locus_tag LOCUS_14100 25191 24283 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937913.1 protein_id gnl|my_center|LOCUS_14100 25976 25197 gene locus_tag LOCUS_14110 25976 25197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720000.1 protein_id gnl|my_center|LOCUS_14110 27139 25973 gene locus_tag LOCUS_14120 27139 25973 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088806.1 protein_id gnl|my_center|LOCUS_14120 27390 27791 gene locus_tag LOCUS_14130 27390 27791 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066647.1 protein_id gnl|my_center|LOCUS_14130 28433 27825 gene locus_tag LOCUS_14140 28433 27825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188758.1 protein_id gnl|my_center|LOCUS_14140 28953 28492 gene locus_tag LOCUS_14150 28953 28492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 29108 31369 gene locus_tag LOCUS_14160 29108 31369 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090647.1 protein_id gnl|my_center|LOCUS_14160 33940 31445 gene locus_tag LOCUS_14170 33940 31445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 34259 35584 gene locus_tag LOCUS_14180 34259 35584 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529765.1 protein_id gnl|my_center|LOCUS_14180 35574 36272 gene locus_tag LOCUS_14190 35574 36272 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529766.1 protein_id gnl|my_center|LOCUS_14190 36364 37350 gene locus_tag LOCUS_14200 36364 37350 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969505.1 protein_id gnl|my_center|LOCUS_14200 38391 37381 gene locus_tag LOCUS_14210 38391 37381 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_14210 39346 38489 gene locus_tag LOCUS_14220 39346 38489 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551435.1 protein_id gnl|my_center|LOCUS_14220 40538 39336 gene locus_tag LOCUS_14230 40538 39336 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389347.1 protein_id gnl|my_center|LOCUS_14230 41054 40605 gene locus_tag LOCUS_14240 41054 40605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 42091 41051 gene locus_tag LOCUS_14250 42091 41051 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_14250 43209 42100 gene locus_tag LOCUS_14260 43209 42100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919114.1 protein_id gnl|my_center|LOCUS_14260 43555 43364 gene locus_tag LOCUS_14270 43555 43364 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004619421.1 protein_id gnl|my_center|LOCUS_14270 44849 43578 gene locus_tag LOCUS_14280 44849 43578 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640508.1 protein_id gnl|my_center|LOCUS_14280 45152 44976 gene locus_tag LOCUS_14290 45152 44976 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401239.1 protein_id gnl|my_center|LOCUS_14290 45275 45658 gene locus_tag LOCUS_14300 45275 45658 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613956.1 protein_id gnl|my_center|LOCUS_14300 45776 47278 gene locus_tag LOCUS_14310 45776 47278 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051218217.1 protein_id gnl|my_center|LOCUS_14310 47313 48284 gene locus_tag LOCUS_14320 47313 48284 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919111.1 protein_id gnl|my_center|LOCUS_14320 48404 48769 gene locus_tag LOCUS_14330 48404 48769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 48855 49697 gene locus_tag LOCUS_14340 48855 49697 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126923991.1 protein_id gnl|my_center|LOCUS_14340 49694 50461 gene locus_tag LOCUS_14350 49694 50461 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037113771.1 protein_id gnl|my_center|LOCUS_14350 50557 50979 gene locus_tag LOCUS_14360 50557 50979 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089576.1 protein_id gnl|my_center|LOCUS_14360 51314 50991 gene locus_tag LOCUS_14370 51314 50991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 51217 52581 gene locus_tag LOCUS_14380 51217 52581 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028276.1 protein_id gnl|my_center|LOCUS_14380 52547 53263 gene locus_tag LOCUS_14390 52547 53263 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731310.1 protein_id gnl|my_center|LOCUS_14390 53268 54353 gene locus_tag LOCUS_14400 53268 54353 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028275.1 protein_id gnl|my_center|LOCUS_14400 54947 54333 gene locus_tag LOCUS_14410 54947 54333 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192781106.1 protein_id gnl|my_center|LOCUS_14410 55084 55671 gene locus_tag LOCUS_14420 55084 55671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 56280 55678 gene locus_tag LOCUS_14430 56280 55678 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388427.1 protein_id gnl|my_center|LOCUS_14430 57242 56277 gene locus_tag LOCUS_14440 gene corA 57242 56277 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626268.1 protein_id gnl|my_center|LOCUS_14440 57542 58897 gene locus_tag LOCUS_14450 57542 58897 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084264.1 protein_id gnl|my_center|LOCUS_14450 58985 59824 gene locus_tag LOCUS_14460 58985 59824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 60862 59828 gene locus_tag LOCUS_14470 60862 59828 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182165467.1 protein_id gnl|my_center|LOCUS_14470 60992 60917 gene locus_tag LOCUS_t00130 60992 60917 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 62284 61136 gene locus_tag LOCUS_14480 gene rodA 62284 61136 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_14480 64173 62284 gene locus_tag LOCUS_14490 gene mrdA 64173 62284 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_14490 64725 64192 gene locus_tag LOCUS_14500 gene mreD 64725 64192 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388231.1 protein_id gnl|my_center|LOCUS_14500 65672 64731 gene locus_tag LOCUS_14510 gene mreC 65672 64731 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388230.1 protein_id gnl|my_center|LOCUS_14510 <66354 65746 gene locus_tag LOCUS_14520 <66354 65746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014625945.1:rod shape-determining protein >Feature sequence016 158 1438 gene locus_tag LOCUS_14530 158 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1619 2179 gene locus_tag LOCUS_14540 1619 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2636 2181 gene locus_tag LOCUS_14550 2636 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2964 3410 gene locus_tag LOCUS_14560 2964 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3685 4224 gene locus_tag LOCUS_14570 3685 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5152 4346 gene locus_tag LOCUS_14580 5152 4346 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090527.1 protein_id gnl|my_center|LOCUS_14580 5568 5230 gene locus_tag LOCUS_14590 5568 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5745 6152 gene locus_tag LOCUS_14600 5745 6152 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_14600 7099 6134 gene locus_tag LOCUS_14610 7099 6134 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391122.1 protein_id gnl|my_center|LOCUS_14610 7771 7112 gene locus_tag LOCUS_14620 7771 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 8215 8139 gene locus_tag LOCUS_t00140 8215 8139 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8472 9122 gene locus_tag LOCUS_14630 8472 9122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_14630 9139 10032 gene locus_tag LOCUS_14640 9139 10032 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494181.1 protein_id gnl|my_center|LOCUS_14640 10038 11543 gene locus_tag LOCUS_14650 10038 11543 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330170.1 protein_id gnl|my_center|LOCUS_14650 12455 11550 gene locus_tag LOCUS_14660 12455 11550 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529172.1 protein_id gnl|my_center|LOCUS_14660 13733 12651 gene locus_tag LOCUS_14670 13733 12651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 14608 14270 gene locus_tag LOCUS_14680 14608 14270 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529180.1 protein_id gnl|my_center|LOCUS_14680 15138 14671 gene locus_tag LOCUS_14690 15138 14671 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387837.1 protein_id gnl|my_center|LOCUS_14690 15592 15194 gene locus_tag LOCUS_14700 15592 15194 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529181.1 protein_id gnl|my_center|LOCUS_14700 18537 15592 gene locus_tag LOCUS_14710 18537 15592 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054314.1 protein_id gnl|my_center|LOCUS_14710 18895 20187 gene locus_tag LOCUS_14720 18895 20187 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921283.1 protein_id gnl|my_center|LOCUS_14720 22598 20226 gene locus_tag LOCUS_14730 22598 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 23445 22753 gene locus_tag LOCUS_14740 23445 22753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 23671 25827 gene locus_tag LOCUS_14750 gene scpA 23671 25827 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_14750 26114 26350 gene locus_tag LOCUS_14760 26114 26350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 27186 26356 gene locus_tag LOCUS_14770 27186 26356 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966645.1 protein_id gnl|my_center|LOCUS_14770 27346 28386 gene locus_tag LOCUS_14780 gene meaB 27346 28386 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_14780 28513 28803 gene locus_tag LOCUS_14790 gene rpmB 28513 28803 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066777.1 protein_id gnl|my_center|LOCUS_14790 29116 28922 gene locus_tag LOCUS_14800 29116 28922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 29018 29638 gene locus_tag LOCUS_14810 29018 29638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 30722 29556 gene locus_tag LOCUS_14820 30722 29556 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083009.1 protein_id gnl|my_center|LOCUS_14820 32215 30788 gene locus_tag LOCUS_14830 32215 30788 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_14830 33467 32292 gene locus_tag LOCUS_14840 33467 32292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531199.1 protein_id gnl|my_center|LOCUS_14840 35427 33514 gene locus_tag LOCUS_14850 gene cobT 35427 33514 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918558.1 protein_id gnl|my_center|LOCUS_14850 36497 35502 gene locus_tag LOCUS_14860 gene cobS 36497 35502 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523293.1 protein_id gnl|my_center|LOCUS_14860 37263 36637 gene locus_tag LOCUS_14870 37263 36637 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844827.1 protein_id gnl|my_center|LOCUS_14870 37366 37692 gene locus_tag LOCUS_14880 37366 37692 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083017.1 protein_id gnl|my_center|LOCUS_14880 38981 37689 gene locus_tag LOCUS_14890 38981 37689 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066784.1 protein_id gnl|my_center|LOCUS_14890 40101 38983 gene locus_tag LOCUS_14900 gene aroB 40101 38983 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337780.1 protein_id gnl|my_center|LOCUS_14900 40730 40098 gene locus_tag LOCUS_14910 40730 40098 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175815.1 protein_id gnl|my_center|LOCUS_14910 41000 41143 gene locus_tag LOCUS_14920 41000 41143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 41235 43100 gene locus_tag LOCUS_14930 41235 43100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391486.1 protein_id gnl|my_center|LOCUS_14930 43117 44079 gene locus_tag LOCUS_14940 gene xerD 43117 44079 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066788.1 protein_id gnl|my_center|LOCUS_14940 44975 44076 gene locus_tag LOCUS_14950 44975 44076 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198106.1 protein_id gnl|my_center|LOCUS_14950 45526 44972 gene locus_tag LOCUS_14960 45526 44972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921100.1 protein_id gnl|my_center|LOCUS_14960 45967 45539 gene locus_tag LOCUS_14970 45967 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921101.1 protein_id gnl|my_center|LOCUS_14970 46207 47166 gene locus_tag LOCUS_14980 46207 47166 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394627.1 protein_id gnl|my_center|LOCUS_14980 48959 47184 gene locus_tag LOCUS_14990 48959 47184 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957983.1 protein_id gnl|my_center|LOCUS_14990 50179 48956 gene locus_tag LOCUS_15000 50179 48956 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_15000 51380 50190 gene locus_tag LOCUS_15010 51380 50190 CDS product epoxide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920927.1 protein_id gnl|my_center|LOCUS_15010 51527 52891 gene locus_tag LOCUS_15020 51527 52891 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920343.1 protein_id gnl|my_center|LOCUS_15020 55702 52976 gene locus_tag LOCUS_15030 gene secA 55702 52976 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066739.1 protein_id gnl|my_center|LOCUS_15030 55976 56857 gene locus_tag LOCUS_15040 55976 56857 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175805.1 protein_id gnl|my_center|LOCUS_15040 56895 58355 gene locus_tag LOCUS_15050 gene argJ 56895 58355 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388153.1 protein_id gnl|my_center|LOCUS_15050 58442 58876 gene locus_tag LOCUS_15060 gene mutT 58442 58876 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529444.1 protein_id gnl|my_center|LOCUS_15060 58906 59082 gene locus_tag LOCUS_15070 58906 59082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 59991 59086 gene locus_tag LOCUS_15080 59991 59086 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918716.1 protein_id gnl|my_center|LOCUS_15080 60110 60877 gene locus_tag LOCUS_15090 60110 60877 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529448.1 protein_id gnl|my_center|LOCUS_15090 60909 61166 gene locus_tag LOCUS_15100 gene grxC 60909 61166 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529449.1 protein_id gnl|my_center|LOCUS_15100 61170 62033 gene locus_tag LOCUS_15110 61170 62033 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083043.1 protein_id gnl|my_center|LOCUS_15110 62030 62473 gene locus_tag LOCUS_15120 62030 62473 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529451.1 protein_id gnl|my_center|LOCUS_15120 63864 62470 gene locus_tag LOCUS_15130 63864 62470 CDS product D-arabinono-1,4-lactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919101.1 protein_id gnl|my_center|LOCUS_15130 64238 63861 gene locus_tag LOCUS_15140 64238 63861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 65064 64273 gene locus_tag LOCUS_15150 gene ubiG 65064 64273 CDS product bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529456.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence017 2038 1199 gene locus_tag LOCUS_15160 gene coxB 2038 1199 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083989.1 protein_id gnl|my_center|LOCUS_15160 2440 2835 gene locus_tag LOCUS_15170 2440 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 2859 4292 gene locus_tag LOCUS_15180 gene tldD 2859 4292 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532782.1 protein_id gnl|my_center|LOCUS_15180 4395 5030 gene locus_tag LOCUS_15190 4395 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 5540 5037 gene locus_tag LOCUS_15200 5540 5037 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000720566.1 protein_id gnl|my_center|LOCUS_15200 5927 5544 gene locus_tag LOCUS_15210 5927 5544 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530342.1 protein_id gnl|my_center|LOCUS_15210 7428 6064 gene locus_tag LOCUS_15220 7428 6064 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388328.1 protein_id gnl|my_center|LOCUS_15220 8348 7761 gene locus_tag LOCUS_15230 8348 7761 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531132.1 protein_id gnl|my_center|LOCUS_15230 9337 8540 gene locus_tag LOCUS_15240 9337 8540 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530342.1 protein_id gnl|my_center|LOCUS_15240 9788 9477 gene locus_tag LOCUS_15250 9788 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 9714 10022 gene locus_tag LOCUS_15260 9714 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 10225 11148 gene locus_tag LOCUS_15270 gene ubiA 10225 11148 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090253.1 protein_id gnl|my_center|LOCUS_15270 12551 11292 gene locus_tag LOCUS_15280 12551 11292 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024649113.1 protein_id gnl|my_center|LOCUS_15280 12704 12865 gene locus_tag LOCUS_15290 12704 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 13021 13677 gene locus_tag LOCUS_15300 13021 13677 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114326.1 protein_id gnl|my_center|LOCUS_15300 13674 14696 gene locus_tag LOCUS_15310 13674 14696 CDS product fatty acid desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086856.1 protein_id gnl|my_center|LOCUS_15310 14797 15864 gene locus_tag LOCUS_15320 14797 15864 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_15320 16020 17999 gene locus_tag LOCUS_15330 16020 17999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 18660 18001 gene locus_tag LOCUS_15340 18660 18001 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311274.1 protein_id gnl|my_center|LOCUS_15340 20025 18787 gene locus_tag LOCUS_15350 20025 18787 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918576.1 protein_id gnl|my_center|LOCUS_15350 20811 20146 gene locus_tag LOCUS_15360 20811 20146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 20705 21721 gene locus_tag LOCUS_15370 20705 21721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 21696 22262 gene locus_tag LOCUS_15380 gene rsmD 21696 22262 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532356.1 protein_id gnl|my_center|LOCUS_15380 22271 23128 gene locus_tag LOCUS_15390 22271 23128 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170199.1 protein_id gnl|my_center|LOCUS_15390 23236 24186 gene locus_tag LOCUS_15400 23236 24186 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390713.1 protein_id gnl|my_center|LOCUS_15400 24183 24845 gene locus_tag LOCUS_15410 24183 24845 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388331.1 protein_id gnl|my_center|LOCUS_15410 24983 25771 gene locus_tag LOCUS_15420 24983 25771 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918285.1 protein_id gnl|my_center|LOCUS_15420 26719 25778 gene locus_tag LOCUS_15430 26719 25778 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976084.1 protein_id gnl|my_center|LOCUS_15430 26846 27556 gene locus_tag LOCUS_15440 26846 27556 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663664.1 protein_id gnl|my_center|LOCUS_15440 27561 28337 gene locus_tag LOCUS_15450 27561 28337 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067911.1 protein_id gnl|my_center|LOCUS_15450 28341 29609 gene locus_tag LOCUS_15460 28341 29609 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876827.1 protein_id gnl|my_center|LOCUS_15460 30223 29618 gene locus_tag LOCUS_15470 30223 29618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 30419 31960 gene locus_tag LOCUS_15480 30419 31960 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918202.1 protein_id gnl|my_center|LOCUS_15480 31965 32387 gene locus_tag LOCUS_15490 gene arfB 31965 32387 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387858.1 protein_id gnl|my_center|LOCUS_15490 32904 32389 gene locus_tag LOCUS_15500 32904 32389 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065167.1 protein_id gnl|my_center|LOCUS_15500 33016 33420 gene locus_tag LOCUS_15510 33016 33420 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706317.1 protein_id gnl|my_center|LOCUS_15510 33448 34812 gene locus_tag LOCUS_15520 33448 34812 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174621.1 protein_id gnl|my_center|LOCUS_15520 34799 35614 gene locus_tag LOCUS_15530 34799 35614 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918197.1 protein_id gnl|my_center|LOCUS_15530 35687 35932 gene locus_tag LOCUS_15540 35687 35932 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037379087.1 protein_id gnl|my_center|LOCUS_15540 35922 36443 gene locus_tag LOCUS_15550 35922 36443 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061381.1 protein_id gnl|my_center|LOCUS_15550 36613 38499 gene locus_tag LOCUS_15560 36613 38499 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918194.1 protein_id gnl|my_center|LOCUS_15560 38506 39246 gene locus_tag LOCUS_15570 38506 39246 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532344.1 protein_id gnl|my_center|LOCUS_15570 39263 40573 gene locus_tag LOCUS_15580 39263 40573 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388339.1 protein_id gnl|my_center|LOCUS_15580 40566 41594 gene locus_tag LOCUS_15590 gene lpxK 40566 41594 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388340.1 protein_id gnl|my_center|LOCUS_15590 41669 42559 gene locus_tag LOCUS_15600 41669 42559 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920111.1 protein_id gnl|my_center|LOCUS_15600 43392 42556 gene locus_tag LOCUS_15610 43392 42556 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925869.1 protein_id gnl|my_center|LOCUS_15610 43607 43389 gene locus_tag LOCUS_15620 43607 43389 CDS product DUF2093 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090242.1 protein_id gnl|my_center|LOCUS_15620 45104 43653 gene locus_tag LOCUS_15630 gene xseA 45104 43653 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090239.1 protein_id gnl|my_center|LOCUS_15630 45250 46533 gene locus_tag LOCUS_15640 gene purD 45250 46533 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_15640 46571 47665 gene locus_tag LOCUS_15650 46571 47665 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918188.1 protein_id gnl|my_center|LOCUS_15650 47708 48157 gene locus_tag LOCUS_15660 47708 48157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 49457 48303 gene locus_tag LOCUS_15670 49457 48303 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_15670 49574 50746 gene locus_tag LOCUS_15680 49574 50746 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061571.1 protein_id gnl|my_center|LOCUS_15680 52144 50999 gene locus_tag LOCUS_15690 52144 50999 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383451.1 protein_id gnl|my_center|LOCUS_15690 52301 52534 gene locus_tag LOCUS_15700 52301 52534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 52567 53178 gene locus_tag LOCUS_15710 52567 53178 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529190.1 protein_id gnl|my_center|LOCUS_15710 54035 53175 gene locus_tag LOCUS_15720 54035 53175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 54167 54844 gene locus_tag LOCUS_15730 54167 54844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155662648.1 protein_id gnl|my_center|LOCUS_15730 55005 55322 gene locus_tag LOCUS_15740 gene groES 55005 55322 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388344.1 protein_id gnl|my_center|LOCUS_15740 55413 57050 gene locus_tag LOCUS_15750 gene groL 55413 57050 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066875142.1 protein_id gnl|my_center|LOCUS_15750 57301 58908 gene locus_tag LOCUS_15760 57301 58908 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461421.1 protein_id gnl|my_center|LOCUS_15760 59613 58888 gene locus_tag LOCUS_15770 59613 58888 CDS product DUF2161 domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402174.1 protein_id gnl|my_center|LOCUS_15770 60687 59641 gene locus_tag LOCUS_15780 gene tdh 60687 59641 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564818.1 protein_id gnl|my_center|LOCUS_15780 61877 60684 gene locus_tag LOCUS_15790 61877 60684 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337442.1 protein_id gnl|my_center|LOCUS_15790 62103 63086 gene locus_tag LOCUS_15800 62103 63086 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532363.1 protein_id gnl|my_center|LOCUS_15800 63088 63804 gene locus_tag LOCUS_15810 63088 63804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 64116 64559 gene locus_tag LOCUS_15820 64116 64559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence018 344 271 gene locus_tag LOCUS_t00150 344 271 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 479 395 gene locus_tag LOCUS_t00160 479 395 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 710 1546 gene locus_tag LOCUS_15830 gene rlmB 710 1546 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384991.1 protein_id gnl|my_center|LOCUS_15830 2622 1543 gene locus_tag LOCUS_15840 2622 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2956 4101 gene locus_tag LOCUS_15850 2956 4101 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088170.1 protein_id gnl|my_center|LOCUS_15850 4101 4301 gene locus_tag LOCUS_15860 4101 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 4360 4435 gene locus_tag LOCUS_t00170 4360 4435 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5113 4466 gene locus_tag LOCUS_15870 5113 4466 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705602.1 protein_id gnl|my_center|LOCUS_15870 5620 5159 gene locus_tag LOCUS_15880 5620 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6180 5761 gene locus_tag LOCUS_15890 6180 5761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 6368 7741 gene locus_tag LOCUS_15900 6368 7741 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205737.1 protein_id gnl|my_center|LOCUS_15900 7741 9105 gene locus_tag LOCUS_15910 7741 9105 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114138.1 protein_id gnl|my_center|LOCUS_15910 9564 9109 gene locus_tag LOCUS_15920 9564 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 10954 9698 gene locus_tag LOCUS_15930 10954 9698 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730143.1 protein_id gnl|my_center|LOCUS_15930 11859 10981 gene locus_tag LOCUS_15940 11859 10981 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641673.1 protein_id gnl|my_center|LOCUS_15940 12893 11859 gene locus_tag LOCUS_15950 12893 11859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 13571 12948 gene locus_tag LOCUS_15960 13571 12948 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084765.1 protein_id gnl|my_center|LOCUS_15960 16098 13759 gene locus_tag LOCUS_15970 16098 13759 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388721.1 protein_id gnl|my_center|LOCUS_15970 16971 16195 gene locus_tag LOCUS_15980 16971 16195 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640174.1 protein_id gnl|my_center|LOCUS_15980 18466 17057 gene locus_tag LOCUS_15990 18466 17057 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244205.1 protein_id gnl|my_center|LOCUS_15990 20018 18528 gene locus_tag LOCUS_16000 gene glpK 20018 18528 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113887.1 protein_id gnl|my_center|LOCUS_16000 20140 21171 gene locus_tag LOCUS_16010 gene moaA 20140 21171 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969526.1 protein_id gnl|my_center|LOCUS_16010 21522 21175 gene locus_tag LOCUS_16020 21522 21175 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_16020 21585 22352 gene locus_tag LOCUS_16030 21585 22352 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919103.1 protein_id gnl|my_center|LOCUS_16030 23255 22425 gene locus_tag LOCUS_16040 23255 22425 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088086.1 protein_id gnl|my_center|LOCUS_16040 23421 24650 gene locus_tag LOCUS_16050 23421 24650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 25868 24654 gene locus_tag LOCUS_16060 gene pcaF 25868 24654 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075194926.1 protein_id gnl|my_center|LOCUS_16060 27158 26025 gene locus_tag LOCUS_16070 27158 26025 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388368.1 protein_id gnl|my_center|LOCUS_16070 27560 28756 gene locus_tag LOCUS_16080 27560 28756 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_16080 31628 28911 gene locus_tag LOCUS_16090 31628 28911 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207762468.1 protein_id gnl|my_center|LOCUS_16090 32171 31704 gene locus_tag LOCUS_16100 32171 31704 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_16100 32274 32711 gene locus_tag LOCUS_16110 32274 32711 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193832.1 protein_id gnl|my_center|LOCUS_16110 33701 32715 gene locus_tag LOCUS_16120 33701 32715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 33866 35284 gene locus_tag LOCUS_16130 33866 35284 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_16130 35940 35476 gene locus_tag LOCUS_16140 35940 35476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 36439 36032 gene locus_tag LOCUS_16150 36439 36032 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309922.1 protein_id gnl|my_center|LOCUS_16150 37617 36448 gene locus_tag LOCUS_16160 37617 36448 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040039.1 protein_id gnl|my_center|LOCUS_16160 37721 38185 gene locus_tag LOCUS_16170 37721 38185 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531968.1 protein_id gnl|my_center|LOCUS_16170 38189 39037 gene locus_tag LOCUS_16180 38189 39037 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965686.1 protein_id gnl|my_center|LOCUS_16180 39047 39967 gene locus_tag LOCUS_16190 39047 39967 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088162.1 protein_id gnl|my_center|LOCUS_16190 41292 39964 gene locus_tag LOCUS_16200 gene chrA 41292 39964 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087813.1 protein_id gnl|my_center|LOCUS_16200 41454 42884 gene locus_tag LOCUS_16210 41454 42884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 42927 43736 gene locus_tag LOCUS_16220 42927 43736 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419601.1 protein_id gnl|my_center|LOCUS_16220 44479 43727 gene locus_tag LOCUS_16230 44479 43727 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971078.1 protein_id gnl|my_center|LOCUS_16230 44535 44822 gene locus_tag LOCUS_16240 44535 44822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 45425 44841 gene locus_tag LOCUS_16250 45425 44841 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328127.1 protein_id gnl|my_center|LOCUS_16250 45592 46374 gene locus_tag LOCUS_16260 45592 46374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 48226 46376 gene locus_tag LOCUS_16270 48226 46376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 48305 48622 gene locus_tag LOCUS_16280 48305 48622 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086780.1 protein_id gnl|my_center|LOCUS_16280 48619 49167 gene locus_tag LOCUS_16290 48619 49167 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930760.1 protein_id gnl|my_center|LOCUS_16290 49188 49586 gene locus_tag LOCUS_16300 49188 49586 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106807.1 protein_id gnl|my_center|LOCUS_16300 51675 49717 gene locus_tag LOCUS_16310 gene thrS 51675 49717 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391234.1 protein_id gnl|my_center|LOCUS_16310 52006 51686 gene locus_tag LOCUS_16320 gene yidD 52006 51686 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018011114.1 protein_id gnl|my_center|LOCUS_16320 52719 52216 gene locus_tag LOCUS_16330 52719 52216 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088271.1 protein_id gnl|my_center|LOCUS_16330 54136 52730 gene locus_tag LOCUS_16340 gene cysS 54136 52730 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 protein_id gnl|my_center|LOCUS_16340 54696 55331 gene locus_tag LOCUS_16350 gene folE 54696 55331 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918347.1 protein_id gnl|my_center|LOCUS_16350 55426 55878 gene locus_tag LOCUS_16360 55426 55878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 55988 57064 gene locus_tag LOCUS_16370 55988 57064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 57511 57083 gene locus_tag LOCUS_16380 57511 57083 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088299.1 protein_id gnl|my_center|LOCUS_16380 57796 59085 gene locus_tag LOCUS_16390 57796 59085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 59082 59687 gene locus_tag LOCUS_16400 59082 59687 CDS product GDYXXLXY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083237.1 protein_id gnl|my_center|LOCUS_16400 61548 60115 gene locus_tag LOCUS_16410 61548 60115 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088534.1 protein_id gnl|my_center|LOCUS_16410 61650 62330 gene locus_tag LOCUS_16420 61650 62330 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403355.1 protein_id gnl|my_center|LOCUS_16420 62652 62317 gene locus_tag LOCUS_16430 62652 62317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 <63448 62740 gene locus_tag LOCUS_16440 <63448 62740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003534691.1:rhomboid family intramembrane serine protease >Feature sequence019 2 379 gene locus_tag LOCUS_16450 2 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 376 1185 gene locus_tag LOCUS_16460 376 1185 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_16460 1273 3444 gene locus_tag LOCUS_16470 1273 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3597 4790 gene locus_tag LOCUS_16480 3597 4790 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228927.1 protein_id gnl|my_center|LOCUS_16480 4802 5899 gene locus_tag LOCUS_16490 4802 5899 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_16490 5979 6257 gene locus_tag LOCUS_16500 5979 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6341 7435 gene locus_tag LOCUS_16510 6341 7435 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085596.1 protein_id gnl|my_center|LOCUS_16510 8051 7449 gene locus_tag LOCUS_16520 8051 7449 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391019.1 protein_id gnl|my_center|LOCUS_16520 8601 8116 gene locus_tag LOCUS_16530 8601 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 9105 8605 gene locus_tag LOCUS_16540 9105 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9379 9116 gene locus_tag LOCUS_16550 9379 9116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 9592 11298 gene locus_tag LOCUS_16560 9592 11298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 12737 11289 gene locus_tag LOCUS_16570 12737 11289 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447682.1 protein_id gnl|my_center|LOCUS_16570 14924 12795 gene locus_tag LOCUS_16580 14924 12795 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_16580 15130 15786 gene locus_tag LOCUS_16590 15130 15786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 15862 16602 gene locus_tag LOCUS_16600 15862 16602 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_16600 17496 16606 gene locus_tag LOCUS_16610 17496 16606 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532966.1 protein_id gnl|my_center|LOCUS_16610 17866 18948 gene locus_tag LOCUS_16620 17866 18948 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_16620 19008 19823 gene locus_tag LOCUS_16630 19008 19823 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764735.1 protein_id gnl|my_center|LOCUS_16630 19826 20599 gene locus_tag LOCUS_16640 19826 20599 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243173.1 protein_id gnl|my_center|LOCUS_16640 20717 21553 gene locus_tag LOCUS_16650 20717 21553 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140962.1 protein_id gnl|my_center|LOCUS_16650 21557 22186 gene locus_tag LOCUS_16660 21557 22186 CDS product urea carboxylase-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140961.1 protein_id gnl|my_center|LOCUS_16660 22235 25855 gene locus_tag LOCUS_16670 gene uca 22235 25855 CDS product urea carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140960.1 protein_id gnl|my_center|LOCUS_16670 25852 27660 gene locus_tag LOCUS_16680 gene atzF 25852 27660 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919696.1 protein_id gnl|my_center|LOCUS_16680 28529 27681 gene locus_tag LOCUS_16690 28529 27681 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191536.1 protein_id gnl|my_center|LOCUS_16690 28648 29724 gene locus_tag LOCUS_16700 28648 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 29888 30703 gene locus_tag LOCUS_16710 29888 30703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 31824 30700 gene locus_tag LOCUS_16720 31824 30700 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_16720 32187 33506 gene locus_tag LOCUS_16730 32187 33506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 33520 36588 gene locus_tag LOCUS_16740 33520 36588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 36966 36691 gene locus_tag LOCUS_16750 36966 36691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 37720 37052 gene locus_tag LOCUS_16760 37720 37052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 37866 39095 gene locus_tag LOCUS_16770 37866 39095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 39179 40177 gene locus_tag LOCUS_16780 39179 40177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 40890 40198 gene locus_tag LOCUS_16790 40890 40198 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_16790 41266 41835 gene locus_tag LOCUS_16800 41266 41835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 41835 42656 gene locus_tag LOCUS_16810 41835 42656 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_16810 43664 42681 gene locus_tag LOCUS_16820 43664 42681 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920124.1 protein_id gnl|my_center|LOCUS_16820 44098 43934 gene locus_tag LOCUS_16830 44098 43934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 44039 44725 gene locus_tag LOCUS_16840 44039 44725 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390859.1 protein_id gnl|my_center|LOCUS_16840 44951 45589 gene locus_tag LOCUS_16850 44951 45589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 45901 46431 gene locus_tag LOCUS_16860 45901 46431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 46573 47847 gene locus_tag LOCUS_16870 46573 47847 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639895.1 protein_id gnl|my_center|LOCUS_16870 48191 50458 gene locus_tag LOCUS_16880 48191 50458 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918053.1 protein_id gnl|my_center|LOCUS_16880 50990 50451 gene locus_tag LOCUS_16890 50990 50451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 52181 51147 gene locus_tag LOCUS_16900 52181 51147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 53611 53366 gene locus_tag LOCUS_16910 53611 53366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 53780 55087 gene locus_tag LOCUS_16920 gene wbpA 53780 55087 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_16920 55092 56030 gene locus_tag LOCUS_16930 55092 56030 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_16930 56032 56619 gene locus_tag LOCUS_16940 gene wbpD 56032 56619 CDS product UDP-2-acetamido-3-amino-2,3-dideoxy-D-glucuronate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208045.1 protein_id gnl|my_center|LOCUS_16940 56616 57713 gene locus_tag LOCUS_16950 gene wbpE 56616 57713 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 protein_id gnl|my_center|LOCUS_16950 60265 61251 gene locus_tag LOCUS_16960 60265 61251 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 protein_id gnl|my_center|LOCUS_16960 61256 61444 gene locus_tag LOCUS_16970 61256 61444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence020 527 901 gene locus_tag LOCUS_16980 527 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1133 1306 gene locus_tag LOCUS_16990 1133 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 1349 2206 gene locus_tag LOCUS_17000 1349 2206 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217633758.1 protein_id gnl|my_center|LOCUS_17000 2739 2506 gene locus_tag LOCUS_17010 2739 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 2626 2889 gene locus_tag LOCUS_17020 2626 2889 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532417.1 protein_id gnl|my_center|LOCUS_17020 3063 2977 gene locus_tag LOCUS_t00180 3063 2977 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3542 3165 gene locus_tag LOCUS_17030 3542 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 4427 3669 gene locus_tag LOCUS_17040 4427 3669 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532015.1 protein_id gnl|my_center|LOCUS_17040 4547 5368 gene locus_tag LOCUS_17050 gene map 4547 5368 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975613.1 protein_id gnl|my_center|LOCUS_17050 5384 6085 gene locus_tag LOCUS_17060 gene radC 5384 6085 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_17060 7049 6063 gene locus_tag LOCUS_17070 7049 6063 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688696.1 protein_id gnl|my_center|LOCUS_17070 7629 7054 gene locus_tag LOCUS_17080 7629 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 9264 7774 gene locus_tag LOCUS_17090 9264 7774 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640209.1 protein_id gnl|my_center|LOCUS_17090 9392 10330 gene locus_tag LOCUS_17100 9392 10330 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809212.1 protein_id gnl|my_center|LOCUS_17100 10389 11717 gene locus_tag LOCUS_17110 gene purB 10389 11717 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037383544.1 protein_id gnl|my_center|LOCUS_17110 11790 12515 gene locus_tag LOCUS_17120 11790 12515 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229264.1 protein_id gnl|my_center|LOCUS_17120 13298 12519 gene locus_tag LOCUS_17130 13298 12519 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925816.1 protein_id gnl|my_center|LOCUS_17130 15300 13372 gene locus_tag LOCUS_17140 15300 13372 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_17140 15422 16138 gene locus_tag LOCUS_17150 15422 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 16218 16739 gene locus_tag LOCUS_17160 16218 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 17068 16751 gene locus_tag LOCUS_17170 17068 16751 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532126.1 protein_id gnl|my_center|LOCUS_17170 17429 18190 gene locus_tag LOCUS_17180 17429 18190 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008974302.1 protein_id gnl|my_center|LOCUS_17180 18213 18458 gene locus_tag LOCUS_17190 gene purS 18213 18458 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088473.1 protein_id gnl|my_center|LOCUS_17190 18455 19129 gene locus_tag LOCUS_17200 gene purQ 18455 19129 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396502.1 protein_id gnl|my_center|LOCUS_17200 19126 21345 gene locus_tag LOCUS_17210 gene purL 19126 21345 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088464.1 protein_id gnl|my_center|LOCUS_17210 21371 21601 gene locus_tag LOCUS_17220 21371 21601 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909092.1 protein_id gnl|my_center|LOCUS_17220 21636 21974 gene locus_tag LOCUS_17230 gene grxD 21636 21974 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708163.1 protein_id gnl|my_center|LOCUS_17230 22710 22090 gene locus_tag LOCUS_17240 gene rpsD 22710 22090 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719445.1 protein_id gnl|my_center|LOCUS_17240 23718 22930 gene locus_tag LOCUS_17250 23718 22930 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388454.1 protein_id gnl|my_center|LOCUS_17250 23920 25143 gene locus_tag LOCUS_17260 23920 25143 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532148.1 protein_id gnl|my_center|LOCUS_17260 27936 25246 gene locus_tag LOCUS_17270 gene alaS 27936 25246 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971929.1 protein_id gnl|my_center|LOCUS_17270 29366 28263 gene locus_tag LOCUS_17280 gene recA 29366 28263 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314063.1 protein_id gnl|my_center|LOCUS_17280 29591 30451 gene locus_tag LOCUS_17290 29591 30451 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_17290 30559 31425 gene locus_tag LOCUS_17300 30559 31425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 32533 31460 gene locus_tag LOCUS_17310 32533 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 35194 32675 gene locus_tag LOCUS_17320 35194 32675 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531860.1 protein_id gnl|my_center|LOCUS_17320 36346 35264 gene locus_tag LOCUS_17330 gene flhB 36346 35264 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088553.1 protein_id gnl|my_center|LOCUS_17330 37123 36362 gene locus_tag LOCUS_17340 gene fliR 37123 36362 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088554.1 protein_id gnl|my_center|LOCUS_17340 37406 37143 gene locus_tag LOCUS_17350 gene fliQ 37406 37143 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088555.1 protein_id gnl|my_center|LOCUS_17350 37755 37432 gene locus_tag LOCUS_17360 gene fliE 37755 37432 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918839.1 protein_id gnl|my_center|LOCUS_17360 38197 37778 gene locus_tag LOCUS_17370 gene flgC 38197 37778 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007602149.1 protein_id gnl|my_center|LOCUS_17370 38652 38224 gene locus_tag LOCUS_17380 gene flgB 38652 38224 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640104.1 protein_id gnl|my_center|LOCUS_17380 38929 39297 gene locus_tag LOCUS_17390 38929 39297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 39294 40076 gene locus_tag LOCUS_17400 gene fliP 39294 40076 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918835.1 protein_id gnl|my_center|LOCUS_17400 43504 40112 gene locus_tag LOCUS_17410 43504 40112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919921.1 protein_id gnl|my_center|LOCUS_17410 44436 43672 gene locus_tag LOCUS_17420 44436 43672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 44913 44446 gene locus_tag LOCUS_17430 44913 44446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 46001 44910 gene locus_tag LOCUS_17440 gene fliM 46001 44910 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640397.1 protein_id gnl|my_center|LOCUS_17440 46532 46026 gene locus_tag LOCUS_17450 46532 46026 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626461.1 protein_id gnl|my_center|LOCUS_17450 46865 47596 gene locus_tag LOCUS_17460 gene flgF 46865 47596 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390469.1 protein_id gnl|my_center|LOCUS_17460 47633 48418 gene locus_tag LOCUS_17470 gene flgG 47633 48418 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919925.1 protein_id gnl|my_center|LOCUS_17470 48433 49422 gene locus_tag LOCUS_17480 gene flgA 48433 49422 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390471.1 protein_id gnl|my_center|LOCUS_17480 49476 50213 gene locus_tag LOCUS_17490 gene flgH 49476 50213 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088573.1 protein_id gnl|my_center|LOCUS_17490 50734 50318 gene locus_tag LOCUS_17500 gene dksA 50734 50318 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531862.1 protein_id gnl|my_center|LOCUS_17500 51495 51058 gene locus_tag LOCUS_17510 51495 51058 CDS product flagellar assembly protein FliX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088579.1 protein_id gnl|my_center|LOCUS_17510 51796 52935 gene locus_tag LOCUS_17520 51796 52935 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173283.1 protein_id gnl|my_center|LOCUS_17520 52935 53264 gene locus_tag LOCUS_17530 52935 53264 CDS product rod-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920439.1 protein_id gnl|my_center|LOCUS_17530 53261 53749 gene locus_tag LOCUS_17540 53261 53749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 53859 55472 gene locus_tag LOCUS_17550 53859 55472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 55855 57036 gene locus_tag LOCUS_17560 55855 57036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence021 1 792 gene locus_tag LOCUS_17570 1 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 963 2249 gene locus_tag LOCUS_17580 963 2249 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087643.1 protein_id gnl|my_center|LOCUS_17580 2242 2955 gene locus_tag LOCUS_17590 2242 2955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216122.1 protein_id gnl|my_center|LOCUS_17590 4858 3068 gene locus_tag LOCUS_17600 4858 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4964 5422 gene locus_tag LOCUS_17610 4964 5422 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403905.1 protein_id gnl|my_center|LOCUS_17610 5630 5764 gene locus_tag LOCUS_17620 5630 5764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 6002 9421 gene locus_tag LOCUS_17630 gene dnaE 6002 9421 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087634.1 protein_id gnl|my_center|LOCUS_17630 9654 10421 gene locus_tag LOCUS_17640 gene rpsB 9654 10421 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531765.1 protein_id gnl|my_center|LOCUS_17640 10517 11440 gene locus_tag LOCUS_17650 gene tsf 10517 11440 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534991.1 protein_id gnl|my_center|LOCUS_17650 11581 12306 gene locus_tag LOCUS_17660 gene pyrH 11581 12306 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389463.1 protein_id gnl|my_center|LOCUS_17660 12332 12895 gene locus_tag LOCUS_17670 gene frr 12332 12895 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389464.1 protein_id gnl|my_center|LOCUS_17670 12942 13700 gene locus_tag LOCUS_17680 12942 13700 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_17680 13705 14568 gene locus_tag LOCUS_17690 13705 14568 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389466.1 protein_id gnl|my_center|LOCUS_17690 14559 15779 gene locus_tag LOCUS_17700 14559 15779 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389467.1 protein_id gnl|my_center|LOCUS_17700 15909 17078 gene locus_tag LOCUS_17710 gene rseP 15909 17078 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087622.1 protein_id gnl|my_center|LOCUS_17710 17170 19512 gene locus_tag LOCUS_17720 gene bamA 17170 19512 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640362.1 protein_id gnl|my_center|LOCUS_17720 19565 20161 gene locus_tag LOCUS_17730 19565 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 20241 21266 gene locus_tag LOCUS_17740 gene lpxD 20241 21266 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969259.1 protein_id gnl|my_center|LOCUS_17740 21301 21777 gene locus_tag LOCUS_17750 gene fabZ 21301 21777 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975310.1 protein_id gnl|my_center|LOCUS_17750 21774 22571 gene locus_tag LOCUS_17760 gene lpxA 21774 22571 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389472.1 protein_id gnl|my_center|LOCUS_17760 22544 23458 gene locus_tag LOCUS_17770 22544 23458 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919776.1 protein_id gnl|my_center|LOCUS_17770 23458 24618 gene locus_tag LOCUS_17780 gene lpxB 23458 24618 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_17780 25995 24679 gene locus_tag LOCUS_17790 gene gltA 25995 24679 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312523.1 protein_id gnl|my_center|LOCUS_17790 27516 26104 gene locus_tag LOCUS_17800 gene gltX 27516 26104 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389476.1 protein_id gnl|my_center|LOCUS_17800 28323 29924 gene locus_tag LOCUS_17810 28323 29924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 30631 29918 gene locus_tag LOCUS_17820 gene lexA 30631 29918 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971587.1 protein_id gnl|my_center|LOCUS_17820 31958 30747 gene locus_tag LOCUS_17830 31958 30747 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531741.1 protein_id gnl|my_center|LOCUS_17830 32444 31962 gene locus_tag LOCUS_17840 gene moaC 32444 31962 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_17840 33309 32458 gene locus_tag LOCUS_17850 gene kdsA 33309 32458 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073591.1 protein_id gnl|my_center|LOCUS_17850 33853 33344 gene locus_tag LOCUS_17860 33853 33344 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388274.1 protein_id gnl|my_center|LOCUS_17860 34805 34008 gene locus_tag LOCUS_17870 gene trpC 34805 34008 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087578.1 protein_id gnl|my_center|LOCUS_17870 35823 34798 gene locus_tag LOCUS_17880 gene trpD 35823 34798 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328329.1 protein_id gnl|my_center|LOCUS_17880 36433 35840 gene locus_tag LOCUS_17890 36433 35840 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_17890 36420 36623 gene locus_tag LOCUS_17900 36420 36623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 36964 36815 gene locus_tag LOCUS_17910 36964 36815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 36938 38995 gene locus_tag LOCUS_17920 36938 38995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 40517 39006 gene locus_tag LOCUS_17930 gene trpE 40517 39006 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389644.1 protein_id gnl|my_center|LOCUS_17930 42412 40514 gene locus_tag LOCUS_17940 42412 40514 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087576.1 protein_id gnl|my_center|LOCUS_17940 42920 42579 gene locus_tag LOCUS_17950 42920 42579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 43583 44344 gene locus_tag LOCUS_17960 gene tpiA 43583 44344 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087575.1 protein_id gnl|my_center|LOCUS_17960 44413 44958 gene locus_tag LOCUS_17970 44413 44958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 45003 46481 gene locus_tag LOCUS_17980 45003 46481 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532671.1 protein_id gnl|my_center|LOCUS_17980 47003 46572 gene locus_tag LOCUS_17990 47003 46572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 47183 47701 gene locus_tag LOCUS_18000 47183 47701 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568255.1 protein_id gnl|my_center|LOCUS_18000 47698 48636 gene locus_tag LOCUS_18010 47698 48636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 48853 49062 gene locus_tag LOCUS_18020 48853 49062 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920476.1 protein_id gnl|my_center|LOCUS_18020 49121 49345 gene locus_tag LOCUS_18030 49121 49345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090083.1 protein_id gnl|my_center|LOCUS_18030 49349 49510 gene locus_tag LOCUS_18040 49349 49510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 49514 49702 gene locus_tag LOCUS_18050 49514 49702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 49883 50335 gene locus_tag LOCUS_18060 gene secG 49883 50335 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531735.1 protein_id gnl|my_center|LOCUS_18060 50451 52079 gene locus_tag LOCUS_18070 50451 52079 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087573.1 protein_id gnl|my_center|LOCUS_18070 53006 52098 gene locus_tag LOCUS_18080 53006 52098 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086755.1 protein_id gnl|my_center|LOCUS_18080 53556 53008 gene locus_tag LOCUS_18090 53556 53008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence022 921 274 gene locus_tag LOCUS_18100 921 274 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 protein_id gnl|my_center|LOCUS_18100 1078 1857 gene locus_tag LOCUS_18110 1078 1857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192152.1 protein_id gnl|my_center|LOCUS_18110 1950 2228 gene locus_tag LOCUS_18120 1950 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 2323 3798 gene locus_tag LOCUS_18130 gene putP 2323 3798 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103073.1 protein_id gnl|my_center|LOCUS_18130 3917 4108 gene locus_tag LOCUS_18140 3917 4108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 5708 4116 gene locus_tag LOCUS_18150 5708 4116 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065145.1 protein_id gnl|my_center|LOCUS_18150 5830 6960 gene locus_tag LOCUS_18160 5830 6960 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919707.1 protein_id gnl|my_center|LOCUS_18160 6957 7715 gene locus_tag LOCUS_18170 6957 7715 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004538576.1 protein_id gnl|my_center|LOCUS_18170 9377 7716 gene locus_tag LOCUS_18180 9377 7716 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228720.1 protein_id gnl|my_center|LOCUS_18180 10393 9413 gene locus_tag LOCUS_18190 10393 9413 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965341.1 protein_id gnl|my_center|LOCUS_18190 11745 10393 gene locus_tag LOCUS_18200 11745 10393 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389068.1 protein_id gnl|my_center|LOCUS_18200 13709 11919 gene locus_tag LOCUS_18210 13709 11919 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967416.1 protein_id gnl|my_center|LOCUS_18210 13940 14497 gene locus_tag LOCUS_18220 13940 14497 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532781.1 protein_id gnl|my_center|LOCUS_18220 15185 14502 gene locus_tag LOCUS_18230 15185 14502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 15628 15296 gene locus_tag LOCUS_18240 gene hspQ 15628 15296 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087359.1 protein_id gnl|my_center|LOCUS_18240 15787 16890 gene locus_tag LOCUS_18250 15787 16890 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103456.1 protein_id gnl|my_center|LOCUS_18250 17941 16898 gene locus_tag LOCUS_18260 17941 16898 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256084.1 protein_id gnl|my_center|LOCUS_18260 19306 18014 gene locus_tag LOCUS_18270 19306 18014 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_18270 19948 19379 gene locus_tag LOCUS_18280 19948 19379 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240524.1 protein_id gnl|my_center|LOCUS_18280 21218 19941 gene locus_tag LOCUS_18290 21218 19941 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259422.1 protein_id gnl|my_center|LOCUS_18290 21400 22017 gene locus_tag LOCUS_18300 21400 22017 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397160.1 protein_id gnl|my_center|LOCUS_18300 22149 22544 gene locus_tag LOCUS_18310 22149 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 22647 23063 gene locus_tag LOCUS_18320 22647 23063 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810864.1 protein_id gnl|my_center|LOCUS_18320 23128 23217 gene locus_tag LOCUS_t00190 23128 23217 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23350 23994 gene locus_tag LOCUS_18330 23350 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 24021 24917 gene locus_tag LOCUS_18340 24021 24917 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919059.1 protein_id gnl|my_center|LOCUS_18340 24961 25386 gene locus_tag LOCUS_18350 24961 25386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 26458 25433 gene locus_tag LOCUS_18360 26458 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 26891 28996 gene locus_tag LOCUS_18370 26891 28996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 29011 29856 gene locus_tag LOCUS_18380 29011 29856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 30036 30374 gene locus_tag LOCUS_18390 30036 30374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 31733 30396 gene locus_tag LOCUS_18400 31733 30396 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811151.1 protein_id gnl|my_center|LOCUS_18400 31924 32925 gene locus_tag LOCUS_18410 31924 32925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 32968 34122 gene locus_tag LOCUS_18420 32968 34122 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389394.1 protein_id gnl|my_center|LOCUS_18420 34127 34774 gene locus_tag LOCUS_18430 gene tmk 34127 34774 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919690.1 protein_id gnl|my_center|LOCUS_18430 35056 35616 gene locus_tag LOCUS_18440 35056 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 36481 35600 gene locus_tag LOCUS_18450 gene yieE 36481 35600 CDS product DNA-binding transcriptional regulator YeiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171339.1 protein_id gnl|my_center|LOCUS_18450 37493 36438 gene locus_tag LOCUS_18460 37493 36438 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223743.1 protein_id gnl|my_center|LOCUS_18460 38309 37506 gene locus_tag LOCUS_18470 gene phnE 38309 37506 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267540.1 protein_id gnl|my_center|LOCUS_18470 39192 38311 gene locus_tag LOCUS_18480 39192 38311 CDS product PhnD/SsuA/transferrin family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937431.1 protein_id gnl|my_center|LOCUS_18480 40012 39203 gene locus_tag LOCUS_18490 gene phnC 40012 39203 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_18490 40083 41372 gene locus_tag LOCUS_18500 40083 41372 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338405.1 protein_id gnl|my_center|LOCUS_18500 41408 42964 gene locus_tag LOCUS_18510 gene metG 41408 42964 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389391.1 protein_id gnl|my_center|LOCUS_18510 42964 43770 gene locus_tag LOCUS_18520 42964 43770 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389390.1 protein_id gnl|my_center|LOCUS_18520 43767 44585 gene locus_tag LOCUS_18530 43767 44585 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_18530 45017 44664 gene locus_tag LOCUS_18540 45017 44664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 45614 45216 gene locus_tag LOCUS_18550 45614 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 46079 45705 gene locus_tag LOCUS_18560 46079 45705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 47111 46284 gene locus_tag LOCUS_18570 47111 46284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 48282 47524 gene locus_tag LOCUS_18580 gene fixK 48282 47524 CDS product transcriptional regulator FixK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918638.1 protein_id gnl|my_center|LOCUS_18580 48836 48432 gene locus_tag LOCUS_18590 48836 48432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 49565 48936 gene locus_tag LOCUS_18600 49565 48936 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811946.1 protein_id gnl|my_center|LOCUS_18600 50704 49565 gene locus_tag LOCUS_18610 50704 49565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 50792 51523 gene locus_tag LOCUS_18620 50792 51523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 51942 51547 gene locus_tag LOCUS_18630 51942 51547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18630 51976 52221 gene locus_tag LOCUS_18640 51976 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence023 108 917 gene locus_tag LOCUS_18650 gene thiS 108 917 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390185.1 protein_id gnl|my_center|LOCUS_18650 1272 925 gene locus_tag LOCUS_18660 1272 925 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_18660 2164 1292 gene locus_tag LOCUS_18670 2164 1292 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140509.1 protein_id gnl|my_center|LOCUS_18670 3660 2161 gene locus_tag LOCUS_18680 3660 2161 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331455.1 protein_id gnl|my_center|LOCUS_18680 4841 3849 gene locus_tag LOCUS_18690 4841 3849 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893529.1 protein_id gnl|my_center|LOCUS_18690 5635 4871 gene locus_tag LOCUS_18700 5635 4871 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947567.1 protein_id gnl|my_center|LOCUS_18700 7042 5675 gene locus_tag LOCUS_18710 7042 5675 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087068.1 protein_id gnl|my_center|LOCUS_18710 7366 8823 gene locus_tag LOCUS_18720 7366 8823 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390177.1 protein_id gnl|my_center|LOCUS_18720 11536 8912 gene locus_tag LOCUS_18730 11536 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 12453 13853 gene locus_tag LOCUS_18740 12453 13853 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087079.1 protein_id gnl|my_center|LOCUS_18740 13925 14431 gene locus_tag LOCUS_18750 13925 14431 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_18750 14614 17391 gene locus_tag LOCUS_18760 14614 17391 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389996.1 protein_id gnl|my_center|LOCUS_18760 17772 18698 gene locus_tag LOCUS_18770 17772 18698 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971006.1 protein_id gnl|my_center|LOCUS_18770 19872 19033 gene locus_tag LOCUS_18780 19872 19033 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_18780 20215 21180 gene locus_tag LOCUS_18790 gene prfB 20215 21180 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113519808.1 protein_id gnl|my_center|LOCUS_18790 22235 21645 gene locus_tag LOCUS_18800 22235 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 23532 22213 gene locus_tag LOCUS_18810 23532 22213 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171463760.1 protein_id gnl|my_center|LOCUS_18810 24533 23733 gene locus_tag LOCUS_18820 24533 23733 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975631.1 protein_id gnl|my_center|LOCUS_18820 25138 24539 gene locus_tag LOCUS_18830 25138 24539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 25401 28913 gene locus_tag LOCUS_18840 25401 28913 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389790.1 protein_id gnl|my_center|LOCUS_18840 29005 30141 gene locus_tag LOCUS_18850 29005 30141 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_18850 31517 30261 gene locus_tag LOCUS_18860 gene tyrS 31517 30261 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532167.1 protein_id gnl|my_center|LOCUS_18860 31601 32716 gene locus_tag LOCUS_18870 31601 32716 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087104.1 protein_id gnl|my_center|LOCUS_18870 33377 32721 gene locus_tag LOCUS_18880 33377 32721 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008143006.1 protein_id gnl|my_center|LOCUS_18880 33641 34165 gene locus_tag LOCUS_18890 33641 34165 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389781.1 protein_id gnl|my_center|LOCUS_18890 34198 35391 gene locus_tag LOCUS_18900 34198 35391 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919731.1 protein_id gnl|my_center|LOCUS_18900 35393 36841 gene locus_tag LOCUS_18910 gene sufB 35393 36841 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003507956.1 protein_id gnl|my_center|LOCUS_18910 36865 37614 gene locus_tag LOCUS_18920 gene sufC 36865 37614 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171266.1 protein_id gnl|my_center|LOCUS_18920 37623 38933 gene locus_tag LOCUS_18930 gene sufD 37623 38933 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_18930 38930 40174 gene locus_tag LOCUS_18940 38930 40174 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087114.1 protein_id gnl|my_center|LOCUS_18940 40167 40583 gene locus_tag LOCUS_18950 40167 40583 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969429.1 protein_id gnl|my_center|LOCUS_18950 40595 40954 gene locus_tag LOCUS_18960 40595 40954 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640349.1 protein_id gnl|my_center|LOCUS_18960 41909 41118 gene locus_tag LOCUS_18970 41909 41118 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085727.1 protein_id gnl|my_center|LOCUS_18970 42742 41951 gene locus_tag LOCUS_18980 gene paaG 42742 41951 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969784.1 protein_id gnl|my_center|LOCUS_18980 43988 42930 gene locus_tag LOCUS_18990 43988 42930 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_18990 44292 45755 gene locus_tag LOCUS_19000 44292 45755 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919715.1 protein_id gnl|my_center|LOCUS_19000 47310 45829 gene locus_tag LOCUS_19010 47310 45829 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087120.1 protein_id gnl|my_center|LOCUS_19010 47678 48790 gene locus_tag LOCUS_19020 47678 48790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 50860 48806 gene locus_tag LOCUS_19030 gene parE 50860 48806 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531965.1 protein_id gnl|my_center|LOCUS_19030 51011 52309 gene locus_tag LOCUS_19040 51011 52309 CDS product NADH:flavin oxidoreductase/NADH oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence024 364 32 gene locus_tag LOCUS_19050 364 32 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918949.1 protein_id gnl|my_center|LOCUS_19050 599 1684 gene locus_tag LOCUS_19060 599 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1969 2373 gene locus_tag LOCUS_19070 1969 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2690 2478 gene locus_tag LOCUS_19080 2690 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2577 3008 gene locus_tag LOCUS_19090 2577 3008 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085853.1 protein_id gnl|my_center|LOCUS_19090 3790 3005 gene locus_tag LOCUS_19100 3790 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19100 4167 3787 gene locus_tag LOCUS_19110 4167 3787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918942.1 protein_id gnl|my_center|LOCUS_19110 4290 4886 gene locus_tag LOCUS_19120 4290 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5372 4926 gene locus_tag LOCUS_19130 5372 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6062 5508 gene locus_tag LOCUS_19140 6062 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 6589 6152 gene locus_tag LOCUS_19150 6589 6152 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640101.1 protein_id gnl|my_center|LOCUS_19150 7795 6878 gene locus_tag LOCUS_19160 7795 6878 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_19160 7934 8188 gene locus_tag LOCUS_19170 7934 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8185 8967 gene locus_tag LOCUS_19180 8185 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 10074 8971 gene locus_tag LOCUS_19190 10074 8971 CDS product DUF2336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640100.1 protein_id gnl|my_center|LOCUS_19190 10227 10529 gene locus_tag LOCUS_19200 10227 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 10557 10820 gene locus_tag LOCUS_19210 10557 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 11966 10824 gene locus_tag LOCUS_19220 11966 10824 CDS product trans-acting enoyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093996.1 protein_id gnl|my_center|LOCUS_19220 12072 12524 gene locus_tag LOCUS_19230 12072 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 12655 13590 gene locus_tag LOCUS_19240 12655 13590 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_19240 13587 14354 gene locus_tag LOCUS_19250 13587 14354 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921201.1 protein_id gnl|my_center|LOCUS_19250 15563 14526 gene locus_tag LOCUS_19260 15563 14526 CDS product DUF2332 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066961.1 protein_id gnl|my_center|LOCUS_19260 16785 15634 gene locus_tag LOCUS_19270 16785 15634 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974562.1 protein_id gnl|my_center|LOCUS_19270 16961 18181 gene locus_tag LOCUS_19280 16961 18181 CDS product citrate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083014.1 protein_id gnl|my_center|LOCUS_19280 19380 18178 gene locus_tag LOCUS_19290 19380 18178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 19516 20187 gene locus_tag LOCUS_19300 19516 20187 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680175.1 protein_id gnl|my_center|LOCUS_19300 20269 21525 gene locus_tag LOCUS_19310 20269 21525 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206346353.1 protein_id gnl|my_center|LOCUS_19310 23081 21576 gene locus_tag LOCUS_19320 23081 21576 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_19320 23318 24544 gene locus_tag LOCUS_19330 23318 24544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 24615 26465 gene locus_tag LOCUS_19340 24615 26465 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100653.1 protein_id gnl|my_center|LOCUS_19340 27422 26517 gene locus_tag LOCUS_19350 27422 26517 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_19350 27668 29224 gene locus_tag LOCUS_19360 27668 29224 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918828.1 protein_id gnl|my_center|LOCUS_19360 29358 29846 gene locus_tag LOCUS_19370 29358 29846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 29965 30417 gene locus_tag LOCUS_19380 29965 30417 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918826.1 protein_id gnl|my_center|LOCUS_19380 30502 30906 gene locus_tag LOCUS_19390 gene msrB 30502 30906 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968974.1 protein_id gnl|my_center|LOCUS_19390 30914 33013 gene locus_tag LOCUS_19400 30914 33013 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974801.1 protein_id gnl|my_center|LOCUS_19400 33082 34626 gene locus_tag LOCUS_19410 33082 34626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532098.1 protein_id gnl|my_center|LOCUS_19410 35544 34687 gene locus_tag LOCUS_19420 35544 34687 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230665.1 protein_id gnl|my_center|LOCUS_19420 35677 36471 gene locus_tag LOCUS_19430 35677 36471 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303819.1 protein_id gnl|my_center|LOCUS_19430 38428 36458 gene locus_tag LOCUS_19440 38428 36458 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391771.1 protein_id gnl|my_center|LOCUS_19440 38535 39620 gene locus_tag LOCUS_19450 38535 39620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 39939 39607 gene locus_tag LOCUS_19460 39939 39607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 40127 40423 gene locus_tag LOCUS_19470 40127 40423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 40455 41696 gene locus_tag LOCUS_19480 40455 41696 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_19480 41713 42618 gene locus_tag LOCUS_19490 41713 42618 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968573.1 protein_id gnl|my_center|LOCUS_19490 43910 43041 gene locus_tag LOCUS_19500 43910 43041 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_19500 44823 43984 gene locus_tag LOCUS_19510 44823 43984 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_19510 44912 45613 gene locus_tag LOCUS_19520 44912 45613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 46664 45666 gene locus_tag LOCUS_19530 46664 45666 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_19530 46893 47804 gene locus_tag LOCUS_19540 46893 47804 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704700.1 protein_id gnl|my_center|LOCUS_19540 >Feature sequence025 2837 2214 gene locus_tag LOCUS_19550 2837 2214 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384239.1 protein_id gnl|my_center|LOCUS_19550 2944 4269 gene locus_tag LOCUS_19560 2944 4269 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530907.1 protein_id gnl|my_center|LOCUS_19560 5061 4591 gene locus_tag LOCUS_19570 5061 4591 CDS product pseudoazurin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525383.1 protein_id gnl|my_center|LOCUS_19570 6207 5158 gene locus_tag LOCUS_19580 gene nirK 6207 5158 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257443.1 protein_id gnl|my_center|LOCUS_19580 6343 7050 gene locus_tag LOCUS_19590 6343 7050 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089821.1 protein_id gnl|my_center|LOCUS_19590 7129 7356 gene locus_tag LOCUS_19600 7129 7356 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338150.1 protein_id gnl|my_center|LOCUS_19600 7353 8546 gene locus_tag LOCUS_19610 7353 8546 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525384.1 protein_id gnl|my_center|LOCUS_19610 8895 9098 gene locus_tag LOCUS_19620 8895 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 9511 9158 gene locus_tag LOCUS_19630 9511 9158 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265884.1 protein_id gnl|my_center|LOCUS_19630 9723 10343 gene locus_tag LOCUS_19640 9723 10343 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 protein_id gnl|my_center|LOCUS_19640 10396 10809 gene locus_tag LOCUS_19650 10396 10809 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083764.1 protein_id gnl|my_center|LOCUS_19650 10797 11027 gene locus_tag LOCUS_19660 10797 11027 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920812.1 protein_id gnl|my_center|LOCUS_19660 11014 11712 gene locus_tag LOCUS_19670 11014 11712 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013845178.1 protein_id gnl|my_center|LOCUS_19670 13047 11716 gene locus_tag LOCUS_19680 13047 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 13997 13143 gene locus_tag LOCUS_19690 13997 13143 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_19690 14500 14048 gene locus_tag LOCUS_19700 14500 14048 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391205.1 protein_id gnl|my_center|LOCUS_19700 15266 14502 gene locus_tag LOCUS_19710 15266 14502 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920912.1 protein_id gnl|my_center|LOCUS_19710 15492 16169 gene locus_tag LOCUS_19720 15492 16169 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310900.1 protein_id gnl|my_center|LOCUS_19720 16798 16298 gene locus_tag LOCUS_19730 16798 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 17271 16795 gene locus_tag LOCUS_19740 17271 16795 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_19740 17341 18705 gene locus_tag LOCUS_19750 17341 18705 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113524.1 protein_id gnl|my_center|LOCUS_19750 18833 20146 gene locus_tag LOCUS_19760 18833 20146 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918596.1 protein_id gnl|my_center|LOCUS_19760 20433 21278 gene locus_tag LOCUS_19770 gene dapD 20433 21278 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493576.1 protein_id gnl|my_center|LOCUS_19770 21383 22567 gene locus_tag LOCUS_19780 gene dapE 21383 22567 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918164.1 protein_id gnl|my_center|LOCUS_19780 22564 23169 gene locus_tag LOCUS_19790 22564 23169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 23166 24014 gene locus_tag LOCUS_19800 gene murI 23166 24014 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_19800 24758 24018 gene locus_tag LOCUS_19810 gene truA 24758 24018 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966077.1 protein_id gnl|my_center|LOCUS_19810 25699 24758 gene locus_tag LOCUS_19820 gene fmt 25699 24758 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_19820 26248 25727 gene locus_tag LOCUS_19830 gene def 26248 25727 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918161.1 protein_id gnl|my_center|LOCUS_19830 26369 27934 gene locus_tag LOCUS_19840 gene rmuC 26369 27934 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527474.1 protein_id gnl|my_center|LOCUS_19840 28113 29456 gene locus_tag LOCUS_19850 28113 29456 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_19850 30069 29470 gene locus_tag LOCUS_19860 gene recR 30069 29470 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527928.1 protein_id gnl|my_center|LOCUS_19860 30391 30074 gene locus_tag LOCUS_19870 30391 30074 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090837.1 protein_id gnl|my_center|LOCUS_19870 32259 30394 gene locus_tag LOCUS_19880 32259 30394 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527932.1 protein_id gnl|my_center|LOCUS_19880 32541 33503 gene locus_tag LOCUS_19890 gene nudC 32541 33503 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918155.1 protein_id gnl|my_center|LOCUS_19890 34377 33508 gene locus_tag LOCUS_19900 34377 33508 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084238.1 protein_id gnl|my_center|LOCUS_19900 35153 34377 gene locus_tag LOCUS_19910 35153 34377 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626528.1 protein_id gnl|my_center|LOCUS_19910 35459 36067 gene locus_tag LOCUS_19920 35459 36067 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084240.1 protein_id gnl|my_center|LOCUS_19920 36432 38456 gene locus_tag LOCUS_19930 36432 38456 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084241.1 protein_id gnl|my_center|LOCUS_19930 38453 40339 gene locus_tag LOCUS_19940 38453 40339 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173514.1 protein_id gnl|my_center|LOCUS_19940 40347 41456 gene locus_tag LOCUS_19950 40347 41456 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527941.1 protein_id gnl|my_center|LOCUS_19950 41458 42525 gene locus_tag LOCUS_19960 41458 42525 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173513.1 protein_id gnl|my_center|LOCUS_19960 42522 44150 gene locus_tag LOCUS_19970 42522 44150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_19970 45275 44406 gene locus_tag LOCUS_19980 45275 44406 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084247.1 protein_id gnl|my_center|LOCUS_19980 45661 45272 gene locus_tag LOCUS_19990 45661 45272 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387900.1 protein_id gnl|my_center|LOCUS_19990 <46686 45806 gene locus_tag LOCUS_20000 <46686 45806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533676.1:M17 family metallopeptidase >Feature sequence026 524 2761 gene locus_tag LOCUS_20010 524 2761 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171795.1 protein_id gnl|my_center|LOCUS_20010 2905 4248 gene locus_tag LOCUS_20020 2905 4248 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640302.1 protein_id gnl|my_center|LOCUS_20020 4248 5312 gene locus_tag LOCUS_20030 gene pdxA 4248 5312 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969073.1 protein_id gnl|my_center|LOCUS_20030 5522 6157 gene locus_tag LOCUS_20040 5522 6157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 6257 7306 gene locus_tag LOCUS_20050 6257 7306 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086875.1 protein_id gnl|my_center|LOCUS_20050 8079 7318 gene locus_tag LOCUS_20060 8079 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 8664 8197 gene locus_tag LOCUS_20070 8664 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 8701 9015 gene locus_tag LOCUS_20080 8701 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 9497 10009 gene locus_tag LOCUS_20090 9497 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 11164 10049 gene locus_tag LOCUS_20100 11164 10049 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_20100 12520 11294 gene locus_tag LOCUS_20110 12520 11294 CDS product methyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707820.1 protein_id gnl|my_center|LOCUS_20110 13081 12530 gene locus_tag LOCUS_20120 gene rfbC 13081 12530 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015242878.1 protein_id gnl|my_center|LOCUS_20120 14163 13078 gene locus_tag LOCUS_20130 gene rfbG 14163 13078 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976067.1 protein_id gnl|my_center|LOCUS_20130 14943 14164 gene locus_tag LOCUS_20140 gene rfbF 14943 14164 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563253.1 protein_id gnl|my_center|LOCUS_20140 15595 14957 gene locus_tag LOCUS_20150 gene gmk 15595 14957 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388188.1 protein_id gnl|my_center|LOCUS_20150 16495 15605 gene locus_tag LOCUS_20160 16495 15605 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388187.1 protein_id gnl|my_center|LOCUS_20160 17662 16574 gene locus_tag LOCUS_20170 17662 16574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 18915 17659 gene locus_tag LOCUS_20180 gene fabF 18915 17659 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086859.1 protein_id gnl|my_center|LOCUS_20180 19258 19019 gene locus_tag LOCUS_20190 19258 19019 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_20190 20254 19517 gene locus_tag LOCUS_20200 gene fabG 20254 19517 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383937.1 protein_id gnl|my_center|LOCUS_20200 21211 20270 gene locus_tag LOCUS_20210 gene fabD 21211 20270 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086857.1 protein_id gnl|my_center|LOCUS_20210 21570 22019 gene locus_tag LOCUS_20220 gene rpsF 21570 22019 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532520.1 protein_id gnl|my_center|LOCUS_20220 22019 22264 gene locus_tag LOCUS_20230 gene rpsR 22019 22264 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615089.1 protein_id gnl|my_center|LOCUS_20230 22286 22888 gene locus_tag LOCUS_20240 gene rplI 22286 22888 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532521.1 protein_id gnl|my_center|LOCUS_20240 23102 24352 gene locus_tag LOCUS_20250 23102 24352 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171076.1 protein_id gnl|my_center|LOCUS_20250 24678 26168 gene locus_tag LOCUS_20260 24678 26168 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086847.1 protein_id gnl|my_center|LOCUS_20260 27353 26991 gene locus_tag LOCUS_20270 27353 26991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 27867 28298 gene locus_tag LOCUS_20280 27867 28298 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967274.1 protein_id gnl|my_center|LOCUS_20280 29835 28459 gene locus_tag LOCUS_20290 29835 28459 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022297.1 protein_id gnl|my_center|LOCUS_20290 32062 29957 gene locus_tag LOCUS_20300 32062 29957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 32290 33477 gene locus_tag LOCUS_20310 gene alr 32290 33477 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967543.1 protein_id gnl|my_center|LOCUS_20310 33474 34247 gene locus_tag LOCUS_20320 33474 34247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_20320 34256 35029 gene locus_tag LOCUS_20330 34256 35029 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_20330 35177 36595 gene locus_tag LOCUS_20340 gene radA 35177 36595 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532526.1 protein_id gnl|my_center|LOCUS_20340 36627 37307 gene locus_tag LOCUS_20350 36627 37307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 37400 38935 gene locus_tag LOCUS_20360 gene purF 37400 38935 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086836.1 protein_id gnl|my_center|LOCUS_20360 38948 39667 gene locus_tag LOCUS_20370 38948 39667 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388162.1 protein_id gnl|my_center|LOCUS_20370 39699 39983 gene locus_tag LOCUS_20380 39699 39983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 40080 40502 gene locus_tag LOCUS_20390 40080 40502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 40504 41094 gene locus_tag LOCUS_20400 40504 41094 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024312082.1 protein_id gnl|my_center|LOCUS_20400 42025 41159 gene locus_tag LOCUS_20410 42025 41159 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871480.1 protein_id gnl|my_center|LOCUS_20410 41985 42194 gene locus_tag LOCUS_20420 41985 42194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 43647 42226 gene locus_tag LOCUS_20430 gene der 43647 42226 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719849.1 protein_id gnl|my_center|LOCUS_20430 45100 43724 gene locus_tag LOCUS_20440 gene bamB 45100 43724 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356919.1 protein_id gnl|my_center|LOCUS_20440 45858 45100 gene locus_tag LOCUS_20450 45858 45100 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086826.1 protein_id gnl|my_center|LOCUS_20450 <46588 45998 gene locus_tag LOCUS_20460 <46588 45998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086824.1:3-methyl-2-oxobutanoate hydroxymethyltransferase >Feature sequence027 343 2133 gene locus_tag LOCUS_20470 343 2133 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189745032.1 protein_id gnl|my_center|LOCUS_20470 2739 2248 gene locus_tag LOCUS_20480 2739 2248 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966456.1 protein_id gnl|my_center|LOCUS_20480 2877 4268 gene locus_tag LOCUS_20490 2877 4268 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626100.1 protein_id gnl|my_center|LOCUS_20490 5584 4448 gene locus_tag LOCUS_20500 5584 4448 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390877.1 protein_id gnl|my_center|LOCUS_20500 6553 5588 gene locus_tag LOCUS_20510 6553 5588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088395.1 protein_id gnl|my_center|LOCUS_20510 7369 6560 gene locus_tag LOCUS_20520 7369 6560 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088396.1 protein_id gnl|my_center|LOCUS_20520 8008 7373 gene locus_tag LOCUS_20530 8008 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 8447 8226 gene locus_tag LOCUS_20540 8447 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 8606 12046 gene locus_tag LOCUS_20550 8606 12046 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972022.1 protein_id gnl|my_center|LOCUS_20550 12308 12051 gene locus_tag LOCUS_20560 12308 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 13714 12323 gene locus_tag LOCUS_20570 gene fumC 13714 12323 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535082.1 protein_id gnl|my_center|LOCUS_20570 14295 13828 gene locus_tag LOCUS_20580 14295 13828 CDS product ClpXP protease specificity-enhancing factor SspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089258.1 protein_id gnl|my_center|LOCUS_20580 16002 14836 gene locus_tag LOCUS_20590 16002 14836 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_20590 16220 17014 gene locus_tag LOCUS_20600 16220 17014 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_20600 17029 17196 gene locus_tag LOCUS_20610 17029 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 17193 17708 gene locus_tag LOCUS_20620 17193 17708 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089250.1 protein_id gnl|my_center|LOCUS_20620 17772 18881 gene locus_tag LOCUS_20630 17772 18881 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_20630 18881 19720 gene locus_tag LOCUS_20640 gene fghA 18881 19720 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920372.1 protein_id gnl|my_center|LOCUS_20640 19738 20997 gene locus_tag LOCUS_20650 19738 20997 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083372.1 protein_id gnl|my_center|LOCUS_20650 21045 21962 gene locus_tag LOCUS_20660 21045 21962 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919989.1 protein_id gnl|my_center|LOCUS_20660 22089 22424 gene locus_tag LOCUS_20670 22089 22424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 23258 22506 gene locus_tag LOCUS_20680 23258 22506 CDS product DUF1428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384906.1 protein_id gnl|my_center|LOCUS_20680 24522 23365 gene locus_tag LOCUS_20690 24522 23365 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528006.1 protein_id gnl|my_center|LOCUS_20690 24703 25869 gene locus_tag LOCUS_20700 gene hflK 24703 25869 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089249.1 protein_id gnl|my_center|LOCUS_20700 25869 26747 gene locus_tag LOCUS_20710 25869 26747 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089248.1 protein_id gnl|my_center|LOCUS_20710 26761 26946 gene locus_tag LOCUS_20720 26761 26946 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531032.1 protein_id gnl|my_center|LOCUS_20720 27075 28505 gene locus_tag LOCUS_20730 27075 28505 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089246.1 protein_id gnl|my_center|LOCUS_20730 29396 28512 gene locus_tag LOCUS_20740 gene serB 29396 28512 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976142.1 protein_id gnl|my_center|LOCUS_20740 29423 30367 gene locus_tag LOCUS_20750 gene miaA 29423 30367 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089244.1 protein_id gnl|my_center|LOCUS_20750 30496 32253 gene locus_tag LOCUS_20760 30496 32253 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640408.1 protein_id gnl|my_center|LOCUS_20760 32315 32827 gene locus_tag LOCUS_20770 gene ilvN 32315 32827 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388227.1 protein_id gnl|my_center|LOCUS_20770 32857 33876 gene locus_tag LOCUS_20780 gene ilvC 32857 33876 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089237.1 protein_id gnl|my_center|LOCUS_20780 33958 34653 gene locus_tag LOCUS_20790 33958 34653 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977883.1 protein_id gnl|my_center|LOCUS_20790 35105 34671 gene locus_tag LOCUS_20800 35105 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 36255 35509 gene locus_tag LOCUS_20810 36255 35509 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085663.1 protein_id gnl|my_center|LOCUS_20810 36790 36347 gene locus_tag LOCUS_20820 36790 36347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 37756 36815 gene locus_tag LOCUS_20830 37756 36815 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529747.1 protein_id gnl|my_center|LOCUS_20830 37947 37753 gene locus_tag LOCUS_20840 37947 37753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 38291 37944 gene locus_tag LOCUS_20850 38291 37944 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143418.1 protein_id gnl|my_center|LOCUS_20850 38555 39772 gene locus_tag LOCUS_20860 gene purT 38555 39772 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186479.1 protein_id gnl|my_center|LOCUS_20860 39878 40828 gene locus_tag LOCUS_20870 39878 40828 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_20870 40976 41935 gene locus_tag LOCUS_20880 40976 41935 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537711.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence028 129 902 gene locus_tag LOCUS_20890 gene modA 129 902 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704779.1 protein_id gnl|my_center|LOCUS_20890 906 1625 gene locus_tag LOCUS_20900 gene modB 906 1625 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090882.1 protein_id gnl|my_center|LOCUS_20900 1622 2746 gene locus_tag LOCUS_20910 gene modC 1622 2746 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531025.1 protein_id gnl|my_center|LOCUS_20910 2776 3000 gene locus_tag LOCUS_20920 2776 3000 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811628.1 protein_id gnl|my_center|LOCUS_20920 4391 2997 gene locus_tag LOCUS_20930 4391 2997 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408749.1 protein_id gnl|my_center|LOCUS_20930 5188 4424 gene locus_tag LOCUS_20940 5188 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 5423 6328 gene locus_tag LOCUS_20950 5423 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 6414 6338 gene locus_tag LOCUS_t00200 6414 6338 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6734 6426 gene locus_tag LOCUS_20960 6734 6426 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171332.1 protein_id gnl|my_center|LOCUS_20960 6903 7124 gene locus_tag LOCUS_20970 6903 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 7282 7206 gene locus_tag LOCUS_t00210 7282 7206 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7750 7319 gene locus_tag LOCUS_20980 7750 7319 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811562.1 protein_id gnl|my_center|LOCUS_20980 8402 7839 gene locus_tag LOCUS_20990 8402 7839 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975604.1 protein_id gnl|my_center|LOCUS_20990 8748 9221 gene locus_tag LOCUS_21000 8748 9221 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335817.1 protein_id gnl|my_center|LOCUS_21000 9223 9510 gene locus_tag LOCUS_21010 9223 9510 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_21010 9507 9884 gene locus_tag LOCUS_21020 gene mnhG 9507 9884 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389329.1 protein_id gnl|my_center|LOCUS_21020 9881 10459 gene locus_tag LOCUS_21030 9881 10459 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_21030 10464 10901 gene locus_tag LOCUS_21040 10464 10901 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389327.1 protein_id gnl|my_center|LOCUS_21040 10901 11320 gene locus_tag LOCUS_21050 10901 11320 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_21050 11317 12825 gene locus_tag LOCUS_21060 11317 12825 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_21060 12832 14337 gene locus_tag LOCUS_21070 12832 14337 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_21070 14334 14609 gene locus_tag LOCUS_21080 14334 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 14602 16296 gene locus_tag LOCUS_21090 14602 16296 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_21090 16354 17004 gene locus_tag LOCUS_21100 16354 17004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 17117 17581 gene locus_tag LOCUS_21110 17117 17581 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531265.1 protein_id gnl|my_center|LOCUS_21110 17622 20003 gene locus_tag LOCUS_21120 17622 20003 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531266.1 protein_id gnl|my_center|LOCUS_21120 20026 20823 gene locus_tag LOCUS_21130 20026 20823 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088410.1 protein_id gnl|my_center|LOCUS_21130 20859 21767 gene locus_tag LOCUS_21140 20859 21767 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388723.1 protein_id gnl|my_center|LOCUS_21140 21769 22965 gene locus_tag LOCUS_21150 21769 22965 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532113.1 protein_id gnl|my_center|LOCUS_21150 22962 23294 gene locus_tag LOCUS_21160 22962 23294 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088407.1 protein_id gnl|my_center|LOCUS_21160 23296 23973 gene locus_tag LOCUS_21170 23296 23973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 23970 25592 gene locus_tag LOCUS_21180 23970 25592 CDS product molybdopterin-binding/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088405.1 protein_id gnl|my_center|LOCUS_21180 27193 25589 gene locus_tag LOCUS_21190 27193 25589 CDS product alpha-glucosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532695.1 protein_id gnl|my_center|LOCUS_21190 27285 28019 gene locus_tag LOCUS_21200 gene fabG 27285 28019 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888576.1 protein_id gnl|my_center|LOCUS_21200 28772 28032 gene locus_tag LOCUS_21210 28772 28032 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967135.1 protein_id gnl|my_center|LOCUS_21210 28849 29268 gene locus_tag LOCUS_21220 gene gloA 28849 29268 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_21220 29235 29666 gene locus_tag LOCUS_21230 29235 29666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 29849 30688 gene locus_tag LOCUS_21240 29849 30688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 30770 30696 gene locus_tag LOCUS_t00220 30770 30696 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 30998 31558 gene locus_tag LOCUS_21250 30998 31558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 31555 32475 gene locus_tag LOCUS_21260 31555 32475 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_21260 32479 33321 gene locus_tag LOCUS_21270 32479 33321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 35203 33332 gene locus_tag LOCUS_21280 gene recJ 35203 33332 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390161.1 protein_id gnl|my_center|LOCUS_21280 36220 35246 gene locus_tag LOCUS_21290 gene glpX 36220 35246 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531987.1 protein_id gnl|my_center|LOCUS_21290 37581 36274 gene locus_tag LOCUS_21300 37581 36274 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390163.1 protein_id gnl|my_center|LOCUS_21300 38915 37578 gene locus_tag LOCUS_21310 38915 37578 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969423.1 protein_id gnl|my_center|LOCUS_21310 39682 39047 gene locus_tag LOCUS_21320 39682 39047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 39862 41835 gene locus_tag LOCUS_21330 39862 41835 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265707.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence029 601 86 gene locus_tag LOCUS_21340 601 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1156 629 gene locus_tag LOCUS_21350 1156 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1800 1159 gene locus_tag LOCUS_21360 1800 1159 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081822.1 protein_id gnl|my_center|LOCUS_21360 1880 2368 gene locus_tag LOCUS_21370 1880 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 2365 3234 gene locus_tag LOCUS_21380 2365 3234 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731590.1 protein_id gnl|my_center|LOCUS_21380 3234 3662 gene locus_tag LOCUS_21390 3234 3662 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919536.1 protein_id gnl|my_center|LOCUS_21390 4435 3671 gene locus_tag LOCUS_21400 gene pheC 4435 3671 CDS product cyclohexadienyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092003.1 protein_id gnl|my_center|LOCUS_21400 4685 7639 gene locus_tag LOCUS_21410 gene ileS 4685 7639 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968828.1 protein_id gnl|my_center|LOCUS_21410 7658 8191 gene locus_tag LOCUS_21420 gene lspA 7658 8191 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174654.1 protein_id gnl|my_center|LOCUS_21420 8264 8869 gene locus_tag LOCUS_21430 8264 8869 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390716.1 protein_id gnl|my_center|LOCUS_21430 8986 10353 gene locus_tag LOCUS_21440 8986 10353 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_21440 10350 11726 gene locus_tag LOCUS_21450 10350 11726 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338715.1 protein_id gnl|my_center|LOCUS_21450 11847 13181 gene locus_tag LOCUS_21460 11847 13181 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546494.1 protein_id gnl|my_center|LOCUS_21460 13186 15006 gene locus_tag LOCUS_21470 gene mutL 13186 15006 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390696.1 protein_id gnl|my_center|LOCUS_21470 15726 14989 gene locus_tag LOCUS_21480 15726 14989 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_21480 15864 17123 gene locus_tag LOCUS_21490 15864 17123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 18136 17120 gene locus_tag LOCUS_21500 18136 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 19133 18216 gene locus_tag LOCUS_21510 gene argB 19133 18216 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528489.1 protein_id gnl|my_center|LOCUS_21510 19859 19164 gene locus_tag LOCUS_21520 gene yihA 19859 19164 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391087.1 protein_id gnl|my_center|LOCUS_21520 21678 19864 gene locus_tag LOCUS_21530 gene yidC 21678 19864 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966085.1 protein_id gnl|my_center|LOCUS_21530 22102 21671 gene locus_tag LOCUS_21540 gene rnpA 22102 21671 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721421.1 protein_id gnl|my_center|LOCUS_21540 22307 22173 gene locus_tag LOCUS_21550 22307 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 22692 23423 gene locus_tag LOCUS_21560 22692 23423 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948447.1 protein_id gnl|my_center|LOCUS_21560 23420 24154 gene locus_tag LOCUS_21570 23420 24154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21570 24207 25631 gene locus_tag LOCUS_21580 24207 25631 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338686.1 protein_id gnl|my_center|LOCUS_21580 25671 27173 gene locus_tag LOCUS_21590 25671 27173 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175987.1 protein_id gnl|my_center|LOCUS_21590 27187 27939 gene locus_tag LOCUS_21600 gene otsB 27187 27939 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533988.1 protein_id gnl|my_center|LOCUS_21600 27964 29760 gene locus_tag LOCUS_21610 27964 29760 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_21610 29757 31151 gene locus_tag LOCUS_21620 29757 31151 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390238.1 protein_id gnl|my_center|LOCUS_21620 31160 32158 gene locus_tag LOCUS_21630 gene glk 31160 32158 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087321.1 protein_id gnl|my_center|LOCUS_21630 33903 32170 gene locus_tag LOCUS_21640 gene ggt 33903 32170 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480939.1 protein_id gnl|my_center|LOCUS_21640 34032 35063 gene locus_tag LOCUS_21650 34032 35063 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014526837.1 protein_id gnl|my_center|LOCUS_21650 35227 35303 gene locus_tag LOCUS_t00230 35227 35303 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35808 35317 gene locus_tag LOCUS_21660 35808 35317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 37692 36028 gene locus_tag LOCUS_21670 37692 36028 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_21670 37922 38461 gene locus_tag LOCUS_21680 37922 38461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 38590 40227 gene locus_tag LOCUS_21690 38590 40227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence030 784 708 gene locus_tag LOCUS_t00240 784 708 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 961 1461 gene locus_tag LOCUS_21700 961 1461 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_21700 1497 2114 gene locus_tag LOCUS_21710 1497 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 2195 3238 gene locus_tag LOCUS_21720 2195 3238 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_21720 4004 3240 gene locus_tag LOCUS_21730 4004 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4525 4001 gene locus_tag LOCUS_21740 4525 4001 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528500.1 protein_id gnl|my_center|LOCUS_21740 4690 6345 gene locus_tag LOCUS_21750 gene ettA 4690 6345 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383668.1 protein_id gnl|my_center|LOCUS_21750 6492 8120 gene locus_tag LOCUS_21760 6492 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 8706 8128 gene locus_tag LOCUS_21770 8706 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 9582 8914 gene locus_tag LOCUS_21780 9582 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 10502 9651 gene locus_tag LOCUS_21790 10502 9651 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387816.1 protein_id gnl|my_center|LOCUS_21790 10800 11792 gene locus_tag LOCUS_21800 10800 11792 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328973.1 protein_id gnl|my_center|LOCUS_21800 11798 12700 gene locus_tag LOCUS_21810 gene metF 11798 12700 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920001.1 protein_id gnl|my_center|LOCUS_21810 12733 13806 gene locus_tag LOCUS_21820 12733 13806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 13895 16579 gene locus_tag LOCUS_21830 13895 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 16855 16583 gene locus_tag LOCUS_21840 16855 16583 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090473.1 protein_id gnl|my_center|LOCUS_21840 17017 17556 gene locus_tag LOCUS_21850 17017 17556 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090472.1 protein_id gnl|my_center|LOCUS_21850 18925 17945 gene locus_tag LOCUS_21860 18925 17945 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_21860 22616 18990 gene locus_tag LOCUS_21870 22616 18990 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530942.1 protein_id gnl|my_center|LOCUS_21870 22767 23477 gene locus_tag LOCUS_21880 22767 23477 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_21880 23545 24720 gene locus_tag LOCUS_21890 23545 24720 CDS product YbfB/YjiJ family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532852.1 protein_id gnl|my_center|LOCUS_21890 25230 26096 gene locus_tag LOCUS_21900 25230 26096 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113950.1 protein_id gnl|my_center|LOCUS_21900 26096 26836 gene locus_tag LOCUS_21910 26096 26836 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089351.1 protein_id gnl|my_center|LOCUS_21910 27795 26833 gene locus_tag LOCUS_21920 27795 26833 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919443.1 protein_id gnl|my_center|LOCUS_21920 28764 29234 gene locus_tag LOCUS_21930 gene mraZ 28764 29234 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599021.1 protein_id gnl|my_center|LOCUS_21930 29231 30247 gene locus_tag LOCUS_21940 gene rsmH 29231 30247 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388713.1 protein_id gnl|my_center|LOCUS_21940 30244 30618 gene locus_tag LOCUS_21950 30244 30618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 30615 32402 gene locus_tag LOCUS_21960 30615 32402 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089348.1 protein_id gnl|my_center|LOCUS_21960 32490 33947 gene locus_tag LOCUS_21970 32490 33947 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089347.1 protein_id gnl|my_center|LOCUS_21970 33944 35383 gene locus_tag LOCUS_21980 gene murF 33944 35383 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388709.1 protein_id gnl|my_center|LOCUS_21980 35383 36471 gene locus_tag LOCUS_21990 gene mraY 35383 36471 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089345.1 protein_id gnl|my_center|LOCUS_21990 36475 37884 gene locus_tag LOCUS_22000 gene murD 36475 37884 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920413.1 protein_id gnl|my_center|LOCUS_22000 37881 39029 gene locus_tag LOCUS_22010 37881 39029 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089343.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence031 187 1119 gene locus_tag LOCUS_22020 187 1119 CDS product DUF2493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173519957.1 protein_id gnl|my_center|LOCUS_22020 1439 2680 gene locus_tag LOCUS_22030 1439 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3677 2763 gene locus_tag LOCUS_22040 3677 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3895 5388 gene locus_tag LOCUS_22050 gene istA 3895 5388 CDS product IS21-like element ISFK1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090936.1 protein_id gnl|my_center|LOCUS_22050 5411 6169 gene locus_tag LOCUS_22060 gene istB 5411 6169 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_22060 6566 6252 gene locus_tag LOCUS_22070 6566 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 6944 7072 gene locus_tag LOCUS_22080 6944 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 7736 7371 gene locus_tag LOCUS_22090 7736 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 8748 7753 gene locus_tag LOCUS_22100 8748 7753 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083626.1 protein_id gnl|my_center|LOCUS_22100 9016 9696 gene locus_tag LOCUS_22110 9016 9696 CDS product sulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528050.1 protein_id gnl|my_center|LOCUS_22110 9693 10070 gene locus_tag LOCUS_22120 9693 10070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 10733 10077 gene locus_tag LOCUS_22130 gene nth 10733 10077 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_22130 10821 11375 gene locus_tag LOCUS_22140 10821 11375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 12014 11382 gene locus_tag LOCUS_22150 12014 11382 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531941.1 protein_id gnl|my_center|LOCUS_22150 12875 12045 gene locus_tag LOCUS_22160 gene dapB 12875 12045 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968395.1 protein_id gnl|my_center|LOCUS_22160 13258 12920 gene locus_tag LOCUS_22170 13258 12920 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112983.1 protein_id gnl|my_center|LOCUS_22170 14485 13328 gene locus_tag LOCUS_22180 gene dnaJ 14485 13328 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309945.1 protein_id gnl|my_center|LOCUS_22180 16515 14590 gene locus_tag LOCUS_22190 gene dnaK 16515 14590 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531910.1 protein_id gnl|my_center|LOCUS_22190 17393 16851 gene locus_tag LOCUS_22200 17393 16851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 17464 18126 gene locus_tag LOCUS_22210 17464 18126 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528341.1 protein_id gnl|my_center|LOCUS_22210 18824 18120 gene locus_tag LOCUS_22220 18824 18120 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973806.1 protein_id gnl|my_center|LOCUS_22220 19652 18948 gene locus_tag LOCUS_22230 19652 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 20759 19695 gene locus_tag LOCUS_22240 gene hrcA 20759 19695 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083502.1 protein_id gnl|my_center|LOCUS_22240 21017 21703 gene locus_tag LOCUS_22250 gene rph 21017 21703 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241574.1 protein_id gnl|my_center|LOCUS_22250 21700 22305 gene locus_tag LOCUS_22260 gene rdgB 21700 22305 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391387.1 protein_id gnl|my_center|LOCUS_22260 22286 23479 gene locus_tag LOCUS_22270 gene hemW 22286 23479 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528629.1 protein_id gnl|my_center|LOCUS_22270 24760 23483 gene locus_tag LOCUS_22280 24760 23483 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000235.1 protein_id gnl|my_center|LOCUS_22280 24904 25803 gene locus_tag LOCUS_22290 gene rsmI 24904 25803 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083497.1 protein_id gnl|my_center|LOCUS_22290 25805 26179 gene locus_tag LOCUS_22300 25805 26179 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_22300 26240 26827 gene locus_tag LOCUS_22310 26240 26827 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597571.1 protein_id gnl|my_center|LOCUS_22310 26882 27730 gene locus_tag LOCUS_22320 26882 27730 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918031.1 protein_id gnl|my_center|LOCUS_22320 28415 27723 gene locus_tag LOCUS_22330 28415 27723 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932168.1 protein_id gnl|my_center|LOCUS_22330 28588 29535 gene locus_tag LOCUS_22340 gene gshB 28588 29535 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391437.1 protein_id gnl|my_center|LOCUS_22340 30438 29449 gene locus_tag LOCUS_22350 30438 29449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 30697 30527 gene locus_tag LOCUS_22360 30697 30527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 30876 32192 gene locus_tag LOCUS_22370 gene pvdM 30876 32192 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_22370 32274 33041 gene locus_tag LOCUS_22380 32274 33041 CDS product HugZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529914.1 protein_id gnl|my_center|LOCUS_22380 33085 34062 gene locus_tag LOCUS_22390 33085 34062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 34257 34066 gene locus_tag LOCUS_22400 34257 34066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 34445 35995 gene locus_tag LOCUS_22410 34445 35995 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529769.1 protein_id gnl|my_center|LOCUS_22410 >Feature sequence032 1695 151 gene locus_tag LOCUS_22420 1695 151 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_22420 3626 1695 gene locus_tag LOCUS_22430 gene nuoL 3626 1695 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531100.1 protein_id gnl|my_center|LOCUS_22430 3944 3633 gene locus_tag LOCUS_22440 gene nuoK 3944 3633 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_22440 4648 4034 gene locus_tag LOCUS_22450 4648 4034 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311651.1 protein_id gnl|my_center|LOCUS_22450 5162 4671 gene locus_tag LOCUS_22460 gene nuoI 5162 4671 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707628.1 protein_id gnl|my_center|LOCUS_22460 6210 5206 gene locus_tag LOCUS_22470 gene nuoH 6210 5206 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087676.1 protein_id gnl|my_center|LOCUS_22470 8272 6227 gene locus_tag LOCUS_22480 gene nuoG 8272 6227 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389436.1 protein_id gnl|my_center|LOCUS_22480 9568 8276 gene locus_tag LOCUS_22490 gene nuoF 9568 8276 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389435.1 protein_id gnl|my_center|LOCUS_22490 10191 9568 gene locus_tag LOCUS_22500 10191 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 11366 10188 gene locus_tag LOCUS_22510 11366 10188 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312711.1 protein_id gnl|my_center|LOCUS_22510 11973 11371 gene locus_tag LOCUS_22520 11973 11371 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919820.1 protein_id gnl|my_center|LOCUS_22520 12617 12042 gene locus_tag LOCUS_22530 12617 12042 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707619.1 protein_id gnl|my_center|LOCUS_22530 12973 12608 gene locus_tag LOCUS_22540 12973 12608 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312714.1 protein_id gnl|my_center|LOCUS_22540 13326 13250 gene locus_tag LOCUS_t00250 13326 13250 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13551 13476 gene locus_tag LOCUS_t00260 13551 13476 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13711 15006 gene locus_tag LOCUS_22550 13711 15006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314722.1 protein_id gnl|my_center|LOCUS_22550 15358 15083 gene locus_tag LOCUS_22560 15358 15083 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389428.1 protein_id gnl|my_center|LOCUS_22560 18004 15554 gene locus_tag LOCUS_22570 gene lon 18004 15554 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531808.1 protein_id gnl|my_center|LOCUS_22570 19557 18292 gene locus_tag LOCUS_22580 gene clpX 19557 18292 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008547851.1 protein_id gnl|my_center|LOCUS_22580 20509 19871 gene locus_tag LOCUS_22590 20509 19871 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087708.1 protein_id gnl|my_center|LOCUS_22590 21294 20731 gene locus_tag LOCUS_22600 21294 20731 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529755.1 protein_id gnl|my_center|LOCUS_22600 22649 21348 gene locus_tag LOCUS_22610 gene odc2 22649 21348 CDS product ornithine/lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529754.1 protein_id gnl|my_center|LOCUS_22610 24461 22947 gene locus_tag LOCUS_22620 gene tig 24461 22947 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087709.1 protein_id gnl|my_center|LOCUS_22620 24591 24507 gene locus_tag LOCUS_t00270 24591 24507 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26206 24704 gene locus_tag LOCUS_22630 26206 24704 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966309.1 protein_id gnl|my_center|LOCUS_22630 26852 26262 gene locus_tag LOCUS_22640 26852 26262 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919832.1 protein_id gnl|my_center|LOCUS_22640 26986 27345 gene locus_tag LOCUS_22650 26986 27345 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327476.1 protein_id gnl|my_center|LOCUS_22650 28983 27427 gene locus_tag LOCUS_22660 28983 27427 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640376.1 protein_id gnl|my_center|LOCUS_22660 29789 29094 gene locus_tag LOCUS_22670 29789 29094 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_22670 29934 30425 gene locus_tag LOCUS_22680 29934 30425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 31597 30422 gene locus_tag LOCUS_22690 31597 30422 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150041682.1 protein_id gnl|my_center|LOCUS_22690 31914 32252 gene locus_tag LOCUS_22700 31914 32252 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_22700 32422 33828 gene locus_tag LOCUS_22710 gene glnA 32422 33828 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528053.1 protein_id gnl|my_center|LOCUS_22710 34657 33893 gene locus_tag LOCUS_22720 34657 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 35300 35914 gene locus_tag LOCUS_22730 35300 35914 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191763.1 protein_id gnl|my_center|LOCUS_22730 <37059 35836 gene locus_tag LOCUS_22740 <37059 35836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006285466.1:DASS family sodium-coupled anion symporter >Feature sequence033 393 944 gene locus_tag LOCUS_22750 393 944 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678340.1 protein_id gnl|my_center|LOCUS_22750 3395 1035 gene locus_tag LOCUS_22760 3395 1035 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537673.1 protein_id gnl|my_center|LOCUS_22760 3624 5501 gene locus_tag LOCUS_22770 3624 5501 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267222.1 protein_id gnl|my_center|LOCUS_22770 5649 6923 gene locus_tag LOCUS_22780 gene eno 5649 6923 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969226.1 protein_id gnl|my_center|LOCUS_22780 6995 7348 gene locus_tag LOCUS_22790 6995 7348 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626266.1 protein_id gnl|my_center|LOCUS_22790 7511 8575 gene locus_tag LOCUS_22800 gene pdhA 7511 8575 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087551.1 protein_id gnl|my_center|LOCUS_22800 8581 9987 gene locus_tag LOCUS_22810 8581 9987 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975253.1 protein_id gnl|my_center|LOCUS_22810 9998 11356 gene locus_tag LOCUS_22820 9998 11356 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087547.1 protein_id gnl|my_center|LOCUS_22820 11356 12753 gene locus_tag LOCUS_22830 gene lpdA 11356 12753 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 protein_id gnl|my_center|LOCUS_22830 12825 13544 gene locus_tag LOCUS_22840 12825 13544 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087355.1 protein_id gnl|my_center|LOCUS_22840 13565 15094 gene locus_tag LOCUS_22850 13565 15094 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145161935.1 protein_id gnl|my_center|LOCUS_22850 15148 15648 gene locus_tag LOCUS_22860 15148 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 15726 16691 gene locus_tag LOCUS_22870 gene lipA 15726 16691 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087249.1 protein_id gnl|my_center|LOCUS_22870 16703 17203 gene locus_tag LOCUS_22880 16703 17203 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315362.1 protein_id gnl|my_center|LOCUS_22880 17698 17204 gene locus_tag LOCUS_22890 17698 17204 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 protein_id gnl|my_center|LOCUS_22890 18195 17695 gene locus_tag LOCUS_22900 18195 17695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 19354 18203 gene locus_tag LOCUS_22910 19354 18203 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_22910 19832 19491 gene locus_tag LOCUS_22920 19832 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 19725 20498 gene locus_tag LOCUS_22930 19725 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 20498 21625 gene locus_tag LOCUS_22940 20498 21625 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087259.1 protein_id gnl|my_center|LOCUS_22940 21639 23081 gene locus_tag LOCUS_22950 gene ntrC 21639 23081 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087260.1 protein_id gnl|my_center|LOCUS_22950 23278 25623 gene locus_tag LOCUS_22960 23278 25623 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967572.1 protein_id gnl|my_center|LOCUS_22960 25613 27007 gene locus_tag LOCUS_22970 gene ntrX 25613 27007 CDS product two-component system response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535439.1 protein_id gnl|my_center|LOCUS_22970 27044 28420 gene locus_tag LOCUS_22980 gene trkA 27044 28420 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_22980 28450 29304 gene locus_tag LOCUS_22990 28450 29304 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969239.1 protein_id gnl|my_center|LOCUS_22990 29540 29788 gene locus_tag LOCUS_23000 gene hfq 29540 29788 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919613.1 protein_id gnl|my_center|LOCUS_23000 29813 31234 gene locus_tag LOCUS_23010 gene hflX 29813 31234 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244647.1 protein_id gnl|my_center|LOCUS_23010 31231 32064 gene locus_tag LOCUS_23020 31231 32064 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389377.1 protein_id gnl|my_center|LOCUS_23020 32864 32061 gene locus_tag LOCUS_23030 gene mazG 32864 32061 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_23030 34295 32877 gene locus_tag LOCUS_23040 34295 32877 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_23040 35118 34468 gene locus_tag LOCUS_23050 35118 34468 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389275.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence034 224 532 gene locus_tag LOCUS_23060 gene rpsJ 224 532 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_23060 567 1325 gene locus_tag LOCUS_23070 gene rplC 567 1325 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969195.1 protein_id gnl|my_center|LOCUS_23070 1325 1945 gene locus_tag LOCUS_23080 gene rplD 1325 1945 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088150.1 protein_id gnl|my_center|LOCUS_23080 1942 2232 gene locus_tag LOCUS_23090 1942 2232 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088149.1 protein_id gnl|my_center|LOCUS_23090 2287 3123 gene locus_tag LOCUS_23100 gene rplB 2287 3123 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531425.1 protein_id gnl|my_center|LOCUS_23100 3135 3413 gene locus_tag LOCUS_23110 gene rpsS 3135 3413 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722496.1 protein_id gnl|my_center|LOCUS_23110 3417 3797 gene locus_tag LOCUS_23120 gene rplV 3417 3797 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707758.1 protein_id gnl|my_center|LOCUS_23120 3797 4507 gene locus_tag LOCUS_23130 gene rpsC 3797 4507 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088146.1 protein_id gnl|my_center|LOCUS_23130 4540 4959 gene locus_tag LOCUS_23140 gene rplP 4540 4959 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531427.1 protein_id gnl|my_center|LOCUS_23140 5005 5208 gene locus_tag LOCUS_23150 gene rpmC 5005 5208 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536529.1 protein_id gnl|my_center|LOCUS_23150 5219 5455 gene locus_tag LOCUS_23160 gene rpsQ 5219 5455 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313974.1 protein_id gnl|my_center|LOCUS_23160 5501 5869 gene locus_tag LOCUS_23170 gene rplN 5501 5869 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603030.1 protein_id gnl|my_center|LOCUS_23170 5869 6186 gene locus_tag LOCUS_23180 gene rplX 5869 6186 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390427.1 protein_id gnl|my_center|LOCUS_23180 6179 6736 gene locus_tag LOCUS_23190 gene rplE 6179 6736 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919139.1 protein_id gnl|my_center|LOCUS_23190 6779 7084 gene locus_tag LOCUS_23200 gene rpsN 6779 7084 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 protein_id gnl|my_center|LOCUS_23200 7096 7494 gene locus_tag LOCUS_23210 gene rpsH 7096 7494 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313978.1 protein_id gnl|my_center|LOCUS_23210 7537 8070 gene locus_tag LOCUS_23220 gene rplF 7537 8070 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531432.1 protein_id gnl|my_center|LOCUS_23220 8075 8437 gene locus_tag LOCUS_23230 gene rplR 8075 8437 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531433.1 protein_id gnl|my_center|LOCUS_23230 8450 9010 gene locus_tag LOCUS_23240 gene rpsE 8450 9010 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008136332.1 protein_id gnl|my_center|LOCUS_23240 9028 9231 gene locus_tag LOCUS_23250 gene rpmD 9028 9231 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536508.1 protein_id gnl|my_center|LOCUS_23250 9273 9755 gene locus_tag LOCUS_23260 gene rplO 9273 9755 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531434.1 protein_id gnl|my_center|LOCUS_23260 9813 11144 gene locus_tag LOCUS_23270 gene secY 9813 11144 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088135.1 protein_id gnl|my_center|LOCUS_23270 11147 11713 gene locus_tag LOCUS_23280 11147 11713 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390417.1 protein_id gnl|my_center|LOCUS_23280 11910 12278 gene locus_tag LOCUS_23290 gene rpsM 11910 12278 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531437.1 protein_id gnl|my_center|LOCUS_23290 12349 12738 gene locus_tag LOCUS_23300 gene rpsK 12349 12738 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919150.1 protein_id gnl|my_center|LOCUS_23300 12893 13909 gene locus_tag LOCUS_23310 12893 13909 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088132.1 protein_id gnl|my_center|LOCUS_23310 13961 14380 gene locus_tag LOCUS_23320 gene rplQ 13961 14380 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919152.1 protein_id gnl|my_center|LOCUS_23320 14550 16037 gene locus_tag LOCUS_23330 14550 16037 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967063.1 protein_id gnl|my_center|LOCUS_23330 16530 16048 gene locus_tag LOCUS_23340 gene bfr 16530 16048 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188572.1 protein_id gnl|my_center|LOCUS_23340 16886 16680 gene locus_tag LOCUS_23350 16886 16680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 17252 17064 gene locus_tag LOCUS_23360 17252 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 17190 18404 gene locus_tag LOCUS_23370 17190 18404 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390410.1 protein_id gnl|my_center|LOCUS_23370 18401 18784 gene locus_tag LOCUS_23380 gene crcB 18401 18784 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971646.1 protein_id gnl|my_center|LOCUS_23380 18781 19770 gene locus_tag LOCUS_23390 18781 19770 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390409.1 protein_id gnl|my_center|LOCUS_23390 19767 20480 gene locus_tag LOCUS_23400 19767 20480 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_23400 20486 22237 gene locus_tag LOCUS_23410 20486 22237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 22324 23124 gene locus_tag LOCUS_23420 22324 23124 CDS product ATP12 family chaperone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975194.1 protein_id gnl|my_center|LOCUS_23420 23377 24909 gene locus_tag LOCUS_23430 23377 24909 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531455.1 protein_id gnl|my_center|LOCUS_23430 24918 25838 gene locus_tag LOCUS_23440 24918 25838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 25844 27859 gene locus_tag LOCUS_23450 25844 27859 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531942.1 protein_id gnl|my_center|LOCUS_23450 28059 29114 gene locus_tag LOCUS_23460 28059 29114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 29235 29540 gene locus_tag LOCUS_23470 29235 29540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 30285 29638 gene locus_tag LOCUS_23480 30285 29638 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976086.1 protein_id gnl|my_center|LOCUS_23480 30408 30911 gene locus_tag LOCUS_23490 30408 30911 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974353.1 protein_id gnl|my_center|LOCUS_23490 31832 31149 gene locus_tag LOCUS_23500 gene lipB 31832 31149 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088013.1 protein_id gnl|my_center|LOCUS_23500 31896 32147 gene locus_tag LOCUS_23510 31896 32147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 32302 32868 gene locus_tag LOCUS_23520 32302 32868 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_23520 32865 33689 gene locus_tag LOCUS_23530 32865 33689 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389682.1 protein_id gnl|my_center|LOCUS_23530 33762 33848 gene locus_tag LOCUS_t00280 33762 33848 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34461 34880 gene locus_tag LOCUS_23540 34461 34880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 35132 35779 gene locus_tag LOCUS_23550 35132 35779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence035 <1 2108 gene locus_tag LOCUS_23560 <1 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193385014.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 2149 2733 gene locus_tag LOCUS_23570 gene pyrE 2149 2733 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919429.1 protein_id gnl|my_center|LOCUS_23570 2750 3373 gene locus_tag LOCUS_23580 2750 3373 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532587.1 protein_id gnl|my_center|LOCUS_23580 3370 4155 gene locus_tag LOCUS_23590 3370 4155 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389607.1 protein_id gnl|my_center|LOCUS_23590 4152 4553 gene locus_tag LOCUS_23600 gene acpS 4152 4553 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532586.1 protein_id gnl|my_center|LOCUS_23600 4639 5397 gene locus_tag LOCUS_23610 gene lepB 4639 5397 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087823.1 protein_id gnl|my_center|LOCUS_23610 5349 6059 gene locus_tag LOCUS_23620 gene rnc 5349 6059 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919434.1 protein_id gnl|my_center|LOCUS_23620 6107 7039 gene locus_tag LOCUS_23630 gene era 6107 7039 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240946.1 protein_id gnl|my_center|LOCUS_23630 7764 7042 gene locus_tag LOCUS_23640 gene arsH 7764 7042 CDS product arsenical resistance protein ArsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095191.1 protein_id gnl|my_center|LOCUS_23640 8191 7757 gene locus_tag LOCUS_23650 gene arsC 8191 7757 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_23650 8500 8204 gene locus_tag LOCUS_23660 8500 8204 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331458.1 protein_id gnl|my_center|LOCUS_23660 8684 9988 gene locus_tag LOCUS_23670 8684 9988 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388514.1 protein_id gnl|my_center|LOCUS_23670 9975 10703 gene locus_tag LOCUS_23680 gene recO 9975 10703 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532580.1 protein_id gnl|my_center|LOCUS_23680 10998 13244 gene locus_tag LOCUS_23690 gene parC 10998 13244 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532278.1 protein_id gnl|my_center|LOCUS_23690 13769 13278 gene locus_tag LOCUS_23700 13769 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 15349 13769 gene locus_tag LOCUS_23710 15349 13769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 15903 15364 gene locus_tag LOCUS_23720 15903 15364 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808109.1 protein_id gnl|my_center|LOCUS_23720 16985 15912 gene locus_tag LOCUS_23730 16985 15912 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389599.1 protein_id gnl|my_center|LOCUS_23730 17881 17135 gene locus_tag LOCUS_23740 17881 17135 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087800.1 protein_id gnl|my_center|LOCUS_23740 19774 17912 gene locus_tag LOCUS_23750 19774 17912 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_23750 20342 19860 gene locus_tag LOCUS_23760 20342 19860 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971440.1 protein_id gnl|my_center|LOCUS_23760 21329 20433 gene locus_tag LOCUS_23770 21329 20433 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919447.1 protein_id gnl|my_center|LOCUS_23770 22222 21359 gene locus_tag LOCUS_23780 gene motA 22222 21359 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389595.1 protein_id gnl|my_center|LOCUS_23780 22426 22992 gene locus_tag LOCUS_23790 22426 22992 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920136.1 protein_id gnl|my_center|LOCUS_23790 23492 22989 gene locus_tag LOCUS_23800 23492 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 23758 24537 gene locus_tag LOCUS_23810 23758 24537 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_23810 24560 24967 gene locus_tag LOCUS_23820 24560 24967 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_23820 24964 25368 gene locus_tag LOCUS_23830 24964 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 25365 26216 gene locus_tag LOCUS_23840 25365 26216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 26332 27201 gene locus_tag LOCUS_23850 26332 27201 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086521.1 protein_id gnl|my_center|LOCUS_23850 27198 28346 gene locus_tag LOCUS_23860 27198 28346 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918249.1 protein_id gnl|my_center|LOCUS_23860 28484 28942 gene locus_tag LOCUS_23870 28484 28942 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384710.1 protein_id gnl|my_center|LOCUS_23870 30049 29042 gene locus_tag LOCUS_23880 gene hemB 30049 29042 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966342.1 protein_id gnl|my_center|LOCUS_23880 30221 31360 gene locus_tag LOCUS_23890 30221 31360 CDS product isobutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640215.1 protein_id gnl|my_center|LOCUS_23890 31374 32414 gene locus_tag LOCUS_23900 31374 32414 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389587.1 protein_id gnl|my_center|LOCUS_23900 32435 33325 gene locus_tag LOCUS_23910 gene mmsB 32435 33325 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531206.1 protein_id gnl|my_center|LOCUS_23910 33467 33979 gene locus_tag LOCUS_23920 33467 33979 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087797.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence036 1738 590 gene locus_tag LOCUS_23930 gene lptF 1738 590 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086881.1 protein_id gnl|my_center|LOCUS_23930 1974 3467 gene locus_tag LOCUS_23940 1974 3467 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171097.1 protein_id gnl|my_center|LOCUS_23940 3478 3927 gene locus_tag LOCUS_23950 3478 3927 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969075.1 protein_id gnl|my_center|LOCUS_23950 4037 4972 gene locus_tag LOCUS_23960 4037 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 6893 4983 gene locus_tag LOCUS_23970 6893 4983 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971407.1 protein_id gnl|my_center|LOCUS_23970 6892 7413 gene locus_tag LOCUS_23980 gene ndk 6892 7413 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532476.1 protein_id gnl|my_center|LOCUS_23980 8113 7463 gene locus_tag LOCUS_23990 gene purN 8113 7463 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390017.1 protein_id gnl|my_center|LOCUS_23990 9201 8110 gene locus_tag LOCUS_24000 gene purM 9201 8110 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312859.1 protein_id gnl|my_center|LOCUS_24000 9384 10562 gene locus_tag LOCUS_24010 9384 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 10593 11690 gene locus_tag LOCUS_24020 10593 11690 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532443.1 protein_id gnl|my_center|LOCUS_24020 11693 12382 gene locus_tag LOCUS_24030 11693 12382 CDS product DnaA/Hda family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086897.1 protein_id gnl|my_center|LOCUS_24030 12459 14666 gene locus_tag LOCUS_24040 12459 14666 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171108.1 protein_id gnl|my_center|LOCUS_24040 14700 16196 gene locus_tag LOCUS_24050 gene ppx 14700 16196 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532415.1 protein_id gnl|my_center|LOCUS_24050 17359 16202 gene locus_tag LOCUS_24060 gene rnd 17359 16202 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_24060 17529 19352 gene locus_tag LOCUS_24070 gene aspS 17529 19352 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027038352.1 protein_id gnl|my_center|LOCUS_24070 19445 19891 gene locus_tag LOCUS_24080 19445 19891 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_24080 20431 19901 gene locus_tag LOCUS_24090 20431 19901 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338938.1 protein_id gnl|my_center|LOCUS_24090 21751 20519 gene locus_tag LOCUS_24100 21751 20519 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705373.1 protein_id gnl|my_center|LOCUS_24100 21957 23885 gene locus_tag LOCUS_24110 21957 23885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 28837 25097 gene locus_tag LOCUS_24120 28837 25097 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_24120 29239 29763 gene locus_tag LOCUS_24130 29239 29763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 29895 30293 gene locus_tag LOCUS_24140 29895 30293 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087052.1 protein_id gnl|my_center|LOCUS_24140 30338 30793 gene locus_tag LOCUS_24150 30338 30793 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390191.1 protein_id gnl|my_center|LOCUS_24150 30817 31251 gene locus_tag LOCUS_24160 30817 31251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 31904 31188 gene locus_tag LOCUS_24170 gene aat 31904 31188 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919751.1 protein_id gnl|my_center|LOCUS_24170 33294 31948 gene locus_tag LOCUS_24180 gene accC 33294 31948 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531357.1 protein_id gnl|my_center|LOCUS_24180 33764 33312 gene locus_tag LOCUS_24190 gene accB 33764 33312 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087064.1 protein_id gnl|my_center|LOCUS_24190 34339 33866 gene locus_tag LOCUS_24200 gene aroQ 34339 33866 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390186.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence037 730 305 gene locus_tag LOCUS_24210 gene rpoZ 730 305 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008133017.1 protein_id gnl|my_center|LOCUS_24210 1373 831 gene locus_tag LOCUS_24220 gene folK 1373 831 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389611.1 protein_id gnl|my_center|LOCUS_24220 1528 2154 gene locus_tag LOCUS_24230 1528 2154 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389612.1 protein_id gnl|my_center|LOCUS_24230 2158 2808 gene locus_tag LOCUS_24240 2158 2808 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_24240 3315 2818 gene locus_tag LOCUS_24250 gene smpB 3315 2818 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087830.1 protein_id gnl|my_center|LOCUS_24250 4212 3337 gene locus_tag LOCUS_24260 gene dapA 4212 3337 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171604.1 protein_id gnl|my_center|LOCUS_24260 4709 6781 gene locus_tag LOCUS_24270 4709 6781 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640172.1 protein_id gnl|my_center|LOCUS_24270 6869 7741 gene locus_tag LOCUS_24280 6869 7741 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923326.1 protein_id gnl|my_center|LOCUS_24280 8448 7738 gene locus_tag LOCUS_24290 8448 7738 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_24290 9528 8692 gene locus_tag LOCUS_24300 9528 8692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 10327 9518 gene locus_tag LOCUS_24310 10327 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 11827 10715 gene locus_tag LOCUS_24320 11827 10715 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403653.1 protein_id gnl|my_center|LOCUS_24320 12659 11901 gene locus_tag LOCUS_24330 12659 11901 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_24330 13373 12747 gene locus_tag LOCUS_24340 13373 12747 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461192.1 protein_id gnl|my_center|LOCUS_24340 13542 13450 gene locus_tag LOCUS_t00290 13542 13450 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14513 13620 gene locus_tag LOCUS_24350 gene tesB 14513 13620 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067256.1 protein_id gnl|my_center|LOCUS_24350 14978 14709 gene locus_tag LOCUS_24360 14978 14709 CDS product sel1 repeat family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532614.1 protein_id gnl|my_center|LOCUS_24360 15784 15152 gene locus_tag LOCUS_24370 15784 15152 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446421.1 protein_id gnl|my_center|LOCUS_24370 16263 15913 gene locus_tag LOCUS_24380 16263 15913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 17170 16376 gene locus_tag LOCUS_24390 17170 16376 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391247.1 protein_id gnl|my_center|LOCUS_24390 17725 17180 gene locus_tag LOCUS_24400 17725 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 19465 17945 gene locus_tag LOCUS_24410 gene gatB 19465 17945 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533056.1 protein_id gnl|my_center|LOCUS_24410 20946 19468 gene locus_tag LOCUS_24420 gene gatA 20946 19468 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975135.1 protein_id gnl|my_center|LOCUS_24420 21237 20950 gene locus_tag LOCUS_24430 gene gatC 21237 20950 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533050.1 protein_id gnl|my_center|LOCUS_24430 21377 21925 gene locus_tag LOCUS_24440 gene ruvX 21377 21925 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384481.1 protein_id gnl|my_center|LOCUS_24440 21959 22873 gene locus_tag LOCUS_24450 21959 22873 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_24450 23362 22928 gene locus_tag LOCUS_24460 23362 22928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 25061 23367 gene locus_tag LOCUS_24470 25061 23367 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114325.1 protein_id gnl|my_center|LOCUS_24470 25171 26154 gene locus_tag LOCUS_24480 25171 26154 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087859.1 protein_id gnl|my_center|LOCUS_24480 26151 27446 gene locus_tag LOCUS_24490 26151 27446 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171586.1 protein_id gnl|my_center|LOCUS_24490 27449 28096 gene locus_tag LOCUS_24500 gene plsY 27449 28096 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087861.1 protein_id gnl|my_center|LOCUS_24500 28102 29214 gene locus_tag LOCUS_24510 gene dprA 28102 29214 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087864.1 protein_id gnl|my_center|LOCUS_24510 29506 29222 gene locus_tag LOCUS_24520 29506 29222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 29873 32575 gene locus_tag LOCUS_24530 gene topA 29873 32575 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920309.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence038 438 1064 gene locus_tag LOCUS_24540 438 1064 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974635.1 protein_id gnl|my_center|LOCUS_24540 1500 1625 gene locus_tag LOCUS_24550 1500 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2661 1762 gene locus_tag LOCUS_24560 2661 1762 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189844.1 protein_id gnl|my_center|LOCUS_24560 3757 2675 gene locus_tag LOCUS_24570 gene tsaD 3757 2675 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626621.1 protein_id gnl|my_center|LOCUS_24570 3875 4801 gene locus_tag LOCUS_24580 gene hemC 3875 4801 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383712.1 protein_id gnl|my_center|LOCUS_24580 4805 5518 gene locus_tag LOCUS_24590 4805 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 5603 6892 gene locus_tag LOCUS_24600 5603 6892 CDS product COG4223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528910.1 protein_id gnl|my_center|LOCUS_24600 6898 8436 gene locus_tag LOCUS_24610 6898 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 8430 9431 gene locus_tag LOCUS_24620 8430 9431 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923351.1 protein_id gnl|my_center|LOCUS_24620 9532 9607 gene locus_tag LOCUS_t00300 9532 9607 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9709 11133 gene locus_tag LOCUS_24630 9709 11133 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948197.1 protein_id gnl|my_center|LOCUS_24630 11451 11275 gene locus_tag LOCUS_24640 11451 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 11663 12160 gene locus_tag LOCUS_24650 11663 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 12293 13165 gene locus_tag LOCUS_24660 12293 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 13162 14874 gene locus_tag LOCUS_24670 13162 14874 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966261.1 protein_id gnl|my_center|LOCUS_24670 15308 15826 gene locus_tag LOCUS_24680 15308 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 16180 18210 gene locus_tag LOCUS_24690 16180 18210 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093045.1 protein_id gnl|my_center|LOCUS_24690 18667 20007 gene locus_tag LOCUS_24700 18667 20007 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103009.1 protein_id gnl|my_center|LOCUS_24700 20344 21378 gene locus_tag LOCUS_24710 20344 21378 CDS product YCF48-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237280.1 protein_id gnl|my_center|LOCUS_24710 21532 22335 gene locus_tag LOCUS_24720 21532 22335 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815614.1 protein_id gnl|my_center|LOCUS_24720 22339 23526 gene locus_tag LOCUS_24730 22339 23526 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225722.1 protein_id gnl|my_center|LOCUS_24730 23543 24736 gene locus_tag LOCUS_24740 23543 24736 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222756.1 protein_id gnl|my_center|LOCUS_24740 24775 25560 gene locus_tag LOCUS_24750 24775 25560 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918135.1 protein_id gnl|my_center|LOCUS_24750 25615 26334 gene locus_tag LOCUS_24760 25615 26334 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972471.1 protein_id gnl|my_center|LOCUS_24760 26779 29922 gene locus_tag LOCUS_24770 26779 29922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 31209 29956 gene locus_tag LOCUS_24780 31209 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 31336 31689 gene locus_tag LOCUS_24790 31336 31689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence039 517 1257 gene locus_tag LOCUS_24800 517 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2604 1339 gene locus_tag LOCUS_24810 2604 1339 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_24810 2849 2601 gene locus_tag LOCUS_24820 2849 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 4030 2879 gene locus_tag LOCUS_24830 4030 2879 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036619.1 protein_id gnl|my_center|LOCUS_24830 4856 4068 gene locus_tag LOCUS_24840 4856 4068 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815612.1 protein_id gnl|my_center|LOCUS_24840 6024 4867 gene locus_tag LOCUS_24850 6024 4867 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_24850 6824 6033 gene locus_tag LOCUS_24860 gene menB 6824 6033 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_24860 7597 6836 gene locus_tag LOCUS_24870 7597 6836 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_24870 7765 8400 gene locus_tag LOCUS_24880 7765 8400 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808006.1 protein_id gnl|my_center|LOCUS_24880 8426 9292 gene locus_tag LOCUS_24890 8426 9292 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_24890 9326 10966 gene locus_tag LOCUS_24900 9326 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 11176 12441 gene locus_tag LOCUS_24910 11176 12441 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_24910 12530 12997 gene locus_tag LOCUS_24920 12530 12997 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808064.1 protein_id gnl|my_center|LOCUS_24920 14408 13656 gene locus_tag LOCUS_24930 14408 13656 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410047.1 protein_id gnl|my_center|LOCUS_24930 16077 14467 gene locus_tag LOCUS_24940 16077 14467 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_24940 16623 16234 gene locus_tag LOCUS_24950 16623 16234 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088090.1 protein_id gnl|my_center|LOCUS_24950 17795 16620 gene locus_tag LOCUS_24960 17795 16620 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967073.1 protein_id gnl|my_center|LOCUS_24960 20070 18220 gene locus_tag LOCUS_24970 20070 18220 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084153.1 protein_id gnl|my_center|LOCUS_24970 20762 20067 gene locus_tag LOCUS_24980 20762 20067 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_24980 21047 22213 gene locus_tag LOCUS_24990 21047 22213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 22192 23802 gene locus_tag LOCUS_25000 22192 23802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 25294 23702 gene locus_tag LOCUS_25010 25294 23702 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_25010 26477 25287 gene locus_tag LOCUS_25020 26477 25287 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067010.1 protein_id gnl|my_center|LOCUS_25020 26963 26481 gene locus_tag LOCUS_25030 26963 26481 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381003.1 protein_id gnl|my_center|LOCUS_25030 27108 27554 gene locus_tag LOCUS_25040 27108 27554 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199454.1 protein_id gnl|my_center|LOCUS_25040 28812 27682 gene locus_tag LOCUS_25050 28812 27682 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 protein_id gnl|my_center|LOCUS_25050 29494 29312 gene locus_tag LOCUS_25060 29494 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25060 29857 29781 gene locus_tag LOCUS_t00310 29857 29781 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 30100 29990 gene locus_tag LOCUS_r00010 30100 29990 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence040 1251 49 gene locus_tag LOCUS_25070 1251 49 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919408.1 protein_id gnl|my_center|LOCUS_25070 1702 1328 gene locus_tag LOCUS_25080 1702 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2325 1708 gene locus_tag LOCUS_25090 2325 1708 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201153.1 protein_id gnl|my_center|LOCUS_25090 2452 3963 gene locus_tag LOCUS_25100 2452 3963 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200631.1 protein_id gnl|my_center|LOCUS_25100 3973 4581 gene locus_tag LOCUS_25110 3973 4581 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090153.1 protein_id gnl|my_center|LOCUS_25110 4757 7048 gene locus_tag LOCUS_25120 4757 7048 CDS product marine proteobacterial sortase target protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083797.1 protein_id gnl|my_center|LOCUS_25120 7045 7644 gene locus_tag LOCUS_25130 7045 7644 CDS product class GN sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083796.1 protein_id gnl|my_center|LOCUS_25130 7825 8484 gene locus_tag LOCUS_25140 7825 8484 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504795.1 protein_id gnl|my_center|LOCUS_25140 8474 9100 gene locus_tag LOCUS_25150 8474 9100 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918803.1 protein_id gnl|my_center|LOCUS_25150 9888 9097 gene locus_tag LOCUS_25160 9888 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 10439 9885 gene locus_tag LOCUS_25170 10439 9885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 10494 10766 gene locus_tag LOCUS_25180 10494 10766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 10873 13197 gene locus_tag LOCUS_25190 10873 13197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 13966 13559 gene locus_tag LOCUS_25200 13966 13559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 14240 14028 gene locus_tag LOCUS_25210 14240 14028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 14139 14696 gene locus_tag LOCUS_25220 14139 14696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 15371 14763 gene locus_tag LOCUS_25230 15371 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 16686 15448 gene locus_tag LOCUS_25240 16686 15448 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969124.1 protein_id gnl|my_center|LOCUS_25240 16825 17178 gene locus_tag LOCUS_25250 16825 17178 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532197.1 protein_id gnl|my_center|LOCUS_25250 18972 17197 gene locus_tag LOCUS_25260 18972 17197 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921325.1 protein_id gnl|my_center|LOCUS_25260 19223 20281 gene locus_tag LOCUS_25270 19223 20281 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730062.1 protein_id gnl|my_center|LOCUS_25270 20292 21050 gene locus_tag LOCUS_25280 20292 21050 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_25280 21070 21477 gene locus_tag LOCUS_25290 21070 21477 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389874.1 protein_id gnl|my_center|LOCUS_25290 21779 23776 gene locus_tag LOCUS_25300 gene uvrC 21779 23776 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532481.1 protein_id gnl|my_center|LOCUS_25300 23849 24472 gene locus_tag LOCUS_25310 gene pgsA 23849 24472 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974979.1 protein_id gnl|my_center|LOCUS_25310 24469 24720 gene locus_tag LOCUS_25320 gene moaD 24469 24720 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532479.1 protein_id gnl|my_center|LOCUS_25320 24725 25171 gene locus_tag LOCUS_25330 24725 25171 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532478.1 protein_id gnl|my_center|LOCUS_25330 26245 25310 gene locus_tag LOCUS_25340 26245 25310 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530016.1 protein_id gnl|my_center|LOCUS_25340 26440 26964 gene locus_tag LOCUS_25350 26440 26964 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976372.1 protein_id gnl|my_center|LOCUS_25350 26979 27713 gene locus_tag LOCUS_25360 26979 27713 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530014.1 protein_id gnl|my_center|LOCUS_25360 27818 29125 gene locus_tag LOCUS_25370 27818 29125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090196.1 protein_id gnl|my_center|LOCUS_25370 29197 29568 gene locus_tag LOCUS_25380 29197 29568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 30194 29574 gene locus_tag LOCUS_25390 30194 29574 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918383.1 protein_id gnl|my_center|LOCUS_25390 >Feature sequence041 36 935 gene locus_tag LOCUS_25400 36 935 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_25400 1080 1238 gene locus_tag LOCUS_25410 1080 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 1310 2227 gene locus_tag LOCUS_25420 1310 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2665 2252 gene locus_tag LOCUS_25430 2665 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25430 3323 2718 gene locus_tag LOCUS_25440 3323 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25440 3562 4842 gene locus_tag LOCUS_25450 3562 4842 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121650680.1 protein_id gnl|my_center|LOCUS_25450 5779 4988 gene locus_tag LOCUS_25460 5779 4988 CDS product cell envelope integrity EipB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531768.1 protein_id gnl|my_center|LOCUS_25460 5893 6858 gene locus_tag LOCUS_25470 5893 6858 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389568.1 protein_id gnl|my_center|LOCUS_25470 7030 7752 gene locus_tag LOCUS_25480 7030 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 8797 7757 gene locus_tag LOCUS_25490 8797 7757 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356689.1 protein_id gnl|my_center|LOCUS_25490 8893 9360 gene locus_tag LOCUS_25500 8893 9360 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561623.1 protein_id gnl|my_center|LOCUS_25500 9388 10587 gene locus_tag LOCUS_25510 9388 10587 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969253.1 protein_id gnl|my_center|LOCUS_25510 10590 11009 gene locus_tag LOCUS_25520 10590 11009 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971569.1 protein_id gnl|my_center|LOCUS_25520 11069 12673 gene locus_tag LOCUS_25530 11069 12673 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965356.1 protein_id gnl|my_center|LOCUS_25530 12683 12907 gene locus_tag LOCUS_25540 12683 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 13339 12974 gene locus_tag LOCUS_25550 13339 12974 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265654.1 protein_id gnl|my_center|LOCUS_25550 15837 13453 gene locus_tag LOCUS_25560 gene clpA 15837 13453 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087911.1 protein_id gnl|my_center|LOCUS_25560 16217 15885 gene locus_tag LOCUS_25570 gene clpS 16217 15885 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535011.1 protein_id gnl|my_center|LOCUS_25570 16743 18386 gene locus_tag LOCUS_25580 16743 18386 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244600.1 protein_id gnl|my_center|LOCUS_25580 19235 18405 gene locus_tag LOCUS_25590 19235 18405 CDS product division plane positioning ATPase MipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721383.1 protein_id gnl|my_center|LOCUS_25590 19444 20811 gene locus_tag LOCUS_25600 19444 20811 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529682.1 protein_id gnl|my_center|LOCUS_25600 20808 22202 gene locus_tag LOCUS_25610 20808 22202 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_25610 22199 23377 gene locus_tag LOCUS_25620 22199 23377 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969773.1 protein_id gnl|my_center|LOCUS_25620 23787 23380 gene locus_tag LOCUS_25630 23787 23380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 23771 24637 gene locus_tag LOCUS_25640 gene panC 23771 24637 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626566.1 protein_id gnl|my_center|LOCUS_25640 25540 24647 gene locus_tag LOCUS_25650 25540 24647 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115256.1 protein_id gnl|my_center|LOCUS_25650 26048 25614 gene locus_tag LOCUS_25660 26048 25614 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087921.1 protein_id gnl|my_center|LOCUS_25660 28069 26045 gene locus_tag LOCUS_25670 28069 26045 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815954.1 protein_id gnl|my_center|LOCUS_25670 29673 28081 gene locus_tag LOCUS_25680 29673 28081 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence042 1042 1614 gene locus_tag LOCUS_25690 1042 1614 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_25690 1611 2354 gene locus_tag LOCUS_25700 1611 2354 CDS product ChrR family anti-sigma-E factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388479.1 protein_id gnl|my_center|LOCUS_25700 4452 2359 gene locus_tag LOCUS_25710 4452 2359 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085247.1 protein_id gnl|my_center|LOCUS_25710 4645 5460 gene locus_tag LOCUS_25720 gene ppk2 4645 5460 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_25720 5478 6821 gene locus_tag LOCUS_25730 5478 6821 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767135.1 protein_id gnl|my_center|LOCUS_25730 6818 7669 gene locus_tag LOCUS_25740 6818 7669 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971419.1 protein_id gnl|my_center|LOCUS_25740 7816 9117 gene locus_tag LOCUS_25750 7816 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 9495 9121 gene locus_tag LOCUS_25760 9495 9121 CDS product limonene-1,2-epoxide hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920798.1 protein_id gnl|my_center|LOCUS_25760 9818 9510 gene locus_tag LOCUS_25770 9818 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 10562 10179 gene locus_tag LOCUS_25780 10562 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 12556 11129 gene locus_tag LOCUS_25790 12556 11129 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918307.1 protein_id gnl|my_center|LOCUS_25790 12904 14490 gene locus_tag LOCUS_25800 12904 14490 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_25800 14499 15065 gene locus_tag LOCUS_25810 14499 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 16137 15385 gene locus_tag LOCUS_25820 gene mtgA 16137 15385 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387788.1 protein_id gnl|my_center|LOCUS_25820 16267 16506 gene locus_tag LOCUS_25830 16267 16506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 16654 17517 gene locus_tag LOCUS_25840 16654 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 18803 17514 gene locus_tag LOCUS_25850 18803 17514 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_25850 19059 18853 gene locus_tag LOCUS_25860 19059 18853 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088520.1 protein_id gnl|my_center|LOCUS_25860 19307 20233 gene locus_tag LOCUS_25870 19307 20233 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967177.1 protein_id gnl|my_center|LOCUS_25870 20230 23490 gene locus_tag LOCUS_25880 20230 23490 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088515.1 protein_id gnl|my_center|LOCUS_25880 23862 23545 gene locus_tag LOCUS_25890 23862 23545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 24206 23859 gene locus_tag LOCUS_25900 24206 23859 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_25900 24337 24600 gene locus_tag LOCUS_25910 24337 24600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 25363 24656 gene locus_tag LOCUS_25920 gene mtnC 25363 24656 CDS product acireductone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147428.1 protein_id gnl|my_center|LOCUS_25920 25914 25360 gene locus_tag LOCUS_25930 25914 25360 CDS product acireductone dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036989.1 protein_id gnl|my_center|LOCUS_25930 26525 25911 gene locus_tag LOCUS_25940 26525 25911 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036990.1 protein_id gnl|my_center|LOCUS_25940 26775 27827 gene locus_tag LOCUS_25950 26775 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 29532 27739 gene locus_tag LOCUS_25960 29532 27739 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209489743.1 protein_id gnl|my_center|LOCUS_25960 29789 29562 gene locus_tag LOCUS_25970 29789 29562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence043 <1 615 gene locus_tag LOCUS_25980 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920230.1:nitronate monooxygenase family protein 1065 622 gene locus_tag LOCUS_25990 1065 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 1356 1120 gene locus_tag LOCUS_26000 1356 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1510 1854 gene locus_tag LOCUS_26010 1510 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2996 1998 gene locus_tag LOCUS_26020 2996 1998 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205699.1 protein_id gnl|my_center|LOCUS_26020 3094 4023 gene locus_tag LOCUS_26030 3094 4023 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529142.1 protein_id gnl|my_center|LOCUS_26030 4098 5327 gene locus_tag LOCUS_26040 4098 5327 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389758.1 protein_id gnl|my_center|LOCUS_26040 5904 5338 gene locus_tag LOCUS_26050 5904 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 6628 6023 gene locus_tag LOCUS_26060 6628 6023 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626398.1 protein_id gnl|my_center|LOCUS_26060 8220 6724 gene locus_tag LOCUS_26070 8220 6724 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919385.1 protein_id gnl|my_center|LOCUS_26070 9025 8351 gene locus_tag LOCUS_26080 9025 8351 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530940.1 protein_id gnl|my_center|LOCUS_26080 10319 9027 gene locus_tag LOCUS_26090 10319 9027 CDS product DUF3419 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530941.1 protein_id gnl|my_center|LOCUS_26090 10585 12405 gene locus_tag LOCUS_26100 10585 12405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_26100 12402 14282 gene locus_tag LOCUS_26110 12402 14282 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_26110 14777 14286 gene locus_tag LOCUS_26120 14777 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 15058 15561 gene locus_tag LOCUS_26130 15058 15561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 15630 15986 gene locus_tag LOCUS_26140 15630 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 16498 15968 gene locus_tag LOCUS_26150 16498 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 18239 16605 gene locus_tag LOCUS_26160 18239 16605 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085722.1 protein_id gnl|my_center|LOCUS_26160 19929 18427 gene locus_tag LOCUS_26170 19929 18427 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919225.1 protein_id gnl|my_center|LOCUS_26170 20258 20184 gene locus_tag LOCUS_t00320 20258 20184 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20440 20516 gene locus_tag LOCUS_t00330 20440 20516 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20780 20604 gene locus_tag LOCUS_26180 20780 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 20888 21523 gene locus_tag LOCUS_26190 20888 21523 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531712.1 protein_id gnl|my_center|LOCUS_26190 21954 23936 gene locus_tag LOCUS_26200 21954 23936 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_26200 24854 24006 gene locus_tag LOCUS_26210 24854 24006 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083381.1 protein_id gnl|my_center|LOCUS_26210 24979 25377 gene locus_tag LOCUS_26220 24979 25377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 25461 27590 gene locus_tag LOCUS_26230 25461 27590 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265970.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence044 1426 3150 gene locus_tag LOCUS_26240 1426 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 3704 5599 gene locus_tag LOCUS_26250 3704 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 6341 6943 gene locus_tag LOCUS_26260 6341 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 7846 7097 gene locus_tag LOCUS_26270 7846 7097 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084097.1 protein_id gnl|my_center|LOCUS_26270 9458 8100 gene locus_tag LOCUS_26280 9458 8100 CDS product DUF1329 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091320.1 protein_id gnl|my_center|LOCUS_26280 11165 9492 gene locus_tag LOCUS_26290 11165 9492 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_26290 11919 11386 gene locus_tag LOCUS_26300 11919 11386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 12566 11916 gene locus_tag LOCUS_26310 12566 11916 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064537.1 protein_id gnl|my_center|LOCUS_26310 14583 12673 gene locus_tag LOCUS_26320 14583 12673 CDS product autotransporter domain-containing SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103197.1 protein_id gnl|my_center|LOCUS_26320 17426 14757 gene locus_tag LOCUS_26330 gene clpB 17426 14757 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084221.1 protein_id gnl|my_center|LOCUS_26330 17626 18393 gene locus_tag LOCUS_26340 17626 18393 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_26340 18631 18428 gene locus_tag LOCUS_26350 18631 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 19392 18769 gene locus_tag LOCUS_26360 19392 18769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 20734 19883 gene locus_tag LOCUS_26370 gene prmC 20734 19883 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083051.1 protein_id gnl|my_center|LOCUS_26370 21798 20731 gene locus_tag LOCUS_26380 gene prfA 21798 20731 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388508.1 protein_id gnl|my_center|LOCUS_26380 23031 21874 gene locus_tag LOCUS_26390 gene ispG 23031 21874 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918736.1 protein_id gnl|my_center|LOCUS_26390 24347 23190 gene locus_tag LOCUS_26400 24347 23190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 26894 24627 gene locus_tag LOCUS_26410 gene ptsP 26894 24627 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083049.1 protein_id gnl|my_center|LOCUS_26410 27176 26955 gene locus_tag LOCUS_26420 27176 26955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence045 1244 759 gene locus_tag LOCUS_26430 gene rpsI 1244 759 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532206.1 protein_id gnl|my_center|LOCUS_26430 1711 1247 gene locus_tag LOCUS_26440 gene rplM 1711 1247 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919253.1 protein_id gnl|my_center|LOCUS_26440 2432 1995 gene locus_tag LOCUS_26450 2432 1995 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975057.1 protein_id gnl|my_center|LOCUS_26450 2604 3152 gene locus_tag LOCUS_26460 2604 3152 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106016.1 protein_id gnl|my_center|LOCUS_26460 3349 4182 gene locus_tag LOCUS_26470 3349 4182 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 protein_id gnl|my_center|LOCUS_26470 4179 4613 gene locus_tag LOCUS_26480 4179 4613 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097249.1 protein_id gnl|my_center|LOCUS_26480 4848 6122 gene locus_tag LOCUS_26490 4848 6122 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969134.1 protein_id gnl|my_center|LOCUS_26490 7564 6530 gene locus_tag LOCUS_26500 7564 6530 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975052.1 protein_id gnl|my_center|LOCUS_26500 7723 7938 gene locus_tag LOCUS_26510 7723 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 8258 8182 gene locus_tag LOCUS_t00340 8258 8182 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8849 8382 gene locus_tag LOCUS_26520 8849 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 9239 8922 gene locus_tag LOCUS_26530 9239 8922 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389358.1 protein_id gnl|my_center|LOCUS_26530 10367 9390 gene locus_tag LOCUS_26540 10367 9390 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087781.1 protein_id gnl|my_center|LOCUS_26540 11443 10364 gene locus_tag LOCUS_26550 gene plsX 11443 10364 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024504675.1 protein_id gnl|my_center|LOCUS_26550 12118 11558 gene locus_tag LOCUS_26560 12118 11558 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389354.1 protein_id gnl|my_center|LOCUS_26560 12675 12118 gene locus_tag LOCUS_26570 12675 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 12793 13299 gene locus_tag LOCUS_26580 gene bamE 12793 13299 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171637.1 protein_id gnl|my_center|LOCUS_26580 15514 13397 gene locus_tag LOCUS_26590 15514 13397 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087787.1 protein_id gnl|my_center|LOCUS_26590 16688 15681 gene locus_tag LOCUS_26600 gene thiL 16688 15681 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389573.1 protein_id gnl|my_center|LOCUS_26600 17166 16666 gene locus_tag LOCUS_26610 gene nusB 17166 16666 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087789.1 protein_id gnl|my_center|LOCUS_26610 17659 17204 gene locus_tag LOCUS_26620 gene ribH 17659 17204 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975017.1 protein_id gnl|my_center|LOCUS_26620 18795 17656 gene locus_tag LOCUS_26630 gene ribB 18795 17656 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389576.1 protein_id gnl|my_center|LOCUS_26630 19427 18801 gene locus_tag LOCUS_26640 19427 18801 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_26640 20521 19430 gene locus_tag LOCUS_26650 gene ribD 20521 19430 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389578.1 protein_id gnl|my_center|LOCUS_26650 21102 20614 gene locus_tag LOCUS_26660 gene nrdR 21102 20614 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532250.1 protein_id gnl|my_center|LOCUS_26660 22466 21150 gene locus_tag LOCUS_26670 22466 21150 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389580.1 protein_id gnl|my_center|LOCUS_26670 22950 23399 gene locus_tag LOCUS_26680 22950 23399 CDS product MucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640101.1 protein_id gnl|my_center|LOCUS_26680 23695 23402 gene locus_tag LOCUS_26690 23695 23402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 24896 23685 gene locus_tag LOCUS_26700 gene hemA 24896 23685 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919232.1 protein_id gnl|my_center|LOCUS_26700 25808 25032 gene locus_tag LOCUS_26710 25808 25032 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence046 303 518 gene locus_tag LOCUS_26720 303 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 1745 546 gene locus_tag LOCUS_26730 1745 546 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_26730 3037 1838 gene locus_tag LOCUS_26740 3037 1838 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919187.1 protein_id gnl|my_center|LOCUS_26740 4227 3142 gene locus_tag LOCUS_26750 4227 3142 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_26750 5432 4239 gene locus_tag LOCUS_26760 5432 4239 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225678.1 protein_id gnl|my_center|LOCUS_26760 5893 5471 gene locus_tag LOCUS_26770 5893 5471 CDS product OB-fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965765.1 protein_id gnl|my_center|LOCUS_26770 7065 5896 gene locus_tag LOCUS_26780 7065 5896 CDS product lipid-transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419287.1 protein_id gnl|my_center|LOCUS_26780 8246 7152 gene locus_tag LOCUS_26790 8246 7152 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407690.1 protein_id gnl|my_center|LOCUS_26790 8395 8964 gene locus_tag LOCUS_26800 8395 8964 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086626.1 protein_id gnl|my_center|LOCUS_26800 9005 9853 gene locus_tag LOCUS_26810 9005 9853 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040692.1 protein_id gnl|my_center|LOCUS_26810 9872 11917 gene locus_tag LOCUS_26820 9872 11917 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031412.1 protein_id gnl|my_center|LOCUS_26820 11972 12811 gene locus_tag LOCUS_26830 11972 12811 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808642.1 protein_id gnl|my_center|LOCUS_26830 13705 12812 gene locus_tag LOCUS_26840 13705 12812 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390572.1 protein_id gnl|my_center|LOCUS_26840 15402 13720 gene locus_tag LOCUS_26850 15402 13720 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_26850 16564 15461 gene locus_tag LOCUS_26860 16564 15461 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228941.1 protein_id gnl|my_center|LOCUS_26860 16722 17534 gene locus_tag LOCUS_26870 16722 17534 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086373.1 protein_id gnl|my_center|LOCUS_26870 17574 18662 gene locus_tag LOCUS_26880 17574 18662 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730665.1 protein_id gnl|my_center|LOCUS_26880 18804 18995 gene locus_tag LOCUS_26890 18804 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 19482 19156 gene locus_tag LOCUS_26900 19482 19156 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_26900 20822 19569 gene locus_tag LOCUS_26910 20822 19569 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_26910 22465 20984 gene locus_tag LOCUS_26920 22465 20984 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089722.1 protein_id gnl|my_center|LOCUS_26920 22412 22609 gene locus_tag LOCUS_26930 22412 22609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 23190 22744 gene locus_tag LOCUS_26940 23190 22744 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086620.1 protein_id gnl|my_center|LOCUS_26940 24376 23243 gene locus_tag LOCUS_26950 24376 23243 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_26950 25169 24492 gene locus_tag LOCUS_26960 25169 24492 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence047 243 25 gene locus_tag LOCUS_26970 243 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 470 1810 gene locus_tag LOCUS_26980 470 1810 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970462.1 protein_id gnl|my_center|LOCUS_26980 1810 2520 gene locus_tag LOCUS_26990 1810 2520 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970460.1 protein_id gnl|my_center|LOCUS_26990 2606 4225 gene locus_tag LOCUS_27000 2606 4225 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918954.1 protein_id gnl|my_center|LOCUS_27000 4243 5385 gene locus_tag LOCUS_27010 4243 5385 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_27010 6598 5402 gene locus_tag LOCUS_27020 6598 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 7296 6595 gene locus_tag LOCUS_27030 7296 6595 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920512.1 protein_id gnl|my_center|LOCUS_27030 7392 8666 gene locus_tag LOCUS_27040 7392 8666 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389421.1 protein_id gnl|my_center|LOCUS_27040 8836 9210 gene locus_tag LOCUS_27050 8836 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 9852 9334 gene locus_tag LOCUS_27060 9852 9334 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919004.1 protein_id gnl|my_center|LOCUS_27060 11497 9839 gene locus_tag LOCUS_27070 11497 9839 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244652.1 protein_id gnl|my_center|LOCUS_27070 11869 11534 gene locus_tag LOCUS_27080 11869 11534 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529562.1 protein_id gnl|my_center|LOCUS_27080 12878 12078 gene locus_tag LOCUS_27090 12878 12078 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531128.1 protein_id gnl|my_center|LOCUS_27090 13636 12875 gene locus_tag LOCUS_27100 13636 12875 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_27100 14673 13633 gene locus_tag LOCUS_27110 14673 13633 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920485.1 protein_id gnl|my_center|LOCUS_27110 15284 14763 gene locus_tag LOCUS_27120 15284 14763 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064536.1 protein_id gnl|my_center|LOCUS_27120 15865 15281 gene locus_tag LOCUS_27130 15865 15281 CDS product DUF1214 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064537.1 protein_id gnl|my_center|LOCUS_27130 17840 16035 gene locus_tag LOCUS_27140 17840 16035 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388768.1 protein_id gnl|my_center|LOCUS_27140 19977 17914 gene locus_tag LOCUS_27150 19977 17914 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970655.1 protein_id gnl|my_center|LOCUS_27150 20151 20627 gene locus_tag LOCUS_27160 20151 20627 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327718.1 protein_id gnl|my_center|LOCUS_27160 20687 21073 gene locus_tag LOCUS_27170 20687 21073 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640534.1 protein_id gnl|my_center|LOCUS_27170 21190 22698 gene locus_tag LOCUS_27180 21190 22698 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626290.1 protein_id gnl|my_center|LOCUS_27180 23166 22705 gene locus_tag LOCUS_27190 23166 22705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence048 211 2049 gene locus_tag LOCUS_27200 211 2049 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086638.1 protein_id gnl|my_center|LOCUS_27200 2164 2237 gene locus_tag LOCUS_t00350 2164 2237 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2408 3706 gene locus_tag LOCUS_27210 2408 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27210 3703 4455 gene locus_tag LOCUS_27220 3703 4455 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532288.1 protein_id gnl|my_center|LOCUS_27220 4568 6031 gene locus_tag LOCUS_27230 gene guaB 4568 6031 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241867.1 protein_id gnl|my_center|LOCUS_27230 6060 7352 gene locus_tag LOCUS_27240 6060 7352 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387996.1 protein_id gnl|my_center|LOCUS_27240 7472 7936 gene locus_tag LOCUS_27250 7472 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 7944 9494 gene locus_tag LOCUS_27260 gene guaA 7944 9494 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_27260 9942 9673 gene locus_tag LOCUS_27270 9942 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 9859 10509 gene locus_tag LOCUS_27280 9859 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 10794 11621 gene locus_tag LOCUS_27290 10794 11621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 12853 11645 gene locus_tag LOCUS_27300 12853 11645 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088242.1 protein_id gnl|my_center|LOCUS_27300 14865 13003 gene locus_tag LOCUS_27310 gene ilvD 14865 13003 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970221.1 protein_id gnl|my_center|LOCUS_27310 15167 15919 gene locus_tag LOCUS_27320 15167 15919 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038724.1 protein_id gnl|my_center|LOCUS_27320 15946 16713 gene locus_tag LOCUS_27330 15946 16713 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970229.1 protein_id gnl|my_center|LOCUS_27330 17733 16714 gene locus_tag LOCUS_27340 17733 16714 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_27340 18354 17839 gene locus_tag LOCUS_27350 18354 17839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 18525 19793 gene locus_tag LOCUS_27360 gene yjiB 18525 19793 CDS product monooxygenase YjiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232789.1 protein_id gnl|my_center|LOCUS_27360 19790 20215 gene locus_tag LOCUS_27370 19790 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 20265 20798 gene locus_tag LOCUS_27380 20265 20798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 20795 21547 gene locus_tag LOCUS_27390 20795 21547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 21642 22547 gene locus_tag LOCUS_27400 21642 22547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence049 1679 813 gene locus_tag LOCUS_27410 1679 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 2203 1712 gene locus_tag LOCUS_27420 2203 1712 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391514.1 protein_id gnl|my_center|LOCUS_27420 2784 2290 gene locus_tag LOCUS_27430 2784 2290 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974253.1 protein_id gnl|my_center|LOCUS_27430 3482 2787 gene locus_tag LOCUS_27440 gene tsaB 3482 2787 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083621.1 protein_id gnl|my_center|LOCUS_27440 4103 3510 gene locus_tag LOCUS_27450 4103 3510 CDS product malonic semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097197.1 protein_id gnl|my_center|LOCUS_27450 4766 4209 gene locus_tag LOCUS_27460 4766 4209 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_27460 5374 4868 gene locus_tag LOCUS_27470 5374 4868 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974250.1 protein_id gnl|my_center|LOCUS_27470 6500 5427 gene locus_tag LOCUS_27480 6500 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7603 6596 gene locus_tag LOCUS_27490 gene trpS 7603 6596 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083624.1 protein_id gnl|my_center|LOCUS_27490 9474 7933 gene locus_tag LOCUS_27500 gene murJ 9474 7933 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391285.1 protein_id gnl|my_center|LOCUS_27500 12384 9598 gene locus_tag LOCUS_27510 12384 9598 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528060.1 protein_id gnl|my_center|LOCUS_27510 12694 13002 gene locus_tag LOCUS_27520 12694 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 13150 13896 gene locus_tag LOCUS_27530 13150 13896 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 protein_id gnl|my_center|LOCUS_27530 14323 13919 gene locus_tag LOCUS_27540 14323 13919 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110101.1 protein_id gnl|my_center|LOCUS_27540 17112 14320 gene locus_tag LOCUS_27550 gene mutS 17112 14320 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391288.1 protein_id gnl|my_center|LOCUS_27550 17357 19621 gene locus_tag LOCUS_27560 17357 19621 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327060.1 protein_id gnl|my_center|LOCUS_27560 20561 19677 gene locus_tag LOCUS_27570 20561 19677 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241556.1 protein_id gnl|my_center|LOCUS_27570 22286 20847 gene locus_tag LOCUS_27580 22286 20847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_27580 <22923 22346 gene locus_tag LOCUS_27590 <22923 22346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965129.1:ATP-binding protein >Feature sequence050 <1 960 gene locus_tag LOCUS_27600 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530957.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase 960 2447 gene locus_tag LOCUS_27610 gene murC 960 2447 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388704.1 protein_id gnl|my_center|LOCUS_27610 2450 3376 gene locus_tag LOCUS_27620 gene murB 2450 3376 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388703.1 protein_id gnl|my_center|LOCUS_27620 3373 4302 gene locus_tag LOCUS_27630 3373 4302 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969744.1 protein_id gnl|my_center|LOCUS_27630 4290 5306 gene locus_tag LOCUS_27640 4290 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 5303 6613 gene locus_tag LOCUS_27650 gene ftsA 5303 6613 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388700.1 protein_id gnl|my_center|LOCUS_27650 6765 8456 gene locus_tag LOCUS_27660 gene ftsZ 6765 8456 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920397.1 protein_id gnl|my_center|LOCUS_27660 8701 9693 gene locus_tag LOCUS_27670 gene lpxC 8701 9693 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037386944.1 protein_id gnl|my_center|LOCUS_27670 9926 10780 gene locus_tag LOCUS_27680 9926 10780 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388696.1 protein_id gnl|my_center|LOCUS_27680 10811 12499 gene locus_tag LOCUS_27690 gene recN 10811 12499 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089333.1 protein_id gnl|my_center|LOCUS_27690 12496 14652 gene locus_tag LOCUS_27700 gene ligA 12496 14652 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969738.1 protein_id gnl|my_center|LOCUS_27700 14741 15946 gene locus_tag LOCUS_27710 14741 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 17768 15954 gene locus_tag LOCUS_27720 17768 15954 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530971.1 protein_id gnl|my_center|LOCUS_27720 18299 17811 gene locus_tag LOCUS_27730 18299 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 19234 18302 gene locus_tag LOCUS_27740 19234 18302 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561968.1 protein_id gnl|my_center|LOCUS_27740 <21402 19242 gene locus_tag LOCUS_27750 <21402 19242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972026.1:UvrD-helicase domain-containing protein >Feature sequence051 528 1313 gene locus_tag LOCUS_27760 gene xth 528 1313 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967248.1 protein_id gnl|my_center|LOCUS_27760 2324 1422 gene locus_tag LOCUS_27770 2324 1422 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812185.1 protein_id gnl|my_center|LOCUS_27770 2658 2987 gene locus_tag LOCUS_27780 2658 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 3070 3846 gene locus_tag LOCUS_27790 gene blaOXA 3070 3846 CDS product oxacillin-hydrolyzing class D beta-lactamase OXA-50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099707.1 protein_id gnl|my_center|LOCUS_27790 5365 3854 gene locus_tag LOCUS_27800 5365 3854 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088347.1 protein_id gnl|my_center|LOCUS_27800 5628 6011 gene locus_tag LOCUS_27810 5628 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 6770 6015 gene locus_tag LOCUS_27820 6770 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 8596 6866 gene locus_tag LOCUS_27830 gene ilvD 8596 6866 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531283.1 protein_id gnl|my_center|LOCUS_27830 8821 9906 gene locus_tag LOCUS_27840 8821 9906 CDS product Zn-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920865.1 protein_id gnl|my_center|LOCUS_27840 10034 10273 gene locus_tag LOCUS_27850 10034 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 13006 10277 gene locus_tag LOCUS_27860 13006 10277 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919197.1 protein_id gnl|my_center|LOCUS_27860 13879 13148 gene locus_tag LOCUS_27870 13879 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 15420 14023 gene locus_tag LOCUS_27880 15420 14023 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626249.1 protein_id gnl|my_center|LOCUS_27880 16272 15571 gene locus_tag LOCUS_27890 16272 15571 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389552.1 protein_id gnl|my_center|LOCUS_27890 16479 16552 gene locus_tag LOCUS_t00360 16479 16552 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17934 16612 gene locus_tag LOCUS_27900 17934 16612 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240811.1 protein_id gnl|my_center|LOCUS_27900 19139 17937 gene locus_tag LOCUS_27910 19139 17937 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087736.1 protein_id gnl|my_center|LOCUS_27910 19699 19139 gene locus_tag LOCUS_27920 19699 19139 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975047.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence052 1090 887 gene locus_tag LOCUS_27930 1090 887 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008874821.1 protein_id gnl|my_center|LOCUS_27930 1719 1303 gene locus_tag LOCUS_27940 1719 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 2025 1786 gene locus_tag LOCUS_27950 2025 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 3026 2127 gene locus_tag LOCUS_27960 3026 2127 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807174.1 protein_id gnl|my_center|LOCUS_27960 3778 3110 gene locus_tag LOCUS_27970 3778 3110 CDS product DUF1007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389507.1 protein_id gnl|my_center|LOCUS_27970 4974 3835 gene locus_tag LOCUS_27980 4974 3835 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_27980 6256 5057 gene locus_tag LOCUS_27990 6256 5057 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919912.1 protein_id gnl|my_center|LOCUS_27990 8006 6396 gene locus_tag LOCUS_28000 8006 6396 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640335.1 protein_id gnl|my_center|LOCUS_28000 9043 8144 gene locus_tag LOCUS_28010 9043 8144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 9753 9130 gene locus_tag LOCUS_28020 9753 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 9904 10515 gene locus_tag LOCUS_28030 9904 10515 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085162530.1 protein_id gnl|my_center|LOCUS_28030 10649 10954 gene locus_tag LOCUS_28040 10649 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 12057 10921 gene locus_tag LOCUS_28050 12057 10921 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923292.1 protein_id gnl|my_center|LOCUS_28050 12221 13060 gene locus_tag LOCUS_28060 12221 13060 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_28060 13642 13136 gene locus_tag LOCUS_28070 13642 13136 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_28070 14205 13639 gene locus_tag LOCUS_28080 14205 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 14714 14217 gene locus_tag LOCUS_28090 14714 14217 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088265.1 protein_id gnl|my_center|LOCUS_28090 15764 14892 gene locus_tag LOCUS_28100 15764 14892 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971751.1 protein_id gnl|my_center|LOCUS_28100 16643 15852 gene locus_tag LOCUS_28110 16643 15852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 16773 17249 gene locus_tag LOCUS_28120 16773 17249 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972183.1 protein_id gnl|my_center|LOCUS_28120 17322 17690 gene locus_tag LOCUS_28130 17322 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 18707 17694 gene locus_tag LOCUS_28140 18707 17694 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969887.1 protein_id gnl|my_center|LOCUS_28140 19482 18772 gene locus_tag LOCUS_28150 19482 18772 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919348.1 protein_id gnl|my_center|LOCUS_28150 20225 19614 gene locus_tag LOCUS_28160 gene wrbA 20225 19614 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816244.1 protein_id gnl|my_center|LOCUS_28160 >Feature sequence053 1997 975 gene locus_tag LOCUS_28170 1997 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927783.1 protein_id gnl|my_center|LOCUS_28170 2669 2037 gene locus_tag LOCUS_28180 2669 2037 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140910.1 protein_id gnl|my_center|LOCUS_28180 3359 2673 gene locus_tag LOCUS_28190 3359 2673 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031152.1 protein_id gnl|my_center|LOCUS_28190 4410 3334 gene locus_tag LOCUS_28200 4410 3334 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031151.1 protein_id gnl|my_center|LOCUS_28200 4994 6820 gene locus_tag LOCUS_28210 4994 6820 CDS product DUF1302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102337.1 protein_id gnl|my_center|LOCUS_28210 9282 7030 gene locus_tag LOCUS_28220 9282 7030 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_28220 10497 9292 gene locus_tag LOCUS_28230 10497 9292 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917966.1 protein_id gnl|my_center|LOCUS_28230 11702 10545 gene locus_tag LOCUS_28240 11702 10545 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917968.1 protein_id gnl|my_center|LOCUS_28240 13521 11728 gene locus_tag LOCUS_28250 13521 11728 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_28250 14096 13575 gene locus_tag LOCUS_28260 14096 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 14323 14886 gene locus_tag LOCUS_28270 14323 14886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 14964 16046 gene locus_tag LOCUS_28280 gene dctP 14964 16046 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_28280 15986 16210 gene locus_tag LOCUS_28290 15986 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 >Feature sequence054 <1 1158 gene locus_tag LOCUS_28300 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992430.1:polysaccharide biosynthesis tyrosine autokinase 2086 1178 gene locus_tag LOCUS_28310 2086 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 3356 2070 gene locus_tag LOCUS_28320 3356 2070 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529437.1 protein_id gnl|my_center|LOCUS_28320 4741 3353 gene locus_tag LOCUS_28330 gene uppV 4741 3353 CDS product Wzx-type polysaccharide biosynthesis protein UppV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973111.1 protein_id gnl|my_center|LOCUS_28330 6021 4753 gene locus_tag LOCUS_28340 6021 4753 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532217.1 protein_id gnl|my_center|LOCUS_28340 6168 7247 gene locus_tag LOCUS_28350 6168 7247 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_28350 7502 7251 gene locus_tag LOCUS_28360 7502 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 7666 7740 gene locus_tag LOCUS_t00370 7666 7740 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7877 8233 gene locus_tag LOCUS_28370 7877 8233 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808563.1 protein_id gnl|my_center|LOCUS_28370 8345 9613 gene locus_tag LOCUS_28380 8345 9613 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640238.1 protein_id gnl|my_center|LOCUS_28380 9668 10282 gene locus_tag LOCUS_28390 9668 10282 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095694.1 protein_id gnl|my_center|LOCUS_28390 10378 11376 gene locus_tag LOCUS_28400 10378 11376 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531459.1 protein_id gnl|my_center|LOCUS_28400 11387 12232 gene locus_tag LOCUS_28410 gene sseA 11387 12232 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_28410 12252 12770 gene locus_tag LOCUS_28420 12252 12770 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531462.1 protein_id gnl|my_center|LOCUS_28420 13557 12781 gene locus_tag LOCUS_28430 13557 12781 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066874280.1 protein_id gnl|my_center|LOCUS_28430 14680 13568 gene locus_tag LOCUS_28440 14680 13568 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_28440 15883 14684 gene locus_tag LOCUS_28450 15883 14684 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 protein_id gnl|my_center|LOCUS_28450 16990 15890 gene locus_tag LOCUS_28460 16990 15890 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087218.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence055 2711 474 gene locus_tag LOCUS_28470 gene pnp 2711 474 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970644.1 protein_id gnl|my_center|LOCUS_28470 3247 2978 gene locus_tag LOCUS_28480 gene rpsO 3247 2978 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710040.1 protein_id gnl|my_center|LOCUS_28480 4182 3259 gene locus_tag LOCUS_28490 gene truB 4182 3259 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172518.1 protein_id gnl|my_center|LOCUS_28490 4609 4187 gene locus_tag LOCUS_28500 gene rbfA 4609 4187 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067640.1 protein_id gnl|my_center|LOCUS_28500 7301 4680 gene locus_tag LOCUS_28510 gene infB 7301 4680 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037436934.1 protein_id gnl|my_center|LOCUS_28510 7984 7334 gene locus_tag LOCUS_28520 7984 7334 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083606.1 protein_id gnl|my_center|LOCUS_28520 9581 7962 gene locus_tag LOCUS_28530 gene nusA 9581 7962 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968444.1 protein_id gnl|my_center|LOCUS_28530 10211 9585 gene locus_tag LOCUS_28540 gene rimP 10211 9585 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538041.1 protein_id gnl|my_center|LOCUS_28540 11065 10355 gene locus_tag LOCUS_28550 11065 10355 CDS product tRNA (guanosine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399664.1 protein_id gnl|my_center|LOCUS_28550 12249 11080 gene locus_tag LOCUS_28560 gene metK 12249 11080 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391523.1 protein_id gnl|my_center|LOCUS_28560 12902 12459 gene locus_tag LOCUS_28570 12902 12459 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970843.1 protein_id gnl|my_center|LOCUS_28570 14700 13027 gene locus_tag LOCUS_28580 gene lnt 14700 13027 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083613.1 protein_id gnl|my_center|LOCUS_28580 15496 14705 gene locus_tag LOCUS_28590 15496 14705 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917943.1 protein_id gnl|my_center|LOCUS_28590 15464 15607 gene locus_tag LOCUS_28600 15464 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 16229 15672 gene locus_tag LOCUS_28610 gene ybeY 16229 15672 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527905.1 protein_id gnl|my_center|LOCUS_28610 17257 16226 gene locus_tag LOCUS_28620 17257 16226 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527679.1 protein_id gnl|my_center|LOCUS_28620 <18013 17310 gene locus_tag LOCUS_28630 <18013 17310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639867.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence056 1282 1626 gene locus_tag LOCUS_28640 1282 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 2663 2172 gene locus_tag LOCUS_28650 2663 2172 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037275395.1 protein_id gnl|my_center|LOCUS_28650 2998 2666 gene locus_tag LOCUS_28660 2998 2666 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212347691.1 protein_id gnl|my_center|LOCUS_28660 3389 3703 gene locus_tag LOCUS_28670 3389 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 3908 5053 gene locus_tag LOCUS_28680 3908 5053 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_28680 5050 6123 gene locus_tag LOCUS_28690 5050 6123 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_28690 6136 9315 gene locus_tag LOCUS_28700 6136 9315 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_28700 9312 9449 gene locus_tag LOCUS_28710 9312 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 10224 9553 gene locus_tag LOCUS_28720 10224 9553 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_28720 10745 10221 gene locus_tag LOCUS_28730 10745 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 10903 11259 gene locus_tag LOCUS_28740 10903 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970716.1 protein_id gnl|my_center|LOCUS_28740 11256 11843 gene locus_tag LOCUS_28750 11256 11843 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970715.1 protein_id gnl|my_center|LOCUS_28750 12364 13104 gene locus_tag LOCUS_28760 12364 13104 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719585.1 protein_id gnl|my_center|LOCUS_28760 13315 14367 gene locus_tag LOCUS_28770 13315 14367 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_28770 14631 14876 gene locus_tag LOCUS_28780 14631 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 15008 17278 gene locus_tag LOCUS_28790 15008 17278 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086677.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence057 1147 542 gene locus_tag LOCUS_28800 1147 542 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_28800 1546 3339 gene locus_tag LOCUS_28810 1546 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041170069.1 protein_id gnl|my_center|LOCUS_28810 5361 3382 gene locus_tag LOCUS_28820 5361 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 6040 5384 gene locus_tag LOCUS_28830 6040 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 7204 6170 gene locus_tag LOCUS_28840 7204 6170 CDS product mitochondrial fission ELM1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389733.1 protein_id gnl|my_center|LOCUS_28840 7300 7788 gene locus_tag LOCUS_28850 7300 7788 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537554.1 protein_id gnl|my_center|LOCUS_28850 8269 7796 gene locus_tag LOCUS_28860 gene greA 8269 7796 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090113.1 protein_id gnl|my_center|LOCUS_28860 11704 8465 gene locus_tag LOCUS_28870 gene carB 11704 8465 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920738.1 protein_id gnl|my_center|LOCUS_28870 12871 11708 gene locus_tag LOCUS_28880 gene carA 12871 11708 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090106.1 protein_id gnl|my_center|LOCUS_28880 13294 13758 gene locus_tag LOCUS_28890 13294 13758 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390634.1 protein_id gnl|my_center|LOCUS_28890 13830 15755 gene locus_tag LOCUS_28900 gene dnaG 13830 15755 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530148.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence058 <1 792 gene locus_tag LOCUS_28910 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337020.1:S-methyl-5'-thioadenosine phosphorylase 808 1335 gene locus_tag LOCUS_28920 808 1335 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383583.1 protein_id gnl|my_center|LOCUS_28920 1427 2524 gene locus_tag LOCUS_28930 gene mtnA 1427 2524 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083782.1 protein_id gnl|my_center|LOCUS_28930 2517 3167 gene locus_tag LOCUS_28940 2517 3167 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388112.1 protein_id gnl|my_center|LOCUS_28940 3888 3394 gene locus_tag LOCUS_28950 3888 3394 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389616.1 protein_id gnl|my_center|LOCUS_28950 4776 4099 gene locus_tag LOCUS_28960 4776 4099 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_28960 5278 4796 gene locus_tag LOCUS_28970 5278 4796 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090171.1 protein_id gnl|my_center|LOCUS_28970 5763 5281 gene locus_tag LOCUS_28980 5763 5281 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529991.1 protein_id gnl|my_center|LOCUS_28980 7106 5997 gene locus_tag LOCUS_28990 gene ychF 7106 5997 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_28990 7733 7131 gene locus_tag LOCUS_29000 gene pth 7733 7131 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090174.1 protein_id gnl|my_center|LOCUS_29000 8416 7760 gene locus_tag LOCUS_29010 8416 7760 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529995.1 protein_id gnl|my_center|LOCUS_29010 9504 8569 gene locus_tag LOCUS_29020 9504 8569 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242730.1 protein_id gnl|my_center|LOCUS_29020 10625 9501 gene locus_tag LOCUS_29030 10625 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 11538 10771 gene locus_tag LOCUS_29040 gene pgeF 11538 10771 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396732.1 protein_id gnl|my_center|LOCUS_29040 12626 11550 gene locus_tag LOCUS_29050 12626 11550 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090179.1 protein_id gnl|my_center|LOCUS_29050 13453 12623 gene locus_tag LOCUS_29060 gene lgt 13453 12623 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530007.1 protein_id gnl|my_center|LOCUS_29060 14911 13580 gene locus_tag LOCUS_29070 14911 13580 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265494.1 protein_id gnl|my_center|LOCUS_29070 15663 14938 gene locus_tag LOCUS_29080 15663 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 15808 16146 gene locus_tag LOCUS_29090 15808 16146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 16329 16832 gene locus_tag LOCUS_29100 16329 16832 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174670.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence059 321 124 gene locus_tag LOCUS_29110 321 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 437 982 gene locus_tag LOCUS_29120 437 982 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186620.1 protein_id gnl|my_center|LOCUS_29120 1765 986 gene locus_tag LOCUS_29130 1765 986 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337170.1 protein_id gnl|my_center|LOCUS_29130 2085 1762 gene locus_tag LOCUS_29140 2085 1762 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719181.1 protein_id gnl|my_center|LOCUS_29140 2208 3122 gene locus_tag LOCUS_29150 2208 3122 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967856.1 protein_id gnl|my_center|LOCUS_29150 4160 3201 gene locus_tag LOCUS_29160 4160 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 4547 5218 gene locus_tag LOCUS_29170 4547 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 6964 5318 gene locus_tag LOCUS_29180 6964 5318 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920494.1 protein_id gnl|my_center|LOCUS_29180 7303 7902 gene locus_tag LOCUS_29190 7303 7902 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028176079.1 protein_id gnl|my_center|LOCUS_29190 8009 8716 gene locus_tag LOCUS_29200 8009 8716 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087759.1 protein_id gnl|my_center|LOCUS_29200 9029 9841 gene locus_tag LOCUS_29210 9029 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 10734 9961 gene locus_tag LOCUS_29220 10734 9961 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921431.1 protein_id gnl|my_center|LOCUS_29220 10924 11706 gene locus_tag LOCUS_29230 10924 11706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 11901 12332 gene locus_tag LOCUS_29240 11901 12332 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_29240 13530 12337 gene locus_tag LOCUS_29250 13530 12337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 14394 13570 gene locus_tag LOCUS_29260 14394 13570 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965766.1 protein_id gnl|my_center|LOCUS_29260 14959 14498 gene locus_tag LOCUS_29270 14959 14498 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087183.1 protein_id gnl|my_center|LOCUS_29270 15489 14959 gene locus_tag LOCUS_29280 15489 14959 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920495.1 protein_id gnl|my_center|LOCUS_29280 >Feature sequence060 1758 2759 gene locus_tag LOCUS_29290 gene trpS 1758 2759 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116097.1 protein_id gnl|my_center|LOCUS_29290 3745 2921 gene locus_tag LOCUS_29300 3745 2921 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975986.1 protein_id gnl|my_center|LOCUS_29300 4729 3980 gene locus_tag LOCUS_29310 4729 3980 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970631.1 protein_id gnl|my_center|LOCUS_29310 6464 4893 gene locus_tag LOCUS_29320 6464 4893 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982172.1 protein_id gnl|my_center|LOCUS_29320 7501 6467 gene locus_tag LOCUS_29330 7501 6467 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109982281.1 protein_id gnl|my_center|LOCUS_29330 7966 9177 gene locus_tag LOCUS_29340 7966 9177 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085576.1 protein_id gnl|my_center|LOCUS_29340 10066 9365 gene locus_tag LOCUS_29350 10066 9365 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243804.1 protein_id gnl|my_center|LOCUS_29350 10445 10056 gene locus_tag LOCUS_29360 10445 10056 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254403.1 protein_id gnl|my_center|LOCUS_29360 11089 10442 gene locus_tag LOCUS_29370 11089 10442 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243806.1 protein_id gnl|my_center|LOCUS_29370 13794 11086 gene locus_tag LOCUS_29380 13794 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 14150 15070 gene locus_tag LOCUS_29390 14150 15070 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174779.1 protein_id gnl|my_center|LOCUS_29390 15818 15387 gene locus_tag LOCUS_29400 15818 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 15705 16385 gene locus_tag LOCUS_29410 15705 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 >Feature sequence061 1492 521 gene locus_tag LOCUS_29420 1492 521 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089112.1 protein_id gnl|my_center|LOCUS_29420 1793 2314 gene locus_tag LOCUS_29430 1793 2314 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085246.1 protein_id gnl|my_center|LOCUS_29430 3338 2325 gene locus_tag LOCUS_29440 3338 2325 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064717.1 protein_id gnl|my_center|LOCUS_29440 4220 3351 gene locus_tag LOCUS_29450 4220 3351 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003376994.1 protein_id gnl|my_center|LOCUS_29450 4933 4217 gene locus_tag LOCUS_29460 gene aztA 4933 4217 CDS product zinc ABC transporter ATP-binding protein AztA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267626.1 protein_id gnl|my_center|LOCUS_29460 5061 4933 gene locus_tag LOCUS_29470 5061 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 7225 5150 gene locus_tag LOCUS_29480 7225 5150 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085249.1 protein_id gnl|my_center|LOCUS_29480 10042 7235 gene locus_tag LOCUS_29490 10042 7235 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085250.1 protein_id gnl|my_center|LOCUS_29490 10993 10052 gene locus_tag LOCUS_29500 10993 10052 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388123.1 protein_id gnl|my_center|LOCUS_29500 12004 11006 gene locus_tag LOCUS_29510 12004 11006 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625927.1 protein_id gnl|my_center|LOCUS_29510 12168 12803 gene locus_tag LOCUS_29520 12168 12803 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408288.1 protein_id gnl|my_center|LOCUS_29520 12814 13482 gene locus_tag LOCUS_29530 12814 13482 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918295.1 protein_id gnl|my_center|LOCUS_29530 13583 14833 gene locus_tag LOCUS_29540 13583 14833 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265544.1 protein_id gnl|my_center|LOCUS_29540 14874 15443 gene locus_tag LOCUS_29550 14874 15443 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816019.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence062 593 2158 gene locus_tag LOCUS_29560 593 2158 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_29560 2451 2167 gene locus_tag LOCUS_29570 2451 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 2639 3526 gene locus_tag LOCUS_29580 2639 3526 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109433.1 protein_id gnl|my_center|LOCUS_29580 4297 3530 gene locus_tag LOCUS_29590 4297 3530 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528280.1 protein_id gnl|my_center|LOCUS_29590 5166 4891 gene locus_tag LOCUS_29600 5166 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 6642 6049 gene locus_tag LOCUS_29610 6642 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 7886 9487 gene locus_tag LOCUS_29620 7886 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 10083 9736 gene locus_tag LOCUS_29630 10083 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 10268 10636 gene locus_tag LOCUS_29640 10268 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 10629 12140 gene locus_tag LOCUS_29650 10629 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 12717 12388 gene locus_tag LOCUS_29660 12717 12388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 14378 12966 gene locus_tag LOCUS_29670 14378 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 14803 14375 gene locus_tag LOCUS_29680 14803 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 15321 15091 gene locus_tag LOCUS_29690 15321 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 15464 15709 gene locus_tag LOCUS_29700 15464 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 15940 16701 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggctggtcctcgatctctaagcggctaaact >Feature sequence063 128 1336 gene locus_tag LOCUS_29710 128 1336 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389533.1 protein_id gnl|my_center|LOCUS_29710 1440 3191 gene locus_tag LOCUS_29720 gene argS 1440 3191 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_29720 3191 4048 gene locus_tag LOCUS_29730 3191 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 4045 5076 gene locus_tag LOCUS_29740 gene nagZ 4045 5076 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640386.1 protein_id gnl|my_center|LOCUS_29740 5204 6109 gene locus_tag LOCUS_29750 5204 6109 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314385.1 protein_id gnl|my_center|LOCUS_29750 6106 6954 gene locus_tag LOCUS_29760 6106 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 7161 7388 gene locus_tag LOCUS_29770 7161 7388 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018239649.1 protein_id gnl|my_center|LOCUS_29770 7458 7928 gene locus_tag LOCUS_29780 7458 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 7925 8749 gene locus_tag LOCUS_29790 gene tatC 7925 8749 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087517.1 protein_id gnl|my_center|LOCUS_29790 8889 10196 gene locus_tag LOCUS_29800 gene serS 8889 10196 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534571.1 protein_id gnl|my_center|LOCUS_29800 10189 11013 gene locus_tag LOCUS_29810 gene surE 10189 11013 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919864.1 protein_id gnl|my_center|LOCUS_29810 11025 11693 gene locus_tag LOCUS_29820 11025 11693 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389521.1 protein_id gnl|my_center|LOCUS_29820 11751 12725 gene locus_tag LOCUS_29830 11751 12725 CDS product LysM peptidoglycan-binding domain-containing M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087511.1 protein_id gnl|my_center|LOCUS_29830 13582 12722 gene locus_tag LOCUS_29840 13582 12722 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531304.1 protein_id gnl|my_center|LOCUS_29840 13799 14116 gene locus_tag LOCUS_29850 gene yajC 13799 14116 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534584.1 protein_id gnl|my_center|LOCUS_29850 14155 15762 gene locus_tag LOCUS_29860 14155 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29860 >Feature sequence064 227 302 gene locus_tag LOCUS_t00380 227 302 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 412 612 gene locus_tag LOCUS_29870 gene secE 412 612 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003523719.1 protein_id gnl|my_center|LOCUS_29870 646 1176 gene locus_tag LOCUS_29880 gene nusG 646 1176 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088165.1 protein_id gnl|my_center|LOCUS_29880 1286 1714 gene locus_tag LOCUS_29890 gene rplK 1286 1714 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390509.1 protein_id gnl|my_center|LOCUS_29890 1720 2424 gene locus_tag LOCUS_29900 gene rplA 1720 2424 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088163.1 protein_id gnl|my_center|LOCUS_29900 2499 2849 gene locus_tag LOCUS_29910 2499 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 2819 3337 gene locus_tag LOCUS_29920 gene rplJ 2819 3337 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531412.1 protein_id gnl|my_center|LOCUS_29920 3389 3763 gene locus_tag LOCUS_29930 gene rplL 3389 3763 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088160.1 protein_id gnl|my_center|LOCUS_29930 3943 8031 gene locus_tag LOCUS_29940 gene rpoB 3943 8031 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088159.1 protein_id gnl|my_center|LOCUS_29940 8187 12389 gene locus_tag LOCUS_29950 gene rpoC 8187 12389 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531415.1 protein_id gnl|my_center|LOCUS_29950 12861 12460 gene locus_tag LOCUS_29960 12861 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 13295 13666 gene locus_tag LOCUS_29970 gene rpsL 13295 13666 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390503.1 protein_id gnl|my_center|LOCUS_29970 13678 14148 gene locus_tag LOCUS_29980 gene rpsG 13678 14148 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536198.1 protein_id gnl|my_center|LOCUS_29980 14179 16254 gene locus_tag LOCUS_29990 gene fusA 14179 16254 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390501.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence065 169 576 gene locus_tag LOCUS_30000 169 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 705 1409 gene locus_tag LOCUS_30010 gene queC 705 1409 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_30010 1413 2045 gene locus_tag LOCUS_30020 gene queE 1413 2045 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920995.1 protein_id gnl|my_center|LOCUS_30020 2045 2413 gene locus_tag LOCUS_30030 gene queD 2045 2413 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268282.1 protein_id gnl|my_center|LOCUS_30030 2427 2903 gene locus_tag LOCUS_30040 gene queF 2427 2903 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122403094.1 protein_id gnl|my_center|LOCUS_30040 4298 2949 gene locus_tag LOCUS_30050 4298 2949 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640087.1 protein_id gnl|my_center|LOCUS_30050 4359 4997 gene locus_tag LOCUS_30060 4359 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 6190 5018 gene locus_tag LOCUS_30070 6190 5018 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083642.1 protein_id gnl|my_center|LOCUS_30070 7204 6371 gene locus_tag LOCUS_30080 7204 6371 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459931.1 protein_id gnl|my_center|LOCUS_30080 8149 7244 gene locus_tag LOCUS_30090 8149 7244 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088038.1 protein_id gnl|my_center|LOCUS_30090 9621 8161 gene locus_tag LOCUS_30100 9621 8161 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_30100 11096 9621 gene locus_tag LOCUS_30110 gene hpaB 11096 9621 CDS product 4-hydroxyphenylacetate 3-monooxygenase, oxygenase component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228328.1 protein_id gnl|my_center|LOCUS_30110 11302 12009 gene locus_tag LOCUS_30120 11302 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 12102 12872 gene locus_tag LOCUS_30130 12102 12872 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027133324.1 protein_id gnl|my_center|LOCUS_30130 12874 13665 gene locus_tag LOCUS_30140 12874 13665 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230346.1 protein_id gnl|my_center|LOCUS_30140 13843 14655 gene locus_tag LOCUS_30150 13843 14655 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085734.1 protein_id gnl|my_center|LOCUS_30150 15542 14679 gene locus_tag LOCUS_30160 15542 14679 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391414.1 protein_id gnl|my_center|LOCUS_30160 16182 15577 gene locus_tag LOCUS_30170 16182 15577 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531545.1 protein_id gnl|my_center|LOCUS_30170 >Feature sequence066 875 138 gene locus_tag LOCUS_30180 875 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 2630 885 gene locus_tag LOCUS_30190 2630 885 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_30190 3198 2647 gene locus_tag LOCUS_30200 3198 2647 CDS product plastocyanin/azurin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895638.1 protein_id gnl|my_center|LOCUS_30200 3399 3740 gene locus_tag LOCUS_30210 3399 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 4018 4278 gene locus_tag LOCUS_30220 4018 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30220 4275 4406 gene locus_tag LOCUS_30230 4275 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 4417 4800 gene locus_tag LOCUS_30240 4417 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 5068 6414 gene locus_tag LOCUS_30250 5068 6414 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_30250 6439 6885 gene locus_tag LOCUS_30260 6439 6885 CDS product DUF411 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028000382.1 protein_id gnl|my_center|LOCUS_30260 6898 7053 gene locus_tag LOCUS_30270 6898 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 7053 7517 gene locus_tag LOCUS_30280 7053 7517 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339163.1 protein_id gnl|my_center|LOCUS_30280 7514 7996 gene locus_tag LOCUS_30290 7514 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 8121 8321 gene locus_tag LOCUS_30300 8121 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 8347 8634 gene locus_tag LOCUS_30310 8347 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 8684 9340 gene locus_tag LOCUS_30320 8684 9340 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384122.1 protein_id gnl|my_center|LOCUS_30320 9337 9780 gene locus_tag LOCUS_30330 9337 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 9777 10388 gene locus_tag LOCUS_30340 9777 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 10448 10876 gene locus_tag LOCUS_30350 10448 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 10873 11604 gene locus_tag LOCUS_30360 10873 11604 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 protein_id gnl|my_center|LOCUS_30360 11980 11633 gene locus_tag LOCUS_30370 11980 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 12028 12900 gene locus_tag LOCUS_30380 12028 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 12897 13373 gene locus_tag LOCUS_30390 gene lspA 12897 13373 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460289.1 protein_id gnl|my_center|LOCUS_30390 13498 14751 gene locus_tag LOCUS_30400 gene cypC 13498 14751 CDS product fatty-acid peroxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246284.1 protein_id gnl|my_center|LOCUS_30400 14748 15755 gene locus_tag LOCUS_30410 14748 15755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 >Feature sequence067 132 389 gene locus_tag LOCUS_30420 132 389 CDS product YjhX family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639915.1 protein_id gnl|my_center|LOCUS_30420 1445 429 gene locus_tag LOCUS_30430 1445 429 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_30430 2359 1451 gene locus_tag LOCUS_30440 gene folD 2359 1451 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640180.1 protein_id gnl|my_center|LOCUS_30440 2837 2526 gene locus_tag LOCUS_30450 2837 2526 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174939.1 protein_id gnl|my_center|LOCUS_30450 3145 2843 gene locus_tag LOCUS_30460 3145 2843 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391274.1 protein_id gnl|my_center|LOCUS_30460 3381 3456 gene locus_tag LOCUS_t00390 3381 3456 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3549 5291 gene locus_tag LOCUS_30470 3549 5291 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337430.1 protein_id gnl|my_center|LOCUS_30470 6655 5321 gene locus_tag LOCUS_30480 6655 5321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 7042 8490 gene locus_tag LOCUS_30490 7042 8490 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_30490 8487 9680 gene locus_tag LOCUS_30500 8487 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 9695 12010 gene locus_tag LOCUS_30510 9695 12010 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_30510 12226 13158 gene locus_tag LOCUS_30520 12226 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 13139 14146 gene locus_tag LOCUS_30530 13139 14146 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038093611.1 protein_id gnl|my_center|LOCUS_30530 14761 14156 gene locus_tag LOCUS_30540 14761 14156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 15248 15436 gene locus_tag LOCUS_30550 15248 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence068 651 139 gene locus_tag LOCUS_30560 651 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1576 842 gene locus_tag LOCUS_30570 1576 842 CDS product extensin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765937.1 protein_id gnl|my_center|LOCUS_30570 1832 1620 gene locus_tag LOCUS_30580 1832 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 1942 2811 gene locus_tag LOCUS_30590 gene htpX 1942 2811 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_30590 2935 4191 gene locus_tag LOCUS_30600 2935 4191 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083408.1 protein_id gnl|my_center|LOCUS_30600 4282 5043 gene locus_tag LOCUS_30610 4282 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 5166 5963 gene locus_tag LOCUS_30620 5166 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 6125 6976 gene locus_tag LOCUS_30630 6125 6976 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640348.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30630 7048 7770 gene locus_tag LOCUS_30640 gene rpe 7048 7770 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639879.1 protein_id gnl|my_center|LOCUS_30640 7824 9755 gene locus_tag LOCUS_30650 7824 9755 CDS product heparinase II/III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965110.1 protein_id gnl|my_center|LOCUS_30650 10163 9759 gene locus_tag LOCUS_30660 10163 9759 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966793.1 protein_id gnl|my_center|LOCUS_30660 10494 10279 gene locus_tag LOCUS_30670 10494 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 10384 11997 gene locus_tag LOCUS_30680 gene purH 10384 11997 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721490.1 protein_id gnl|my_center|LOCUS_30680 13458 12034 gene locus_tag LOCUS_30690 13458 12034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083411.1 protein_id gnl|my_center|LOCUS_30690 14927 13455 gene locus_tag LOCUS_30700 14927 13455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920791.1 protein_id gnl|my_center|LOCUS_30700 15514 15017 gene locus_tag LOCUS_30710 15514 15017 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941709.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence069 <1 613 gene locus_tag LOCUS_30720 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089808.1:energy transducer TonB 793 1812 gene locus_tag LOCUS_30730 793 1812 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766899.1 protein_id gnl|my_center|LOCUS_30730 1978 4650 gene locus_tag LOCUS_30740 gene malT 1978 4650 CDS product HTH-type transcriptional regulator MalT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208926.1 protein_id gnl|my_center|LOCUS_30740 4773 6656 gene locus_tag LOCUS_30750 4773 6656 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530170.1 protein_id gnl|my_center|LOCUS_30750 6676 7071 gene locus_tag LOCUS_30760 6676 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 7095 9230 gene locus_tag LOCUS_30770 7095 9230 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827278.1 protein_id gnl|my_center|LOCUS_30770 9493 11739 gene locus_tag LOCUS_30780 9493 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 11744 12502 gene locus_tag LOCUS_30790 11744 12502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 14808 12814 gene locus_tag LOCUS_30800 14808 12814 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259232.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence070 1320 508 gene locus_tag LOCUS_30810 1320 508 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088350.1 protein_id gnl|my_center|LOCUS_30810 1478 2266 gene locus_tag LOCUS_30820 1478 2266 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088716.1 protein_id gnl|my_center|LOCUS_30820 2683 2276 gene locus_tag LOCUS_30830 2683 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 3786 2680 gene locus_tag LOCUS_30840 3786 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 4794 3874 gene locus_tag LOCUS_30850 4794 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 5264 4884 gene locus_tag LOCUS_30860 5264 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 5476 5787 gene locus_tag LOCUS_30870 5476 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 7250 5892 gene locus_tag LOCUS_30880 7250 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 8269 7418 gene locus_tag LOCUS_30890 8269 7418 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967074.1 protein_id gnl|my_center|LOCUS_30890 8730 8392 gene locus_tag LOCUS_30900 8730 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 9221 8823 gene locus_tag LOCUS_30910 9221 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 9254 9457 gene locus_tag LOCUS_30920 9254 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 9942 9454 gene locus_tag LOCUS_30930 9942 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 10309 11529 gene locus_tag LOCUS_30940 10309 11529 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921291.1 protein_id gnl|my_center|LOCUS_30940 12487 13107 gene locus_tag LOCUS_30950 12487 13107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 >Feature sequence071 483 875 gene locus_tag LOCUS_30960 gene flbT 483 875 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088588.1 protein_id gnl|my_center|LOCUS_30960 859 1236 gene locus_tag LOCUS_30970 859 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 1300 2469 gene locus_tag LOCUS_30980 1300 2469 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338524.1 protein_id gnl|my_center|LOCUS_30980 3261 2470 gene locus_tag LOCUS_30990 3261 2470 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918013.1 protein_id gnl|my_center|LOCUS_30990 4946 3453 gene locus_tag LOCUS_31000 4946 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 6802 4952 gene locus_tag LOCUS_31010 gene flgK 6802 4952 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088594.1 protein_id gnl|my_center|LOCUS_31010 8236 6872 gene locus_tag LOCUS_31020 8236 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 8577 8341 gene locus_tag LOCUS_31030 8577 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 8730 9575 gene locus_tag LOCUS_31040 8730 9575 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919331.1 protein_id gnl|my_center|LOCUS_31040 9793 10308 gene locus_tag LOCUS_31050 9793 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 10621 10400 gene locus_tag LOCUS_31060 10621 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 10520 11131 gene locus_tag LOCUS_31070 10520 11131 CDS product DUF6134 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389069.1 protein_id gnl|my_center|LOCUS_31070 11198 11794 gene locus_tag LOCUS_31080 11198 11794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 11787 13277 gene locus_tag LOCUS_31090 11787 13277 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_31090 13274 13960 gene locus_tag LOCUS_31100 13274 13960 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_31100 >Feature sequence072 797 1024 gene locus_tag LOCUS_31110 797 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 1118 1594 gene locus_tag LOCUS_31120 1118 1594 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087466.1 protein_id gnl|my_center|LOCUS_31120 1646 2515 gene locus_tag LOCUS_31130 1646 2515 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099950.1 protein_id gnl|my_center|LOCUS_31130 2764 2964 gene locus_tag LOCUS_31140 2764 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 2968 5619 gene locus_tag LOCUS_31150 gene gyrA 2968 5619 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087464.1 protein_id gnl|my_center|LOCUS_31150 5628 6152 gene locus_tag LOCUS_31160 gene coaD 5628 6152 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087462.1 protein_id gnl|my_center|LOCUS_31160 6165 6701 gene locus_tag LOCUS_31170 6165 6701 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919458.1 protein_id gnl|my_center|LOCUS_31170 6720 7193 gene locus_tag LOCUS_31180 6720 7193 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087459.1 protein_id gnl|my_center|LOCUS_31180 7323 8393 gene locus_tag LOCUS_31190 gene queA 7323 8393 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531823.1 protein_id gnl|my_center|LOCUS_31190 8390 9529 gene locus_tag LOCUS_31200 gene tgt 8390 9529 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531821.1 protein_id gnl|my_center|LOCUS_31200 9640 9714 gene locus_tag LOCUS_t00400 9640 9714 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10703 9756 gene locus_tag LOCUS_31210 10703 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 11666 10776 gene locus_tag LOCUS_31220 11666 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 11828 12349 gene locus_tag LOCUS_31230 11828 12349 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396102.1 protein_id gnl|my_center|LOCUS_31230 12368 12802 gene locus_tag LOCUS_31240 12368 12802 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086688.1 protein_id gnl|my_center|LOCUS_31240 13262 12843 gene locus_tag LOCUS_31250 gene rnk 13262 12843 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388697.1 protein_id gnl|my_center|LOCUS_31250 13759 13262 gene locus_tag LOCUS_31260 gene rnk 13759 13262 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836246.1 protein_id gnl|my_center|LOCUS_31260 >Feature sequence073 <1 2092 gene locus_tag LOCUS_31270 <1 2092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072544.1:MMPL family transporter 2133 3512 gene locus_tag LOCUS_31280 2133 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 3591 4511 gene locus_tag LOCUS_31290 3591 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 4574 6328 gene locus_tag LOCUS_31300 4574 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 6462 7844 gene locus_tag LOCUS_31310 6462 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 9019 7847 gene locus_tag LOCUS_31320 9019 7847 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_31320 9055 9483 gene locus_tag LOCUS_31330 9055 9483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 10138 9488 gene locus_tag LOCUS_31340 10138 9488 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390977.1 protein_id gnl|my_center|LOCUS_31340 10515 11027 gene locus_tag LOCUS_31350 10515 11027 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_31350 11024 12349 gene locus_tag LOCUS_31360 11024 12349 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_31360 >Feature sequence074 <1 607 gene locus_tag LOCUS_31370 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241884.1:peptidoglycan-binding protein 723 1643 gene locus_tag LOCUS_31380 723 1643 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530135.1 protein_id gnl|my_center|LOCUS_31380 1640 2428 gene locus_tag LOCUS_31390 1640 2428 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_31390 2440 3210 gene locus_tag LOCUS_31400 2440 3210 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401893.1 protein_id gnl|my_center|LOCUS_31400 4270 3476 gene locus_tag LOCUS_31410 gene pdeM 4270 3476 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533672.1 protein_id gnl|my_center|LOCUS_31410 6882 4267 gene locus_tag LOCUS_31420 6882 4267 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530127.1 protein_id gnl|my_center|LOCUS_31420 7255 8091 gene locus_tag LOCUS_31430 gene mscS 7255 8091 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_31430 8349 8618 gene locus_tag LOCUS_31440 8349 8618 CDS product DUF6460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172810.1 protein_id gnl|my_center|LOCUS_31440 8925 9815 gene locus_tag LOCUS_31450 8925 9815 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085733.1 protein_id gnl|my_center|LOCUS_31450 10811 9837 gene locus_tag LOCUS_31460 10811 9837 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640058.1 protein_id gnl|my_center|LOCUS_31460 11034 11915 gene locus_tag LOCUS_31470 gene ephM 11034 11915 CDS product epoxide hydrolase EphM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243419.1 protein_id gnl|my_center|LOCUS_31470 >Feature sequence075 2464 125 gene locus_tag LOCUS_31480 2464 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2891 4378 gene locus_tag LOCUS_31490 2891 4378 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_31490 4378 5130 gene locus_tag LOCUS_31500 4378 5130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971721.1 protein_id gnl|my_center|LOCUS_31500 5186 6556 gene locus_tag LOCUS_31510 5186 6556 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_31510 6781 6560 gene locus_tag LOCUS_31520 6781 6560 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002831611.1 protein_id gnl|my_center|LOCUS_31520 8177 6918 gene locus_tag LOCUS_31530 8177 6918 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228841.1 protein_id gnl|my_center|LOCUS_31530 8335 9093 gene locus_tag LOCUS_31540 8335 9093 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328180.1 protein_id gnl|my_center|LOCUS_31540 10035 9244 gene locus_tag LOCUS_31550 10035 9244 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_31550 10288 10127 gene locus_tag LOCUS_31560 10288 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 10235 10495 gene locus_tag LOCUS_31570 10235 10495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 10608 11000 gene locus_tag LOCUS_31580 10608 11000 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088462.1 protein_id gnl|my_center|LOCUS_31580 <11663 11052 gene locus_tag LOCUS_31590 <11663 11052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010917983.1:glucose 1-dehydrogenase >Feature sequence076 1351 224 gene locus_tag LOCUS_31600 1351 224 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_31600 2502 1348 gene locus_tag LOCUS_31610 2502 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 3629 2502 gene locus_tag LOCUS_31620 3629 2502 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411849.1 protein_id gnl|my_center|LOCUS_31620 4089 3643 gene locus_tag LOCUS_31630 4089 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 4349 4089 gene locus_tag LOCUS_31640 4349 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 5435 4413 gene locus_tag LOCUS_31650 5435 4413 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_31650 5621 7372 gene locus_tag LOCUS_31660 gene atsA 5621 7372 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_31660 7571 7323 gene locus_tag LOCUS_31670 7571 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31670 8241 9602 gene locus_tag LOCUS_31680 8241 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 9788 11440 gene locus_tag LOCUS_31690 9788 11440 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence077 3 713 gene locus_tag LOCUS_31700 3 713 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919057.1 protein_id gnl|my_center|LOCUS_31700 810 2624 gene locus_tag LOCUS_31710 810 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2720 4891 gene locus_tag LOCUS_31720 2720 4891 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556205.1 protein_id gnl|my_center|LOCUS_31720 4909 5577 gene locus_tag LOCUS_31730 4909 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 6437 5574 gene locus_tag LOCUS_31740 gene aguB 6437 5574 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111119.1 protein_id gnl|my_center|LOCUS_31740 6604 7605 gene locus_tag LOCUS_31750 gene ptcA 6604 7605 CDS product putrescine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166873.1 protein_id gnl|my_center|LOCUS_31750 7641 9032 gene locus_tag LOCUS_31760 7641 9032 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102289.1 protein_id gnl|my_center|LOCUS_31760 9100 10206 gene locus_tag LOCUS_31770 gene aguA 9100 10206 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989327.1 protein_id gnl|my_center|LOCUS_31770 10210 11112 gene locus_tag LOCUS_31780 gene arcC 10210 11112 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100033.1 protein_id gnl|my_center|LOCUS_31780 >Feature sequence078 1032 88 gene locus_tag LOCUS_31790 gene sppA 1032 88 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968542.1 protein_id gnl|my_center|LOCUS_31790 2890 1178 gene locus_tag LOCUS_31800 gene rpsA 2890 1178 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027546860.1 protein_id gnl|my_center|LOCUS_31800 3733 3086 gene locus_tag LOCUS_31810 gene cmk 3733 3086 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388047.1 protein_id gnl|my_center|LOCUS_31810 4904 3741 gene locus_tag LOCUS_31820 gene aroA 4904 3741 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339439.1 protein_id gnl|my_center|LOCUS_31820 4872 5078 gene locus_tag LOCUS_31830 4872 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 5303 5698 gene locus_tag LOCUS_31840 5303 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 5840 5915 gene locus_tag LOCUS_t00410 5840 5915 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7860 6211 gene locus_tag LOCUS_31850 7860 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 8297 7860 gene locus_tag LOCUS_31860 8297 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 8560 8294 gene locus_tag LOCUS_31870 8560 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 11301 8830 gene locus_tag LOCUS_31880 11301 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence079 <1 1571 gene locus_tag LOCUS_31890 <1 1571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085899.1:MBL fold metallo-hydrolase 1604 2263 gene locus_tag LOCUS_31900 1604 2263 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919061.1 protein_id gnl|my_center|LOCUS_31900 3310 2279 gene locus_tag LOCUS_31910 3310 2279 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_31910 4418 3345 gene locus_tag LOCUS_31920 4418 3345 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_31920 4624 5040 gene locus_tag LOCUS_31930 4624 5040 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640167.1 protein_id gnl|my_center|LOCUS_31930 5594 5037 gene locus_tag LOCUS_31940 5594 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 6288 7982 gene locus_tag LOCUS_31950 gene phaC 6288 7982 CDS product class II poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095864.1 protein_id gnl|my_center|LOCUS_31950 8023 8904 gene locus_tag LOCUS_31960 gene phaZ 8023 8904 CDS product poly(3-hydroxyalkanoate) depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739559.1 protein_id gnl|my_center|LOCUS_31960 9017 10672 gene locus_tag LOCUS_31970 9017 10672 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640166.1 protein_id gnl|my_center|LOCUS_31970 >Feature sequence080 801 427 gene locus_tag LOCUS_31980 801 427 CDS product DUF6285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085729.1 protein_id gnl|my_center|LOCUS_31980 1816 815 gene locus_tag LOCUS_31990 1816 815 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085728.1 protein_id gnl|my_center|LOCUS_31990 2852 1818 gene locus_tag LOCUS_32000 2852 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 2793 3047 gene locus_tag LOCUS_32010 2793 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3048 3782 gene locus_tag LOCUS_32020 3048 3782 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531909.1 protein_id gnl|my_center|LOCUS_32020 5858 3774 gene locus_tag LOCUS_32030 gene recG 5858 3774 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389481.1 protein_id gnl|my_center|LOCUS_32030 5953 6258 gene locus_tag LOCUS_32040 5953 6258 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640346.1 protein_id gnl|my_center|LOCUS_32040 6275 9784 gene locus_tag LOCUS_32050 gene mfd 6275 9784 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087372.1 protein_id gnl|my_center|LOCUS_32050 9878 10288 gene locus_tag LOCUS_32060 9878 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 10669 10367 gene locus_tag LOCUS_32070 10669 10367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence081 <1 664 gene locus_tag LOCUS_32080 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639871.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 688 972 gene locus_tag LOCUS_32090 688 972 CDS product YciI-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330126.1 protein_id gnl|my_center|LOCUS_32090 979 1404 gene locus_tag LOCUS_32100 979 1404 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174950.1 protein_id gnl|my_center|LOCUS_32100 1401 1757 gene locus_tag LOCUS_32110 1401 1757 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917957.1 protein_id gnl|my_center|LOCUS_32110 2758 2012 gene locus_tag LOCUS_32120 2758 2012 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921407.1 protein_id gnl|my_center|LOCUS_32120 3062 3352 gene locus_tag LOCUS_32130 3062 3352 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965080.1 protein_id gnl|my_center|LOCUS_32130 3721 4989 gene locus_tag LOCUS_32140 3721 4989 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_32140 5026 5439 gene locus_tag LOCUS_32150 5026 5439 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390780.1 protein_id gnl|my_center|LOCUS_32150 6339 5446 gene locus_tag LOCUS_32160 6339 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 6254 6436 gene locus_tag LOCUS_32170 6254 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 6501 8444 gene locus_tag LOCUS_32180 gene acs 6501 8444 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174953.1 protein_id gnl|my_center|LOCUS_32180 8563 9420 gene locus_tag LOCUS_32190 8563 9420 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966131.1 protein_id gnl|my_center|LOCUS_32190 10015 9581 gene locus_tag LOCUS_32200 10015 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 >Feature sequence082 648 1451 gene locus_tag LOCUS_32210 648 1451 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388487.1 protein_id gnl|my_center|LOCUS_32210 2682 1438 gene locus_tag LOCUS_32220 2682 1438 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971478.1 protein_id gnl|my_center|LOCUS_32220 3673 2921 gene locus_tag LOCUS_32230 3673 2921 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031711.1 protein_id gnl|my_center|LOCUS_32230 3787 4671 gene locus_tag LOCUS_32240 3787 4671 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205322.1 protein_id gnl|my_center|LOCUS_32240 5988 4672 gene locus_tag LOCUS_32250 5988 4672 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242252.1 protein_id gnl|my_center|LOCUS_32250 6830 6063 gene locus_tag LOCUS_32260 6830 6063 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388250.1 protein_id gnl|my_center|LOCUS_32260 7834 6830 gene locus_tag LOCUS_32270 7834 6830 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_32270 8475 7831 gene locus_tag LOCUS_32280 8475 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 8410 8673 gene locus_tag LOCUS_32290 8410 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 9075 9710 gene locus_tag LOCUS_32300 9075 9710 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083803.1 protein_id gnl|my_center|LOCUS_32300 <10506 9718 gene locus_tag LOCUS_32310 <10506 9718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103586.1:glycosyltransferase >Feature sequence083 861 91 gene locus_tag LOCUS_32320 861 91 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965747.1 protein_id gnl|my_center|LOCUS_32320 2779 950 gene locus_tag LOCUS_32330 2779 950 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090889.1 protein_id gnl|my_center|LOCUS_32330 3249 2935 gene locus_tag LOCUS_32340 3249 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028154436.1 protein_id gnl|my_center|LOCUS_32340 3453 4664 gene locus_tag LOCUS_32350 3453 4664 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_32350 4796 4873 gene locus_tag LOCUS_t00420 4796 4873 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5681 5142 gene locus_tag LOCUS_32360 5681 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 5952 6809 gene locus_tag LOCUS_32370 5952 6809 CDS product oxygenase MpaB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920426.1 protein_id gnl|my_center|LOCUS_32370 6839 8041 gene locus_tag LOCUS_32380 6839 8041 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090005.1 protein_id gnl|my_center|LOCUS_32380 8485 8045 gene locus_tag LOCUS_32390 8485 8045 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526466.1 protein_id gnl|my_center|LOCUS_32390 8604 9374 gene locus_tag LOCUS_32400 8604 9374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 >Feature sequence084 1797 772 gene locus_tag LOCUS_32410 1797 772 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918656.1 protein_id gnl|my_center|LOCUS_32410 2574 1924 gene locus_tag LOCUS_32420 2574 1924 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265622.1 protein_id gnl|my_center|LOCUS_32420 4199 2772 gene locus_tag LOCUS_32430 4199 2772 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918659.1 protein_id gnl|my_center|LOCUS_32430 4456 4977 gene locus_tag LOCUS_32440 4456 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32440 4974 5420 gene locus_tag LOCUS_32450 4974 5420 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921473.1 protein_id gnl|my_center|LOCUS_32450 5428 6750 gene locus_tag LOCUS_32460 5428 6750 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_32460 7105 6755 gene locus_tag LOCUS_32470 gene arsC 7105 6755 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112580.1 protein_id gnl|my_center|LOCUS_32470 8177 7119 gene locus_tag LOCUS_32480 8177 7119 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388272.1 protein_id gnl|my_center|LOCUS_32480 8542 8177 gene locus_tag LOCUS_32490 8542 8177 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970930.1 protein_id gnl|my_center|LOCUS_32490 >Feature sequence085 3 1121 gene locus_tag LOCUS_32500 gene nuoN 3 1121 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975095.1 protein_id gnl|my_center|LOCUS_32500 1125 1877 gene locus_tag LOCUS_32510 1125 1877 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919802.1 protein_id gnl|my_center|LOCUS_32510 1887 3596 gene locus_tag LOCUS_32520 1887 3596 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919800.1 protein_id gnl|my_center|LOCUS_32520 3677 4081 gene locus_tag LOCUS_32530 gene mce 3677 4081 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_32530 4095 4370 gene locus_tag LOCUS_32540 4095 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 6122 4812 gene locus_tag LOCUS_32550 6122 4812 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095114.1 protein_id gnl|my_center|LOCUS_32550 6337 6774 gene locus_tag LOCUS_32560 6337 6774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 6864 8552 gene locus_tag LOCUS_32570 6864 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence086 902 135 gene locus_tag LOCUS_32580 902 135 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529912.1 protein_id gnl|my_center|LOCUS_32580 972 1667 gene locus_tag LOCUS_32590 972 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 1679 2818 gene locus_tag LOCUS_32600 1679 2818 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120625.1 protein_id gnl|my_center|LOCUS_32600 3364 2879 gene locus_tag LOCUS_32610 3364 2879 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976090.1 protein_id gnl|my_center|LOCUS_32610 3733 3434 gene locus_tag LOCUS_32620 3733 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 4090 3806 gene locus_tag LOCUS_32630 4090 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 4592 4518 gene locus_tag LOCUS_t00430 4592 4518 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4833 5009 gene locus_tag LOCUS_32640 4833 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 5175 6452 gene locus_tag LOCUS_32650 gene murA 5175 6452 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920208.1 protein_id gnl|my_center|LOCUS_32650 6532 6981 gene locus_tag LOCUS_32660 6532 6981 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265795.1 protein_id gnl|my_center|LOCUS_32660 7196 8491 gene locus_tag LOCUS_32670 gene hisD 7196 8491 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530199.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence087 364 1419 gene locus_tag LOCUS_32680 364 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 1738 1427 gene locus_tag LOCUS_32690 1738 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2181 1756 gene locus_tag LOCUS_32700 2181 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 2372 3136 gene locus_tag LOCUS_32710 2372 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 3358 3149 gene locus_tag LOCUS_32720 3358 3149 CDS product DUF3126 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531334.1 protein_id gnl|my_center|LOCUS_32720 3496 3741 gene locus_tag LOCUS_32730 3496 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 4552 3746 gene locus_tag LOCUS_32740 4552 3746 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967134.1 protein_id gnl|my_center|LOCUS_32740 4746 5021 gene locus_tag LOCUS_32750 4746 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 5027 6298 gene locus_tag LOCUS_32760 5027 6298 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_32760 7144 6308 gene locus_tag LOCUS_32770 gene cysE 7144 6308 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920503.1 protein_id gnl|my_center|LOCUS_32770 7359 8159 gene locus_tag LOCUS_32780 7359 8159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence088 1821 106 gene locus_tag LOCUS_32790 1821 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2124 3632 gene locus_tag LOCUS_32800 2124 3632 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_32800 3645 4847 gene locus_tag LOCUS_32810 3645 4847 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_32810 4994 6502 gene locus_tag LOCUS_32820 4994 6502 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_32820 6506 7528 gene locus_tag LOCUS_32830 6506 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence089 528 313 gene locus_tag LOCUS_32840 528 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 649 1596 gene locus_tag LOCUS_32850 649 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 2537 3223 gene locus_tag LOCUS_32860 2537 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 3865 3374 gene locus_tag LOCUS_32870 3865 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 4470 3997 gene locus_tag LOCUS_32880 4470 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 4700 5017 gene locus_tag LOCUS_32890 4700 5017 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383935.1 protein_id gnl|my_center|LOCUS_32890 6415 5366 gene locus_tag LOCUS_32900 gene hfaB 6415 5366 CDS product holdfast anchoring protein HfaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920482.1 protein_id gnl|my_center|LOCUS_32900 6778 7380 gene locus_tag LOCUS_32910 6778 7380 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence090 568 419 gene locus_tag LOCUS_32920 568 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 1614 877 gene locus_tag LOCUS_32930 1614 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2571 1627 gene locus_tag LOCUS_32940 2571 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 3086 2568 gene locus_tag LOCUS_32950 3086 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 4059 3094 gene locus_tag LOCUS_32960 4059 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 4188 5111 gene locus_tag LOCUS_32970 4188 5111 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_32970 6771 5308 gene locus_tag LOCUS_32980 6771 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence091 <1 605 gene locus_tag LOCUS_32990 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728131.1:alpha/beta fold hydrolase 602 1531 gene locus_tag LOCUS_33000 602 1531 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918244.1 protein_id gnl|my_center|LOCUS_33000 2178 1528 gene locus_tag LOCUS_33010 2178 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33010 2694 2311 gene locus_tag LOCUS_33020 2694 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 3622 2711 gene locus_tag LOCUS_33030 3622 2711 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_33030 4560 3667 gene locus_tag LOCUS_33040 4560 3667 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_33040 5502 4591 gene locus_tag LOCUS_33050 5502 4591 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918245.1 protein_id gnl|my_center|LOCUS_33050 6187 5561 gene locus_tag LOCUS_33060 6187 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 6317 6529 gene locus_tag LOCUS_33070 6317 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531185.1 protein_id gnl|my_center|LOCUS_33070 >Feature sequence092 522 91 gene locus_tag LOCUS_33080 522 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 642 1142 gene locus_tag LOCUS_33090 642 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 1927 5052 gene locus_tag LOCUS_33100 1927 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 5049 5948 gene locus_tag LOCUS_33110 gene cas1 5049 5948 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_33110 5954 6298 gene locus_tag LOCUS_33120 gene cas2 5954 6298 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence093 <1 1201 gene locus_tag LOCUS_33130 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112672.1:aldehyde dehydrogenase 3046 1676 gene locus_tag LOCUS_33140 3046 1676 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087882.1 protein_id gnl|my_center|LOCUS_33140 3550 3176 gene locus_tag LOCUS_33150 gene divK 3550 3176 CDS product cell-cycle response regulator DivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_33150 3804 4061 gene locus_tag LOCUS_33160 3804 4061 CDS product DUF3572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338213.1 protein_id gnl|my_center|LOCUS_33160 4052 4813 gene locus_tag LOCUS_33170 4052 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531934.1 protein_id gnl|my_center|LOCUS_33170 6111 4915 gene locus_tag LOCUS_33180 6111 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence094 105 1295 gene locus_tag LOCUS_33190 105 1295 CDS product TrbI/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533262.1 protein_id gnl|my_center|LOCUS_33190 1307 1630 gene locus_tag LOCUS_33200 1307 1630 CDS product DUF2274 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533261.1 protein_id gnl|my_center|LOCUS_33200 1634 1948 gene locus_tag LOCUS_33210 1634 1948 CDS product DUF736 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920532.1 protein_id gnl|my_center|LOCUS_33210 2058 2672 gene locus_tag LOCUS_33220 2058 2672 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026312796.1 protein_id gnl|my_center|LOCUS_33220 2669 3589 gene locus_tag LOCUS_33230 2669 3589 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_33230 3747 4874 gene locus_tag LOCUS_33240 3747 4874 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_33240 4987 5658 gene locus_tag LOCUS_33250 4987 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 >Feature sequence095 1105 344 gene locus_tag LOCUS_33260 1105 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33260 2430 1153 gene locus_tag LOCUS_33270 2430 1153 CDS product cytochrome b N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918361.1 protein_id gnl|my_center|LOCUS_33270 2984 2445 gene locus_tag LOCUS_33280 gene petA 2984 2445 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085272.1 protein_id gnl|my_center|LOCUS_33280 3289 3774 gene locus_tag LOCUS_33290 3289 3774 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969494.1 protein_id gnl|my_center|LOCUS_33290 3805 4689 gene locus_tag LOCUS_33300 gene hemF 3805 4689 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918394.1 protein_id gnl|my_center|LOCUS_33300 4691 5179 gene locus_tag LOCUS_33310 gene ybaK 4691 5179 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405434.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence096 664 314 gene locus_tag LOCUS_33320 664 314 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087690.1 protein_id gnl|my_center|LOCUS_33320 1775 816 gene locus_tag LOCUS_33330 1775 816 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599080.1 protein_id gnl|my_center|LOCUS_33330 3894 1864 gene locus_tag LOCUS_33340 3894 1864 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923295.1 protein_id gnl|my_center|LOCUS_33340 4179 5147 gene locus_tag LOCUS_33350 gene pip 4179 5147 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence097 469 1896 gene locus_tag LOCUS_33360 469 1896 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_33360 1924 3333 gene locus_tag LOCUS_33370 gene trmFO 1924 3333 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531313.1 protein_id gnl|my_center|LOCUS_33370 4191 3334 gene locus_tag LOCUS_33380 4191 3334 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971712.1 protein_id gnl|my_center|LOCUS_33380 4874 4260 gene locus_tag LOCUS_33390 4874 4260 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_33390 5418 5044 gene locus_tag LOCUS_33400 5418 5044 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389515.1 protein_id gnl|my_center|LOCUS_33400 >Feature sequence098 3144 1321 gene locus_tag LOCUS_33410 gene glmS 3144 1321 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087378.1 protein_id gnl|my_center|LOCUS_33410 4508 3147 gene locus_tag LOCUS_33420 gene glmU 4508 3147 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626497.1 protein_id gnl|my_center|LOCUS_33420 <5489 4635 gene locus_tag LOCUS_33430 <5489 4635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533607.1:UDP-glucose 4-epimerase GalE >Feature sequence099 263 1273 gene locus_tag LOCUS_33440 263 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 1451 1651 gene locus_tag LOCUS_33450 1451 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 1837 3375 gene locus_tag LOCUS_33460 1837 3375 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_33460 3576 4376 gene locus_tag LOCUS_33470 3576 4376 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085567.1 protein_id gnl|my_center|LOCUS_33470 >Feature sequence100 3267 1144 gene locus_tag LOCUS_33480 3267 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 <4856 3354 gene locus_tag LOCUS_33490 <4856 3354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529545.1:excinuclease ABC subunit UvrA >Feature sequence101 2156 1143 gene locus_tag LOCUS_33500 2156 1143 CDS product kelch repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_33500 3566 2181 gene locus_tag LOCUS_33510 gene mgtE 3566 2181 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531112.1 protein_id gnl|my_center|LOCUS_33510 >Feature sequence102 158 550 gene locus_tag LOCUS_33520 158 550 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206942.1 protein_id gnl|my_center|LOCUS_33520 1743 547 gene locus_tag LOCUS_33530 1743 547 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243454.1 protein_id gnl|my_center|LOCUS_33530 1849 2754 gene locus_tag LOCUS_33540 1849 2754 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618859.1 protein_id gnl|my_center|LOCUS_33540 3818 2739 gene locus_tag LOCUS_33550 3818 2739 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640427.1 protein_id gnl|my_center|LOCUS_33550 >Feature sequence103 945 1412 gene locus_tag LOCUS_33560 gene dpsA 945 1412 CDS product non-specific DNA-binding protein DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_33560 1486 2154 gene locus_tag LOCUS_33570 1486 2154 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528046.1 protein_id gnl|my_center|LOCUS_33570 3077 2151 gene locus_tag LOCUS_33580 3077 2151 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_33580 <3850 3251 gene locus_tag LOCUS_33590 <3850 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090115.1:thioredoxin-disulfide reductase >Feature sequence104 <1 1426 gene locus_tag LOCUS_33600 <1 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971530.1:ribonuclease R 1525 1941 gene locus_tag LOCUS_33610 1525 1941 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312672.1 protein_id gnl|my_center|LOCUS_33610 2054 2821 gene locus_tag LOCUS_33620 2054 2821 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265812.1 protein_id gnl|my_center|LOCUS_33620 2827 3501 gene locus_tag LOCUS_33630 2827 3501 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531919.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence105 219 560 gene locus_tag LOCUS_33640 219 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 729 1523 gene locus_tag LOCUS_33650 729 1523 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084292.1 protein_id gnl|my_center|LOCUS_33650 1536 3455 gene locus_tag LOCUS_33660 gene cysC 1536 3455 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084291.1 protein_id gnl|my_center|LOCUS_33660 >Feature sequence106 142 441 gene locus_tag LOCUS_33670 142 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 542 1891 gene locus_tag LOCUS_33680 gene gor 542 1891 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338175.1 protein_id gnl|my_center|LOCUS_33680 2090 2368 gene locus_tag LOCUS_33690 2090 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33690 >Feature sequence107 1347 520 gene locus_tag LOCUS_33700 1347 520 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707323.1 protein_id gnl|my_center|LOCUS_33700 1483 2325 gene locus_tag LOCUS_33710 1483 2325 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391324.1 protein_id gnl|my_center|LOCUS_33710 >Feature sequence108 124 1326 gene locus_tag LOCUS_33720 124 1326 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975119.1 protein_id gnl|my_center|LOCUS_33720 1494 1661 gene locus_tag LOCUS_33730 gene rpmG 1494 1661 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920317.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence109 58 702 gene locus_tag LOCUS_33740 58 702 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970569.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence110 1311 823 gene locus_tag LOCUS_33750 1311 823 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014903.1 protein_id gnl|my_center|LOCUS_33750